Kit and method for detecting snp sites and applications

By utilizing the specific binding of primers and probes, and employing techniques such as magnetic microspheres and fluorescent labeling, the problems of long detection time, complex operation, and high cost of SNP sites in existing technologies have been solved, achieving efficient and low-cost detection of multiple SNP sites.

CN122303415APending Publication Date: 2026-06-30MGI TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
MGI TECH CO LTD
Filing Date
2024-12-31
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing SNP site detection methods suffer from problems such as long detection time, complex operation, high cost, and limited throughput, making it difficult to achieve efficient simultaneous detection of multiple SNP sites.

Method used

By employing a first detection label with a distinctive morphology to bind probe molecules, and utilizing asymmetric PCR technology and patterned magnetic bead hybridization, efficient detection of multiple SNP sites can be achieved. Through the specific binding of primers and probes, magnetic microspheres and fluorescent labeling techniques are used for differentiation and detection.

Benefits of technology

It achieves efficient detection of multiple SNP sites in a short time, is simple to operate, has high specificity and good repeatability, and can detect more than 50 SNP sites at the same time, reducing detection costs and complexity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303415A_ABST
    Figure CN122303415A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of molecular biology technology, specifically relating to a kit, method, and application for detecting SNP sites. The kit includes: primers, including upstream and downstream primers for amplifying upstream and downstream sequence fragments of the SNP site; probes, including multiple probes that specifically recognize SNP site polymorphisms; multiple different first detection markers, each used to bind to one of the probes; and a second detection marker for binding to the upstream and downstream sequence fragments. By using patterned first detection markers to bind probes for differentiation, a large number of different probes can be mixed in the same reaction well. After the probe captures an amplified fragment containing a specific SNP site, it forms a first detection marker-amplified fragment-second detection marker complex with the second detection marker bound to the amplified fragment. Thus, the genotype of the SNP site can be distinguished based on the combination of the first and second detection markers, ultimately achieving simultaneous and efficient multiplex detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a kit, method, and application for detecting SNP sites. Background Technology

[0002] Single nucleotide polymorphisms (SNPs) are DNA sequence polymorphisms caused by changes in a single nucleotide, such as transitions, transversions, insertions, or deletions, at the genomic level. There are over 3 million SNPs, averaging one SNP per 500-1000 base pairs. SNPs directly cause diseases such as hemophilia and phenylketonuria in humans, and indirectly contribute to many other diseases along with environmental factors, thus determining susceptibility to diseases and differences in drug responses. Therefore, SNPs have significant application research value in molecular diagnostics, clinical testing, forensic medicine, pathogen detection, genetic diseases, and new drug development.

[0003] Currently, the main methods for detecting gene polymorphisms include direct sequencing, microarray hybridization, and fluorescent PCR-Taqman MGB probe genotyping. Direct sequencing is the gold standard for SNP analysis, but it requires expensive sequencers, has high template quantity requirements, is complex, and has a long cycle time. Microarray hybridization is complex, time-consuming, and has low automation. Fluorescent PCR-Taqman MGB probe genotyping has limited throughput due to fluorescence channel limitations, and a single tube of mixture cannot detect multiple genotypes at various sites. Therefore, there is an urgent need to develop a method and corresponding kit that can simultaneously detect multiple SNP sites in a short time. Summary of the Invention

[0004] This invention provides a kit, method, and application for detecting SNP sites, which enables the simultaneous detection of multiple SNP sites in a short time.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] A first aspect of the present invention provides a kit for detecting SNP sites, the kit comprising:

[0007] Primers, the primers comprising an upstream primer and a downstream primer for amplifying a target fragment containing the SNP site;

[0008] The probes include multiple probes that specifically recognize multiple alleles of the SNP site;

[0009] Multiple different first detection markers are used to correspond one-to-one with the multiple probes;

[0010] A second detection marker is used to bind the target fragment.

[0011] In some embodiments of the present invention, the first detection marker includes magnetic microspheres, and different types of magnetic microspheres have different identifiable morphological features.

[0012] In some embodiments of the present invention, the morphological features include patterns on the surface of the magnetic microspheres.

[0013] In some embodiments of the present invention, the upstream primer or the downstream primer has a first binding portion, and the second detection marker has a second binding portion capable of binding with the first binding portion.

[0014] In some embodiments of the present invention, one of the first binding portion and the second binding portion is biotin, and the other is avidin or streptavidin.

[0015] In some embodiments of the present invention, one of the first binding portion and the second binding portion is an antigen, and the other is an antibody.

[0016] In some embodiments of the present invention, the second detection label includes at least one of a fluorescent label, a chemiluminescent label, and a radioactive isotope.

[0017] In some embodiments of the present invention, the working concentration ratio of the upstream primer to the downstream primer is 1:3 to 100.

[0018] In some embodiments of the present invention, the primers and the probes comprise a combination of at least one primer and probe selected from the following A1) to A6):

[0019] A1) The combination of primers and probes for the SNP site numbered rs429358 includes:

[0020] ApoE upstream primer: TGTCCAAGGAGCTGCAGGCGG

[0021] ApoE downstream primer: GTTCCACCAGGGGCCCCAGG

[0022] ApoE 388T probe: ttttttGAGGACGTGtGCGGC, and

[0023] ApoE 388C probe: ttttttGAGGACGTGcGCGGC;

[0024] A2) The combination of primers and probes for the SNP site numbered rs7412 includes:

[0025] ApoE upstream primer: TGTCCAAGGAGCTGCAGGCGG

[0026] ApoE downstream primer: GTTCCACCAGGGGCCCCAGG

[0027] ApoE 526T probe: TGCAGAAGtGCCTGGCA, and

[0028] ApoE 526C probe: TGCAGAAGcGCCTGGCA;

[0029] A3) The combination of primers and probes for the SNP site numbered rs1800566 includes:

[0030] NQO1 upstream primer: CAGGATTTGAATTCGGGCGTCT,

[0031] NQO1 downstream primer: GTGCTTTCTGTATCCTCAGAGTGGC

[0032] NQO1 G probe: aaaGTTGAGgTTCTAAGA, and

[0033] NQO1 A probe: aaaCAGTTGAGaTTCTAAGA;

[0034] A4) The combination of primers and probes for the SNP site numbered rs4880 includes:

[0035] SOD2 upstream primer: TCGGGGAGGCTGTGCTTCT,

[0036] SOD2 downstream primer: TGACCGGGCTGTGCTTTCTCG,

[0037] SOD2 A probe: tttttCCCAAAaCCGGAG, and

[0038] SOD2 G probe: tttttCCCAAAgCCGGAG;

[0039] A5) The combination of primers and probes for the SNP site numbered rs1050450 includes:

[0040] GPX1 upstream primer: CTGCAACTGCCAAGCAGCC,

[0041] GPX1 downstream primer: CGCTTCCAGACCATTGACATCG

[0042] GPX1 G probe: tttttACAGCTGgGCCCTTG, and

[0043] GPX1 A probe: tttttACAGCTGaGCCCTTG;

[0044] A6) The combination of primers and probes for the SNP site numbered rs1001179 includes:

[0045] CAT upstream primer: GGCCTGAAGGATGCTGATAACCG

[0046] CAT downstream primer: AGCAATGGAGAGCCTCGC

[0047] CAT C probe: ttttaTCGGCTATcCCGGGC

[0048] CAT T probe: ttttaTCGGCTATtCCGGGC, and

[0049] CAT G probe: ttttaTCGGCTATgCCGGGC.

[0050] A second aspect of the present invention provides a method for detecting SNP sites using the aforementioned kit, comprising the following steps:

[0051] Take the DNA sample to be tested, add primers for amplification, and obtain the amplification product;

[0052] The amplification product is mixed with the modified probe and incubated. After incubation, a second detection label is added and incubation continues to obtain the incubation product. The modified probe is obtained by binding multiple probes with multiple different first detection labels one by one.

[0053] The incubation product is tested, and the genotyping of the SNP site is determined based on the detection results of the second detection marker corresponding to different first detection markers.

[0054] In some embodiments of the present invention, the amplification includes asymmetric PCR.

[0055] A third aspect of the present invention provides a detection system for SNP sites, comprising any of the aforementioned reagent kits.

[0056] In a fourth aspect, the present invention provides the application of the aforementioned reagent kit or the aforementioned detection system in the preparation of genotyping detection products.

[0057] In a fifth aspect, the present invention provides the application of the aforementioned reagent kit or the aforementioned detection system in the preparation of diagnostic products for diseases.

[0058] In some embodiments of the present invention, the disease includes a hereditary disease.

[0059] In some embodiments of the present invention, the disease includes a single-gene genetic disease.

[0060] In some embodiments of the present invention, the disease includes at least one of vascular disease, autoimmune disease, neurodegenerative disease, and tumor.

[0061] The beneficial effects of this invention are:

[0062] This method utilizes a first detection marker with a distinct morphology to bind probe molecules for differentiation, thereby allowing a large number of different probe molecules to be mixed in the same reaction well. After the probe captures an amplified fragment containing a specific SNP site, it forms a complex of first detection marker-amplified fragment-second detection marker with the second detection marker bound to the amplified fragment. Thus, the combination of the first detection marker and the second detection marker can distinguish the genotype of the SNP site, ultimately achieving simultaneous and efficient multiplex detection.

[0063] Furthermore, this invention combines asymmetric PCR technology with patterned magnetic bead hybridization, shortening the hybridization incubation time to less than 1 hour. Ultimately, it can achieve short-time, multi-site, highly discriminative SNP detection with low fluorescence background. It is simple to operate, highly specific, and has good repeatability. Moreover, it has high discrimination between different genotypes at the same site and high throughput, and can detect more than 50 SNP sites simultaneously. It solves the problems of high price, complex operation, and high detection cost of conventional detection instruments, and provides a better solution for the detection of multiple gene polymorphism sites. Attached Figure Description

[0064] Figure 1 This represents the fluorescence intensity ratio corresponding to the ApoE 388SNP site in the genomic DNA sample extracted from the saliva sample in Example 1. The horizontal axis represents the sample number, and the vertical axis represents the fluorescence intensity ratio.

[0065] Figure 2 This represents the fluorescence intensity ratio corresponding to the ApoE 526SNP site in the genomic DNA sample extracted from the saliva sample in Example 1. The horizontal axis represents the sample number, and the vertical axis represents the fluorescence intensity ratio.

[0066] Figure 3 This is a clustering diagram of fluorescence intensity corresponding to the rs1800566 site in the genomic DNA sample extracted from the blood sample in Example 2. The horizontal and vertical axes represent the fluorescence intensity corresponding to the two types of coding magnetic beads at this SNP site, respectively.

[0067] Figure 4This is a clustering diagram of fluorescence intensity corresponding to the rs4880 site in the genomic DNA sample extracted from the blood sample in Example 2. The horizontal and vertical axes represent the fluorescence intensity corresponding to the two types of coding magnetic beads at this SNP site, respectively.

[0068] Figure 5 This is a clustering diagram of fluorescence intensity corresponding to the rs1050450 site in the genomic DNA sample extracted from the blood sample in Example 2. The horizontal and vertical axes represent the fluorescence intensity corresponding to the two types of coding magnetic beads at this SNP site, respectively.

[0069] Figure 6 This is a clustering diagram of fluorescence intensity corresponding to the rs1001179 site in the genomic DNA sample extracted from the blood sample in Example 2. The horizontal and vertical axes represent the fluorescence intensity corresponding to the two types of coding magnetic beads at this SNP site, respectively.

[0070] Figure 7 This is a clustering diagram of fluorescence intensity corresponding to the rs1800566 site in the blood sample from Example 2. The horizontal and vertical axes represent the fluorescence intensity corresponding to the two types of encoded magnetic beads at this SNP site, respectively.

[0071] Figure 8 This is a clustering diagram of fluorescence intensity corresponding to the rs4880 site in the blood sample from Example 2. The horizontal and vertical axes represent the fluorescence intensity corresponding to the two types of encoded magnetic beads at this SNP site, respectively.

[0072] Figure 9 This is a clustering diagram of fluorescence intensity corresponding to the rs1050450 site in the blood sample from Example 2. The horizontal and vertical axes represent the fluorescence intensity corresponding to the two types of encoded magnetic beads at this SNP site, respectively.

[0073] Figure 10 This is a clustering diagram of fluorescence intensity corresponding to the rs1001179 site in the blood sample from Example 2. The horizontal and vertical axes represent the fluorescence intensity corresponding to the two types of encoded magnetic beads at this SNP site, respectively. Detailed Implementation

[0074] In the description of this invention, the terms "first," "second," and "third" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Thus, a feature defined as "first," "second," or "third" may explicitly or implicitly include at least one of that feature. In the description of this invention, "a plurality of" means at least two, such as two, three, etc., unless otherwise explicitly specified.

[0075] In a first aspect, the present invention provides a kit for detecting SNP sites, the kit comprising primers, probes, and a second detection marker.

[0076] The term "primer" refers to an oligonucleotide molecule that participates in nucleic acid synthesis reactions as a starting point for elongation. In DNA double-strand amplification reactions, a pair of primers is typically required: an upstream primer (or forward primer) and a downstream primer (or reverse primer). The upstream primer binds to the sense strand of the DNA double helix, while the downstream primer binds to the sense strand. The general principle of primer design is to enhance specific amplification while suppressing non-specific amplification. There are specific requirements for primer length (usually 18–30 bases), GC content (40–60%), and annealing temperature (55–75°C). Specific primer designs can be created using primer design software, websites, etc., based on the DNA sequence.

[0077] The term "probe" refers to a molecule that can specifically interact with a specific target molecule and can be detected by a specific method. Specifically, in the embodiments of this application, the specific target molecule is a target fragment containing a specific SNP site, and these target fragments exhibit multiple different alleles at the SNP site. Theoretically, each base site can potentially have four variations, thus each SNP site has four alleles. However, in practice, in some cases, a SNP site includes two alleles, while in other cases, a SNP site may have three or more alleles. Therefore, in the embodiments of this application, a probe refers to an oligonucleotide molecule that can bind complementary to a portion of the target fragment containing the SNP site, thereby specifically recognizing the alleles of the SNP site. Each allele of the SNP site corresponds to one probe, so when multiple alleles exist at a certain SNP site, corresponding multiple probes are required. In order to distinguish each probe from any other probe in the subsequent detection process, a first detection marker is bound to each probe, and the first detection markers are different for different probes, so different first detection markers are bound to these multiple probes respectively.

[0078] The high-throughput detection requirements of SNPs typically necessitate the use of 10, 20, 30, 40, 50, 60, 80, 100, 200, 400, 500, 1000, 2000, or even more than 4000 types of first detection markers. Therefore, in some embodiments, microspheres are used as carriers for the first detection markers, and different detectable features are woven onto the microspheres to form a variety of different microspheres. In some embodiments, the detectable features include, but are not limited to, the morphological features of the microspheres, such as their appearance and size. In some specific embodiments, the appearance includes the microscopic morphology of the microspheres, for example, forming one or more two-dimensional or three-dimensional patterns on the surface of the microspheres through one or more methods such as etching or printing, utilizing the differences in the patterns to construct the desired variety of detection markers. In some specific embodiments, the patterns can be set at different positions on the microspheres, and each position can have multiple different patterns; for example, setting y selectable patterns at x positions on the microspheres can yield y... x Microspheres are then used. To determine the location of the microsphere to which the pattern belongs, it needs to be positioned. In some embodiments, the magnetic bead has a positioning marker. In some specific embodiments, the marker can be a notch on the magnetic bead, which disrupts the symmetry of the microsphere to achieve positioning. It is understood that the microsphere is not necessarily a perfect sphere; it can be a sphere with a notch, an ellipsoid, a near-sphere, or other shapes. In some embodiments, the pattern can also be a QR code or barcode. In some embodiments, for ease of subsequent operation and recycling, the microsphere can be a magnetic microsphere.

[0079] After the probe fully binds to the target fragment containing a specific allele, the system also contains some free probes that have not bound to the target fragment due to excess. Therefore, a second detection label is used to form a complex of the first detection label, the target fragment, and the second detection label to distinguish these free probes and complete the detection. Unlike the first detection label, the second detection label is typically only used to determine "yes" or "no," without needing to distinguish between different second detection labels. Therefore, the type of the second detection label can be any label type well-known in the art that can be detected by binding through one or more physical, chemical, or biological methods. In some embodiments, the second detection label includes, but is not limited to, fluorescent labels, chemiluminescent labels, and radioactive isotopes. In some specific embodiments, fluorescent labeling includes fluorescent dyes such as anthocyanins (e.g., Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, Cy7.5, etc.), rhodamine derivatives (e.g., Rhodamine 101, Rhodamine 6G, Tetramethylrhodamine, Rhodamine B, X-rhodamine, Texas Red, etc.), fluorescein derivatives (e.g., fluorescein, fluorescein isothiocyanate, 5(6)-carboxyhexachlorofluorescein, 5(6)-carboxynaphthylfluorescein, Oregon Green, Pennsylvania Green, etc.), fluorescent proteins (e.g., green fluorescent protein, phycoerythrin, phycocyanin, allophycocyanin), quantum dots, nanocrystals, etc. In some specific embodiments, chemiluminescent labeling includes luminol, isoluminol, acridine esters, acridine salts, imidazole, oxalates, etc. In some specific embodiments, radioactive isotopes include tritium, carbon-14, phosphorus-32, sulfur-35, iodine-125, etc.

[0080] In some embodiments, the upstream or downstream primer has a first binding portion, and the second detection label has a second binding portion capable of binding to the first binding portion, thereby binding the second detection label to the target fragment. In some embodiments, the first and second binding portions bind via covalent bonds (e.g., amide bonds, gold-thiol bonds, coordination bonds, etc.), non-covalent interactions (e.g., the biotin-avidin system), or antigen-antibody interactions. In some specific embodiments, one of the first and second binding portions is biotin, and the other is avidin or streptavidin. In some specific embodiments, one of the first and second binding portions is an antigen, and the other is an antibody, such as digoxigenin-anti-digoxigenin antibody.

[0081] In some implementations, the working concentration ratio of the upstream primer to the downstream primer is 1:3 to 100, for example, 1:3, 1:5, 1:10, 1:20, 1:30, 1:40, 1:50, 1:60, 1:70, 1:80, 1:90, or 1:100. Thus, in actual reactions, asymmetric PCR is performed. In the initial 10-15 cycles, both the upstream and downstream primers anneal to the template, producing double-stranded DNA. Subsequently, the concentration of the upstream primer, acting as a restriction primer, decreases or even becomes depleted, while the downstream primer, acting as a non-restriction primer, continues to guide the synthesis of single-stranded DNA, ultimately resulting in a large amount of sense strand synthesized. It is understood that in this case, the downstream primer has a first binding portion. Specifically, the downstream primer has a first binding portion at its 5' end. The working concentration refers to the concentration of the upstream and downstream primers in the actual reaction system. Under the above conditions, the initial concentration and initial volume of the upstream and downstream primers can be arbitrarily varied.

[0082] In some specific implementations, the combinations of primers and probes for different SNP sites are shown in Tables 1 and 2 below:

[0083] Table 1. Primer sequences

[0084] Oligo name 5'-3' sequence ApoE upstream primer TGTCCAAGGAGCTGCAGGCGG(SEQ ID NO.1) ApoE downstream primers GTTCCACCAGGGGGCCCCAGG(SEQ ID NO.2) NQO1 upstream primer CAGGATTTGAATTCGGGCGTCT(SEQ ID NO.3) NQO1 downstream primer GTGCTTTCTGTATCCTCAGAGTGGC(SEQ ID NO.4) SOD2 upstream primer TCGGGGAGGCTGTGCTTCT(SEQ ID NO.5) SOD2 downstream primer TGACCGGGCTGTGCTTTCTCG(SEQ ID NO.6) GPX1 upstream primer CTGCAACTGCCAAGCAGCC(SEQ ID NO.7) GPX1 downstream primer CGCTTCCAGACCATTGACATCG(SEQ ID NO.8) CAT upstream primer GGCCTGAAGGATGCTGATAACCG(SEQ ID NO.9) CAT downstream primers AGCAATTGGAGAGCCTCGC(SEQ ID NO.10)

[0085] Table 2. Probe Bead Assemblies

[0086] Oligo name 5'-3' sequence Magnetic bead encoding ApoE 388T probe ttttttGAGGACGTGtGCGGC(SEQ ID NO.11) 0003 ApoE 388C probe ttttttGAGGACGTGcGCGGC(SEQ ID NO.12) 0056 ApoE 526T probe TGCAGAAGtGCCTGGCA(SEQ ID NO.13) 0066 ApoE 526C probe TGCAGAAGcGCCTGGCA(SEQ ID NO.14) 1024 NQO1 G probe aaaGTTGAGgTTCTAAGA(SEQ ID NO.15) 0005 NQO1 A probe aaaCAGTTGAGaTTCTAAGA(SEQ ID NO.16) 0006 SOD2 A probe tttttCCCAAAaCCGGAG(SEQ ID NO.17) 0009 SOD2 G probe tttttCCCAAAgCCGGAG(SEQ ID NO.18) 0010 GPX1 G probe tttttACAGCTGgGCCCTTG(SEQ ID NO.19) 0012 GPX1 A probe tttttACAGCTGaGCCCTTG(SEQ ID NO.20) 0017 CAT C probe ttttaTCGGCTATcCCGGGC(SEQ ID NO.21) 0018 CAT T probe ttttaTCGGCTATtCCGGGC(SEQ ID NO.22) 0020 CAT G probe ttttaTCGGCTATgCCGGGC(SEQ ID NO.23) 0024

[0087] A second aspect of the present invention provides a method for detecting SNP sites using the aforementioned kit, comprising the following steps:

[0088] Take the DNA sample to be tested, add primers for amplification, and obtain the amplification product;

[0089] The amplification product is mixed with the modified probe and incubated. After incubation, a second detection label is added and incubation continues to obtain the incubation product. The modified probe is obtained by binding multiple probes to multiple different first detection labels one by one.

[0090] The incubation products were tested, and the genotyping of the SNP sites was determined based on the detection results of the second detection markers corresponding to different first detection markers.

[0091] In some implementations, the amount of DNA sample input in the amplification reaction system is ≥4ng, for example, 4ng, 5ng, 6ng, 8ng, 10ng, 20ng, 30ng, 40ng, or 50ng.

[0092] In some embodiments, the concentration of the upstream primer in the amplification reaction system is 0.2–2 μM, for example, it can be 0.2 μM, 0.4 μM, 0.6 μM, 0.8 μM, 1 μM, 1.2 μM, 1.4 μM, 1.6 μM, 1.8 μM, or 2 μM.

[0093] In some embodiments, the concentration of the downstream primer in the amplification reaction system is 0.2–2 μM, for example, 0.2 μM, 0.4 μM, 0.6 μM, 0.8 μM, 1 μM, 1.2 μM, 1.4 μM, 1.6 μM, 1.8 μM, or 2 μM.

[0094] In some embodiments, the amplification reaction system also includes 1 to 4 μL of DMSO, for example, 1, 2, 3, or 4 μL.

[0095] In some embodiments, the amplification reaction system is 10 to 50 μL, for example, 10 μL, 20 μL, 30 μL, 40 μL, or 50 μL.

[0096] In some implementations, the amplification program is as follows: 95°C for 2–4 min, 35–45 cycles (95°C for 10–20 s, 66°C for 25–35 s, 72°C for 25–35 s), 72°C for 8–12 min, and hold at 4–8°C.

[0097] In some embodiments, the amplification product further includes thermal denaturation or alkaline denaturation. The thermal denaturation step involves taking 1-5 μL of the amplification product and adding formamide at a volume ratio of 1:2-4 for thermal denaturation. The alkaline denaturation step involves taking 1-5 μL of the amplification product and adding sodium hydroxide solution at a volume ratio of 1:2-4 for alkaline denaturation. In some embodiments, the thermal denaturation temperature is 94-96°C, for example, 94°C, 95°C, or 96°C. In some embodiments, the thermal or alkaline denaturation time is 5-10 min, for example, 5, 6, 7, 8, 9, or 10 min.

[0098] In some embodiments, the incubation time between the modified probe and the amplification product is 10 to 20 minutes, for example, 10 minutes, 12 minutes, 14 minutes, 15 minutes, 16 minutes, 18 minutes, or 20 minutes.

[0099] In some implementations, after incubation, the process includes cleaning with a cleaning solution, which may be performed 1 to 3 times, for example, 2 times.

[0100] In some embodiments, the incubation time for adding the second detection marker is 10 to 20 minutes, for example, 10 minutes, 12 minutes, 14 minutes, 15 minutes, 16 minutes, 18 minutes, or 20 minutes.

[0101] In some embodiments, the incubation product further includes washing with a cleaning solution, and the number of washing cycles may be 1 to 3. In some embodiments, the incubation product further includes a demagnetization step. In some embodiments, the incubation product further includes a replenishment step.

[0102] In some implementations, the genotyping of SNP sites is determined based on the detection results of the second detection markers corresponding to different first detection markers. This includes determining the detection amount of the second detection marker for each allele in the SNP site based on the combination result of the first detection marker and the second detection marker of the complex formed by the first detection marker-target fragment-second detection marker corresponding to multiple alleles of the SNP site, and thus obtaining the genotyping of the SNP site.

[0103] In some embodiments, the second detection marker includes a fluorescent marker, and the genotyping of the SNP locus is determined based on the difference in fluorescence intensity of different alleles (e.g., a ratio). In some embodiments, the difference in fluorescence intensity can be determined by methods such as clustering.

[0104] In some implementations, different probes at the same SNP site are used to distinguish between wild-type and mutant gene sequences, and the detection results are determined by the difference in fluorescence intensity corresponding to each magnetic bead.

[0105] In some implementations, the number of SNP sites to be detected is 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or more than 50.

[0106] In some implementations, the detection of incubated products is performed using a liquid biochip reader to read the results.

[0107] In some implementations, the modified probe can participate in the reaction directly as a finished product, or it can be prepared in advance by reacting the probe with the raw material of the first detection label.

[0108] In some implementations, detecting SNP sites does not directly involve the diagnosis or treatment of a disease, and therefore this method falls under the category of non-disease diagnosis or treatment methods.

[0109] A third aspect of the present invention provides a detection system for SNP sites, comprising any of the aforementioned reagent kits.

[0110] In some implementations, the primers, probes, first detection markers, second detection markers, etc. in the kit can be independently distributed in different positions in the detection system. During detection, the components are mixed and reacted according to the corresponding steps by manual or automated means, and the reaction results are detected.

[0111] A fourth aspect of the present invention provides the application of the aforementioned reagent kit or the aforementioned detection system in the preparation of genotyping detection products.

[0112] A fifth aspect of the present invention provides the application of the aforementioned reagent kit or the aforementioned detection system in the preparation of diagnostic products for diseases.

[0113] In some implementations, the disease includes a genetic disease.

[0114] In some implementations, the disease includes at least one of the following: Duchenne muscular dystrophy, hemophilia A, hemophilia B, hereditary deafness, thalassemia, spinal muscular atrophy, congenital adrenocortical hyperplasia, phenylketonuria, albinism, galactosemia, Wilson's disease, polycystic kidney disease, glycogen storage disease type II, citrullinemia, Gaucher disease, mucopolysaccharide type I, and mucopolysaccharide type II.

[0115] In some implementations, the disease includes at least one of cardiovascular disease, autoimmune disease, neurodegenerative disease, and tumor.

[0116] In some implementations, cardiovascular diseases include cardiomyopathy, cardiac ion channelopathies, monogenic hereditary hypertension, hereditary aortic disease, pulmonary hypertension, hereditary thrombophilia, familial hypercholesterolemia, etc.

[0117] In some implementations, autoimmune diseases include alopecia areata (ALO), ankylosing spondylitis (AS), celiac disease (CED), Crohn's disease (CRD), eosinophilic esophagitis (EE), Graves' disease (GRD), juvenile idiopathic arthritis (JIA), multiple sclerosis (MS), primary biliary cirrhosis (PBC), psoriatic arthritis (PA), psoriasis (PSO), rheumatoid arthritis (RA), Sjögren's syndrome (SJS), systemic lupus erythematosus (SLE), systemic scleroderma / sclerosis (SSC), type 1 diabetes mellitus (T1D), ulcerative colitis (ULC), and vitiligo (VIT), etc.

[0118] In some implementations, neurodegenerative diseases include Alzheimer's disease, Parkinson's disease, multiple sclerosis, amyotrophic lateral sclerosis, spinocerebellar ataxia, Pick's disease dementia, etc.

[0119] In some embodiments, the tumor includes at least one of solid tumors and non-solid tumors. Solid tumors include, but are not limited to, at least one of brain cancer, head and neck cancer, lung cancer, liver cancer, breast cancer, stomach cancer, colon cancer, rectal cancer, cervical cancer, ovarian cancer, pancreatic cancer, prostate cancer, bladder cancer, thyroid cancer, lymphoma, and skin cancer. Non-solid tumors include leukemia. Brain cancer includes primary and secondary brain cancer. Primary brain cancer includes gliomas and non-gliomas (such as meningiomas, medulloblastomas, medullary pituitary adenomas, primary CNS lymphomas, and central nervous system germ cell tumors). Secondary brain cancer includes malignant tumors originating elsewhere but that have spread (metastasized) to the brain, such as breast and lung cancer that have metastasized to the brain. Head and neck cancers include oral / oropharyngeal cancer, nasopharyngeal cancer, nasal / sinus cancer, laryngeal / laryngopharyngeal cancer, and salivary gland cancer. Lung cancers include small cell lung cancer and non-small cell lung cancer. Liver cancers include hepatocellular carcinoma, cholangiocarcinoma, and hepatoblastoma. Breast cancers include carcinoma in situ (such as lobular carcinoma in situ and ductal carcinoma in situ) and invasive breast cancer (invasive lobular carcinoma and invasive ductal carcinoma). Stomach cancers include gastric adenocarcinoma. Gastrointestinal tumors, including leiomyosarcomas, carcinoid tumors, and lymphomas; cervical cancer, including squamous cell carcinoma and adenocarcinoma; ovarian cancer, including epithelial tumors, germ cell tumors, and stromal tumors; pancreatic cancer, including pancreatic cancer, cystic tumors, acinar cell carcinoma, sarcoma, and ampullary carcinoma; bladder cancer, including urothelial carcinoma, squamous cell carcinoma, adenocarcinoma, clear cell carcinoma, small cell carcinoma, and carcinoid tumors; thyroid cancer, including papillary thyroid carcinoma, follicular thyroid carcinoma, and Herxheimer's cell carcinoma; lymphoma, including Hodgkin's lymphoma and non-Hodgkin's lymphoma; skin cancer, including non-melanoma and melanoma; and leukemia, including acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, and chronic myeloid leukemia.

[0120] In some implementations, diagnosis includes early diagnosis and prognostic risk assessment. For example, both the "Guidelines for the Diagnosis and Treatment of Alzheimer's Disease in China" and the "Chinese Expert Consensus on the Diagnosis and Treatment of Mild Cognitive Impairment of Alzheimer's Disease" explicitly recommend ApoE genotyping for predictive testing of the risk of AD occurrence and transformation. Meta-analyses of numerous other studies have also shown that gene polymorphisms at SNP sites such as rs1800566, rs4880, rs1050450, and rs1001179 are associated with the risk and prognosis of tumors such as breast cancer, bladder cancer, cervical cancer, prostate cancer, lung cancer, colorectal cancer, and leukemia.

[0121] The present invention will be further described in detail below through specific embodiments.

[0122] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0123] Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in these examples are commercially available.

[0124] Example 1: APOE Genotyping Detection

[0125] This embodiment constructs a detection system based on an encoded magnetic bead platform for the qualitative detection of the 388T>C and 526C>T sites of the ApoE gene. The specific implementation steps are as follows:

[0126] Step 1) Sample collection and preparation

[0127] Saliva samples were collected from ten subjects using the MGIEAsy saliva sample collection kit, and genomic DNA was extracted from the ten subjects using the MGIEAsy genomic DNA extraction kit (magnetic bead method). The extracted nucleic acid concentration was determined using Nanodrop, and the nucleic acid concentration was diluted to 10 ng / μL to obtain the genomic DNA samples.

[0128] Step 2) Probe modification

[0129] Take 80,000 magnetic beads of each of the following SEQ ID NO.11 to SEQ ID NO.14 from Table 2: 0003 (BGI Genomics, the same manufacturer for all beads below, CZ-0003), 0056 (CZ-0056), 0066 (CZ-0066), and 1024 (CZ-1024), according to their density, and place them in a 1.5 mL centrifuge tube. Wash twice with MSET (0.05 M MES and 0.05 v / v % Tween-20) and 2-morpholinoethanesulfonic acid (MES) buffer, and then resuspend in 575 μL of MES buffer. Add 5 μL of the corresponding probe at a concentration of 100 μM and 25 μL of 20 mg / mL 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC). Shake at room temperature in the dark for 45 min, then add another 25 μL of 20 mg / mL EDC and shake at room temperature in the dark for 45 min. Wash three times with magnetic bead blocking buffer (Tris buffer containing 2 w / v % bovine serum albumin). Add 800 μL of magnetic bead blocking buffer and shake at room temperature in the dark for 15 h. Wash once with magnetic bead preservation buffer (Tris buffer containing 2 w / v % bovine serum albumin), then add 250 μL of magnetic bead preservation buffer for storage.

[0130] Step 3) PCR reaction

[0131] Prepare a 25 μL multiplex PCR reaction mixture (10 ng gDNA, 0.2 μM ApoE upstream primer, 2 μM ApoE downstream primer, 12.5 μL multiplex PCR amplification reagent, 2 μL DMSO) and perform amplification according to the following procedure:

[0132] PCR amplification program: 95℃ for 3 min, 40 cycles (95℃ for 15 s, 66℃ for 30 s, 72℃ for 30 s), 72℃ for 10 min, and hold at 4℃.

[0133] Step 4) Hybridization reaction

[0134] The four modified probes prepared in step 2) were diluted 500 times with hybridization buffer (250mM Tris-HCl, 4 w / v% bovine serum albumin, 2 w / v% trehalose, 5mM EDTA, pH 7.4) at a reaction volume of 50μL. 3μL of the PCR product prepared in step 3) was denatured at 95℃ for 8 min with 9μL formamide (refer to Table 3). Then, the first incubation for hybridization was performed by shaking at 600rpm for 15 min at 37℃. The product was washed twice with washing buffer (PBS buffer containing 0.05v / v% Tween-20).

[0135] Table 3. Hybridization first incubation system

[0136] reagents volume Modified probe 0.1 μL of each, 4 types in total Step 3) PCR products 12μL Hybridization buffer 49.6μL

[0137] Then, the chromogenic reagent (streptavidin-phycoerythrin conjugate, Shanghai Langya) was diluted 875 times with hybridization buffer (250 mM Tris-HCl, 4 w / v % bovine serum albumin, 2 w / v % trehalose, 5 mM EDTA, pH 7.4). 50 μL of the solution was added to the product from the first incubation. The mixture was sealed and protected from light, and shaken at 37°C and 600 rpm for 15 min for the second hybridization incubation. After the incubation, the mixture was washed three times with washing buffer, and 390 μL of washing buffer was added. After standing for 7 min, the results were read.

[0138] Step 5) Result Reading and Analysis

[0139] The MGIant-X liquid biochip reader was used to detect the product from the second incubation. The steps are as follows: Select "Detection Run," check the wells to be detected, and click "Run." After the run is complete, select "Log" under the "admin" window, then select the "PronDecodeResult" window. The results are output in the folder corresponding to the date.

[0140] Two probes at the same SNP site were used to distinguish between wild-type and mutant gene sequences. The detection results were determined by the difference in fluorescence intensity of the coding magnetic beads in each well after hybridization. A no-template control (NTC) was used to check if the system was functioning correctly; the NTC fluorescence intensity should not exceed 200. The fluorescence intensity of the 0003 coding magnetic bead in each well was used to determine the allele T at the ApoE 388 site; the fluorescence intensity of the 0056 coding magnetic bead in each well was used to determine the allele C at the ApoE 388 site; the fluorescence intensity of the 0066 coding magnetic bead in each well was used to determine the allele T at the ApoE 526 site; and the fluorescence intensity of the 0066 coding magnetic bead in each well was used to determine the allele C at the ApoE 526 site. Results were interpreted according to Table 4.

[0141] Table 4. Interpretation of Gene Polymorphism Detection Results

[0142]

[0143]

[0144] Figure 1 and Figure 2 The table below shows the fluorescence intensity and fluorescence intensity ratio at the ApoE 388 and ApoE 526 loci in 10 genomic DNA samples from Example 1. The fluorescence intensity in Table 5 was determined according to the criteria in Table 4 to identify the genotype of each sample, which was then compared with the sequencing results. Table 6 shows that the genotypes obtained using this method are completely consistent with the sequencing results, demonstrating extremely high accuracy.

[0145] Table 5. Fluorescence intensity of samples

[0146] Magnetic bead encoding Polymorphism Sample 1 Sample 2 Sample 3 Sample 4 Sample 5 Sample 6 Sample 7 Sample 8 Sample 9 Sample 10 NTC 3 388-T 1584 1738 2286 1698 2674 2257 2493 2396 2115 1613 142 56 388-C 1236 1358 283 1362 271 230 245 256 249 224 105 66 526-T 275 302 301 308 468 459 462 461 288 239 124 1024 526-C 1459 1477 1672 1566 1307 814 788 776 1344 958 109

[0147] Table 6. Sample Detection Results

[0148]

[0149] Example 2: NQO1, SOD2, GPX1 and CAT genotyping detection

[0150] This embodiment constructs a detection system based on an encoded magnetic bead platform for the qualitative detection of the human NQO1 gene G>A site, the human SOD2 gene A>G site, the human GPX1 gene G>A site, and the human CAT gene C>G,T site. The specific implementation steps are as follows:

[0151] Step 1) Sample collection and preparation

[0152] (1) Genomic DNA was extracted from 95 subjects using the MGIEAsy Blood Genomic DNA Extraction Kit (magnetic bead method). The concentration of the extracted nucleic acid was detected using Nanodrop. The nucleic acid concentration was diluted to 10 ng / μL to obtain genomic DNA samples.

[0153] (2) The blood of 78 subjects was diluted 19 times to obtain blood samples.

[0154] Step 2) Probe modification

[0155] Take 80,000 coded magnetic beads (0005(CZ-0005), 0006(CZ-0006), 0009(CZ-0009), 0010(CZ-0010), 0012(CZ-0012), 0018(CZ-0018), 0019(CZ-0019), 0020(CZ-0020), and 0024(CZ-0024)) corresponding to SEQ ID NO.15~SEQ ID NO.23 in Table 2 according to density and place them in a 1.5mL centrifuge tube. Wash twice with MSET and MES buffers, and then resuspend in 575μL of MES buffer. Add 5μL of the corresponding probe at a concentration of 100μM and 25μL of 20mg / mL EDC. Shake at room temperature in the dark for 45min, then add another 25μL of 20mg / mL EDC and shake at room temperature in the dark for 45min. After washing three times with magnetic bead blocking solution, add 800 μL of magnetic bead blocking solution and shake at room temperature in the dark for 15 hours. After washing once with magnetic bead preservation solution, add 250 μL of magnetic bead preservation solution for preservation.

[0156] Step 3) PCR reaction

[0157] Prepare a 20 μL multiplex PCR reaction system (10 ng gDNA (or 1 μL blood), 0.2 μM of each upstream primer, 1 μM of each downstream primer, and 10 μL of multiplex PCR amplification reagent) and perform amplification according to the following procedure:

[0158] PCR amplification program: 95℃ for 3 min, 40 cycles (95℃ for 15 s, 58℃ for 30 s, 72℃ for 30 s), 72℃ for 10 min, and hold at 4℃.

[0159] Step 4) Hybridization reaction

[0160] Dilute the modified probe prepared in step 2) 500-fold with hybridization buffer at a reaction volume of 50 μL. Take 3 μL of the PCR product prepared in step 3) and denature it with 9 μL of sodium hydroxide solution for 8 min. Then, perform the first hybridization incubation at 37°C and 600 rpm for 15 min. Wash twice with washing buffer. Dilute the chromogenic reagent 875-fold with hybridization buffer at a reaction volume of 50 μL. Add 50 μL of the solution to the product from the first incubation. Seal and protect from light. Perform the second hybridization incubation at 37°C and 600 rpm for 15 min. After the second incubation, wash three times with washing buffer. Add 390 μL of washing buffer, let stand for 7 min, and then read the results.

[0161] Step 5) Result Reading and Analysis

[0162] The MGIant-X liquid biochip reader was used to detect the product from the second incubation. The steps are as follows: Select "Detection Run," check the wells to be detected, and click "Run." After the run is complete, select "Log" under the "admin" window, then select the "PronDecodeResult" window. The results are output in the folder corresponding to the date.

[0163] Two probes at the same SNP site are used to distinguish between wild-type and mutant gene sequences, and the detection results are determined by the difference in fluorescence intensity of the encoded magnetic beads in each well after hybridization.

[0164] Non-template control (NTC) is used to detect whether the system is normal. The fluorescence intensity of NTC should not be higher than 200.

[0165] The fluorescence intensity of the 0005-coded magnetic bead in each well was used to determine the allele G at the NQO1 (rs1800566) locus in the test sample; the fluorescence intensity of the 0006-coded magnetic bead in each well was used to determine the allele A at the NQO1 (rs1800566) locus in the test sample.

[0166] The fluorescence intensity of the 0009 encoded magnetic bead in each well was used to determine the allele A at the SOD2 (rs4880) locus of the test sample; the fluorescence intensity of the 0010 encoded magnetic bead in each well was used to determine the allele G at the SOD2 (rs4880) locus of the test sample.

[0167] The fluorescence intensity of the 0012 encoded magnetic bead in each well was used to determine the allele G at the GPX1 (rs1050450) locus in the test sample; the fluorescence intensity of the 0017 encoded magnetic bead in each well was used to determine the allele A at the GPX1 (rs1050450) locus in the test sample.

[0168] The allele C in the CAT (rs1001179) locus of the test sample was determined based on the fluorescence intensity of the 0018 encoded magnetic bead in each well; the allele T in the CAT (rs1001179) locus of the test sample was determined based on the fluorescence intensity of the 0020 encoded magnetic bead in each well; and the allele G in the CAT (rs1001179) locus of the test sample was determined based on the fluorescence intensity of the 0024 encoded magnetic bead in each well.

[0169] The results are judged based on the clustering diagram of fluorescence intensity.

[0170] Figures 3-6 The following is a clustering diagram of fluorescence intensity for four SNP sites in 95 gDNA samples from Example 2. Based on the clustering results, the genotype of the samples was determined. Furthermore, the sequencing results of each sample were used as a comparison benchmark to determine the effectiveness of the scheme in identifying SNP sites in this example. The results are shown in Table 6. The correct identification rates for the four SNP sites rs1800566, rs4880, rs1050450, and rs1001179 were 100%, 100%, 97%, and 98%, respectively.

[0171] Table 6. Detection results of gDNA samples

[0172] Test Results rs1800566 rs4880 rs1050450 rs1001179 Total loci 95 95 95 95 accuracy 100% 100% 97% 98%

[0173] Figures 7-10 The following is a clustering diagram of fluorescence intensity for four SNP loci in 78 blood samples from Example 2. Based on the clustering results, the genotype of the samples was determined. Furthermore, the sequencing results of each sample were used as a comparison benchmark to determine the effectiveness of the scheme in identifying SNP loci in this example. The results are shown in Table 7. The correct identification rates for the four SNP loci rs1800566, rs4880, rs1050450, and rs1001179 were 100%, 97%, 100%, and 100%, respectively.

[0174] Table 7. Blood Sample Test Results

[0175] Test Results rs1800566 rs4880 rs1050450 rs1001179 Total loci 78 78 78 78 accuracy 100% 97% 100% 100%

[0176] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A kit for detecting SNP sites, characterized in that, include: Primers, the primers comprising an upstream primer and a downstream primer for amplifying a target fragment containing the SNP site; The probes include multiple probes that specifically recognize multiple alleles of the SNP site; Multiple different first detection markers are used to correspond one-to-one with the multiple probes; A second detection marker is used to bind the target fragment.

2. The reagent kit according to claim 1, characterized in that: The first detection marker includes magnetic microspheres, and different types of magnetic microspheres have different identifiable morphological features; Preferably, the morphological features include the pattern on the surface of the magnetic microspheres.

3. The reagent kit according to claim 1, characterized in that: The upstream primer or the downstream primer has a first binding portion, and the second detection marker has a second binding portion capable of binding to the first binding portion; Preferably, one of the first binding portion and the second binding portion is biotin, and the other is avidin or streptavidin; Preferably, one of the first binding portion and the second binding portion is an antigen, and the other is an antibody.

4. The kit according to claim 1, characterized in that: The second detection label includes at least one of fluorescent label, chemiluminescent label, and radioactive isotope.

5. The reagent kit according to claim 1, characterized in that: The working concentration ratio of the upstream primer to the downstream primer is 1:3 to 100.

6. The reagent kit according to claim 1, characterized in that: The primers and the probes comprise at least one combination of primers and probes selected from A1) to A6): A1) The combination of primers and probes for the SNP site numbered rs429358 includes: ApoE upstream primer: TGTCCAAGGAGCTGCAGGCGG ApoE downstream primer: GTTCCACCAGGGGCCCCAGG ApoE 388T probe: ttttttGAGGACGTGtGCGGC, and ApoE 388C probe: ttttttGAGGACGTGcGCGGC; A2) The combination of primers and probes for the SNP site numbered rs7412 includes: ApoE upstream primer: TGTCCAAGGAGCTGCAGGCGG ApoE downstream primer: GTTCCACCAGGGGCCCCAGG ApoE 526T probe: TGCAGAAGtGCCTGGCA, and ApoE 526C probe: TGCAGAAGcGCCTGGCA; A3) The combination of primers and probes for the SNP site numbered rs1800566 includes: NQO1 upstream primer: CAGGATTTGAATTCGGGCGTCT, NQO1 downstream primer: GTGCTTTCTGTATCCTCAGAGTGGC NQO1 G probe: aaaGTTGAGgTTCTAAGA, and NQO1 A probe: aaaCAGTTGAGaTTCTAAGA; A4) The combination of primers and probes for the SNP site numbered rs4880 includes: SOD2 upstream primer: TCGGGGAGGCTGTGCTTCT, SOD2 downstream primer: TGACCGGGCTGTGCTTTCTCG, SOD2 A probe: tttttCCCAAAaCCGGAG, and SOD2 G probe: tttttCCCAAAgCCGGAG; A5) The combination of primers and probes for the SNP site numbered rs1050450 includes: GPX1 upstream primer: CTGCAACTGCCAAGCAGCC, GPX1 downstream primer: CGCTTCCAGACCATTGACATCG GPX1 G probe: tttttACAGCTGgGCCCTTG, and GPX1 A probe: tttttACAGCTGaGCCCTTG; A6) The combination of primers and probes for the SNP site numbered rs1001179 includes: CAT upstream primer: GGCCTGAAGGATGCTGATAACCG CAT downstream primer: AGCAATGGAGAGCCTCGC CAT C probe: ttttaTCGGCTATcCCGGGC CAT T probe: ttttaTCGGCTATtCCGGGC, and CAT G probe: ttttaTCGGCTATgCCGGGC.

7. A method for detecting SNP sites using the kit according to any one of claims 1 to 6, characterized in that, Includes the following steps: Take the DNA sample to be tested, add primers for amplification, and obtain the amplification product; The amplification product is mixed with the modified probe and incubated. After incubation, a second detection label is added and incubation continues to obtain the incubation product. The modified probe is obtained by binding multiple probes with multiple different first detection labels one by one. The incubation products are tested, and the genotyping of the SNP sites is determined based on the detection results of the second detection markers corresponding to different first detection markers; Preferably, the amplification includes asymmetric PCR.

8. A system for detecting SNP sites, characterized in that: The kit includes the kit described in any one of claims 1 to 6.

9. The use of the kit according to any one of claims 1 to 6, or the detection system according to claim 8, in the preparation of genotyping detection products.

10. The use of the kit according to any one of claims 1 to 6, or the detection system according to claim 8, in the preparation of diagnostic products for diseases; Preferably, the disease includes a hereditary disease; Preferably, the disease includes a single-gene genetic disease; Preferably, the disease includes at least one of cardiovascular disease, autoimmune disease, neurodegenerative disease, and tumor.