A kit for detecting common pathogenic bacteria of CNS infection based on MIRA-CRISPR-Cas12a technology, a method and application thereof
By combining multi-enzyme isothermal rapid amplification technology with CRISPR-Cas12a nucleic acid detection technology, rapid, sensitive and specific detection of central nervous system infections under isothermal conditions has been achieved. This solves the problems of long detection time, strong equipment dependence and difficulty in balancing sensitivity and specificity in existing technologies, and is suitable for rapid detection of cerebrospinal fluid samples.
Patent Information
- Application Number
- CN202610423729.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-01
- Publication Date
- 2026-06-23
AI Technical Summary
Existing technologies for detecting pathogens in infectious diseases of the central nervous system suffer from problems such as long detection time, strong equipment dependence, and difficulty in balancing sensitivity and specificity, making it difficult to meet the needs for rapid and accurate diagnosis.
By combining multi-enzyme isothermal rapid amplification (MIRA) technology with CRISPR-Cas12a nucleic acid detection technology, rapid, sensitive and specific detection of common pathogens infecting the central nervous system can be achieved under isothermal conditions. Specific primer pairs, crRNA and ssDNA probes are used for nucleic acid amplification and detection.
It enables nucleic acid amplification and detection under isothermal conditions, is suitable for rapid detection of clinical samples (cerebrospinal fluid), and reads results via fluorescence or colloidal gold. It is suitable for the specific identification of Acinetobacter baumannii, Staphylococcus epidermidis, and Streptococcus pneumoniae, with detection time controlled within 60 minutes and high sensitivity and specificity.
Smart Images

Figure CN122256540A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomolecular detection technology, specifically to a molecular diagnostic method that combines multi-enzyme isothermal rapid amplification (MIRA) technology with CRISPR-Cas12a nucleic acid detection technology, and particularly to its application in the rapid, sensitive, and specific detection of common pathogens in infectious diseases of the central nervous system (CNS). Background Technology
[0002] Central nervous system infectious diseases (such as meningitis and encephalitis) have a rapid onset and progression. If the pathogen cannot be identified and targeted treatment implemented early, serious consequences are highly likely. Therefore, establishing rapid and accurate pathogen detection technologies has always been an important research direction in clinical testing and molecular diagnostics. With the development of molecular biology techniques, nucleic acid detection methods have been increasingly applied to the detection of central nervous system pathogens. Among them, polymerase chain reaction (PCR) and real-time quantitative PCR technologies have certain advantages in terms of sensitivity and specificity and have been widely used in clinical testing. In recent years, the development of isothermal amplification technology and CRISPR nucleic acid detection technology has provided new technical means for rapid pathogen detection.
[0003] Currently, the main methods for detecting pathogens of the central nervous system include pathogen culture, immunological detection, and molecular detection methods based on nucleic acid amplification.
[0004] Pathogen culture, as a traditional detection method, can directly obtain pathogens, but the culture period is long, the positive rate is low, and it is easily affected by the patient's antibiotic use. Immunological detection methods are relatively simple to operate, but their sensitivity and specificity are limited, making it difficult to meet the needs of early diagnosis.
[0005] In molecular detection, PCR and real-time fluorescence PCR technologies can achieve specific detection of pathogenic nucleic acids, but they usually require sophisticated thermal cycling equipment, placing high demands on the experimental environment and operators. CRISPR-Cas nucleic acid detection technology, which has emerged in recent years, has received widespread attention in the field of molecular diagnostics by specifically recognizing target nucleic acids and generating signal output; however, this technology usually still needs to be used in conjunction with PCR or other amplification techniques.
[0006] Although the above technologies have made some progress in the detection of pathogens in the central nervous system, the following shortcomings still exist:
[0007] First, traditional culture methods have long detection cycles, making it difficult to guide clinical medication in a timely manner. Second, PCR and real-time fluorescence PCR technologies are highly dependent on instruments and equipment, which is not conducive to rapid on-site testing in primary healthcare institutions. Third, some CRISPR nucleic acid detection methods still rely on complex amplification processes, resulting in long overall detection times and cumbersome operation steps. In addition, existing detection methods struggle to balance sensitivity, specificity, detection speed, and ease of operation, and cannot fully meet the actual needs of rapid diagnosis of central nervous system infections.
[0008] The aforementioned shortcomings limit the further application of existing technologies in the rapid and accurate detection of pathogens in the central nervous system. Summary of the Invention
[0009] In view of the above-mentioned shortcomings of the existing technology, the present invention aims to provide a method for detecting common pathogens of central nervous system infection based on MIRA-CRISPR-Cas12a, so as to solve the problems of long detection time, strong equipment dependence, complex operation and difficulty in balancing sensitivity and specificity in the existing detection technology.
[0010] This invention combines multi-enzyme isothermal rapid amplification technology with the CRISPR-Cas12a nucleic acid detection system to achieve rapid, sensitive, and specific detection of nucleic acids of common pathogens causing central nervous system infections under isothermal conditions, thus providing a new technical means for the early diagnosis of infectious diseases of the central nervous system.
[0011] The purpose of this invention is to provide a rapid detection method for common pathogens causing central nervous system infections based on MIRA-CRISPR-Cas12a, in order to overcome the problems of long detection time, strong equipment dependence, and insufficient sensitivity and specificity in the existing technology.
[0012] A further objective of this invention is to achieve: nucleic acid amplification and detection under isothermal conditions; rapid identification of various common pathogens of the central nervous system; rapid detection of clinical samples (cerebrospinal fluid); and results that can be read via fluorescence or colloidal gold, facilitating widespread application.
[0013] This invention provides a detection kit for common pathogens of the central nervous system, comprising: a first primer pair and a first crRNA for detecting Acinetobacter baumannii, a second primer pair and a second crRNA for detecting Staphylococcus epidermidis, a third primer pair and a third crRNA for detecting Streptococcus hepatitis, and an ssDNA probe sequence;
[0014] in,
[0015] The first primer pair is selected from any one of the primer pairs whose nucleotide sequences are shown below:
[0016] SEQ ID NO: 1 and SEQ ID NO: 4, SEQ ID NO: 2 and SEQ ID NO: 5, SEQ ID NO: 3 and SEQ ID NO: 6;
[0017] The second primer pair is selected from any one of the primer pairs whose nucleotide sequences are shown below:
[0018] SEQ ID NO:8 and SEQ ID NO:11, SEQ ID NO:9 and SEQ ID NO:12, and SEQ ID NO:10 and SEQ ID NO:13;
[0019] The third primer pair is selected from any one of the primer pairs shown below, with nucleotide sequences as follows:
[0020] SEQ ID NO:15 and SEQ ID NO:18, SEQ ID NO:16 and SEQ ID NO:19, and SEQ ID NO:17 and SEQ ID NO:20;
[0021] The nucleotide sequence of the first crRNA is SEQ ID NO:7;
[0022] The nucleotide sequence of the second crRNA is SEQ ID NO:14;
[0023] The nucleotide sequence of the third crRNA is SEQ ID NO:21;
[0024] The nucleotide sequence of the ssDNA is SEQ ID NO:22.
[0025] In one embodiment of the invention, the ssDNA contains a fluorescently modified label selected from FAM-TTATT-BHQ1 and / or FAM-TTATT-Biotin.
[0026] In one embodiment of the present invention, the first primer pair is a primer pair with nucleotide sequences SEQ ID NO:2 and SEQ ID NO:5, respectively; and / or,
[0027] The second primer pair consists of primers with nucleotide sequences SEQ ID NO:8 and SEQ ID NO:11, respectively.
[0028] The third primer pair is a primer pair with nucleotide sequences SEQ ID NO:16 and SEQ ID NO:19.
[0029] In one embodiment of the invention, it further includes a dissolution buffer, lyophilized enzyme powder, and magnesium acetate solution for performing the multi-enzyme rapid amplification technology reaction;
[0030] Preferably, the dissolution buffer (A buffer) is mainly a buffer system of 25mM Tris-HCl (pH=8.0, 25℃), 150mM KCI, and 5v / v% PEG.
[0031] Preferably, the lyophilized enzyme powder contains reagents comprising a protein / enzyme system including recombinant enzyme, recombinant enzyme cofactor, single-stranded DNA binding protein, and ATP.
[0032] Preferably, the magnesium acetate solution has a concentration of 320 nM and a pH of 8.0-8.5.
[0033] In one embodiment of the invention, it also includes 50–200 nM of LbCas12a protein.
[0034] Another aspect of the present invention provides a method for detecting bacterial infection based on the above-described kit, comprising:
[0035] 1) Extract nucleic acid from the sample to be tested to obtain a nucleic acid template to be tested; preferably, the sample to be tested is a cerebrospinal fluid sample;
[0036] 2) Add appropriate amounts of the first primer pair, the second primer pair, and the third primer pair respectively, mix well, then add the corresponding nucleic acid template to be tested, and add the multi-enzyme isothermal rapid amplification reaction reagent;
[0037] 3) Nucleic acid amplification reaction was carried out at 37–42 ℃. The optimal reaction primer pair was screened by gel electrophoresis. After the reaction, the amplification product of the target nucleic acid was obtained.
[0038] 4) Add the CRISPR-Cas12a reaction reagent containing the first crRNA, the second crRNA, or the third crRNA and ssDNA to the amplification product obtained in step 3), and react at 39 °C for 20 minutes to obtain the detection product;
[0039] 5) The detection product is detected using a fluorescence method or a colloidal gold method;
[0040] In one embodiment of the present invention, when using fluorescence detection, the ssDNA probe is: FAM-TTATT-BHQ1; when using colloidal gold detection, the ssDNA probe is: FAM-TTATT-Biotin.
[0041] In one embodiment of the present invention, in step 2), the first primer pair, the second primer pair, the third primer pair, the nucleic acid template to be tested, and the multi-enzyme isothermal rapid amplification reaction reagent are added to the bottom of the reaction tube; CRISPR-Cas12a reaction reagent containing the first crRNA, the second crRNA, or the third crRNA and ssDNA are added to the cap of the reaction tube; after the nucleic acid amplification reaction is completed in step 3), the reaction is briefly detached for 10 seconds and then continued at 39 °C for 20 minutes.
[0042] In one embodiment of the present invention, step 2) further includes:
[0043] Add 29.4 μL of dissolution buffer to the lyophilized enzyme powder, then add 2 μL each of the upstream and downstream primers of the first, second, and third primer pairs, mix well, and pipette 6.7 μL into another eight-tube bundle. Divide the mixed reaction solution into 5 equal portions, then add 3.3 μL of the corresponding nucleic acid template to be tested, and finally add 0.5 μL of magnesium acetate solution.
[0044] Another aspect of the present invention provides the application of the above-mentioned detection kit or method in detecting bacterial infections, wherein the pathogens are selected from one or more of Acinetobacter baumannii (Ab), Staphylococcus epidermidis (Sep), and / or Streptococcus pneumoniae (Spn); preferably, the samples of the pathogen infection are obtained from a clinical laboratory.
[0045] The beneficial effects of the above-described technical solution of the present invention are as follows:
[0046] This invention enables nucleic acid amplification and detection under isothermal conditions, and achieves rapid identification of various common pathogens causing central nervous system infections. This invention is applicable to the rapid detection of clinical samples (cerebrospinal fluid); the results can be read using fluorescence or colloidal gold methods, facilitating widespread application. Attached Figure Description
[0047] Figure 1 The optimal primer pairs, reaction time, and reaction temperature were screened for the MIRA reaction.
[0048] Figure 2 The figure shows the optimal concentrations and ratios of Cas12a, crRNA, and ssDN in the MIRA-CRISPR / Cas12a reaction system.
[0049] Figure 3 Figure showing the analytical specificity of MIRA-CRISPR / Cas12a in the detection of Acinetobacter baumannii, Staphylococcus epidermidis, and Streptococcus pneumoniae.
[0050] Figure 4 The figure shows the results of evaluating the analytical sensitivity of MIRA-CRISPR / Cas12a by detecting different DNA concentrations of Acinetobacter baumannii, Staphylococcus epidermidis, and Streptococcus pneumoniae.
[0051] Figure 5 The results of validating the MIRA-CRISPR / Cas12a FPD detection method using clinical pathogen samples are shown in the figure.
[0052] Figure 6 The figure shows the results of validating the MIRA-CRISPR / Cas12a LFA detection method using clinical pathogen samples. Detailed Implementation
[0053] To make the technical problems, technical solutions and advantages of the present invention clearer, a detailed description will be given below in conjunction with the accompanying drawings and specific embodiments.
[0054] Experimental materials and reagents (During the MIRA detection process, all reaction systems were purchased from AmpMed DNA isothermal amplification kits, including fluorescent kits, basic kits, and colloidal gold kits; all CRISPR reaction systems were purchased from Shanghai Tulugang Biotechnology Co., Ltd.)
[0055] Acinetobacter baumannii: Standard strain Acinetobacter baumannii ATCC19606 preserved at Dazu District People's Hospital, Chongqing.
[0056] Staphylococcus epidermidis: Standard strain Staphylococcus epidermidis ATCC12228 preserved at Dazu District People's Hospital, Chongqing.
[0057] Streptococcus pneumoniae: Standard strain of Streptococcus pneumoniae ATCC6305 preserved at Dazu District People's Hospital, Chongqing.
[0058] Cerebrospinal fluid: The cerebrospinal fluid samples were collected from the People's Hospital of Dazu District, Chongqing, and all of them had negative clinical cultures.
[0059] The sequences of primers, probes, crRNA, and ssDNA used in the MIRA and CRISPR reaction processes were synthesized by Beijing Liuhe BGI Genomics Co., Ltd.
[0060] MIRA reaction system:
[0061] Dissolution buffer (A buffer): mainly composed of 25mM Tris-HCl (pH=8.0, 25℃), 150mM KCI, and 5v / v% PEG.
[0062] Freeze-dried enzyme powder: a reagent containing recombinant enzymes, recombinant enzyme cofactors, single-stranded DNA binding proteins, ATP and other protein / enzyme systems.
[0063] Buffer B is an activation system for magnesium acetate solution (320 nM, pH=8.0).
[0064] CRISPR reaction system:
[0065] LbCas12a protein
[0066] 10 x HOLMES Buffer for Cas12a
[0067] CRISPR single-system lateral chromatography test strip
[0068] Example 1: Establishment of a MIRA-CRISPR / Cas12a detection method for common pathogens of the central nervous system
[0069] 1. Standard strains of Acinetobacter baumannii ATCC19606, Staphylococcus epidermidis ATCC12228, and Streptococcus pneumoniae ATCC6305 preserved at Dazu District People's Hospital of Chongqing were transferred to blood agar plates and incubated for 16-24 hours. The colonies were then mixed with cerebrospinal fluid to prepare a test sample for cerebrospinal fluid environmental infection. The sample was lysed and nucleic acid was extracted as a detection template.
[0070] 2. MIRA primers and crRNA were designed targeting the specific gene Spn-lytA sequences of Acinetobacter baumannii Ab-OXA-51, Staphylococcus epidermidis Sep-SESB, and Streptococcus pneumoniae, respectively.
[0071] 1) Design primers, probes, crRNA, and ssDNA for the MIRA and CRISPR reaction processes in the experiment.
[0072] a) Acinetobacter baumannii (Ab. baumannii)
[0073] The sequence used in the technical solution is as follows:
[0074] Ab-MIRA-F1: (SEQ ID NO:1)
[0075] GAAAAGGACATGACCCTAGGCGATGCTATG
[0076] Ab-MIRA-F2: (SEQ ID NO:2)
[0077] GATTTAGCTCGTCGTATTGGACTTGAACTC
[0078] Ab-MIRA-F3:(SEQ ID NO:3)
[0079] CATGACCCTAGGCGATGCTATGAAAGCTTC
[0080] Ab-MIRA-R1:(SEQ ID NO:4)
[0081] TATTAGCTAGCTTGTAAGCAAACTGTGCCTC
[0082] Ab-MIRA-R2:(SEQ ID NO:5)
[0083] GCTAAATGGAAGCGTTTTATTAGCTAGCTT
[0084] Ab-MIRA-R3:(SEQ ID NO:6)
[0085] GAACAACCCATCCAGTTAACCAGCCTACTTG
[0086] Ab-crRNA: (SEQ ID NO:7)AAUUUCUACUAAGUGUAGAUGCUGGUGGUCCUUAAAAAU
[0087] (b) Epidermidis (S. epidermidis,Sep) .
[0088] The best way to get a smile on your face:
[0089] Sep-MIRA-F1:(SEQ ID NO:8)
[0090] AATCTGGTGCAGGTGTCGGTACTTATAAAG
[0091] Sep-MIRA-F2:(SEQ ID NO:9)
[0092] GGTGCAGGTGTCGGTACTTATAAAGTATAC
[0093] Sep-MIRA-F3:(SEQ ID NO:10)
[0094] TGGTGCTATATAAAAGTGGAAATTATGGAG
[0095] Sep-MIRA-R1:(SEQ ID NO:11)
[0096] GGTAAAGTGTAATGAAACCAGCAGTGAGTA
[0097] Sep-MIRA-R2:(SEQ ID NO:12)
[0098] ATTCGGTAGCATATCAGATGAACTTTGTTG
[0099] Sep-MIRA-R3:(SEQ ID NO:13)
[0100] GCATATCAGATGAACTTTGTTGTGACCATA
[0101] Sep-crRNA:(SEQ ID NO:14)AAUUUCUACUAAGUGUAGAUCUUGUGAAGAUGUAGCAAUA
[0102] c)Photographic Survey(S. pneumoniae,Spn)
[0103] The best way to get a smile on your face:
[0104] Spn-MIRA-F1: (SEQ ID NO:15)
[0105] TCTTACGCAATCTAGCAGATGAAGCAGGTTTG
[0106] Spn-MIRA-F2: (SEQ ID NO:16)
[0107] TAGCTGGAATTAAAACGCACGAGTATTGCACG
[0108] Spn-MIRA-F3: (SEQ ID NO:17)
[0109] TATTGCACGAATAACCAACCAACAACCAC
[0110] Spn-MIRA-R1: (SEQ ID NO:18)
[0111] TTCTCAATATCATGCTTAAACTGCTCACGG
[0112] Spn-MIRA-R2: (SEQ ID NO:19)
[0113] TCAAGCCGTTCTCAATATCATGCTTAAACTG
[0114] Spn-MIRA-R3: (SEQ ID NO:20)
[0115] TTCTGCCAGCCTGTTTCAATCGTCAAGCCG
[0116] Spn-crRNA: (SEQ ID NO:21)
[0117] AAUUUCUACUAAGUGUAGAUGCAAGAUAUGGAUAAGGGGUCA
[0118] In this technical solution, all ssDNA probes used in the reactions use the sequence: TTATT (SEQ ID NO:22). The fluorescence method uses: FAM-TTATT-BHQ1; the colloidal gold method uses: FAM-TTATT-Biotin.
[0119] Based on the selected optimal primer pairs, reaction temperature, and reaction time, an isothermal amplification reaction is performed to obtain the target nucleic acid amplification product.
[0120] 3. Add the amplification product to a CRISPR reaction system containing LbCas12a protein, crRNA corresponding to the target sequence, and ssDNA reporter probe, and incubate at 39 °C.
[0121] 4. Determine whether the target pathogen exists in the sample by detecting changes in the fluorescence signal in the reaction system or the color development in the colloidal gold test strip.
[0122] 5. The MIRA-CRISPR / Cas12a detection method established in this embodiment is characterized.
[0123] 1) The optimal primer pairs, reaction temperature, and reaction time for the MIRA amplification reaction were screened using agarose gel electrophoresis (Figure 1A). The results show that the optimal primer pairs in this invention are F2R2 of Acinetobacter baumannii (Figure 1B), F1R1 of Staphylococcus epidermidis (Figure 1C), and F2R2 of Streptococcus pneumoniae (Figure 1D). The optimal reaction temperature for the MIRA reaction is 39℃, and the optimal reaction time is 20 minutes. Figure 1 E to J).
[0124] 2) From Figure 2The optimal concentrations and ratios of LbCas12a protein, corresponding crRNA, and ssDNA reporter probe in the MIRA-CRISPR reaction show that the ratios of Acinetobacter baumannii, Staphylococcus epidermidis, and Streptococcus pneumoniae in this invention are 1:2:2.5 (200 nM / 400 nM / 500 nM) (Figures 2a and 2b), 1:2:2.5 (200 nM / 400 nM / 500 nM) (Figures 2c and d), and 1:2:2 (200 nM / 400 nM / 400 nM) (Figures 2e and f), respectively.
[0125] Example 2. Material composition and proportional parameters of the MIRA and CRISPR-Cas12a nucleic acid detection system
[0126] 1. Composition of the isothermal rapid amplification reaction system
[0127] The multi-enzyme isothermal rapid amplification technology reaction kit includes the following components:
[0128] Dissolution buffer (Buffer A), lyophilized enzyme powder, magnesium acetate solution (Buffer B)
[0129] All of the above-mentioned isothermal amplification reagents are commercially available.
[0130] 2. Composition of the CRISPR-Cas12a nucleic acid detection reaction system
[0131] The CRISPR-Cas12a detection reaction system includes: LbCas12a protein; crRNA complementary to the target amplification product; single-stranded nucleic acid reporter probe; and detection buffer.
[0132] The concentrations of Cas12a protein used were LbCas12a, with an optimized concentration range of 50–200 nM; the concentration of crRNA was 50–200 nM; the concentration of ssDNA reporter probe was 50–500 nM; and the total volume of the MIRA-CRISPR reaction system was 20 μL.
[0133] The Cas12a protein, crRNA, and reporter probe mentioned above are all commercially available.
[0134] The clinical sample test for MIRA-CRISPR / Cas12a established in this embodiment was characterized.
[0135] Clinical performance characterization of MIRA and CRISPR-Cas12a nucleic acid detection system
[0136] 3. Sensitivity verification results
[0137] 1) The target pathogens (Acinetobacter baumannii, Staphylococcus epidermidis, and Streptococcus pneumoniae) were serially diluted 10-fold and then tested. The experimental results showed that:
[0138] 2) When using fluorescence detection (FPD), a clear signal was detected in all reactions with a template concentration of not less than 10¹ CFU / mL; no significant signal change was observed in the negative control group. When using colloidal gold detection (LFA), a template concentration of not less than 10¹ CFU / mL was also detected. 2 A clear signal was detected in all CFU / mL reactions; no significant signal change was observed in the negative control group.
[0139] The results are as follows Figure 4 As shown, the method of the present invention has high detection sensitivity.
[0140] The sample concentration was obtained by plating each tube of bacterial suspension, which was serially diluted, onto a plate and incubating for 14-18 hours before counting the colonies.
[0141] 4. Specificity verification results
[0142] In addition to the three pathogens used in this experiment, nucleic acids from seven other common clinical non-target pathogens were used as interference templates, and a negative control was set up for detection. After MIRA amplification, the samples were fed into a CRISPR reaction system for detection. The other seven pathogens were: Klebsiella pneumoniae, Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Enterococcus faecalis, Staphylococcus saprophyticus, Stenotrophomonas maltophilia, and Enterobacter cloacae.
[0143] The presence of nonspecific amplification or false triggering signals can be determined by fluorescence readings or lateral chromatography results. For example... Figure 3 As shown, only the target pathogen sample produced a detection signal, while the other samples did not show obvious signals, indicating that the method of the present invention has good specificity.
[0144] 5. Detection time and stability verification
[0145] The total detection time from nucleic acid extraction to result interpretation was controlled within 60 minutes. The results of repeated experiments were consistent, and the method was validated using clinical samples, demonstrating its good stability and repeatability.
[0146] 6. Results Analysis
[0147] 1) From Figure 3 The specificity results of the analysis show that cerebrospinal fluid samples containing only Acinetobacter baumannii, Staphylococcus epidermidis, and Streptococcus pneumoniae in this invention exhibit obvious fluorescent signals or LFA bands in colloidal gold staining. Figure 3 (a to f).
[0148] 2) From Figure 4The analytical sensitivity results show that the detection limits for Acinetobacter baumannii in this invention are 5 × 10¹ CFU / mL (FPD) ( Figure 4 a) and 5×10² CFU / mL (LFA) Figure 4 (b) The detection limits for Staphylococcus epidermidis were 3 × 10¹ CFU / mL (FPD) ( Figure 4 c) and 3×10² CFU / mL (LFA) Figure 4 The detection limits for Streptococcus pneumoniae were 4 × 10¹ CFU / mL (FPD) (d). Figure 4 (e) and 4×10² CFU / mL (LFA) Figure 4 (f)
[0149] The results showed that different pathogens could be specifically detected using corresponding primers and crRNA, demonstrating that the method of the present invention has good versatility and scalability.
[0150] Example 3: Validation of the MIRA-CRISPR / Cas12a detection method using clinical pathogen samples
[0151] Clinical validation was performed on clinical samples of Streptococcus pneumoniae, Acinetobacter baumannii, and Staphylococcus epidermidis, respectively, and the tests were conducted according to the method described in this invention.
[0152] 1. MIRA-CRISPR fluorescence detection steps (FPD):
[0153] 1.1. MIRA Amplification Reaction
[0154] 1) Obtain the cerebrospinal fluid sample to be tested (cerebrospinal fluid samples simulating infection fluid Acinetobacter baumannii, Staphylococcus epidermidis and Streptococcus pneumoniae), and use the boiling method to extract nucleic acid to obtain the nucleic acid template to be tested.
[0155] 2) Using the Amp Future DNA Isothermal Amplification Kit (Basic Type), the specific steps are as follows: Add 29.4 μL of Buffer A to the lyophilized enzyme powder, then add 2 μL each of the upstream and downstream primers for the three pathogens mentioned above, mix well, and divide the reaction solution into 5 equal portions. Transfer 6.7 μL of each portion to another 8-tube strip. Then add 3.3 μL of the corresponding nucleic acid template to be tested to the 8-tube strip, and finally add 0.5 μL of Buffer B to the reaction system.
[0156] 3) Perform nucleic acid amplification reaction at 39 ℃ for 20 minutes to finally obtain the amplification product of the target nucleic acid.
[0157] The amplification step does not require a thermal cycling process; only a constant temperature device is needed to maintain the reaction temperature. Optimal primer pairs are used for detection in all reactions (F2R2 for Acinetobacter baumannii, F1R1 for Staphylococcus epidermidis, and F1R1 for Streptococcus pneumoniae).
[0158] 1.2 CRISPR-Cas12a Nucleic Acid Detection
[0159] The CRISPR-Cas12a nucleic acid detection steps include the following operations:
[0160] 1) First, perform the MIRA reaction. Add 10 μL of all MIRA reaction systems to the bottom of the tube according to the above reaction steps. Then, add 10 μL of CRISPR-Cas12a detection reaction system (including Cas12a protein, target bacterial crRNA, Cas12a Buffer, enzyme-free water and ssDNA reporter probe) to the tube cap.
[0161] 2) After reacting at 39 ℃ for 20 minutes, briefly disconnect for 10 seconds and then continue reacting at 39 ℃ for another 20 minutes.
[0162] 3) The total reaction time is 40 minutes; observe the reaction curve to determine the result.
[0163] from Figure 5 In the clinical validation diagram using the fluorescence method, A. Clinical sample validation samples 1-165. B. Clinical samples 166-175, detected using the Acinetobacter baumannii, Staphylococcus epidermidis, and Streptococcus pneumoniae reaction systems, respectively. C, D, and E. Statistical results of Acinetobacter baumannii, Staphylococcus epidermidis, and Streptococcus pneumoniae in the clinical sample validation. The results show that the detection sensitivity and specificity are both 100%, and the concordance is 100%.
[0164] 2. MIRA-CRISPR colloidal gold method (LFA) detection:
[0165] 2.1. MIRA Amplification Reaction
[0166] 1) Obtain the cerebrospinal fluid sample to be tested (cerebrospinal fluid samples simulating infection fluid Acinetobacter baumannii, Staphylococcus epidermidis and Streptococcus pneumoniae), and use the boiling method to extract nucleic acid to obtain the nucleic acid template to be tested.
[0167] 2) Using the Amp Future DNA Isothermal Amplification Kit (colloidal gold form), the specific steps are as follows: Add 29.4 μL of Buffer A to the lyophilized enzyme powder, then add 2 μL each of the upstream and downstream primers for the three pathogens mentioned above, mix well, and divide the reaction solution into 5 equal portions. Transfer 6.7 μL of each portion to another 8-tube strip. Then add 3.3 μL of the corresponding nucleic acid template to be tested to the 8-tube strip, and finally add 0.5 μL of Buffer B to the reaction system.
[0168] 3) Perform nucleic acid amplification reaction at 39 ℃ for 20 minutes to finally obtain the amplification product of the target nucleic acid.
[0169] The amplification step does not require a thermal cycling process; only a thermostat is needed to maintain the reaction temperature. Optimal primer pairs were used for detection in all reactions (F2R2 for Acinetobacter baumannii, F1R1 for Staphylococcus epidermidis, and F1R1 for Streptococcus pneumoniae).
[0170] 2.2 CRISPR-Cas12a Nucleic Acid Detection
[0171] The CRISPR-Cas12a nucleic acid detection steps include the following operations:
[0172] 1) First, perform the MIRA reaction. Add 10 μL of all MIRA reaction systems to the bottom of the tube according to the above reaction steps. Then, add 10 μL of CRISPR-Cas12a detection reaction system (including Cas12a protein, target bacterial crRNA, Cas12a Buffer, enzyme-free water and ssDNA reporter probe) to the tube cap.
[0173] 2) After reacting at 39 ℃ for 20 minutes, briefly disconnect for 10 seconds and then continue reacting at 39 ℃ for another 20 minutes.
[0174] 3) Dilute the total reaction system to 50 μL, then react with the colloidal gold test strip for 5-10 minutes. The total reaction time is 45-50 minutes. Observe the color development of the colloidal gold to determine the result. There are two bands: a lower control line (C line) and an upper detection line (T line). The C line is coated with avidin (SA), and the T line is coated with goat anti-mouse secondary antibody. The colloidal gold is labeled with anti-FITC / FAM monoclonal antibody. The intact CRISPR system probe (one end labeled with biotin, the other end labeled with FAM) allows all the colloidal gold to be captured at the C line. When the probe is cleaved by Cas enzyme, the colloidal gold bound to the cleaved fragment cannot be captured by the C line, forming the T line.
[0175] from Figure 6 The results of the colloidal gold clinical validation diagram show that the detection sensitivity and specificity are both 100%, and the consistency is 100%. Figure 6 In the following sections: A. Clinical sample validation samples 1-165. B. Clinical samples 166-175 tested using the Acinetobacter baumannii reaction system. C. Clinical samples 166-175 tested using the Staphylococcus epidermidis reaction system. D. Clinical samples 166-175 tested using the Streptococcus pneumoniae reaction system. E, F, G. Statistical results of Acinetobacter baumannii, Staphylococcus epidermidis, and Streptococcus pneumoniae in clinical sample validation.
[0176] The above description represents the preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A test kit, comprising: The first primer pair and first crRNA for detecting Acinetobacter baumannii, the second primer pair and second crRNA for detecting Staphylococcus epidermidis, the third primer pair and third crRNA for detecting Streptococcus hepatitis, and the ssDNA probe sequence; in, The first primer pair is selected from any one of the primer pairs whose nucleotide sequences are shown below: Primer pairs with nucleotide sequences SEQ ID NO:1 and SEQ ID NO:4, primer pairs with nucleotide sequences SEQ ID NO:2 and SEQ ID NO:5, and primer pairs with nucleotide sequences SEQ ID NO:3 and SEQ ID NO:6; The second primer pair is selected from any one of the primer pairs whose nucleotide sequences are shown below: Primer pairs with nucleotide sequences SEQ ID NO:8 and SEQ ID NO:11, primer pairs with nucleotide sequences SEQ ID NO:9 and SEQ ID NO:12, and primer pairs with nucleotide sequences SEQ ID NO:10 and SEQ ID NO:13; The third primer pair is selected from any one of the primer pairs shown below, with nucleotide sequences as follows: Primer pairs with nucleotide sequences SEQ ID NO:15 and SEQ ID NO:18, primer pairs with nucleotide sequences SEQ ID NO:16 and SEQ ID NO:19, and primer pairs with nucleotide sequences SEQ ID NO:17 and SEQ ID NO:20; The nucleotide sequence of the first crRNA is SEQ ID NO:7; The nucleotide sequence of the second crRNA is SEQ ID NO:14; The nucleotide sequence of the third crRNA is SEQ ID NO:21; The nucleotide sequence of the ssDNA is SEQ ID NO:
22.
2. The detection kit as described in claim 1, wherein, The ssDNA contains a fluorescently modified label selected from FAM-TTATT-BHQ1 and / or FAM-TTATT-Biotin.
3. The detection kit as described in claim 1, wherein, The first primer pair is a primer pair with nucleotide sequences SEQ ID NO:2 and SEQ ID NO:5, respectively; and / or, The second primer pair consists of primers with nucleotide sequences SEQ ID NO:8 and SEQ ID NO:11, respectively. The third primer pair is a primer pair with nucleotide sequences SEQ ID NO:16 and SEQ ID NO:
19.
4. The detection kit according to any one of claims 1-3 further includes a dissolution buffer, lyophilized enzyme powder, and magnesium acetate solution for performing multi-enzyme rapid amplification technology reactions; Preferably, the dissolution buffer contains 25 mM Tris-HCl (pH=8.0, 25°C), 150 mM KCl, and 5 v / v% PEG; Preferably, the lyophilized enzyme powder contains 500 ng / μL recombinase, 400 ng / μL recombinase cofactor, 900 ng / μL single-stranded DNA binding protein, 200 ng / μL DNA polymerase, 100 ng / μL reverse transcriptase, 3 mM ATP, etc. Preferably, the magnesium acetate solution has a concentration of 320 nM and a pH of 8.0-8.
5.
5. The kit according to any one of claims 1-4 further comprises 50–200 nM of LbCas12a protein.
6. A method for detecting bacterial infection based on a kit according to any one of claims 1-5, comprising: 1) Extract nucleic acid from the sample to be tested to obtain a nucleic acid template to be tested; preferably, the sample to be tested is a cerebrospinal fluid sample; 2) Add appropriate amounts of the first primer pair, the second primer pair, and the third primer pair respectively, mix well, then add the corresponding nucleic acid template to be tested, and add the multi-enzyme isothermal rapid amplification reaction reagent; 3) Nucleic acid amplification reaction was carried out at 37–42 ℃. The optimal reaction primer pair was screened by gel electrophoresis. After the reaction, the amplification product of the target nucleic acid was obtained. 4) Add the CRISPR-Cas12a reaction reagent containing the first crRNA, the second crRNA, or the third crRNA and ssDNA to the amplification product obtained in step 3), and react at 39 °C for 20 minutes to obtain the detection product; 5) The detection product is detected using a fluorescence method or a colloidal gold method.
7. The method as described in claim 6, in step 5), When using fluorescence detection, the ssDNA probe is: FAM-TTATT-BHQ1; when using colloidal gold detection, the ssDNA probe is: FAM-TTATT-Biotin.
8. The method as described in claim 6 or 7, wherein in step 2), the first primer pair, the second primer pair, the third primer pair, the nucleic acid template to be tested, and the multi-enzyme isothermal rapid amplification reaction reagent are added to the bottom of the reaction tube; the CRISPR-Cas12a reaction reagent containing the first crRNA, the second crRNA, or the third crRNA and ssDNA are added to the cap of the reaction tube; after the nucleic acid amplification reaction is completed in step 3), the reaction is briefly detached for 10 seconds and then continued at 39 °C for 20 minutes.
9. The method of any one of claims 6-8, wherein step 2) further comprises: Add 29.4 μL of dissolution buffer to the lyophilized enzyme powder, then add 2 μL each of the upstream and downstream primers of the first, second, and third primer pairs, mix well, and pipette 6.7 μL into another eight-tube strip. Divide the mixed reaction solution into 5 equal portions, then add 3.3 μL of the corresponding nucleic acid template to be tested, and finally add 0.5 μL of magnesium acetate solution.
10. The application of the detection kit according to any one of claims 1-5, or the method according to any one of claims 6-9, in the detection of bacterial infection, wherein the pathogen is selected from Acinetobacter baumannii (… A. baumannii ,Ab), Staphylococcus epidermidis ( S. epidermidis Sep) and / or Streptococcus pneumoniae ( S. pneumoniae One or more of (Spn); preferably, the bacterial infection sample is derived from a clinically preserved sample and is tested in a simulated cerebrospinal fluid environment.