A composition for repairing the lipid barrier and its use in sensitive skin care

By combining extracts of purple algae, flaxseed, senna glycosides, and oat extract, the synthesis and transport of skin lipids are activated, solving the problem of incomplete repair of the skin lipid barrier in existing technologies, and achieving stable repair of the skin barrier and improved hydration.

CN122272452APending Publication Date: 2026-06-26N O D TOPIA (GUANGZHOU) BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610415260.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-31
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Existing products for repairing the skin's lipid barrier cannot fundamentally restore the skin's ability to synthesize lipids, leading to dry, flaky, sensitive, or even inflammatory skin diseases.

Method used

It uses a specific ratio of purple algae extract, flaxseed extract, senna glycoside and oat extract to activate PPAR-α receptors in keratinocytes, promote lipid synthesis and transport, provide antioxidant protection, enhance skin's defense and water-locking ability, and achieve barrier repair throughout the entire process.

Benefits of technology

It achieves long-lasting and stable repair of the skin's lipid barrier, increases skin moisture content, and significantly improves the condition of sensitive skin, making it suitable for people with sensitive skin.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
Patent Text Reader

Abstract

This invention relates to a composition for repairing the lipid barrier and its application in sensitive skin care, belonging to the field of cosmetic technology. The composition includes *Plasmodium purpureus* extract, flaxseed extract, senna-based glycosides, and oat extract. The rational combination of these four components not only promotes lipid synthesis but also ensures effective lipid transport and prevents the oxidative degradation of newly synthesized lipids. By covering the entire lipid metabolism process, it achieves a long-lasting and stable barrier repair effect, and can be applied to the repair of the lipid barrier in people with sensitive skin. Efficacy testing shows that the *Plasmodium purpureus* extract, flaxseed extract, senna-based glycosides, and oat extract in the composition can synergistically enhance the composition's antioxidant and lipid synthesis-promoting capabilities, while effectively promoting skin barrier repair and increasing skin moisture content, exhibiting significant skin-soothing and repairing effects, making it highly suitable for people with sensitive skin.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of cosmetic technology, and more particularly to a composition for repairing the lipid barrier and its application in the care of sensitive skin. Background Technology

[0002] As the body's first line of defense, the skin's barrier function primarily relies on the "brick-and-mortar structure" of the stratum corneum. Intercellular lipids, composed of lipids such as ceramides, free fatty acids, and cholesterol, are crucial for maintaining barrier integrity, preventing moisture loss, and resisting external stimuli. Damage to the lipid barrier can lead to dry, flaky, sensitive skin, and even inflammatory skin diseases.

[0003] Currently, many repair products on the market mainly rely on supplementing exogenous lipids (such as ceramides) to temporarily fill the skin barrier gaps. However, this approach often only addresses the symptoms and not the root cause, failing to fundamentally restore the skin's ability to synthesize, transport, and maintain lipid homeostasis. Therefore, developing a composition that can promote the entire process of endogenous lipid metabolism in a multi-dimensional and multi-level manner, thereby achieving self-repair of the skin barrier, has significant market implications. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide a composition for repairing the lipid barrier and its application in the care of sensitive skin.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a composition comprising, by weight ratio of, *Porphyra yezoensis* extract, flaxseed extract, senna glycoside, and oat extract, in a ratio of 0.05-1:0.1-1:0.1-1:0.1-2.

[0006] The composition provided by this invention includes: *Plasmodium purpureus* extract, rich in disulfide-bonded polysaccharides, whose specific polysaccharide fragments can act as signaling molecules to activate PPAR-α receptors in keratinocytes, inducing keratinocyte differentiation and promoting epidermal lipid synthesis; flaxseed extract, which can increase the number of lamellar bodies in human skin, facilitating lipid storage and transport and secretion into the stratum corneum; and senna-glucosinolates, which have potent antioxidant effects. Newly synthesized lipids in the skin, especially unsaturated fatty acids, are easily oxidized, and once oxidized, they cannot form a robust barrier structure, leading to dry and sensitive skin. Therefore, senna-glucosinolates provide potent antioxidant protection, ensuring that lipids are not oxidized and damaged. Oat extract can replenish skin lipids, promote ceramide synthesis, structurally repair the skin lipid barrier, and reduce barrier damage through anti-inflammatory and antioxidant effects, enhancing the skin's own defense and water-locking capabilities. The above four components, when rationally combined, not only promote lipid synthesis but also ensure effective lipid transport and prevent the oxidative degradation of newly synthesized lipids. By covering the entire process of lipid metabolism, a long-lasting and stable barrier repair effect is achieved.

[0007] Further, the composition comprises *Porphyra yezoensis* extract, flaxseed extract, senna glycoside, and oat extract in a weight ratio of 0.1-0.5:0.2-0.5:0.2-0.5:0.2-1.

[0008] Secondly, the present invention provides the use of the composition described in the first aspect in the preparation of cosmetics having the function of repairing the lipid barrier.

[0009] Furthermore, the cosmetic product includes one of the following: lotion, emulsion, cream, mask, or spray.

[0010] Furthermore, the cosmetic product is an emulsion.

[0011] Furthermore, the composition accounts for 2%-8% by weight in the cosmetic.

[0012] Thirdly, the present invention provides a cosmetic containing 2wt%-8wt% of the composition described in the first aspect.

[0013] Furthermore, the cosmetic product also contains excipients acceptable in the cosmetic field.

[0014] Fourthly, the present invention provides an emulsion containing the following raw materials in weight percentages: 2%-8% of the composition described in the first aspect, 0.01%-1% of a thickener, 1%-10% of a moisturizer, 0.1%-6% of an emulsifier, 1%-15% of a skin moisturizer, 0.01%-0.5% of a pH adjuster, 0.1%-4% of an antioxidant, and the balance being deionized water.

[0015] Furthermore, the method for preparing the emulsion includes the following steps: S1. Mix some of the humectant, thickener and water, heat to 75-85℃, and homogenize at 6000-7000 r / min for 3-8 min. After homogenization, keep warm for later use to obtain the pre-prepared phase A. S2. Mix the emollient and emulsifier, heat to 75-85℃, homogenize at 6000-7000 r / min for 3-8 min, keep warm after homogenization, and obtain the pre-prepared phase B; S3. Mix the antioxidant and the remaining humectant, heat to 60°C to melt, and obtain the pre-prepared phase C; S4. Heat the pre-prepared phase A to 80°C, add the pre-prepared phase B, homogenize at 7500-8500 r / min for 3 min, cool to 50°C, add the pre-prepared phase C at 250-400 r / min and stir to mix, cool to below 45°C and add the composition, continue stirring, add pH adjuster to adjust pH, stop stirring to obtain emulsion.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a composition comprising *Plasmodium purpureus* extract, flaxseed extract, senna-based glycosides, and oat extract. The four components in this composition, through a rational blending process, not only promote lipid synthesis but also ensure effective lipid transport and prevent the oxidative degradation of newly synthesized lipids. By covering the entire lipid metabolism process, it achieves a long-lasting and stable barrier repair effect, making it suitable for lipid barrier repair in individuals with sensitive skin. Efficacy testing shows that the *Plasmodium purpureus* extract, flaxseed extract, senna-based glycosides, and oat extract in this composition synergistically enhance the composition's antioxidant and lipid synthesis-promoting capabilities, while effectively promoting skin barrier repair and increasing skin moisture content, exhibiting significant skin-soothing and repairing effects, making it highly suitable for individuals with sensitive skin. Detailed Implementation

[0017] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0018] The materials used in the following embodiments are from the following sources: The extract of *Porphyra yezoensis* was purchased from Shaanxi Mufei Biotechnology Co., Ltd., and its product name is *Porphyra yezoensis* extract. Flaxseed extract was purchased from Xi'an Haoyu Kangze Biotechnology Co., Ltd., and its product name is flaxseed extract. The herbicide was purchased from Xi'an Shilin Biotechnology Co., Ltd., and its product name is herbicide. The oat extract was purchased from Shaanxi Kangzhou Biotechnology Co., Ltd., and its product name is Oat Extract. Unless otherwise specified, all other materials and reagents used in the examples are commercially available.

[0019] Examples 1-5 The compositions of Examples 1-5 were prepared according to the formulations shown in Table 1. The preparation method of the compositions is as follows: weigh the corresponding components according to Table 1, mix the components evenly, and obtain the compositions.

[0020] Table 1. Component composition and dosage of the composition

[0021] Note: The total weight of the compositions prepared in Examples 1-5 is equal.

[0022] Comparative Example 1 This comparative example provides a composition that differs from Example 1 only in that the composition does not contain *Porphyra yezoensis* extract. Instead, the missing amount is made up by flaxseed extract, senna glycoside, and oat extract in a weight ratio of 0.3:0.3:0.5. The preparation method is the same as in Example 1.

[0023] Comparative Example 2 This comparative example provides a composition that differs from Example 1 only in that the composition does not contain flaxseed extract, but is supplemented by extracts of *Plasmodium styracifolium*, senna glycoside, and oat extract in a weight ratio of 0.2:0.3:0.5. The preparation method is the same as in Example 1.

[0024] Comparative Example 3 This comparative example provides a composition that differs from Example 1 only in that the composition does not contain senna-based glycosides. Instead, it is supplemented by extracts of *Porphyra yezoensis*, flaxseed, and oat in a weight ratio of 0.2:0.3:0.5. The preparation method is the same as in Example 1.

[0025] Comparative Example 4 This comparative example provides a composition that differs from Example 1 only in that the composition does not contain oat extract, but is supplemented with a mixture of *Plasmodium styracifolium* extract, flaxseed extract, and senna glycoside in a weight ratio of 0.2:0.3:0.3. The preparation method is the same as in Example 1.

[0026] Comparative Example 5 This comparative example provides a composition that differs from Example 1 only in that the *Porphyra yezoensis* extract in the composition is replaced with an equal amount of *Spirulina salina* extract (purchased from Fufeng Sinote Biotechnology Co., Ltd.), and the preparation method is the same as in Example 1.

[0027] Comparative Example 6 This comparative example provides a composition that differs from Example 1 only in that the flaxseed extract in the composition is replaced with an equal amount of safflower seed extract (purchased from Fufeng Sinote Biotechnology Co., Ltd.), and the preparation method is the same as in Example 1.

[0028] Comparative Example 7 This comparative example provides a composition that differs from Example 1 only in that the senna-based glycosides in the composition are replaced with an equal amount of hesperidin (purchased from Fufeng Sinote Biotechnology Co., Ltd.), and the preparation method is the same as in Example 1.

[0029] Comparative Example 8 This comparative example provides a composition that differs from Example 1 only in that the oat extract in the composition is replaced with an equal amount of barley extract (purchased from Fufeng Sinote Biotechnology Co., Ltd.), and the preparation method is the same as in Example 1.

[0030] Comparative Example 9 This comparative example provides a composition that differs from Example 1 in that the weight ratio of *Plasmodium purpureum* extract, flaxseed extract, senna glycoside, and oat extract in the composition is 1.5:0.05:1.5:0.05, and the preparation method is the same as in Example 1.

[0031] Application Examples 1-5 and Comparative Application Examples 1-9 The compositions of Examples 1-5 and Comparative Examples 1-9 were added to the emulsion at a concentration of 5 wt% to obtain the emulsions of Application Examples 1-5 and Comparative Application Examples 1-9. The formulations are shown in Table 2.

[0032] Table 2. Component composition and dosage of the emulsion

[0033] The method for preparing the emulsion includes the following steps: S1. Mix each component of phase A with water and stir. Heat to 80°C and homogenize at 6500 r / min for 5 min. After homogenization, keep warm for later use to obtain the pre-prepared phase A. S2. Mix the components of phase B, heat to 80°C, homogenize at 6500 r / min for 5 min, and keep warm after homogenization to obtain the pre-prepared phase B; S3. Mix the components of phase C and heat to 60°C to melt them to obtain the pre-prepared phase C; S4. Heat the pre-prepared phase A to 80°C, add the pre-prepared phase B, homogenize at 8000 r / min for 3 min, then cool to 50°C, add the pre-prepared phase C at 300 r / min and stir to mix, then cool to below 45°C and add the corresponding composition, continue stirring for 5 min, finally add arginine to adjust the pH, then stop stirring, discharge the material to obtain the emulsion.

[0034] The present invention also provides a blank application example emulsion, which differs from application example 1 only in that no composition is added, and the missing amount is made up with an equal amount of deionized water. The preparation method of the blank application example emulsion includes the following steps: S1. Mix each component of phase A with water and stir. Heat to 80°C and homogenize at 6500 r / min for 5 min. After homogenization, keep warm for later use to obtain the pre-prepared phase A. S2. Mix the components of phase B, heat to 80°C, homogenize at 6500 r / min for 5 min, and keep warm after homogenization to obtain the pre-prepared phase B; S3. Mix the components of phase C and heat to 60°C to melt them to obtain the pre-prepared phase C; S4. Heat the pre-prepared phase A to 80°C, add the pre-prepared phase B, homogenize at 8000 rpm for 3 min, then cool to 50°C, add the pre-prepared phase C at 300 rpm and stir to mix, then cool to below 45°C, add arginine to adjust the pH, then stop stirring, discharge the material to obtain the emulsion.

[0035] Test Example 1 1. Free radical scavenging ability test of the composition The compositions prepared in Examples 1-5 and Comparative Examples 1-9 were used as test samples. The antioxidant effect of the compositions was evaluated by measuring their ability to scavenge DPPH free radicals. The specific test methods are as follows: Add 4.0 mL of 1×10 to a 10 mL test tube. -4 Mix 0.5 mL of 1 mol / L DPPH solution and 0.5 mL of deionized water containing 0.01 g / mL of the corresponding test sample, seal with sealing film, shake well, and immediately measure the absorbance at 517 nm (A1). React in the dark for 30 min, and then measure the absorbance at 517 nm (A2). In a new 10 mL test tube, add 4.0 mL of DPPH solution and 0.5 mL of deionized water, shake well, and measure the absorbance at 517 nm, recording it as A0. Calculate the DPPH free radical scavenging rate using the following formula: DPPH free radical scavenging rate: Y = [1 - (A2 - A1) / A0] × 100%.

[0036] 2. Test on the ability of the composition to promote lipid synthesis CerS3 (ceramide synthase 3) and CerS4 (ceramide synthase 4) are the most important ceramide synthases, playing a crucial role in the formation of the lipid barrier in the stratum corneum of the skin. Therefore, the ability of a composition to promote lipid synthesis can be evaluated by detecting its effect on the expression of CerS3 and CerS4 genes. Human keratinocytes (HaCaT, Guangzhou Genio Biotechnology Co., Ltd.) were used as cell models. The compositions prepared in Examples 1-5 and Comparative Examples 1-9 were used as test samples. The test conditions were: incubator temperature 37±1℃, humidity 90±5%, and carbon dioxide 5±1%. Cells were cultured and treated according to groups, and then the expression levels of CerS3 and CerS4 genes in each group were tested. The specific test methods are as follows: (1) The cell suspension was seeded into a 96-well cell culture plate at a density of 2000 cells / well, and 100 μL of DMEM medium was added to each well. The cells were cultured for 24 h. (2) Discard the culture medium, add 100 μL of DMEM culture medium (2105341, Gibco) to the blank control group, and add 100 μL of DMEM culture medium containing 0.1 wt% of the corresponding test sample to the sample group respectively. (3) After incubation for 48 h, the culture medium was discarded, and RNA was extracted from the cells using an RNA extraction kit (TRIzol, Thermo Fisher Scientific). The RNA was then reverse transcribed into cDNA using a reverse transcription kit (RevertAid RT, Thermo Fisher Scientific). The synthesized cDNA was used as a template for real-time quantitative PCR (TaqMan, Thermo Fisher Scientific). (4) The expression levels of CerS3 and CerS4 genes in HaCaT cells of each group were detected by real-time quantitative PCR. β-actin was used as an internal reference gene. The primer sequence for CerS3 was as follows: forward: ACATTCCACAAGGCAACCATTG, reverse:CTCTTGATTCCGCCGACTCC; The CerS4 primer sequence used is as follows: forward:GGAGGCCTGTAAGATGGTCA, reverse:GAGGACCAGTCGGGTGTAGA; The β-actin primer sequence used is: forward:GATGAGATTGGCATGGCTTT, reverse: CACCTTCACCGTTCCAGTTT.

[0037] (5) Calculate the promotion rates of CerS3 and CerS4: Promotion rate (%) = Expression level 样品组 / expression level 空白对照组 ×100%.

[0038] The results are shown in Table 3. Data from Examples 1-5 show that the composition provided by this invention has a high DPPH free radical scavenging rate and can effectively increase the expression levels of CerS3 and CerS4 genes, indicating that the composition provided by this invention has strong antioxidant and lipid synthesis-promoting abilities, thereby effectively repairing the skin lipid barrier. Comparing the data of Comparative Examples 1-9 with Example 1, the DPPH free radical scavenging rate, CerS3 promotion rate, and CerS4 promotion rate of Comparative Examples 1-9 are significantly lower than those of Example 1. The difference between Comparative Examples 1-9 and Example 1 lies in the absence of one of the following ingredients: *Plasmodium styracifolium* extract, flaxseed extract, senna glycoside, and oat extract; one ingredient may be replaced with an active ingredient with similar functions; or the dosage ratio of the four ingredients may not be within the limits specified in this invention. This indicates that the *Plasmodium styracifolium* extract, flaxseed extract, senna glycoside, and oat extract in the composition provided by this invention can synergistically enhance the antioxidant and lipid synthesis-promoting abilities of the composition within a specific dosage ratio range.

[0039] Table 3 Results of in vitro efficacy tests Group DPPH free radical scavenging rate (%) CerS3 promotion rate (%) CerS4 promotion rate (%) Example 1 95.6 155.3 174.9 Example 2 83.4 139.7 158.3 Example 3 86.2 142.5 161.7 Example 4 90.5 147.9 165.6 Example 5 93.8 152.6 172.2 Comparative Example 1 50.3 103.2 109.8 Comparative Example 2 62.8 105.3 114.5 Comparative Example 3 53.5 110.7 127.4 Comparative Example 4 59.7 107.5 123.1 Comparative Example 5 65.4 112.4 129.9 Comparative Example 6 67.0 115.2 132.0 Comparative Example 7 64.6 116.8 135.7 Comparative Example 8 67.9 113.6 130.8 Comparative Example 9 70.1 119.1 139.6 Test Example 2: Skin Soothing and Repairing Effect Test The emulsions prepared using Application Examples 1-5, Comparative Application Examples 1-9, and the blank application example were used as test samples to test their skin soothing and repair effects. The method is as follows: Seventy-five volunteers aged 18-45 were selected and randomly divided into 15 groups of 5 people each. During the test, each group randomly used the lotion from Application Examples 1-5, Control Application Examples 1-9, and the blank application example of this invention. The lotion was used once in the morning and once in the evening. The method of use was to take 1 mL of the sample and apply it evenly to the entire face after cleansing and moisturizing in the morning and evening, and gently massage until fully absorbed. Follow-up visits were conducted on days 0 and 14 to test various indicators.

[0040] (2) On the days of follow-up visits on days 0 and 14, the subjects did not apply any skin care products. After cleansing, they sat quietly for 30 minutes in a constant temperature and humidity room with a temperature of 21±1℃ and a humidity of 50±10%. The initial TEWL value and moisture content of the subjects were tested using the Tewameter®™ Hex (Courage+Khazaka) transdermal moisture loss probe and the Corneometer® CM 825 (Courage + Khazaka) moisture probe. Facial images were taken using Visia-7, and the exported red area images were analyzed to obtain the a* value. (3) Analyze the improvement of each indicator, and take the average value of the data. The improvement is calculated as follows: TEWL value improvement rate % = (TEWL value) 使用前- TEWL value 使用后 ) / TEWL value 使用前 ×100%; Moisture content improvement rate % = (Moisture content) 使用后- Moisture content 使用前 ) / Moisture content 使用前 ×100%; a* value improvement rate % = (a* value) 使用前- a* value 使用后 ) / a*value 使用前 ×100%; In the formula: X 使用前 Data on various indicators tested before subjects used the product; X 使用后 Data on various indicators were tested on subjects 14 days after they used the product.

[0041] The test results are shown in Table 4. Compared with the blank application example, after 14 days of use of the lotions in Application Examples 1-5 provided by this invention, the subjects showed a significant improvement rate in skin TEWL value, moisture content, and a* value. This indicates that the lotions in Application Examples 1-5 provided by this invention can effectively repair the skin barrier, increase moisture content, and improve skin sensitivity and redness, achieving a soothing and repairing effect on the skin. Comparison of the data from Application Examples 1-9 with Application Example 1 shows that the combination of *Plasmodium styracifolium* extract, flaxseed extract, senna glycoside, and oat extract within a specific range can synergistically enhance the effects of the resulting composition in repairing the skin barrier, increasing moisture content, and improving sensitivity and redness.

[0042] Table 4. Results of Skin Soothing and Repair Effect Test Group TEWL value improvement rate (%) Moisture content improvement rate (%) a* value improvement rate (%) Application Example 1 18.2 28.9 14.6 Application Example 2 15.3 23.3 12.2 Application Example 3 15.9 24.5 13.1 Application Example 4 16.5 26.8 13.8 Application Example 5 17.7 27.6 14.3 Comparative Application Example 1 6.4 10.3 3.4 Comparative Application Example 2 7.1 13.5 4.5 Comparative Application Example 3 5.6 14.1 4.0 Comparative Application Example 4 4.9 12.2 2.3 Comparative Application Example 5 7.9 14.5 4.8 Comparative Application Example 6 8.8 15.2 5.2 Comparative Application Example 7 9.6 16.0 4.6 Comparative Application Example 8 8.1 14.8 5.9 Comparative Application Example 5 10.2 16.6 6.7 Blank application example 1.5 2.4 0.2 Test Example 3: Sensitive Skin Suitability Test Using the lotions from Application Examples 1-5, Comparative Application Examples 1-9, and the blank application example as test samples, the suitability of the product for sensitive skin was determined by judging the improvement rate of lactic acid stinging before and after use by people with sensitive skin.

[0043] Volunteer selection: 75 people with sensitive skin were selected as volunteers, with 5 people in each group.

[0044] Test procedure: The test was conducted on the nasolabial folds of volunteers. 50 μL of 10wt% lactic acid solution was dropped onto a single layer of filter paper with a diameter of 0.8 cm. The subjects were asked about their stinging sensation at 0.5 min and 2.5 min. The subjects were scored using a 4-point scale (0 points for no stinging, 1 point for mild stinging, 2 points for moderate stinging, and 3 points for severe stinging).

[0045] Sample usage: Volunteers in the sample group applied the samples from Application Examples 1-5 or the control samples 1-9 to their entire face, while volunteers in the blank control group used the lotion from the blank application examples. Volunteers applied the product twice daily, morning and evening, applying 1 mL of lotion each time, for two consecutive weeks. After two weeks of use, the above test steps were repeated.

[0046] Record the lactic acid stinging scores of volunteers before and after 2 weeks of use, and calculate the improvement rate of lactic acid stinging in volunteers.

[0047] The improvement rate of lactic acid stinging (%) was calculated as follows: (sum of lactic acid stinging scores before use - sum of lactic acid stinging scores after 2 weeks of use) / sum of lactic acid stinging scores before use × 100%. The sum of lactic acid stinging scores = the average lactic acid stinging score over 0.5 minutes + the average stinging score over 2.5 minutes.

[0048] The higher the improvement rate of lactic acid stinging, the better the repair effect of the sample, and the more suitable the product is for people with sensitive skin.

[0049] The results of the improvement rate of lactic acid stinging are shown in Table 5. The improvement rate of lactic acid stinging in the blank application examples was only 12.6%, while the improvement rate of lactic acid stinging in application examples 1-5 provided by the present invention reached 60.1%-73.2%, indicating that the skin repair effect of the emulsion provided by the present invention is significant and suitable for people with sensitive skin. At the same time, comparing the data of application examples 1-9 with application example 1, it can be seen that the combination of Porphyromonas auricula-judae extract, flaxseed extract, senna glycoside, and oat extract within a certain range can synergistically improve the skin repair effect of the resulting composition, making it more suitable for people with sensitive skin.

[0050] Table 5 Results of the test for suitability for sensitive skin Group Improvement rate of lactic acid stinging (%) Application Example 1 73.2 Application Example 2 60.1 Application Example 3 62.2 Application Example 4 67.8 Application Example 5 70.4 Comparative Application Example 1 36.2 Comparative Application Example 2 40.5 Comparative Application Example 3 37.8 Comparative Application Example 4 34.6 Comparative Application Example 5 42.3 Comparative Application Example 6 43.8 Comparative Application Example 7 45.4 Comparative Application Example 8 43.1 Comparative Application Example 5 46.7 Blank application example 12.6 Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A composition, characterized in that, It includes extracts of *Porphyra yezoensis*, flaxseed, senna glycoside, and oat extract in a weight ratio of 0.05-1:0.1-1:0.1-1:0.1-2.

2. The composition according to claim 1, characterized in that, It includes extracts of *Porphyra yezoensis*, flaxseed, senna glycosides, and oat extract in a weight ratio of 0.1-0.5:0.2-0.5:0.2-0.5:0.2-1.

3. The use of the composition according to claim 1 or 2 in the preparation of cosmetics with lipid barrier repair function.

4. The application as described in claim 3, characterized in that, The cosmetics include one of the following: toner, lotion, cream, mask, or spray.

5. The application as described in claim 4, characterized in that, The cosmetic product is an emulsion.

6. The application as described in claim 3, characterized in that, The composition accounts for 2%-8% by weight in the cosmetic.

7. A cosmetic product, characterized in that, Containing 2wt%-8wt% of the composition according to claim 1 or 2.

8. The cosmetic product as described in claim 7, characterized in that, It also contains excipients acceptable in the cosmetics industry.

9. An emulsion, characterized in that, The raw materials contain the following weight percentages: 2%-8% of the composition according to claim 1 or 2, 0.01%-1% thickener, 1%-10% moisturizer, 0.1%-6% emulsifier, 1%-15% skin moisturizer, 0.01%-0.5% pH adjuster, 0.1%-4% antioxidant, and the balance being deionized water.

10. The emulsion as described in claim 9, characterized in that, The method for preparing the emulsion includes the following steps: S1. Mix and stir a portion of the humectant, thickener and deionized water, heat to 75-85℃, homogenize at 6000-7000 r / min for 3-8 min, keep warm after homogenization, and obtain the pre-prepared phase A; S2. Mix the emollient and emulsifier, heat to 75-85℃, homogenize at 6000-7000 r / min for 3-8 min, keep warm after homogenization, and obtain the pre-prepared phase B; S3. Mix the antioxidant and the remaining humectant, heat to 60°C to melt, and obtain the pre-prepared phase C; S4. Heat the pre-prepared phase A to 80°C, add the pre-prepared phase B, homogenize at 7500-8500 r / min for 3 min, cool to 50°C, add the pre-prepared phase C at 250-400 r / min and stir to mix, cool to below 45°C and add the composition, continue stirring, add pH adjuster to adjust pH, stop stirring to obtain emulsion.