A method and kit for detecting staphylococcus aureus

Abstract

The application provides a method and a kit for detecting Staphylococcus aureus. The method embeds multivalent binding probes on microspheres through strain-promoted azide-alkyne cycloaddition reaction, thereby forming microspheres loaded with multivalent binding probes. The microspheres loaded with multivalent binding probes are aggregated in a large size through multivalent binding between the probes and the genome of Staphylococcus aureus, so as to qualitatively and quantitatively identify Staphylococcus aureus through fluorescence. The method not only shortens the detection period and reduces the cost, but also has the advantages of high sensitivity and high specificity.

Description

Technical Field

[0001] This invention relates to the field of microbial detection technology, and specifically to a method and kit for detecting Staphylococcus aureus. Background Technology

[0002] Bloodstream infection refers to infection caused by pathogenic microorganisms directly entering the human bloodstream. As a serious systemic infectious disease, bloodstream infection can easily induce sepsis, septic shock, and multiple organ dysfunction syndrome, manifesting as unexplained fever, body aches, rapid heartbeat, and intravascular infection. 1 According to statistics, between 2010 and 2019, approximately 6.5‰ of adult hospitalized patients in China suffered from bloodstream infections. 2 In various parts of the world, including Asia, Africa, Europe, the Americas, and the Middle East, bloodstream infections remain one of the leading causes of death in intensive care units. 3 Currently, bloodstream infections have become a serious public health problem worldwide due to their rapid onset, high mortality rate, and rising incidence. 4 .

[0003] Common pathogens causing bloodstream infections include Staphylococcus aureus, Escherichia coli, and Klebsiella pneumoniae. 5 Currently, the clinical detection process for bloodstream infection pathogens... 6 First, blood samples are collected from suspected patients and inoculated into blood culture bottles for culture. Then, Gram staining is performed on positive culture bottles to determine whether the bacteria are Gram-positive or Gram-negative, generating a preliminary report, which takes about 1 hour. The bacteria in the positive blood culture bottles are then inoculated onto solid culture media and placed in a bacterial incubator for isolation and culture, which takes about 18-24 hours. The pure colonies on the solid culture media are identified using matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS) to determine the infecting bacteria, which takes about 15 minutes. Finally, a final clinical report is generated based on the results of drug sensitivity testing.

[0004] Studies have found that the diagnostic window for sepsis caused by bloodstream infection, from symptom-based recognition to the initiation of antibiotic treatment, is only 1-3 hours. 7 For every hour of delayed treatment following septic shock, the mortality rate increases by 7.6%. 8 Delayed, inadequate, or inappropriate anti-infective treatment can directly lead to increased mortality rates from bloodstream infections. Staphylococcus aureus, a common pathogen causing bloodstream infections, is a bacterium that is both ubiquitous and dangerous. Its potent pathogenicity and significant drug resistance, especially methicillin-resistant Staphylococcus aureus (MRSA), make it a persistent focus and challenge in global public health.

[0005] While some rapid nucleic acid detection methods for blood culture samples have been developed to shorten testing time, they still have significant drawbacks:

[0006] 1. PCR techniques, such as droplet digital PCR or multiplex quantitative PCR, can detect bloodstream microorganisms within 1.5-4 hours, using small sample volumes and with high sample utilization, but their sensitivity is relatively low. 9 ;

[0007] 2. Metagenomics next-generation sequencing (mNGS) of pathogens can be directly used for bacterial detection by comparing and analyzing specific genomic information in a sample. It can also analyze antibiotic resistance and virulence information at the gene level. However, it is expensive, time-consuming, and cannot truly reflect the patient's infection status at the time of infection. 10 ;

[0008] 3. T2MR, developed by T2 Biosystems in the United States, utilizes a combination of PCR and nuclear magnetic resonance (NMR) technologies to directly detect pathogens in whole blood, providing results in 3-5 hours. The T2Dx® instrument, T2Bacteria®, and T2Candida® reagents have been approved and marketed by the FDA, demonstrating high clinical sensitivity (detecting up to 6 common bloodstream pathogens), but the equipment is also relatively expensive. 11 .

[0009] Therefore, there is still a need in this field to develop a method for identifying Staphylococcus aureus that is rapid, sensitive, specific, easy to operate, and low in cost. Summary of the Invention

[0010] Therefore, in order to solve the problems of long detection cycle, low sensitivity and high cost of Staphylococcus aureus in the prior art, the present invention provides a method for rapid detection of Staphylococcus aureus. This method not only shortens the detection cycle and reduces costs, but also has the advantages of high sensitivity and high specificity.

[0011] This invention first uses the nucleic acid sequence with the highest multiplicity score obtained through theoretical simulation based on an algorithm as a multivalent binding probe. Then, it is embedded onto microspheres via a strain-promoted azide-alkyne cycloaddition (SPAAC) reaction, thus forming microspheres loaded with multivalent binding probes. These microspheres aggregate in large size due to the multivalent binding between the probes and the Staphylococcus aureus genome, thereby enabling qualitative identification of Staphylococcus aureus. Furthermore, because the microspheres are fluorescently labeled, quantitative analysis of Staphylococcus aureus can also be achieved. This method can effectively detect Staphylococcus aureus in clinical samples, showing 100% consistency with clinical results, and can accurately quantify the Staphylococcus aureus content in blood culture bottles.

[0012] The term "multivalent binding probe" refers to a probe that has multiple binding sites with the target genome. Its advantage lies in the fact that even if a small number of complementary sequences exist in the non-target genome, the lack of sufficient binding sites prevents stable interactions, thus improving probe selectivity. In this invention, the multivalent binding probe can bind to multiple high-frequency repetitive complementary sequences in the Staphylococcus aureus genome (e.g., by comparing the probe with Staphylococcus aureus (taxid: 1280) in RefSeqReference genomes using BLAST, 1096 completely complementary (8-20 complementary base pairs) sites can be obtained).

[0013] The term "microspheres loaded with multivalent binding probes" refers to microspheres loaded with probes that can form multivalent binding interactions with the target bacterial genome. They can only form large aggregates through multivalent binding if there are enough high-frequency repetitive complementary sequences in the target genome. Therefore, non-target genomes, due to their few or scattered complementary sequences, can only form small aggregates, which can be used to identify the presence of target bacteria.

[0014] The above-mentioned objective of this invention is achieved through the following technical solution:

[0015] In a first aspect, the present invention provides a method for preparing microspheres loaded with multivalent binding probes for detecting Staphylococcus aureus, comprising the following steps:

[0016] (1) Azide-modified polyethylene oxide-polystyrene block copolymer (PS-b-PEO-N3) was embedded into fluorescently labeled polystyrene microspheres;

[0017] (2) React the polystyrene microspheres obtained in step (1) with the dibenzocyclooctylene-modified Staphylococcus aureus genome multivalent binding probe in a buffer solution to obtain microspheres loaded with multivalent binding probe.

[0018] According to some embodiments of the present invention, in step (1), the ratio of the azide-modified polyethylene oxide-polystyrene block copolymer to the fluorescently labeled polystyrene microspheres is 0.01~0.1 μmol:0.5 mg, preferably 0.05 μmol:0.5 mg.

[0019] According to some embodiments of the present invention, in step (1), the initial concentration of the azide-modified polyethylene oxide-polystyrene block copolymer is 0.01~1 mM, preferably 500 μM.

[0020] According to some embodiments of the present invention, in step (1), the diameter of the fluorescently labeled polystyrene microspheres is 500 nm to 1000 nm, preferably 500 nm.

[0021] According to some embodiments of the present invention, in step (1), the embedding includes first swelling the azide-modified polyethylene oxide-polystyrene block copolymer and the fluorescently labeled polystyrene microspheres in water containing tetrahydrofuran, and then adding water to swell them further.

[0022] According to some embodiments of the present invention, in step (2), the nucleotide sequence of the multivalent binding probe is as shown in SEQ ID NO. 1.

[0023] According to some embodiments of the present invention, in step (2), the initial concentration of the dibenzocyclooctyne-modified Staphylococcus aureus genome multivalent binding probe is 0.05~500 μM, preferably 50 μM.

[0024] According to some embodiments of the present invention, in step (2), the buffer solution is an aqueous solution of tris(hydroxymethyl)aminomethane-ethylenediaminetetraacetic acid containing sodium chloride, wherein the concentration of sodium chloride is 0.02~200 mM, preferably 50 mM.

[0025] In a second aspect, the present invention provides microspheres loaded with multivalent binding probes for detecting Staphylococcus aureus, which are prepared by the preparation method described in the first aspect of the present invention.

[0026] Thirdly, the present invention provides a kit for detecting Staphylococcus aureus, comprising microspheres loaded with multivalent binding probes prepared by the preparation method according to the first aspect of the present invention or microspheres loaded with multivalent binding probes according to the second aspect of the present invention.

[0027] Fourthly, the present invention provides an in vitro detection method for Staphylococcus aureus, comprising placing microspheres loaded with multivalent binding probes obtained by the preparation method of the first aspect of the present invention or microspheres loaded with multivalent binding probes according to the second aspect of the present invention in a buffer containing DNA extracted from a sample, adding DNA intercalation dye, and measuring the formation of fluorescent aggregates.

[0028] According to some embodiments of the present invention, the DNA intercalation dye is 4',6-diamidinyl-2-phenylindole (DAPI). In this invention, DAPI can also be used as a signal amplification reagent, enabling microspheres loaded with multivalent binding probes bound to DNA to form large aggregates, making fluorescence easier to observe and measure.

[0029] According to some embodiments of the present invention, the buffer solution is an aqueous solution of tris(hydroxymethyl)aminomethane-ethylenediaminetetraacetic acid containing sodium chloride, wherein the concentration of sodium chloride is 0.05~50 mM, preferably 10 mM.

[0030] According to some embodiments of the present invention, the concentration of DNA extracted from the sample is 50 μg / mL.

[0031] According to some embodiments of the present invention, the sample is selected from one or more of clinical biological samples, hospital environmental samples, living environment samples, and food-related samples. The clinical biological samples are selected from blood culture fluid, blood, urine, bronchoalveolar lavage fluid, pus, pleural effusion, sputum, amniotic fluid, and / or ascites samples. The hospital environmental samples are selected from medical device surfaces, medical staff clothing, and / or hospital public facilities samples. The living environment samples are selected from soil, sewage, and / or beach samples. The food-related samples are selected from food and / or food processing tool surface samples.

[0032] According to some embodiments of the present invention, the presence of Staphylococcus aureus in the sample is determined by measuring under a microscope whether fluorescent aggregates are formed and the ratio of their area to the area of ​​the microscope field of view, using an area quantification method.

[0033] Preferably, the sample is used to determine whether it contains Staphylococcus aureus by selecting the largest two-dimensional cross-sectional area of ​​the fluorescent aggregate within the field of view of the confocal microscope and using the area quantification method.

[0034] More preferably, when fluorescent clusters can be observed within the microscope's field of view, and the total area of ​​the fluorescent clusters accounts for more than 2.3% of the microscope's field of view, and the area of ​​the largest single fluorescent cluster is greater than 0.23%, then the sample is determined to contain Staphylococcus aureus. For example, when the microscope's field of view is 465 × 465 μm, the area of ​​the fluorescent clusters is greater than 5000 μm. 2And the largest single cluster area is greater than 500 μm 2 If so, the sample is confirmed to contain Staphylococcus aureus.

[0035] According to some specific embodiments of the present invention, it includes the following steps:

[0036] 1-1. An azide-modified polyethylene oxide-polystyrene block copolymer with an initial concentration of 0.01~1 mM was mixed with fluorescently labeled polystyrene microspheres with a diameter of 500~1000 nm at a ratio of 0.01~0.1 μmol:0.5 mg. The mixture was first swollen in water containing tetrahydrofuran, and then water was added to deswell it.

[0037] 2-1. The polystyrene microspheres obtained in step 1-1 were reacted with a 0.05-500 μM dibenzocyclooctyne-modified Staphylococcus aureus genome multivalent binding probe in an aqueous solution containing 0.02-200 mM sodium chloride to obtain microspheres loaded with the multivalent binding probe, wherein the nucleotide sequence of the multivalent binding probe is shown in SEQ ID NO. 1;

[0038] 3-1. Place the microspheres loaded with multivalent binding probes obtained in step 2-1 in a buffer solution containing DNA extracted from the sample. Add the DNA intercalation dye 4',6-diamidinyl-2-phenylindole and measure the formation of fluorescent aggregates. The buffer solution is an aqueous solution of tris(hydroxymethyl)aminomethane-ethylenediaminetetraacetic acid containing 0.05–50 mM sodium chloride. Fluorescent aggregates are visible within the microscope field of view, and the proportion of the total area of ​​the fluorescent aggregates relative to the microscope field of view is greater than 2.3%, with the largest single aggregate area greater than 0.23%. For example, when the microscope field of view is 465 × 465 μm, the aggregate area is greater than 5000 μm. 2 Furthermore, the area of ​​a single agglomerate is greater than 500 μm. 2 If so, the sample is confirmed to contain Staphylococcus aureus.

[0039] Compared with the prior art, the present invention has at least the following beneficial effects:

[0040] 1. Ensuring stable binding of probes and genome: The method of synthesizing microspheres loaded with multivalent binding probes is simpler to operate, has milder reaction conditions, and can carry out click chemistry reactions without the need for metal catalysts - copper ions, thus avoiding damage to the bacterial genome caused by copper ion residues, thereby ensuring the stability of the genome for accurate identification of Staphylococcus aureus.

[0041] 2. Simple operation: The present invention is simple to operate; detection can be achieved by simply mixing the multivalent binding probe loaded with the target Staphylococcus aureus genome.

[0042] 3. Fast reaction speed: In this invention, obvious turbidity—i.e., microsphere aggregation—can be observed 10 minutes after the multivalent binding probe is mixed with the target Staphylococcus aureus genome, indicating a fast reaction time; in addition, sample pretreatment and experimental determination can be completed within 30 minutes.

[0043] 4. Sensitivity: The detection limit of this invention for Staphylococcus aureus is as low as 7 copies, and the detection range is wide, covering 7E0-7E7 copies;

[0044] 5. High specificity: When this invention is used to detect Staphylococcus aureus, other non-target bacteria do not significantly interfere with the experimental results;

[0045] 6. Low cost: This invention does not involve expensive instruments or equipment, nor does it require amplification steps; the determination can be completed at room temperature or 37°C.

[0046] 7. Easy to store: The multivalent binding probe used in this invention can be pre-synthesized and stored for a long time in a 4°C refrigerator, and can be used as needed when identifying Staphylococcus aureus;

[0047] 8. Portability: The experimental system of this invention is small, the experimental method is simple, and it is easy to integrate into a chip, thus possessing the potential for portable detection;

[0048] 9. Quantitative: This technology establishes a standard curve for the detection of Staphylococcus aureus, enabling the quantitative detection of results in the target sample.

[0049] 10. No restrictions on sample source: Since the reaction substrate is genomic DNA, there are no restrictions on the source of the sample; only the DNA needs to be extracted from the sample. Attached Figure Description

[0050] The embodiments of the present invention will now be described in detail with reference to the accompanying drawings, wherein:

[0051] Figure 1 shows a schematic diagram of the reaction between the microspheres loaded with multivalent binding probes provided by the present invention and the target genome in clinical samples; wherein, Figure 1A This is a schematic diagram illustrating the collection of bloodstream infection samples and blood culture samples in clinical practice. Figure 1B This demonstrates the process of using an algorithm to screen multivalent binding probes. Figure 1C This is a schematic diagram of the detection process of the present invention.

[0052] Figure 2 shows the experimental results of detecting Staphylococcus aureus using microspheres loaded with multivalent binding probes provided by the present invention; wherein, Figure 2A This shows the effect of different concentrations of PS-b-PEO-N3 on the area of ​​fluorescent aggregates in Example 2; Figure 2B This shows the effect of using different concentrations of DBCO-probe (DBCO-Sa in the figure) on the area of ​​fluorescent aggregates in Example 3; Figure 2C This shows the effect of different NaCl concentrations on the area of ​​fluorescent aggregates in the SPAAC reaction in Example 4. Figure 2D This demonstrates the effect of NaCl concentration in the solution on the area of ​​fluorescent aggregates during the reaction of microspheres loaded with multivalent binding probes with genomic DNA in Example 5.

[0053] Figure 3 The sensitivity test results and linear interval fitting results of the method for identifying Staphylococcus aureus provided by the present invention in Example 6 are shown; wherein, Figure 3 A shows fluorescence images of Staphylococcus aureus DNA standards at different concentrations; Figure 3 B shows the quantitative results of the clustered area; Figure 3 C shows the fitting results at concentrations of 7E0-7E7 copies / mL: log[aggregation area] = 3.74 + 0.15log[DNA content] (R 2 = 0.95);

[0054] Figure 4 shows the specificity test results of the detection method provided by the present invention in Example 7; wherein, Figure 4A Showing the fluorescence signals produced by different types of bacteria at the same genomic DNA concentration (50 μg / mL); Figure 4B The quantitative results show the area of ​​fluorescent aggregates; Figure 4C This table displays the area statistics of the largest single fluorescent cluster in the fluorescence data obtained from the detection of each type of bacteria.

[0055] Figure 5 shows the detection results of blood culture samples from 40 clinical bloodstream infections using the method for detecting Staphylococcus aureus provided by the present invention in Example 8; wherein, Figure 5A The results of 20 Staphylococcus aureus positive samples are shown; Figure 5B The results show the detection results of 10 positive blood culture samples with non-Staphylococcal infections; Figure 5C The results of 10 blood culture-negative samples without bacterial infection are shown. Figure 5D The results of quantitative analysis of the fluorescent aggregate area of ​​the above 40 samples (where P is the area of ​​the aggregates) are as follows: Figure 5A The result is that nP is Figure 5B The result is that N is Figure 5C (Results), the gray dashed line represents the threshold of 5000 μm 2 ; Figure 5EThe results are the quantitative analysis of the area of ​​the largest single fluorescent cluster in the fluorescence images of the above 40 samples (where P is the area of ​​the largest single fluorescent cluster). Figure 5A The result is that nP is Figure 5B The result is that N is Figure 5C (Results), the red dashed line represents the threshold of 500 μm 2 ; Figure 5F To Figure 5A Statistical analysis of the quantitative results of Staphylococcus aureus content in 20 Staphylococcus aureus-positive samples in China. Detailed Implementation

[0056] The present invention will be further described in detail below with reference to specific embodiments. The embodiments given are only for illustrating the present invention and are not intended to limit the scope of the present invention.

[0057] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the reagents, bacterial strains, plasmids, kits, etc., used in the following examples are commercially available products.

[0058] Example 1: Identification of Staphylococcus aureus

[0059] 1. Synthesis of DBCO-multivalent binding probes

[0060] The genome of *Staphylococcus aureus* ATCC25923 (ASM75620v1), a commonly used quality control strain in clinical practice as outlined in CNAS-GL41 "Guidelines for Validation of Clinical Microbiology Laboratory Procedures," was theoretically simulated using an algorithm published in *Proc. Natl. Acad. Sci.*, 2020, 117, 8719-8726. The number of bases in the nucleic acid sequence was set to 20. The corresponding code can be found in [link to code]. https: / / github.com / tc387 / Genome-targeting The reference genome data came from NCBI (https: / / www.ncbi.nlm.nih.gov), and the nucleic acid sequence with the highest multiplicity score (as shown in SEQ ID NO. 1) was selected as the multivalent binding probe.

[0061] SEQ ID NO. 1: ATCATTTCTGTCCCACTCCC

[0062] Then, Sangon Biotech (Shanghai) Co., Ltd. was commissioned to synthesize a multivalent binding probe with a 5' segment modified with dibenzocyclooctyne (DBCO), thus obtaining the DBCO-multivalent binding probe.

[0063] 2. Synthesis of microspheres loaded with multivalent binding probes

[0064] A. Mix 50 μL of an aqueous solution of polystyrene microspheres (FITC-PS, 500 nm in diameter) containing 10 mg / mL of green fluorescently labeled (fluorescein isothiocyanate) with 100 μL of an aqueous solution containing 500 μM of azide-modified polyethylene oxide-polystyrene block copolymer (PS-b-PEO-N3), add 150 μL of tetrahydrofuran (THF) to swell, and shake at room temperature for 2 h.

[0065] B. Deswelling: Add 1.3 mL of water to the above reaction system, mix well, and evaporate at room temperature in a fume hood for 2 hours to obtain PS-b-PEO-N3@PS microspheres (PS-b-PEO-N3@PS refers to PS-b-PEO-N3 embedded on polystyrene microspheres).

[0066] C. Wash the microspheres three times with sterile water: centrifuge at 16000 rpm for 5 min to remove excess solution from the upper layer, add 1 mL of aqueous solution, shake, and centrifuge again;

[0067] D. The clean PS-b-PEO-N3@PS microspheres obtained were mixed with 40 μL of 50 μM DBCO-multivalent binding probe solution synthesized in step 1. 1x Tris-EDTA (TE) buffer (pH 8.0, containing 50 mM NaCl) was added to 1 mL. The mixture was shaken at 200 rpm for 24 h at room temperature in the dark to obtain microspheres loaded with multivalent binding probe.

[0068] E. Wash the microspheres three times with sterile water: centrifuge at 16000 rpm for 5 min to remove excess solution from the upper layer, add 1 mL of aqueous solution, shake, and centrifuge again;

[0069] F. Add 50 μL of sterile water to the cleaned multivalent binding probe-loaded microspheres and resuspend the microspheres to obtain multivalent binding probe-loaded microspheres that can be used for the detection of Staphylococcus aureus.

[0070] 3. Microspheres loaded with multivalent binding probes react with the genome.

[0071] A control group was set up by taking 10 μL of Staphylococcus aureus genomic DNA (50 μg / mL) and sterile water for the control group. After the double-stranded DNA dissociated at 95℃ for 10 min, the mixture was immediately placed on ice. 10 μL of the multivalent binding probe loaded with microspheres for Staphylococcus aureus detection obtained in step 2 was added and mixed thoroughly. Then, 10 μL of TE buffer (the final reaction solution concentration was 1x TE buffer and 10 mM NaCl) was added and mixed thoroughly. Finally, 5 μL of 4',6-diamidinyl-2-phenylindole (DAPI) aqueous solution was added and the mixture was incubated at 37℃ with shaking for 10 min.

[0072] 4. Identify the target genomic DNA and whether it is Staphylococcus aureus DNA.

[0073] Take the reaction solution obtained in step 3 and observe the fluorescent aggregation phenomenon in the reaction solution using a confocal microscope. Specifically, qualitative and quantitative analysis is performed using the largest two-dimensional cross-section of the aggregates under the confocal microscope as the signal. The image size is 465×465 μm. Fluorescent aggregates with an area greater than 5000 μm are considered valid under the microscope. 2 (Detection limit value calculated based on sensitivity test experiments) and the area of ​​the largest single aggregate is greater than 500 μm. 2 When the threshold (calculated based on the specificity test experiment) is reached, it is determined that the sample contains Staphylococcus aureus.

[0074] Example 2: Optimization of PS-b-PEO-N3 concentration during the synthesis of microspheres loaded with multivalent binding probes.

[0075] Based on Example 1, during the synthesis of microspheres loaded with multivalent binding probes, the concentration of PS-b-PEO-N3 was set to 0, 10, 100, 500, and 1000 μM (the rest was the same as in Example 1). Then, microspheres loaded with multivalent binding probes that can be used for the detection of Staphylococcus aureus were prepared and reacted with pure water control group and Staphylococcus aureus genome. The aggregates were detected by laser confocal microscopy, and the percentage of fluorescent area in each group was analyzed.

[0076] Experimental results are as follows Figure 2A As shown, when the concentration of PS-b-PEO-N3 increases, the detected fluorescent aggregate area shows a trend of first increasing and then decreasing, reaching the maximum difference between the detection signal and the background signal at a concentration of 500 μM.

[0077] Example 3: Optimization of DBCO-multivalent binding probe concentration during the synthesis of microspheres loaded with multivalent binding probes

[0078] Based on Example 1, during the synthesis of microspheres loaded with multivalent binding probes, the concentration of DBCO-multivalent binding probes was set to 0, 10, 50, 100, and 500 μM (the rest was the same as in Example 1). Then, microspheres loaded with multivalent binding probes that can be used for the detection of Staphylococcus aureus were prepared and reacted with pure water control group and Staphylococcus aureus genome, respectively. The aggregates were detected by laser confocal microscopy, and the percentage of fluorescent region area in each group was analyzed.

[0079] Experimental results are as follows Figure 2BAs shown, when the concentration of the DBCO-multivalent binding probe increases, the detected fluorescent aggregate area shows a trend of first increasing and then decreasing, reaching the maximum difference between the detection signal and the background signal at a concentration of 50 μM.

[0080] Example 4: Optimization of NaCl concentration during the synthesis of microspheres loaded with multivalent binding probes

[0081] Based on Example 1, during the synthesis of microspheres loaded with multivalent binding probes, the concentration of NaCl was set to 0, 10, 50, 100, and 200 mM (the rest was the same as in Example 1). Then, microspheres loaded with multivalent binding probes that can be used for the detection of Staphylococcus aureus were prepared and reacted with pure water control group and Staphylococcus aureus genome, respectively. The aggregates were detected by laser confocal microscopy, and the percentage of fluorescent area in each group was analyzed.

[0082] Experimental results are as follows Figure 2C As shown, when the NaCl concentration increases, the detected fluorescent aggregate area first increases and then decreases, reaching the maximum difference between the detection signal and the background signal at a concentration of 50 mM.

[0083] Example 5: Optimization of NaCl concentration during the reaction of microspheres loaded with multivalent binding probes with the genome.

[0084] Based on Example 1, in the reaction of microspheres loaded with multivalent binding probes with the genome, the concentration of NaCl was set to 0, 1, 5, 10, and 50 mM respectively (the rest is the same as in Example 1). Laser confocal microscopy was used to detect the aggregates and analyze the percentage of fluorescent region area in each group.

[0085] Experimental results are as follows Figure 2D As shown, when the NaCl concentration increases, the detected fluorescent aggregate area first increases and then decreases, reaching the maximum difference between the detection signal and the background signal at a concentration of 10 mM.

[0086] Example 6 Sensitivity Test

[0087] Based on Example 1, Staphylococcus aureus genomic DNA of different copy numbers was reacted with microspheres loaded with multivalent binding probes for Staphylococcus aureus detection. The area of ​​the fluorescent aggregates was detected by laser confocal microscopy, and the total area of ​​the fluorescent region in each group was analyzed.

[0088] Experimental results are as follows Figure 3 As shown, the detection limit for Staphylococcus aureus in this invention is as low as 7 copies, and the detection range is broad, covering 7E0-7E7 copies / mL. Furthermore, the fitting results at concentrations of 7E0-7E7 copies / mL show that the fluorescent aggregates of Staphylococcus aureus have an area greater than 5000 μm.2 .

[0089] Example 7 Specificity Test

[0090] Based on Example 1, bacterial genomic DNA of Staphylococcus aureus and other non-target bacteria were reacted with microspheres loaded with multivalent binding probes for Staphylococcus aureus detection. The aggregates were detected by laser confocal microscopy, and the area of ​​the fluorescent region in each group was analyzed.

[0091] The experimental results are shown in Figure 4. The fluorescence of various other non-target bacteria was weak, and the area of ​​their fluorescent regions was significantly smaller than that of the target bacteria, with the aggregate area of ​​a single fluorescent cluster being less than 500 μm. 2 This indicates that other non-target bacteria do not significantly interfere with the detection of Staphylococcus aureus in this invention.

[0092] Example 8 Identification of Staphylococcus aureus in clinical samples

[0093] The samples included 20 Staphylococcus aureus positive samples, 10 positive blood culture samples from non-Staphylococcus aureus infections, and 10 negative blood culture samples from no bacterial infection (collected from the First Affiliated Hospital of Zhejiang University School of Medicine, ethics approval number: IIT20240738B).

[0094] Then, 500 μL of blood culture sample (blood culture bottle) was taken, and bacterial genomic DNA was extracted according to the experimental procedure of the TIANGEN Bacterial DNA Kit (DP302). Lysozyme (50 mg / mL) and ribonuclease A (RNase A) (100 mg / mL) were then added for pretreatment. The sample was then tested according to the method in Example 1.

[0095] The test results are shown in Figure 5. After testing the Staphylococcus aureus positive sample using the method of this invention, obvious fluorescent clusters can be seen. Figure 5A ), rather than positive samples of Staphylococcus aureus infection ( Figure 5B ) and blood culture negative samples ( Figure 5C This results in virtually no or very weak fluorescent agglomerates. The total area of ​​the fluorescent agglomerates ( Figure 5D ) and the area of ​​the single largest fluorescent cluster ( Figure 5E Quantitative analysis was performed, and the results showed that the total area of ​​fluorescent aggregates was greater than 5000 μm. 2 And the area of ​​a single largest cluster is greater than 500 μm. 2 Using "as the screening criterion" as the standard, the detection method of this invention obtained results that were 100% consistent with the clinical judgment of the samples, and the detection method of this invention can perform quantitative analysis of Staphylococcus aureus in blood culture-positive samples. Figure 5F ).

[0096] References

[0097] (1) Holmes, C. L.; Albin, O. R.; Mobley, H. L.; Bachman, M. A. Bloodstream infections: mechanisms of pathogenesis and opportunities for intervention. Nature Reviews Microbiology 2024, 1 - 15.

[0098] (2) Cui, J.; Li, M.; Cui, J.; Wang, J.; Qiang, X.; Liang, Z. The proportion, species distribution and dynamic trends of bloodstream infection cases in a tertiary hospital in China, 2010 - 2019. Infection 2022, 50 (1), 121 - 130.

[0099] (3) Rosenthal, V. D.; Yin, R.; Lu, Y.; Rodrigues, C.; Myatra, S. N.; Kharbanda, M.; Valderrama - Beltran, S. L.; Mehta, Y.; Daboor, M. A.; Todi, S. K. The impact of healthcare - associated infections on mortality in ICU: A prospective study in Asia, Africa, Eastern Europe, Latin America, and the Middle East. American journal of infection control 2023, 51 (6), 675 - 682.

[0100] (4) Ohnuma, T.; Chihara, S.; Costin, B.; Treggiari, M. M.; Bartz, R.R.; Raghunathan, K.; Krishnamoorthy, V. Association of appropriate empiricalantimicrobial therapy with in-hospital mortality in patients with bloodstreaminfections in the US. JAMA Network Open 2023, 6 (1), e2249353-e2249353.

[0101] (5) Tabah, A.; Buetti, N.; Staiquly, Q.; Ruckly, S.; Akova, M.;Aslan, A. T.; Leone, M.; Morris, A. C.; Bassetti, M.; Arvaniti, K.; et al.Epidemiology and outcomes of hospital-acquired bloodstream infections inintensive care unit patients: the EUROBACT-2 international cohort study.Intensive Care Medicine 2023. DOI: 10.1007 / s00134-022-06944-2. Laupland, K.B.; Church, D. L. Population-Based Epidemiology and Microbiology ofCommunity-Onset Bloodstream Infections. Clinical Microbiology Reviews 2014,27 (4), 647-664. DOI: 10.1128 / Cmr.00002-14.

[0102]

[0103] (7) Weiss, S. L.; Fitzgerald, J. C.; Balamuth, F.; Alpern, E. R.;Lavelle, J.; Chilutti, M.; Grundmeier, R.; Nadkarni, V. M.; Thomas, N. J.Delayed Antimicrobial Therapy Increases Mortality and Organ DysfunctionDuration in Pediatric Sepsis. Critical Care Medicine 2014, 42 (11), 2409-2417. DOI: 10.1097 / Ccm.0000000000000509.

[0104] (8) Ferrer, R.; Martin-Loeches, I.; Phillips, G.; Osborn, T. M.;Townsend, S.; Dellinger, R. P.; Artigas, A.; Schorr, C.; Levy, M. M. EmpiricAntibiotic Treatment Reduces Mortality in Severe Sepsis and Septic Shock Fromthe First Hour: Results From a Guideline-Based Performance ImprovementProgram. Critical Care Medicine 2014, 42 (8), 1749-1755. DOI: 10.1097 / Ccm.0000000000000330.

[0105] (9) Lin, K.; Zhao, Y.; Xu, B.; Yu, S.; Fu, Z.; Zhang, Y.; Wang, H.;Song, J.; Fan, M.; Zhou, Y.; Ai, J.; Qiu, C.; Zhang, H.; Zhang, W. ClinicalDiagnostic Performance of Droplet Digital PCR for Suspected BloodstreamInfections. Microbiol. Spectr. 2023, 11(1), e0137822(1-14).

[0106] (10) Qin, C.; Zhang, S.; Zhao, Y.; Ding, X.; Yang, F.; Zhao, Y.Diagnostic value of metagenomic next-generation sequencing in sepsis andbloodstream infection. Front. Cell. Infect. Microbiol. 2023, 13, 1117987(1–9).

[0107] (11) https: / / www.t2biosystems.com.

Claims

1. A method for preparing microspheres loaded with multivalent binding probes for detecting Staphylococcus aureus, comprising the following steps: (1) Azide-modified polyethylene oxide-polystyrene block copolymers were embedded into fluorescently labeled polystyrene microspheres; (2) React the polystyrene microspheres obtained in step (1) with the dibenzocyclooctylene-modified Staphylococcus aureus genome multivalent binding probe in a buffer solution to obtain microspheres loaded with multivalent binding probe.

2. According to the preparation method of claim 1, in step (1), the ratio of the azide-modified polyethylene oxide-polystyrene block copolymer to the fluorescently labeled polystyrene microspheres is 0.01~0.1 μmol:0.5 mg, preferably 0.05 μmol:0.5 mg; Preferably, the initial concentration of the azide-modified polyethylene oxide-polystyrene block copolymer is 0.01~1mM, more preferably 500 μM; Preferably, in step (1), the diameter of the fluorescently labeled polystyrene microspheres is 500 nm to 1000 nm, preferably 500 nm; Preferably, in step (1), the embedding includes first swelling the azide-modified polyethylene oxide-polystyrene block copolymer and the fluorescently labeled polystyrene microspheres in water containing tetrahydrofuran, and then adding water to swell them further.

3. The preparation method according to claim 1 or 2, in step (2), the nucleotide sequence of the multivalent binding probe is as shown in SEQ ID NO.

1.

4. The preparation method according to any one of claims 1-3, wherein in step (2), the initial concentration of the dibenzocyclooctyne-modified Staphylococcus aureus genome multivalent binding probe is 0.05~500 μM, preferably 50 μM; Preferably, in step (2), the buffer solution is an aqueous solution of tris(hydroxymethyl)aminomethane-ethylenediaminetetraacetic acid containing sodium chloride, wherein the concentration of sodium chloride is 0.02~200 mM, preferably 50 mM.

5. A microsphere loaded with a multivalent binding probe for detecting Staphylococcus aureus, prepared by the method according to any one of claims 1-4.

6. A kit for detecting Staphylococcus aureus, comprising microspheres loaded with multivalent binding probes prepared by any one of claims 1-4 or microspheres loaded with multivalent binding probes according to claim 5.

7. An in vitro detection method for Staphylococcus aureus, comprising placing microspheres loaded with multivalent binding probes prepared by any one of claims 1-4 or microspheres loaded with multivalent binding probes according to claim 5 in a buffer containing DNA extracted from a sample, adding a DNA intercalation dye, and then measuring the formation of fluorescent aggregates.

8. The detection method according to claim 7, wherein, The DNA intercalation dye is 4',6-diamidinyl-2-phenylindole; Preferably, the buffer solution is an aqueous solution of tris(hydroxymethyl)aminomethane-ethylenediaminetetraacetic acid containing sodium chloride, wherein the concentration of sodium chloride is 0.05~50 mM, preferably 10 mM; Preferably, the sample is selected from one or more of clinical biological samples, hospital environmental samples, living environment samples, and food-related samples. The clinical biological samples are selected from blood culture fluid, blood, urine, bronchoalveolar lavage fluid, pus, pleural effusion, sputum, amniotic fluid, and / or ascites samples. The hospital environmental samples are selected from medical device surfaces, medical staff clothing, and / or hospital public facilities samples. The living environment samples are selected from soil, sewage, and / or beach samples. The food-related samples are selected from food and / or food processing tool surface samples.

9. The detection method according to claim 7 or 8, wherein, The presence of Staphylococcus aureus in the sample was determined by measuring the formation of fluorescent aggregates under a microscope and the ratio of their area to the area of ​​the microscope's field of view using an area quantification method. Preferably, the largest two-dimensional cross-sectional area of ​​the fluorescent aggregate within the field of view of the confocal microscope is selected, and the presence of Staphylococcus aureus in the sample is determined by area quantification. Preferably, when fluorescent clusters can be observed within the field of view of the microscope, and the total area of ​​the fluorescent clusters is greater than 2.3% relative to the area of ​​the microscope's field of view, and the area of ​​the largest single fluorescent cluster is greater than 0.23%, then the sample is determined to contain Staphylococcus aureus.

10. Use of the microspheres loaded with multivalent binding probes prepared by the method according to any one of claims 1-4, or the microspheres loaded with multivalent binding probes according to claim 5, in the preparation of the kit according to claim 6.

Images