Nucleic acid aptamers, biosensors and their applications

By obtaining nucleic acid aptamers targeting the ADAR1 protein through in vitro screening, a dual-lock protein biosensor was constructed, solving the challenges of ADAR1 protein imaging and drug evaluation, and achieving high-sensitivity and specific detection as well as live-cell imaging.

CN122303244APending Publication Date: 2026-06-30NORTHEAST NORMAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610456411.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-08
Publication Date
2026-06-30

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention relates to the fields of biotechnology and medicine, and particularly to nucleic acid aptamers, biosensors, and their applications. The invention provides nucleic acid aptamers having nucleotide sequences as shown in any of SEQ ID NO:1 to SEQ ID NO:14. The invention utilizes in vitro screening technology to screen nucleic acid aptamers, ultimately obtaining nucleic acid aptamers that target and bind to the ADAR1 protein. Subsequently, based on the nucleic acid aptamers as target protein recognition elements, a dual-signal protein biosensor with input and output signals is constructed, enabling in vitro detection of target proteins and imaging of native proteins in live cells. Finally, the imaging technology is applied to drug evaluation and screening of proteins.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of biotechnology and medicine, and in particular to nucleic acid aptamers, biosensors and their applications. Background Technology

[0002] RNA adenosine deaminases (ADARs) are RNA editing enzymes that can edit adenosine (A) into inosine (I). Dysregulation of ADAR1 expression has been shown to be closely related to various human diseases. It can be strongly induced under pathological conditions such as interferon, viral infection, and the tumor microenvironment. Through its multiple functions, including RNA editing, immune regulation, and viral interaction, ADAR1 is widely involved in the development and progression of the nervous system, immune system, tumors, and infectious diseases, making it an emerging target for drug development. However, currently, there is a lack of small molecules that target and bind to ADAR1.

[0003] Nucleic acid aptamers, also known as chemical antibodies, have been developed to date. Many aptamers have been created targeting a wide range of targets, including proteins, small metal ions, peptides, cells, viruses, and bacteria. Aptamers can contain targets with different functional groups, distinguishing closely related molecules such as conformational isomers and even amino acid mutations. Compared to the specific binding requirements of small molecule ligands, nucleic acid aptamers have virtually no specific requirements for their targets. Therefore, nucleic acid aptamers, as a chemical biology tool, show great advantages in overcoming the challenge of ligand scarcity at target sites. Currently, no nucleic acid aptamers targeting the ADAR1 protein have been reported.

[0004] Furthermore, the study of protein function is closely related to its location and abundance. Currently, protein imaging techniques generally employ the method of overexpressing fusion proteins, such as fusion proteins of target proteins and fluorescent proteins. However, overexpression of ADAR1 can lead to severe off-target RNA editing. Therefore, the imaging method of overexpressing fusion proteins is not suitable for the presentation of endogenous natural proteins. Currently, there is a lack of imaging techniques for endogenous natural proteins in living cells. Summary of the Invention

[0005] In view of this, the present invention provides nucleic acid aptamers, biosensors, and their applications. The present invention utilizes in vitro screening technology to screen nucleic acid aptamers, ultimately obtaining nucleic acid aptamers that target and bind to the ADAR1 protein. Subsequently, based on the nucleic acid aptamers as target protein recognition elements, a dual-signal protein biosensor with input and output signals is constructed, realizing in vitro detection of target proteins and imaging of native proteins in living cells. Finally, the imaging technology is applied to drug evaluation and screening of proteins.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a nucleic acid aptamer having: (1) A nucleotide sequence as shown in any of SEQ ID NO:1 to SEQ ID NO:14; or (2) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (1), and which has the same or similar function as the nucleotide sequence shown in (1); or (3) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2).

[0007] In some embodiments of the present invention, the sequences of the above-mentioned nucleic acid aptamers are as shown in SEQ ID NO:4 and any of SEQ ID NO:11 to SEQ ID NO:14.

[0008] In some embodiments of the present invention, the truncated sequence in the above-described nucleic acid aptamer is as shown in SEQ ID NO:13.

[0009] In some embodiments of the present invention, the above-mentioned nucleic acid aptamers are obtained by modification; the modification is one or more of phosphorylation, methylation, amination, thiolation, substitution of oxygen with sulfur, substitution of oxygen with selenium, and isotopization.

[0010] The present invention also provides conjugates or derivatives of nucleic acid aptamers, wherein the conjugates or derivatives are obtained by linking the above-mentioned nucleic acid aptamers with a marker; the marker includes one or more of the following: radioactive substances, therapeutic substances, biotinylated substances, enzyme-labeled substances, fluorescein-labeled substances, nucleic acid probes, nanoluminescent materials, small peptides, and siRNA.

[0011] The present invention also provides a biosensor comprising: the above-described nucleic acid aptamer and / or the above-described conjugate or derivative.

[0012] In some embodiments of the present invention, the above-mentioned biosensor, from the 5' end to the 3' end, sequentially includes: an output signal right-locking module, a sensing module, a first fluorescent aptamer module, an output signal left-locking module, an input signal lock module, and a second fluorescent aptamer module; The sensing module and the input signal lock module are partially complementary; The output signal right-lock module and the second fluorescent aptamer module are partially complementary; The output signal left-locking module and the first fluorescent aptamer module are partially complementary; The sensing module is the nucleic acid aptamer or its conjugate or derivative.

[0013] In some embodiments of the present invention, in the above-mentioned biosensor, the base length of the left locking module and the right locking module is not less than 4 nt.

[0014] In some embodiments of the present invention, the base lengths of the left locking module and the right locking module in the above-described biosensor are 4 nt.

[0015] In some embodiments of the present invention, in the above-mentioned biosensor, the sequence of the left locking module from the 5' end to the 3' end is: UGCC; and the sequence of the right locking module from the 5' end to the 3' end is: CCGU.

[0016] In some embodiments of the present invention, the first fluorescent aptamer module and the second fluorescent aptamer module in the above-described biosensor may be the same or different.

[0017] The present invention also provides a ring-shaped biosensor, comprising: the above-described biosensor and a ring-shaped element.

[0018] The present invention also provides the application of the above-mentioned nucleic acid aptamers, the above-mentioned conjugates or derivatives, the above-mentioned biosensors and / or the above-mentioned ring biosensors in any of the following: (a) Purify ADAR1 protein; (b) Labeling the ADAR1 protein; (c) Imaging of the ADAR1 protein; (d) Quantitative or qualitative detection of ADAR1 protein; (e) Gene editing; (f) Inhibitors and / or degraders of the ADAR1 protein; (g) Products for screening and / or evaluating the efficacy of drugs targeting the ADAR1 protein; (h) Prepare products for the diagnosis and / or detection of ADAR1 protein; (i) Prepare drugs and / or drug combinations for the treatment of ADAR1 protein-related diseases.

[0019] In some embodiments of the present invention, the gene editing described above includes: RNA single-base editing.

[0020] The present invention also provides detection products, including: the above-mentioned nucleic acid aptamers, the above-mentioned conjugates or derivatives, the above-mentioned biosensors and / or the above-mentioned ring biosensors, as well as acceptable adjuvants, carriers and / or devices.

[0021] In some embodiments of the present invention, the above-mentioned detection products include: detection reagents and / or detection kits.

[0022] The present invention also provides a drug or combination of drugs, comprising: the above-described nucleic acid aptamers, the above-described conjugates or derivatives, the above-described biosensors and / or the above-described cyclic biosensors, and pharmaceutically acceptable excipients.

[0023] This invention utilizes in vitro screening technology to screen nucleic acid aptamers, ultimately obtaining nucleic acid aptamers that target and bind to the ADAR1 protein. Subsequently, based on the nucleic acid aptamers as target protein recognition elements, a dual-lock protein biosensor with input and output signals was constructed, realizing in vitro detection of target proteins and imaging of natural proteins in living cells. Finally, the imaging technology was applied to the drug evaluation and screening of proteins. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0025] Figure 1 Demonstrates the binding ability of candidate sequences of RNA aptamers that target and bind to the ADAR1 protein; Figure 2 This study evaluates the binding affinity of the A-Apt4 modified sequence to the ADAR1 protein. Figure 3 The affinity of the nucleic acid aptamer to the ADAR1 protein is shown; where: a is the affinity of A-Apt4 to the ADAR1 protein; b is the affinity of A-Apt4-3 to the ADAR1 protein; and c is the affinity of the R / G motif to the ADAR1 protein. Figure 4 The following data were used to verify the specificity of the binding of the nucleic acid aptamer to ADAR1: a) ELISA results of the binding ability of 100 nM biotin-modified A-Apt4-3 to different proteins (all protein amounts were 100 ng); b) relative expression levels of ADAR1 protein in different cells (based on A549); c) ELISA results of the binding of 100 nM biotin-modified A-Apt4-3 to different cell lysates; d) mRNA level detection after ADAR1 overexpression (ADAR-OE) in 293T cells; e) protein level detection; f) ELISA results of 100 nM biotin-modified A-Apt4-3 to 239T cell lysates (293T) and 239T (ADAR-OE) cell lysates overexpressing ADAR1. Figure 5 A schematic diagram illustrating the design principle of a dual-lock protein biosensor that shows input and output signals; Figure 6This diagram illustrates the sensitivity and specificity of a dual-lock protein biosensor for in vitro protein detection, evaluating both input and output signals. Specifically: ab represents the optimization of the left and right lock lengths of the output signal; c represents the optimization of the input signal lock length; d shows the spectral scanning results of Step (250 nM, in vitro transcribed RNA) for detecting the target protein ADAR1; e shows the linear correlation analysis between fluorescence intensity and the logarithm of the target protein ADAR1 concentration, with the figure showing the linear analysis results between fluorescence values ​​in the low concentration range of 10 pM-5 nM and the logarithm of the target RNA concentration; f shows the specific fluorescence detection results of Step for detecting the ADAR1 target in total protein. Figure 7 This demonstrates the ability of a dual-lock protein biosensor to detect proteins in complex biological samples, evaluating both input and output signals. Specifically: a) shows the fluorescence spectral scanning results of Step in detecting different concentrations of the target protein ADAR1 in HEK-293T cell lysates; b) shows the linear relationship between the Step fluorescence signal intensity and the logarithmic value of ADAR1 concentration in HEK-293T cell lysates. Figure 8 This study demonstrates the imaging capability of a dual-lock protein biosensor for endogenous ADAR1 protein in live cells, assessing both input and output signals. Specifically: a) laser confocal imaging results of HeLa cells transfected with a circular protein biosensor plasmid treated with shp150-1 / 2 (reduced ADAR1) and overexpression (increased ADAR1, OE p150); mut-circStep: mutated circStep (no imaging capability); scramble: shRNA without knockdown capability; p150: ADAR1; b) Western blot analysis of ADAR1 protein levels in HeLa cells with ADAR1 knockdown and overexpression; c) fluorescence from flow cytometry quantification plot a; d) correlation analysis between Western blot quantification results and flow cytometry fluorescence signals in HeLa cells with ADAR1 knockdown and overexpression, with the x-axis representing Western blot quantification results and the y-axis representing fluorescence signal intensity; e) comparison of circStep and IF imaging for target protein localization in live cells. Figure 9This study demonstrates the imaging capability of a dual-lock protein biosensor for endogenous NF-κB protein in living cells, evaluating both input and output signals. Specifically: a) laser confocal imaging results of HeLa cells transfected with a circular protein biosensor plasmid treated with shNF-κB (shRNA knocking down NF-κB); b) fluorescence from flow cytometry quantification plot a; c) correlation analysis between Western blot quantification results and flow cytometry fluorescence signals in HeLa cells treated with different methods, where shNF-κB represents shRNA knocking down NF-κB, and scramble represents shRNA without knockdown capability (as a control). The x-axis represents Western blot quantification results, and the y-axis represents fluorescence signal intensity; d) a comparison of circStep and IF imaging for target protein localization in living cells. Figure 10 This paper illustrates the application of a dual-lock protein biosensor for evaluating input and output signals in drug evaluation and screening. Specifically: a) compares the imaging of NF-κB protein localization in live cells treated with different concentrations of TNF-α using circStep; b and c) show the nucleocytoplasmic changes of NF-κB protein in HeLa cells treated with different drugs using Western blot analysis; d) shows the quantitative fluorescence results of the nucleocytoplasmic fluorescence in Figure a; e) shows the correlation analysis between Western blot quantitative results and fluorescence signals of NF-κB protein in HeLa cells treated with different drugs, with the horizontal axis representing the Western blot quantitative results and the vertical axis representing the fluorescence signal intensity; f) analyzes the effective drug concentrations that promote NF-κB nucleus translocation using both Western blot and fluorescence quantitative results. Detailed Implementation

[0026] This invention discloses nucleic acid aptamers, biosensors, and their applications.

[0027] It should be understood that the expression “one or more of…” individually includes each of the objects described after the expression, as well as various different combinations of two or more of the described objects, unless otherwise understood from the context and usage. The expression “and / or” combined with three or more described objects should be understood to have the same meaning, unless otherwise understood from the context.

[0028] The terms “including,” “having,” or “containing,” including the use of their grammatical synonyms, should generally be understood as open-ended and non-restrictive, for example, not excluding other unstated elements or steps, unless otherwise specifically stated or understood from the context.

[0029] It should be understood that the order of the steps or the order in which certain actions are performed is not important as long as the invention remains operational. Furthermore, two or more steps or actions can be performed simultaneously.

[0030] The use of any and all instances or exemplary language such as “e.g.” or “including” in this document is merely intended to better illustrate the invention and is not intended to limit the scope of the invention unless the claims are made. No language in this specification should be construed as indicating that any unclaimed element is essential to the practice of the invention.

[0031] Furthermore, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as precisely as possible. However, any value inevitably contains standard deviations due to individual test methods. Therefore, unless explicitly stated otherwise, it should be understood that all ranges, quantities, values, and percentages used in this disclosure are modified with the word "approximately". Here, "approximately" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specific value or range.

[0032] On the one hand, the present invention provides a nucleic acid aptamer that targets and binds to the ADAR1 protein.

[0033] The nucleic acid aptamer was obtained through in vitro screening and has the nucleotide sequence shown in SEQ ID NO:4, SEQ ID NO:11 to SEQ ID NO:14. The nucleic acid aptamer exhibits high affinity and high specificity for the ADAR1 protein.

[0034] A-Apt4 (Seq ID No: 4):5'-GAGGACGAUGCGGCACUGGUCGUUCUUCCCCCCGAAACACAGUGCUGUGGCCCGAGACA-3'; A-Apt4-3 (Seq ID No:13): 5'-CACUGGUCGUUCUUCCCCCCGAAACACAGUG-3'; A-Apt4-1 (Seq ID No:11): 5'-GGACGAUGCGGCACUGGUCGUUCUUCCCCCCGAAACACAGUGCUGUGGCCC-3'; A-Apt4-2 (Seq ID No:12): 5'-GCGGCACUGGUCGUUCUUCCCCCCGAAACACAGUGCUGU-3'; A-Apt4-4 (Seq ID No:14): 5'-CUGGUCGUUCUUCCCCCCGAAACACAG-3'.

[0035] This invention also provides the application of the above-mentioned nucleic acid aptamers in any of the following: (1) Isolate and purify ADAR1 protein; (2) Label ADAR1 protein; (3) Image ADAR1 protein; (4) Quantitatively or qualitatively detect ADAR1 protein; (5) Prepare gene editing technology; (6) Prepare inhibitors of ADAR1 protein; (7) Prepare reagents or drugs targeting ADAR1 protein; (8) Prepare PROTAC degrading agent for ADAR1 protein; (9) Prepare reagents or drugs for the diagnosis and treatment of ADAR1 protein-related diseases; (10) Prepare kits for the detection, imaging, diagnosis and treatment of ADAR1 protein-related diseases.

[0036] On the one hand, the present invention provides a biosensor for monitoring natural proteins in living cells.

[0037] From the 5' end to the 3' end, it includes, in sequence: an output signal right-lock module, a nucleic acid aptamer sensing module, a first fluorescent aptamer module, an output signal left-lock module, an input signal lock module, and a second fluorescent aptamer module; The nucleic acid aptamer sensing module and the input signal lock module are partially complementary; The output signal right-lock module and the second fluorescent aptamer module are partially complementary; The output signal left-locking module and the first fluorescent aptamer module are partially complementary.

[0038] The base length of the output signal locking module and the input signal right locking module is not less than 2nt.

[0039] In some embodiments of the present invention, in the above-mentioned protein biosensor, the base length of the left locking module is 3-7 nt; the base length of the right locking module is 3-5 nt; and the base length of the input signal locking module is 12-16 nt. The present invention also provides a ring-shaped input and output signal dual-locked protein biosensor, comprising: the above-mentioned input and output signal dual-locked protein biosensor and cyclization element.

[0040] The present invention also provides the application of the above-described biosensor and / or the above-described ring-shaped biosensor in any of the following: (I) Protein detection; and / or (II) Drug screening; and / or (III) Drug efficacy evaluation; and / or (IV) Preparation of products for drug screening and / or drug efficacy evaluation; and / or (V) Protein imaging; and / or (VI) Preparation of products for diagnosing and / or treating protein-related diseases; and / or (VII) Preparation of products for studying protein function.

[0041] The present invention also provides a method for detecting proteins, wherein the above-mentioned biosensor and / or the above-mentioned ring biosensor are mixed with a detection target and a fluorescent dye for detection.

[0042] In some embodiments of the present invention, in the above detection method, when the target protein binds to the nucleic acid aptamer sensing module, the first fluorescent aptamer module and the second fluorescent aptamer module bind to the fluorescent dye to generate fluorescence.

[0043] The present invention also provides products comprising: a dual-lock protein biosensor for input and output signals and / or a ring-shaped dual-lock protein biosensor for input and output signals.

[0044] In Examples 1 to 10 of this invention, all raw materials and reagents used can be purchased from the market.

[0045] The present invention will be further illustrated below with reference to the embodiments: Example 1: Screening of ADAR1 aptamers and verification of candidate aptamer sequences The screening process used in this invention utilizes the physical adsorption of proteins by microplates to maximize the protection of ADAR1 protein activity. Free RNA oligonucleotide libraries are then incubated with immobilized ADAR1 protein. By continuously increasing the screening pressure (including decreasing the RNA oligonucleotide library concentration (500 nM~50 nM), increasing the Tween-20 concentration in the washing buffer (0.005%~1%), and decreasing the ADAR1 protein coating amount (1000 ng~250 ng), sequences with weak affinity for ADAR1 protein are removed. After 12 rounds of exponential enrichment, 10 candidate nucleic acid aptamers with high affinity for ADAR1 protein were successfully screened and named A-Apt1 to A-Apt-10. Subsequently, the binding affinity of the ten candidate sequences to ADAR1 protein was compared using ELISA experiments. The results showed that A-Apt4 had the strongest binding affinity to ADAR1 (…). Figure 1 ).

[0046] The sequence information: A-Apt1: UAAUACGACUCACUAUAGGGAGGACGAUGCGG CACUGGUCGUUCUUCCCCCCGAAACACAG UGC UGU GGC CCG AGA CA (as shown in SEQ ID NO: 1).

[0047] A-Apt2: UAAUACGACUCACUAUAGGGAGGACGAUGCGGGAGGGAUGGGUGGUGGUCGUCCUUGACAGUGC UGU GGC CCG AGA CA (as shown in SEQ ID NO:2).

[0048] A-Apt3: UAAUACGACUCACUAUAGGGAGGACGAUGCGG AAGGGAGGAGGAUAGGCAUCGCGGACCCAG UGC UGU GGC CCG AGA CA (as shown in SEQ ID NO:3).

[0049] A-Apt4: GAGGACGAUGCGGCACUGGUCGUUCUUCCCCCCGAAACACAGUGCUGUGGCCCGAGACA (as shown in SEQ ID NO:4).

[0050] A-Apt5: UAAUACGACUCACUAUAGGGAGGACGAUGCGGAGGUGGGAGGAAGGGGACUCGUCCU CAGUGC UGU GGC CCG AGA CA (as shown in SEQ ID NO:5).

[0051] A-Apt6: UAAUACGACUCACUAUAGGGAGGACGAUGCGG AGGGUGAGUGGUGGGCGUCCUUGA CAGUGC UGU GGC CCG AGA CA (as shown in SEQ ID NO:6).

[0052] A-Apt7: UAAUACGACUCACUAUAGGGAGGACGAUGCGGUUGGGUGGGUGGUGGGCGUCCUUCGCACAG UGC UGU GGC CCG AGA CA (as shown in SEQ ID NO:7).

[0053] A-Apt8: UAAUACGACUCACUAUAGGGAGGACGAUGCGG CACUGGUCGUUCUUCCCCCCCGAAACACAG UGC UGU GGC CCG AGA CA (as shown in SEQ ID NO:8).

[0054] A-Apt9: UAAUACGACUCACUAUAGGGAGGACGAUGCGGACGGGAGGGAGGAUAGGCAUCGCGGACCCAG UGC UGU GGC CCG AGA CA (as shown in SEQ ID NO: 9).

[0055] A-Apt10: UAAUACGACUCACUAUAGGGAGGACGAUGCGGAGGUGGGAGGAAGGGGGAAUCGUCCACAG UGC UGU GGC CCG AGA CA (as shown in SEQ ID NO: 10).

[0056] Example 2: Evaluation of the binding affinity of the A-Apt4-modified sequence to the ADAR1 protein.

[0057] This invention analyzes the secondary structure of the A-Apt4 sequence and optimizes it by cleaving, resulting in a series of cleaved sequences. Subsequently, ELISA experiments were used to compare the binding of these cleaved sequences to the ADAR1 protein. Cleavages 1-4 all showed binding ability to ADAR1, with A-Apt4-3 exhibiting the highest binding ability (e.g., ...). Figure 2 (As shown).

[0058] The sequence information: A-Apt4-3 (Seq ID No:13): 5'-CACUGGUCGUUCUUCCCCCCGAAACACAGUG-3'; A-Apt4-1 (Seq ID No:11): 5'-GGACGAUGCGGCACUGGUCGUUCUUCCCCCCGAAACACAGUGCUGUGGCCC-3'; A-Apt4-2 (Seq ID No:12): 5'-GCGGCACUGGUCGUUCUUCCCCCCGAAACACAGUGCUGU-3'; A-Apt4-4 (Seq ID No:14): 5'-CUGGUCGUUCUUCCCCCCGAAACACAG-3'.

[0059] Example 3: Investigating the affinity between nucleic acid aptamers and ADAR1 protein

[0060] The affinity constant (KD value) is a direct indicator of the binding ability between molecules. A smaller KD value indicates a lower concentration required for saturation, meaning a higher affinity between the molecules. To determine the affinity constants of A-Apt4 and A-Apt4-3 with ADAR1 protein, this invention uses the Pall forteBio Octet K2 molecular interaction system to measure the KD value of A-Apt-4. Biotin-labeled nucleic acid aptamers were immobilized on a biosensor, and ADAR1 protein was used as the analyte. After immobilization, binding, and dissociation steps, the changes in light absorbance received by the sensor were converted into corresponding rates. The calculated KD values ​​for the affinity between A-Apt4 and A-Apt4-3 with ADAR1 protein were 64.77 nM and 62.19 nM, respectively. Figure 3 The KD value of A-Apt4 and A-Apt4-3 is better than that of the RNA motif (R / G) that binds to ADAR1, which is 204.50 nM, indicating that A-Apt4 and A-Apt4-3 have a high affinity for ADAR1 protein.

[0061] The sequence information: R / G (Seq ID No: 15):5'-GGUGUCGAGA AGAGGAGAACAAUAUGCUAAAUGUUGUUCUCGUCUCCUCGACACC-3'.

[0062] Example 4: Investigating the specificity of nucleic acid aptamer binding to ADAR1 protein

[0063] The binding affinity of 100 nM A-Apt4-3 to several common proteins, including intracellular, membrane, and extracellular proteins, was detected using an ELISA assay. The results showed that A-Apt4-3 bound only to ADAR1 with high affinity, and did not bind to BSA, IgG, PD-L1, PD-1, LAG-3, or PDGFBB proteins. Figure 4 (a).

[0064] To further verify the specificity of aptamer binding to intracellular ADAR1 protein, several cell lines with different ADAR1 expression levels were used. Real-time quantitative PCR was used to obtain the relative expression levels of ADAR1 in these cell lines. Figure 4 (b). ELISA experiments using different cell lysis buffers showed that the binding ability of A-Apt4-3 to different cell lysis buffers was consistent with the detected cellular ADAR1 expression level. Figure 4(c). Meanwhile, because ADAR1 expression levels are generally higher in cancer cells than in normal cells, the 293T cell line had the lowest ADAR1 expression among the selected cell lines. After overexpressing ADAR1 protein in 293T cells, the overexpression level was detected at both the mRNA and protein levels. Figure 4 (d and e). After confirming successful overexpression, a binding ELISA experiment was performed using cell lysate overexpressing ADAR1 and A-Apt4-3. The results showed a significant increase in the binding of A-Apt4-3 to the ADAR1 overexpressing cell lysate. Figure 4 (f). These results fully demonstrate that the binding of A-Apt4-3 to the ADAR1 protein has high specificity.

[0065] Example 5: Design of a dual-lock protein biosensor for input and output signals

[0066] Currently, various fluorescent RNA aptamers have been reported, including Pepper, Broccoli, Corn, Mango, Spinach, and Clivia. This invention selects Pepper as an example of a dual-lock protein biosensor. Different fluorescent reporter elements only require the selection of different fluorescent RNA aptamers, such as... Figure 5 As shown, it consists of four modules: (1) a nucleic acid aptamer sensing module: this part is screened and designed according to the target protein to specifically identify the target protein; (2) two fluorescent RNA aptamer modules: as fluorescent reporter elements, this embodiment takes the fluorescent RNA aptamer Pepper as an example; (3) an output signal double-lock module, which is complementary to some fluorescent RNA aptamers and presents two stem-like conformations to block the fluorescent RNA aptamers. Here, certain optimization is required depending on the target; (4) an input signal lock module: a sequence that is partially complementary to the nucleic acid aptamer sensing module to maintain the closed state of the nucleic acid aptamer sensing module. The specific combination order of the above four modules is as follows: 5'-output signal right lock + nucleic acid aptamer sensing module + fluorescent RNA aptamer + output signal left lock + input signal lock module + fluorescent RNA aptamer - 3'.

[0067] In the absence of the target protein, the nucleic acid aptamer sensing module and the fluorescent RNA aptamer are locked by the input signal lock and output signal lock modules, respectively, and are in an inactive conformation. When the target protein is present, the target protein binds to the nucleic acid aptamer sensing module, mediating the conformational switch of the nucleic acid aptamer sensing module, releasing the two locked fluorescent RNA aptamers, which refold into an active conformation, bind to dyes to produce fluorescence (these dyes only "illuminate" when they bind to correctly folded fluorescent RNA aptamers), enabling highly sensitive and specific detection of proteins in vitro and imaging of proteins in living cells, including precise quantification of protein localization and abundance, and dynamic monitoring of movement.

[0068] Example 6: Evaluation of the sensitivity and specificity of a dual-lock protein biosensor for in vitro protein detection using input and output signals.

[0069] ADAR1 was selected as the target, and a corresponding dual-lock protein biosensor, Step, was designed. The dual-lock lengths of Step's output signal lock and input signal lock were then optimized through screening (e.g., ...). Figure 6 As shown in the diagram (ac), Step (L4-R4-IL55), which has the best signal-to-noise ratio, was selected to evaluate its sensitivity and specificity for target protein detection in vitro. First, Step (in vitro transcribed RNA) was used to detect the target protein ADAR1 at different concentration gradients. The results showed that fluorescence gradually increased with increasing target concentration (e.g., as shown in the diagram). Figure 6 As shown in d), and there is a good linear relationship between the fluorescence signal intensity and the logarithm of the target concentration (e.g., Figure 6 As shown in e), it can still be detected at a concentration of 1 pM, indicating that Step has good sensitivity for in vitro protein detection.

[0070] To evaluate the specificity of Step for detecting proteins in vitro, analysis was performed using HEK-293T cell lysis buffer. Step was incubated with total protein from HEK-293T cells (overexpressing and not expressing ADAR1 mRNA), and fluorescence was detected. Figure 6 The results showed that the cell group that did not express Survivin was basically the same as the negative control group, while the fluorescence intensity of the cell group that overexpressed ADAR1 mRNA (ADAR1-OE) was significantly higher than that of the cell group that did not express ADAR1 mRNA. Furthermore, Step showed a gradually increasing fluorescence signal with increasing mass of total ADAR1-OE protein, exhibiting a dose-dependent effect, indicating that Step has high specificity for the detection of target proteins in vitro.

[0071] The sequence information: Step of ADAR1 (L4-R4-IL55) (SEQ ID No:16): 5'- UGCC CACUGGUCGUUCUUCCCCGAAACACAGUG ggcacuggcgcugcgccuucgggcgccaaucguagcgugucggcc UGCC CACUGAUCAGUGggcacuggcgcugcgccuucgggcgccaaucguagcgugucggcc-3'; (The underlined and bolded parts represent the right lock of the output signal, the bolded italic parts represent the nucleic acid aptamer sensing module (i.e., A-Apt4-3), the underlined parts represent the left lock of the output signal, the bolded parts represent the input signal lock, and the lowercase letters represent the fluorescent RNA aptamer).

[0072] Example 7: Evaluation of the ability of a dual-lock protein biosensor with input and output signals to detect proteins in complex biological samples.

[0073] To evaluate the applicability of Step in detecting complex biological samples, HEK-293T cell lysates were selected as the test substrate, and different concentrations of ADAR1 protein were added to them for detection and analysis using Step. The results showed a positive correlation between fluorescence intensity and ADAR1 concentration (e.g., ...). Figure 7 a and Figure 7 (b). Furthermore, based on the fluorescence signals of target RNA at different concentrations, the corresponding concentrations of ADAR1 were calculated by substituting them into the obtained linear regression equation. The calculated spiked recovery rate ranged from 84% to 108% (Table 1), indicating that Step can quantitatively detect the concentration of target proteins in cell lysates with good specificity and is not affected by other intracellular substances.

[0074] Table 1. Recovery rate assay of ADA protein in HEK-293T cell lysates

[0075] Example 8: Evaluation of the imaging capability of a dual-lock protein biosensor with input and output signals for endogenous ADAR1 protein in living cells.

[0076] To achieve imaging of native proteins in living cells using Step, the stability of the dual-locked protein biosensor first needs to be addressed. Therefore, this invention introduces the "Tornado" system, connecting the dual-locked protein biosensor to an F30 RNA scaffold and a Twister ribozyme to construct a circular input and output signal dual-locked protein biosensor (circStep). A plasmid expressing circStep was constructed, transfected into cells, and the imaging capability of circStep for native ADAR1 protein in living cells was evaluated. Results are as follows: Figure 8 a and Figure 8 As shown in b, in cells treated with shRNA to reduce ADAR1 protein and those overexpressing ADAR1, changes in fluorescence intensity were positively correlated with changes in ADAR1 protein levels. To verify the accuracy of the results, Western blot was used to quantify ADAR1 protein in cells, showing the same trend. Furthermore, a comparison between the Western blot quantification results and the fluorescence quantification results from flow cytometry revealed a high correlation between the two (e.g., ...). Figure 8 c and Figure 8 As shown in d), this demonstrates the accuracy of circStep's quantitative imaging results of ADAR1 protein in cells.

[0077] To further verify the accuracy of protein localization, immunofluorescence (IF) assays were used as positive control assays, such as... Figure 8 As shown in Figure e, the red fluorescence signal of the cy3-labeled ADAR1 antibody and the green fluorescence signal of circStep exhibit high colocalization, indicating that circStep has good accuracy in imaging native proteins in live cells.

[0078] The sequence information: ADAR1's circStep (SEQ ID No:17): 5'-GCCAUCAGUCGCCGGUCCCAAGCCCGGAUAAAAUGGGAGGGGGCGGGAAACCGCCU AACCAUGCC GACUGAUGGCAG UUGCCAUGUGUAUGUGGGUUGGCCCACAUACUCUGAUGAUCC ugcccacuggucguucuuccccccgaaacacagugggcacuggcgcugcgccuucgggcgccaaucguagcgugucggccugcccacugaucagugggcacuggcgcugcgccuucgggcgccaaucguagcgugucggcc GGAUCAUUCAUGGCAA CUGCCAUCAGUCGGCGU GGACUGUAG AACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGUACAGUCCACGC-3'; (The bold and underlined parts represent Twister's Tornado System, the italic parts represent the F30 support, and the lowercase parts represent its Step.)

[0079] Example 9: Evaluation of the imaging capability of a dual-lock protein biosensor with input and output signals for endogenous NF-κB protein in living cells.

[0080] To evaluate the universality of a dual-lock protein biosensor with circular input and output signals, NF-κB protein was selected as the target, and the corresponding circStep was constructed. A plasmid expressing circStep was constructed, cells were transfected, and the imaging ability of circStep on native NF-κB protein in live cells was evaluated. Results are as follows: Figure 9As shown in Figure a, the cellular fluorescence intensity decreased with decreasing shRNA levels and NF-κB levels. Quantification of NF-κB protein in cells using Western blot showed the same trend. Furthermore, a comparison between the Western blot quantification results and the flow cytometry fluorescence quantification results revealed a high correlation between the two (e.g., ...). Figure 9 b and Figure 9 As shown in c), this demonstrates the accuracy of circStep's quantitative imaging results of NF-κB protein in cells.

[0081] To further verify the accuracy of protein localization, immunofluorescence (IF) assays were used as positive control assays, such as... Figure 9 As shown in Figure d, the red fluorescence signal of the cy3-labeled NF-κB antibody and the green fluorescence signal of circStep exhibit high colocalization. Furthermore, cell treatment with TNF-α (inducing NF-κB nuclear translocation) showed good colocalization between immunofluorescence (IF) and circStep, both confirming the NF-κB nuclear translocation results. Therefore, these results demonstrate that circStep has good accuracy and universality for imaging native proteins in live cells.

[0082] The sequence information: Step of NF-κB (SEQ ID No:18): 5'- UGCC AUCGGCCAACCUUAAAACAGUUUCAGGAU ggcacuggcgcugcgccuucgggcgccaaucguagcgugucggcc UGCC AUCCUAUCCGAUggcacuggcgcugcgccuucgggcgccaaucguagcgugucggcc-3'; (The underlined and bolded parts represent the right lock of the output signal, the bolded italic parts represent the nucleic acid aptamer sensing module (the nucleic acid aptamer that binds to NF-κB), the underlined parts represent the left lock of the output signal, the bolded parts represent the input signal lock, and the lowercase letters represent the fluorescent RNA aptamer).

[0083] circStep of NF-κB (SEQ ID No:19): 5'-GCCAUCAGUCGCCGGUCCCAAGCCCGGAUAAAAUGGGAGGGGGCGGGAAACCGCCU AACCAUGCC GACUGAUGGCAG UUGCCAUGUGUAUGUGGGUUGGCCCACAUACUCUGAUGAUCCugccaucggccaaccuuaaaacaguuucaggauggcacuggcgcugcgccuucgggcgccaaucguagcgugucggccugccauccuauccgau GGAU CAUUCAUGGCAA CUGCCAUCAGUCGGCGUGGACUGUAG AACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGUACAGUCCACGC-3'; (The bold and underlined parts represent Twister's Tornado System, the italic parts represent the F30 support, and the lowercase parts represent its Step.)

[0084] Example 10: Application of a dual-lock protein biosensor for evaluating input and output signals in drug evaluation and screening.

[0085] Subcellular protein localization controls protein function. Abnormal protein transport and localization are fundamental to many diseases. Targeting strategies that relocate proteins to the nucleus to eliminate pathogenic phenotypes represent a highly attractive precision medicine strategy. Example 8 of this invention has demonstrated that circStep can monitor NF-κB nuclear translocation; therefore, this invention establishes a high-throughput protein imaging platform in live cells based on circStep to discover nucleocytoplasmic transport regulators, including nuclear import and export of proteins.

[0086] First, TNF-α (a potent NF-κB pathway activator that induces NF-κB nuclear importation) was used as a protein transport regulator to validate the concept of screening compounds to manipulate protein nuclear translocation. Upon TNF-α stimulation, p65 translocated to the nucleus, and TNF-α showed a dose-dependent promotion of nuclear importation (…). Figure 10 As shown in a). Only the nucleocytoplasmic fluorescence ratio changed, while the total cellular fluorescence remained unchanged (as shown in a). Figure 10 (As shown in b). The total fluorescence intensity of the cells is unaffected by the compounds and can serve as a reference for calibrating analyte-independent factors, enabling precise quantification of circStep nuclear fluorescence and eliminating analyte-independent variables such as instrument settings and sensor abundance. Furthermore, to assess the accuracy of circStep, we performed nucleocytoplasmic separation and Western blot analysis (…). Figure 10 c and Figure 10 As shown in d). The results showed that the fluorescence quantification of nuclear NF-κB levels was highly consistent with the results of Western blot analysis (as shown in d). Figure 10 (As shown in e). The calculated IC50 value after 0.5 hours of treatment was approximately 3.71 nM, which is highly consistent with the IC50 value (3.66 nM) of Western blot analysis. Figure 10(as shown in f). These results indicate that circStep can be effectively used to screen drugs that affect protein nuclear translocation.

[0087] The above embodiments focus on how the present invention uses in vitro screening technology to screen nucleic acid aptamers, and finally obtains nucleic acid aptamers that target and bind to ADAR1 protein. Subsequently, based on the nucleic acid aptamers as target protein recognition elements, a dual-lock protein biosensor with input and output signals is constructed, realizing in vitro detection of target proteins and imaging of natural proteins in living cells. Finally, the imaging technology is used in the drug evaluation and screening of proteins.

[0088] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A nucleic acid aptamer that targets and binds to the ADAR1 protein, characterized in that, It has the following characteristics: (1) A nucleotide sequence as shown in any of SEQ ID NO:1 to SEQ ID NO:14; or (2) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence shown in (1), and which has the same or similar function as the nucleotide sequence shown in (1); or (3) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2).

2. The nucleic acid aptamer as described in claim 1, characterized in that, The nucleic acid aptamer is obtained after modification; the modification is one or more of phosphorylation, methylation, amination, thiolation, substitution of oxygen with sulfur, substitution of oxygen with selenium, and isotopization.

3. A conjugate or derivative of a nucleic acid aptamer, characterized in that, The conjugate or derivative is obtained by linking a nucleic acid aptamer to a marker as described in any one of claims 1 to 3; the marker includes one or more of the following: radioactive substances, therapeutic substances, biotinylated substances, enzyme-labeled substances, fluorescein-labeled substances, nucleic acid probes, luminescent nanomaterials, small peptides, and siRNA.

4. A biosensor, characterized in that, include: The nucleic acid aptamer as described in claim 1 or 2 and / or the conjugate or derivative as described in claim 3.

5. The biosensor as described in claim 4, characterized in that, From the 5' end to the 3' end, the module comprises, in sequence: an output signal right-lock module, a sensing module, a first fluorescent aptamer module, an output signal left-lock module, a complementary module input signal lock module, and a second fluorescent aptamer module; the sensing module and the input signal lock module are partially complementary. The output signal right-lock module and the second fluorescent aptamer module are partially complementary; The output signal left-locking module and the first fluorescent aptamer module are partially complementary; The sensing module is the nucleic acid aptamer or its conjugate or derivative.

6. The biosensor as described in claim 5, characterized in that, The base length of the left locking module and the right locking module of the output signal is not less than 4nt.

7. A ring-shaped biosensor, characterized in that, include: The biosensor and cyclization element as described in any one of claims 4 to 6.

8. The use of the nucleic acid aptamer as described in claim 1 or 2, the conjugate or derivative as described in claim 3, the biosensor as described in any one of claims 4 to 6, and / or the ring biosensor as described in claim 7 in any of the following: (a) Purification of ADAR1 protein; (b) Labeling the ADAR1 protein; (c) Imaging of the ADAR1 protein; (d) Quantitative or qualitative detection of ADAR1 protein; (e) Gene editing; (f) Inhibitors and / or degraders of the ADAR1 protein; (g) Products for screening and / or evaluating the efficacy of drugs targeting the ADAR1 protein; (h) Prepare products for the diagnosis and / or detection of ADAR1 protein; (i) Prepare drugs and / or drug combinations for treating ADAR1 protein-related diseases.

9. The product being tested, characterized in that, include: The nucleic acid aptamer as claimed in claim 1 or 2, the conjugate or derivative as claimed in claim 3, the biosensor as claimed in any one of claims 4 to 6, and / or the ring biosensor as claimed in claim 7, as well as acceptable adjuvants, carriers, and / or devices.

10. A drug or combination of drugs, characterized in that, include: The nucleic acid aptamer as described in claim 1 or 2, the conjugate or derivative as described in claim 3, the biosensor as described in any one of claims 4 to 6, and / or the cyclic biosensor as described in claim 7, and pharmaceutically acceptable excipients.