A primer set and method for high-throughput assessment of resistance levels in murine populations
By designing universal primer combinations and next-generation sequencing technology, the problem of high-throughput drug resistance detection in various rodents has been solved, enabling rapid and economical drug resistance assessment, improving detection efficiency and accuracy, and reducing costs.
Patent Information
- Application Number
- CN202610683705.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-18
- Publication Date
- 2026-06-30
AI Technical Summary
Existing technologies are not suitable for rapid and economical high-throughput drug resistance testing in various rodent species, and traditional methods also present issues of animal ethics and high testing costs.
A set of universal primer combinations was designed to amplify the coding region of the Vkorc1 gene in various rodents. Combined with next-generation sequencing technology, high-throughput drug resistance assessment of various rodents was achieved. The primer combination includes three pairs of primers to amplify the three exons of the Vkorc1 gene, and next-generation sequencing technology is used for efficient assessment.
It significantly improves the species universality and throughput of rodent drug resistance detection, reduces detection costs, overcomes the limitation of Sanger sequencing in accurately analyzing heterozygotes with insertions and deletions, and enhances the ability to discover new resistance mutations.
Smart Images

Figure CN122303446A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a primer set and method for high-throughput assessment of drug resistance levels in rodent populations. Background Technology
[0002] Rodents easily develop resistance to anticoagulant rodenticides. Monitoring rodent population resistance is a core element in ensuring the effective use of anticoagulant rodenticides and achieving scientific and sustainable rodent control.
[0003] Anticoagulant rodenticides are widely used for rodent control due to their safety and effectiveness. However, many rodent species have developed resistance to these agents, severely impacting their effectiveness. Resistance significantly reduces the efficiency of rodenticide use. Furthermore, the level of resistance to different anticoagulant rodenticides varies among different geographical populations, closely related to the intensity of local rodenticide use and the spread of resistant populations in neighboring areas. Therefore, in practical rodent control, it is crucial to regularly monitor the resistance levels of rodent populations in different areas where rodenticides have been used. Appropriate anticoagulant rodenticides should be selected based on the resistance level: first-generation rodenticides with low toxicity should be prioritized in areas with low resistance, while second-generation anticoagulant rodenticides with higher toxicity should be used in areas where resistance has developed, to prevent the further spread of resistant populations.
[0004] Traditional methods for detecting antibiotic resistance mainly include the lethal period poisoning (LFP) method and the hemagglutination reaction (BCR) method. The lethal period poisoning method requires rodent capture, taming, several days of observation after poisoning, and waiting for death; the entire process typically takes one to two weeks or even longer, failing to meet the needs of rapid monitoring and emergency response. While the hemagglutination reaction method is faster than the LFP method, it still requires live or fresh samples, and the procedures are cumbersome with low throughput. Furthermore, raising and euthanizing large numbers of live rodents under laboratory conditions poses a risk of pathogen leakage and spread, and also raises animal ethics concerns. Therefore, in the past 20 years, there have been relatively few studies using these two methods to investigate large-scale antibiotic resistance in rodents.
[0005] The Vkorc1 gene is a target gene of anticoagulant rodenticides; amino acid variations in this gene can lead to resistance in rodents to anticoagulant rodenticides. Molecular resistance detection methods based on this gene are both economical and efficient compared to traditional resistance detection methods. Reduced vitamin K in the vitamin K cycle is a key cofactor in the γ-carboxylation process of many coagulation factors (coagulation factors II, VII, IX, etc.). Anticoagulant rodenticides such as warfarin can bind to vitamin K epoxide reductase (VKOR) in the vitamin K cycle, preventing the formation of reduced vitamin K and thus preventing the activation of coagulation factors, which leads to coagulation dysfunction. Variations in the Vkorc1 gene are the main cause of resistance in rodents to anticoagulant rodenticides.
[0006] Currently, the Vkorc1 gene of 36 rodent species, including brown rats and house mice, has been published in NCBI, Uniprot, and various literatures, including some sequences extracted from the genome. Primers for some common farm rodent pests, such as brown rats, house mice, yellow-breasted rats, and yellow-haired rats, have been published. However, due to the differences in Vkorc1 sequences among different rodent species, these primers mainly amplify the full-length or coding region of the Vkorc1 gene for a specific rodent species, and then use the first-generation Sanger sequencing method to sequence the entire coding region or the full length of the gene.
[0007] The relevant technologies currently available are as follows: Existing technology 1: Early monitoring of rodent resistance mainly relies on traditional lethal poisoning and hemagglutination assays. The drawbacks are: lethal poisoning requires rodent capture, domestication, several days of observation after poisoning, and waiting for death, a process typically taking 1 to 2 weeks or even longer, failing to meet the needs of rapid monitoring and emergency response. While hemagglutination assays are faster than poisoning, they still require live or fresh samples, are cumbersome, and have low throughput. Furthermore, raising and euthanizing large numbers of live rodents under laboratory conditions poses a risk of pathogen leakage and spread, and also raises animal ethics concerns. Therefore, research on rodent drug resistance using these two methods has been relatively limited in the past 20 years. These two methods are suitable for detecting drug resistance in small populations in localized areas, but cannot meet the needs of large-scale, long-term monitoring of rodent drug resistance.
[0008] Existing technology two: Target-specific PCR technology, such as four-primer amplification arrestor mutagenesis system PCR (ARMS-PCR). ARMS-PCR is a molecular biology method for accurately detecting point mutations or single nucleotide polymorphisms in specific genes. It uses four primers in a single reaction tube: two outer universal primers (producing a common inner control band) and two inner allele-specific primers (with opposite extension directions and designed product lengths). An additional mismatched base is artificially introduced at the penultimate position of the 3' end of the specific primers to enhance allele discrimination. In the PCR reaction, DNA polymerase can efficiently initiate extension and obtain amplified products only when the 3' end base of the primer is completely complementary (matched) to the corresponding base of the template DNA. If a base mismatch exists, the extension reaction will be severely hindered or even completely impossible. Wild-type, mutant, or both (heterozygote) types can be directly distinguished on an electrophoretic gel by detecting differences in product length. Its disadvantage is that it only detects known specific mutations. This method is low-cost and fast, but it can only detect pre-designed known mutations and cannot discover new or rare resistance mutations. Furthermore, different primers need to be designed for different mouse species.
[0009] Existing technology three: Amplifying the full-length or coding region of the Vkorc1 gene using species-specific primers, followed by sequencing the entire coding region or full-length gene using first-generation Sanger sequencing. Its disadvantages are: Sanger sequencing of PCR products from individuals with heterozygous insertions or deletions is prone to failure. The Vkorc1 gene has three exons, and its intron regions contain single or multiple nucleotide repeat sequences. When performing first-generation sequencing on PCR products, the sequencing chromatogram will show consecutive overlapping peaks at heterozygous sites, leading to inaccurate sequence reading and sequencing failure. Therefore, when using Sanger sequencing to analyze PCR products of the Vkorc1 gene from specific rodent populations, the number of exon sequences obtained is often inconsistent because the Vkorc1 gene itself contains some heterozygous insertion and deletion sites, affecting the sequencing quality. Primers have high species specificity: Published primers are usually designed for specific sequences of a single rodent species (such as the brown rat). Because the Vkorc1 gene exhibits sequence differences among different mouse species, these primers may fail to amplify in other mouse species due to low (or even nonexistent) binding efficiency with the template DNA, indicating a lack of universality. Low throughput and high cost: Sanger sequencing can only sequence one fragment per reaction, one sample. When the number of samples reaches hundreds or even thousands, the time, manpower, and reagent costs become extremely high. The current primers cover a limited number of mouse species: Currently, only a small subset of mouse species have had their Vkorc1 target gene sequences amplified and sequenced, such as common brown rats, house mice, yellow-breasted rats, and yellow-haired rats. Although NCBI has Vkorc1 sequences for more than 30 mouse species, most are extracted from whole genomes; target genes for many more mouse species still need to be amplified and analyzed.
[0010] Compared to first-generation sequencing, second-generation sequencing (NGS) technology can achieve high-throughput amplification of the Vkorc1 gene more efficiently and economically, enabling simultaneous high-throughput sequencing of hundreds of samples. Currently, internationally, assessing drug resistance levels in rodents such as brown rats, house mice, and black rats by sequencing the mutation frequency of Vkorc1 target genes still relies on Sanger sequencing to sequence individual individuals, which is more expensive than NGS technology. There are currently no reports on high-throughput sequencing of the rodent drug resistance target gene Vkorc1. The current technical bottleneck lies in the fact that the sequencing primers for the Vkorc1 coding region reported for different mouse species are mainly designed for first-generation sequencing methods. The amplified fragments are relatively long, and the requirements for primer position are not high. For example, internationally, the assessment of drug resistance levels in mice such as brown rats, house mice, and black rats by sequencing the mutation frequency of Vkorc1 target genes still relies on first-generation Sanger sequencing. The specific primers designed for closely related mouse species such as Brandt's vole and Trichodina are also sequenced using first-generation Sanger sequencing. The amplified fragment length is 890-1100 bp, and the requirements for primer conservation are relatively low. Therefore, the primers are highly specific and not suitable for simultaneously amplifying multiple mouse species. In addition, when dealing with large population samples, the sequencing cost of first-generation Sanger sequencing is higher than that of second-generation sequencing technology.
[0011] The current technical challenges are: (1) When high-throughput amplicon sequencing uses the PE250 mode, it is necessary to remove the forward and reverse sequencing primers and the low-quality bases in the first 20-30 bp, while requiring the sequence fragment to be no more than 450 bp in length while completely covering the coding region. Therefore, designing primers suitable for multiple rodent species within a limited sequence interval is a great challenge. (2) In actual rodent control, several rodent species often coexist in the same geographical area. The published Vkorc1 sequencing primers are usually for a certain rodent species or closely related rodent species. Therefore, when conducting drug resistance assessment for multiple rodent species in a geographical area, it is necessary to design multiple pairs of primers for different rodent species, which is complicated and time-consuming. (3) The sequencing primers for Vkorc1 coding regions of different rodent species reported so far are mainly for first-generation sequencing methods. The amplified fragments are long and the conservation of intron regions is not considered. Therefore, the primers are highly specific and not suitable for the high-throughput simultaneous amplification of multiple rodent species by second-generation sequencing platforms.
[0012] Therefore, there is an urgent need to develop a universal degenerate primer combination applicable to multiple mouse species, as well as a universal method for high-throughput amplification and sequencing of Vkorc1 genes in multiple mouse species using next-generation sequencing technology in a cross-species, efficient and accurate manner. Summary of the Invention
[0013] To address the aforementioned technical problems, the present invention aims to provide a universal primer combination that can be used to amplify the coding region of the Vkorc1 gene in various rodent species. Combined with next-generation sequencing technology, this enables high-throughput assessment of drug resistance levels in multiple rodent species within the same geographical region in a short period of time, thereby improving the efficiency of drug resistance detection while significantly reducing detection costs.
[0014] To achieve the above objectives, the present invention provides a set of primer combinations for amplifying the Vkorc1 gene in various rodent species. The primer combinations include three pairs of primers for amplifying the three exons of the Vkorc1 gene, respectively. The primer sequences for amplifying the first exon are shown in SEQ ID NO. 1-2 or SEQ ID NO. 3-4, the primer sequences for amplifying the second exon are shown in SEQ ID NO. 5-6 or SEQ ID NO. 7-8, and the primer sequences for amplifying the third exon are shown in SEQ ID NO. 9-10.
[0015] According to a specific embodiment of the present invention, preferably, the primer combination includes a combination of SEQ ID NO.1-2, SEQ ID NO.5-6 and SEQ ID NO.9-10.
[0016] According to a specific embodiment of the present invention, preferably, when the primer combination includes a combination of SEQ ID NO.1-2, SEQ ID NO.5-6 and SEQ ID NO.9-10, the plurality of rodents includes, but is not limited to, the following 15 rodent species: *Eolagurus luteus*, *Rhombomys opimus*, *Meriones unguiculatus*, *Meriones meridianus*, *Microtus juldaschi*, *Microtus fortis*, *Lasiopodomys brandtii*, *Ellobiustalpinus*, *Rattus andamanensis*, *Rattus tanezumi*, *Rattus losea*, *Rattus norvegicus*, *Apodemus uralensis*, *Apodemus agrarius*, and *Apodemus sulphurus*. sylvaticus).
[0017] On the other hand, the present invention also provides a kit for high-throughput assessment of drug resistance levels in rodent populations, wherein the kit comprises the primer combination described above.
[0018] On the other hand, the present invention also provides a method for high-throughput assessment of drug resistance levels in rodent populations, wherein the method includes the following steps: (1) Provide M rodent populations as a sample library to be tested, each population containing N rodent individual samples, and extract genomic DNA from each sample; wherein M≥1, and each N is independently ≥10; (2) Using the genomic DNA of each sample extracted in step (1) as a template, primers shown in SEQ ID NO.1-2 or SEQ ID NO.3-4, primers shown in SEQ ID NO.5-6 or SEQ ID NO.7-8, and primers shown in SEQ ID NO.9-10 were used to amplify the first, second, or third exon of the Vkorc1 gene, respectively; each amplification primer in each amplification reaction was labeled with a sample tag for identification of individual samples; (3) Mix the target amplification products to construct a library, perform second-generation sequencing, and obtain the number of individuals carrying different mutations and allele frequencies in each population; assess the drug resistance level of the mouse population based on the number of individuals carrying different mutations and allele frequencies in each population.
[0019] In the above method, in step (2), the sample label is added in the following ways: a label sequence is added only to the 5' end of the forward primer; or, different label sequences are added to the 5' ends of the forward primer and the reverse primer respectively, and the sample is identified by the combination of labels. In the above method, in step (2), the sample tag is an oligonucleotide sequence with a length of 5bp-9bp, preferably 7bp; each tag sequence satisfies the following: it contains only four bases: ATCG, the GC content is 40%-60%, there are no more than 3 consecutive identical bases, the Hamming distance between any two tag sequences is ≥3, and there is no reverse complementary conflict.
[0020] In the above method, in step (2), the amplification program is as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 30 s, annealing at 51℃~56℃ for 1 min, extension at 72℃ for 80 s, cycled 30-40 times; and finally extension at 72℃ for 10 min.
[0021] In the above method, in step (2), the second-generation sequencing is the PE250 or PE300 paired-end sequencing mode of the Illumina platform.
[0022] In the above method, in step (3), each sequencing library contains data from 50-200 individual samples.
[0023] In the above method, in step (3), the samples to be tested are grouped according to the region of origin of the individuals, and the number of individuals carrying different mutations and the frequency of alleles in each population of each region are counted respectively. In the above method, in step (3), when assessing the drug resistance level of the rodent population, the population... Vkorc1 Synonymous mutations in genes have virtually no effect on drug resistance in mice.
[0024] In the above method, in step (3), when assessing the drug resistance level of the rodent population, the population is statistically analyzed. Vkorc1 The proportion of individuals with nonsynonymous mutations in their genes is used to assess the level of resistance in a population to coagulant rodenticides. Vkorc1 Multiple non-synonymous mutations (i.e., amino acid alterations) in genes have been clearly shown to affect drug resistance in mice. This can be verified by statistical analysis of population data. Vkorc1 The proportion of individuals carrying amino acid variants associated with drug resistance was used to assess the level of resistance in a population to coagulant rodenticides.
[0025] In some specific embodiments of the present invention, the nonsynonymous mutation includes one or more combinations of Tyr139Cys, Leu120Gln, Leu128Ser, Ala26Thr, and Arg58Gly.
[0026] In some specific embodiments of the present invention, in striped field mice, the nonsynonymous mutations include one or more combinations of Ala14Val, Leu17Phe, Asp36Asn, Ser50Asn, Gly99Arg, Val118Leu, and His161Tyr.
[0027] In some specific embodiments of the invention, in the long-clawed gerbil, the nonsynonymous mutations include Leu76Glu and / or Val115Leu.
[0028] According to a specific embodiment of the present invention, the nonsynonymous mutation can be further identified by combining the lethal period food poisoning method (LFP) or by using expression systems such as cells or yeast for in vitro resistance detection, and then the drug resistance level of the population can be assessed based on the frequency of the mutation in the population.
[0029] In some specific embodiments of the present invention, SEQ ID NO.1-2 has an amplification efficiency of over 90% for the first exon of the Vkorc1 gene, specifically, the amplification efficiency for striped field mouse reaches 99.6%.
[0030] In some specific embodiments of the present invention, SEQ ID NO.3-4 has an amplification efficiency of over 90% for the first exon of the Vkorc1 gene, specifically, the amplification efficiency for Brandt's vole reaches 100%, and the amplification efficiency for long-clawed gerbil reaches 100%.
[0031] In some specific embodiments of the present invention, SEQ ID NO.5-6 has an amplification efficiency of over 90% for the second exon of the Vkorc1 gene, specifically, an amplification efficiency of 97.4% for Brandt's vole and 97.5% for Gerbil.
[0032] In some specific embodiments of the present invention, SEQ ID NO.7-8 has an amplification efficiency of over 65% for the second exon of the Vkorc1 gene, specifically, the amplification efficiency for striped field mouse reaches 68.9%.
[0033] In some specific embodiments of the present invention, SEQ ID NO. 9-10 has an amplification efficiency of over 90% for the third exon of the Vkorc1 gene. Specifically, the amplification efficiency for striped field mouse reaches 97.6%, for Brandt's vole reaches 96.3%, and for long-clawed gerbil reaches 95%.
[0034] On the other hand, the present invention also provides the application of the above-described primer combination, the above-described kit, or the above-described method in the preparation of products for monitoring drug resistance in rodents.
[0035] This invention provides a set of universal primer combinations that can be used to amplify the coding region of the Vkorc1 gene in various rodent species, and for the first time combines them with high-throughput next-generation sequencing technology. This significantly improves the species universality and detection throughput of rodent drug resistance monitoring, reduces the cost of large-scale screening, and overcomes the limitation of Sanger sequencing in accurately analyzing heterozygotes with insertions and deletions. It also improves the ability to discover new resistance mutations and provides a standardized and low-cost technical solution for efficient assessment of rodent drug resistance. Attached Figure Description
[0036] Figure 1 The results are PCR amplification results of the first exon region, where a represents the results of amplification of the first exon region of different mice using Vkor_e1_4F and Vkor_e1_4R; b represents the results of amplification of the first exon region of different mice using Vkor_e1_1F and Vkor_e1_10R.
[0037] Figure 2The results show the PCR amplification of the second exon region, where a represents the amplification of the second exon region of different mice using Vkor_e2_12F and Vkor_e2_12R; and b represents the amplification of the second exon region of different mice using Vkor_e2_A.a2F and Vkor_e2_A.a2R.
[0038] Figure 3 To amplify the third exon region of different mouse species using Vkor_e3_13F and Vkor_e2_13R.
[0039] Figure 4 Peak diagram of the missense mutation His161Tyr in black-striped field mice.
[0040] Figure 5 Peak diagram of the missense mutation Val115Leu in the long-clawed gerbil. Detailed Implementation
[0041] In order to provide a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention will now be described in detail below, but it should not be construed as limiting the scope of implementation of the present invention.
[0042] It should be noted that, unless otherwise specified, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0043] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.
[0044] It should be understood that the terms “comprising,” “including,” and / or “containing” as used herein specify the presence of the stated features, integers, steps, components, or combinations thereof, but do not exclude the presence or addition of one or more other features, integers, steps, components, or combinations thereof.
[0045] The endpoints and any values of the ranges disclosed in this invention are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of the various ranges, the endpoint values of the various ranges and individual point values, and individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this invention.
[0046] Example 1: Design and Screening of Universal Primer Sets
[0047] In this experiment, 13 pairs of primers were initially designed, and after screening, the 5 pairs of primers of this invention were determined.
[0048] The amplification effects of 13 primer pairs on striped field mice, Brandt's vole, and long-clawed gerbils are shown in Table 1.
[0049] Table 1
[0050] Based on the amplification results above, the five primer pairs initially screened are shown in Table 2.
[0051] Table 2 List of Amplification Primers
[0052] Example 2: Validation of multi-species amplification using a universal primer set
[0053] The primer pairs in Table 2 were used to amplify the following 23 different mouse species, including: Yellow-tailed Rat (Rhizophora spp.), a species belonging to the Cricetidae family and the Rhizophora genus. Eolagurus luteus ; large hamsters of the genus *Hamster* Cricetulus triton gray hamster Cricetulus migratorius, black-striped hamster Cricetulus barabensis ; gerbils of the genus *Gerberis* Rhombomys opimus Gerbils of the genus *Gerbilus* Meriones unguiculatus Meriones meridianus and Pamir voles (Voles of the genus Meriones meridianus). Microtus juldaschi And the Oriental vole, Microtus fortis; Brandt's vole, a species of the genus Microtus. Lasiopodomys brandtii Mole voles (Volvae of the genus Vulpes) Ellobius talpinus. Muridae: Rat (Rat nigra) Rattus andamanensis Yellow-breasted rat Rattus tanezumi, Yellow-haired rat Rattus losea and brown rat Rattus norvegicus Ural field mice (genus *Apoda*) Apodemus uralensis , Black-striped field mouse Apodemus agrarius and Kobayashi Himeko Apodemus sylvaticus Jerboa: Three-toed jerboas (family Jerboaidae, genus Tridactylus). Dipus sagitta Tarim jerboa Dipus deasyi Long-eared jerboas (genus *Long-eared jerboas*) Euchoreutes naso. Squirrels: Plateau mole rat (Rapidula spp.) Eospalax fontanierii .
[0054] First exon: Vkor_e1_4F and Vkor_e1_4R can amplify the first exon region of 22 mouse species ( Figure 1 In the a), Vkor_e1_1F and Vkor_e1_10R amplify relatively few species, but can amplify the first exons of 16 mouse species quite well. Figure 1 (b) in the middle.
[0055] Second exon: Vkor_e2_12F and Vkor_e2_12R can also amplify the second exon regions of 22 mouse species ( Figure 2 (a) Vkor_e2_A.a2F and Vkor_e1_A.a2R are not very effective for amplifying exons in jerboa species, but they can amplify exons 2 of other rodent species quite well, especially Ural field mice and striped field mice. Figure 2 (b) in the middle.
[0056] Third exon: Vkor_e3_13F and Vkor_e3_13R can amplify the third exon region of 15 mouse species ( Figure 3 The primers failed to amplify the species of red-cheeked ground squirrel, plateau mole rat, hamster, and jerboa, but showed good amplification results for the remaining 15 species.
[0057] Based on the PCR results above, the amplification of different mouse species using different primers is summarized in Table 3. Samples that were successfully amplified were marked as 1, and all three exons of 15 mouse species were obtained.
[0058] Table 3
[0059] Example 3: Large-scale drug resistance assessment of field mixed samples using NGS technology
[0060] The sample library for this experiment included 502 striped field mice, 120 long-clawed gerbils, and 191 Brandt's voles. The experimental procedure is as follows: (1) Sample collection A total of 502 striped field mouse samples were collected from 19 cities in 8 provinces (Heilongjiang, Jilin, Liaoning, Inner Mongolia, Henan, Hubei, Guizhou, and Jiangxi) and Beijing using the trapping method. The mouse tail samples were cut off, placed in 75% ethanol solution, and frozen at -20℃. Among them, Heilongjiang Province had 5 sampling sites (Harbin 134, Qiqihar 69, Daqing 16, Suihua 16, Jiamusi 15), Jilin Province had 3 (Changchun 30, Songyuan 17, Jilin 2), Jiangxi Province had 4 (Yichun 40, Nanchang 15, Jiujiang 5, Shangrao 5), Inner Mongolia Autonomous Region had 2 (Hulunbuir 80, Hinggan League 11), Liaoning Province (Shenyang 2), Beijing (Beijing 14), Henan Province (Zhoukou 15), Hubei Province (Tianmen 1), and Guizhou Province (Zunyi 15). The number of samples at each sampling site ranged from 1 to 134, covering multiple geographical populations from north to south.
[0061] A total of 120 long-clawed gerbil samples were collected from 12 sampling sites across 6 banners and cities in Inner Mongolia Autonomous Region (Siziwang Banner, Sunite Right Banner, Sunite Left Banner, Abaga Banner, Xilinhot City, and Xiwu Banner) using a trapping method. Tail samples were cut off and placed in 75% ethanol solution, then frozen at -20℃. Specifically, there were 2 sampling sites in Siziwang Banner (M_SZ1 16 samples, M_SZ2 18 samples), 2 sites in Sunite Right Banner (M_SR1 9 samples, M_SR2 8 samples), 2 sites in Sunite Left Banner (M_SL1 7 samples, M_SL2 8 samples), 3 sites in Abaga Banner (M_AB1 11 samples, M_AB2 9 samples, M_AB3 8 samples), 2 sites in Xilinhot City (M_XC1 8 samples, M_XC2 8 samples), and 1 site in Xiwu Banner (M_XB 10 samples). The number of samples at each sampling point ranged from 7 to 18, covering multiple geographical populations in the central grassland region of Inner Mongolia.
[0062] A total of 191 Brandt's vole samples were collected from 15 sampling sites across four banners and cities in Inner Mongolia Autonomous Region (Sunite Left Banner, Abaga Banner, Xilinhot City, West Ujimqin Banner, and East Ujimqin Banner). Specifically, there were 4 sampling sites in Sunite Left Banner (SLB1 11 samples, SLB2 18 samples, SLB3 17 samples, SLB4 14 samples), 4 sampling sites in Abaga Banner (AB1 8 samples, AB2 10 samples, AB3 15 samples, AB4 9 samples), 3 sampling sites in Xilinhot City (XC1 18 samples, XC2 9 samples, XC3 13 samples), 2 sampling sites in West Ujimqin Banner (XB1 12 samples, XB2 8 samples), and 2 sampling sites in East Ujimqin Banner (DB1 7 samples, DB2 22 samples). The number of samples at each sampling site ranged from 7 to 22, covering multiple geographical populations in the central grassland region of Inner Mongolia.
[0063] (2) Genomic DNA extraction
[0064] DNA was extracted using a tissue genome extraction kit (Novizan) and stored in TE buffer at pH 8.0.
[0065] (3) Primer and sequence tag design
[0066] Regarding primers: For striped field mice, the primers used were VK4_F / R (exon1), Vkor_e2_A.a2F / R (exon2), and VK13_F / R (exon3); for Brandt's voles and long-clawed gerbils, the primers used were VK1_F / 10R (exon1), VK_12F / R (exon2), and VK13_F / R (exon3).
[0067] Regarding sequence tags: This experiment used a Python program to randomly generate three sets of 300 7-bp indices by changing the random seed, satisfying the following conditions: containing only the four bases ATCG, GC content 40%~60% (i.e., 2~4 G / C), no three consecutive identical bases, Hamming distance between each pair >= 3, and no reverse complementary conflicts (i.e., no two indices are reverse complementary to each other, and no index is a palindrome). If the number of indices did not reach 300, the one with the highest number was selected. Then, all the 7-bp index sequences were merged, and the indices that met the above conditions were mixed and filtered again to remove duplicate tags, finally obtaining a library of 208 unique tags (see below). From this, 70 tags were selected and added to the 5' end of the black-striped field mouse forward primer. For example, the VK4F forward primer sequence GCATBCCTAGCTGYCDTGCC (SEQ ID NO.1) becomes ATACCGCGCATBCCTAGCTGYCDTGCC (SEQ ID NO.23) after adding the 7bp tag ATACCGC.
[0068] From a library of 208 tags, 70 tags were randomly selected and added to the 5' end of the forward primers (exon 1, 2, 3) of the three pairs of amplification primers for the striped field mouse. Another 40 tags were randomly selected and added to the 5' end of the forward amplification primers for exon 1 and exon 2 of the Brandt's vole. The exon 1 and exon 2 amplification primers were shared by the long-clawed gerbil and the Brandt's vole (these primers were retrieved based on species-specific characteristic sequences after sequencing). The third exon was common to all three species; the long-clawed gerbil and the Brandt's vole could directly use the exon 3 amplification primer from the striped field mouse.
[0069] 208 tag libraries: ACACAGT ACAGTCA ACTCTGA ACTGACT AGACTCT AGTCACA TCAGAGATGACTGA TGAGACT TGTCAGT TGTGTCA CAACTGT CATCAGA CATGTCT CACAAGT CACACTGCACTTGA CACTGAT CAGATCA CAGACAT CAGAGTC CAGTACT CAGTCTA CTAGACA CTTGAGTCTCACGA CTCAGAC CTCTCAG CTCTGTA CTGATGT CTGTAGA GAACACT GATCTCA GACATCTGACAGTA GACTACA GACTCAC GAGTCGT GTACAGA GTAGTCT GTCACAT GTCTAGT GTCGTGAGTGAACA GTGACTC GTGTCAA AACTGTC AACGTGT AAGAGCT AAGTCAG ATCTGCT ATGCACTACAACTG ACATCGA ACATGAG ACACGTA ACAGATC ACAGCAT ACTACGT ACTTGCA ACTGTTGACGTTCT ACGTCTC AGAAGTC AGATCAC AGAGTGC AGAGCTA AGTACAG AGTTCCT AGTCTACAGTCGTT AGCAACT AGCATGA AGCTCTG AGCTGAA AGGACTT TAGACGA TAGTGCA TTCAGCATTGACAG TCAAGCT TCATGTC TCACACG TCAGTAC TCTAGTG TCTTCAG TCTCGAA TCTGCTATCCATGT TCCTGGA TCGTAGT TGAACCA TGATCGT TGACAAC TGAGCAG TGTACTC TGTTGACTGCAGTT CAATGTG CAAGTAG CAAGCTT CATCTTG CATCGAC CATGATC CATGCAA CAGTTACCTATGGT CTACAAG CTACGTC CTAGCAC CTTAGCT CTTGGAG CTCAACG CTCGTAT CTGCTAACTGGATG CCAATGA CCACGAT CCGTGAA CGATTCA CGTAGAA CGTTCGA CGTCCAT GAACTACGAACCTAGAAGGTC GATTCTG GATTGCT GATGACG GATGTGC GACCATC GACGAAT GACGTTGGAGTTCG GAGCGAT GTATGCA GTACTTG GTTCAAC GTTCGTA GTTGCCA GTGGTAC GCATTGTGCTAAGA GCTCATT GCTGTAA GCCTCTA GCGAGTT AACTAGG AACCTAG AAGATGC AAGCGTGATTCTCG ATTGCTC ATCAAGC ATCCGGA ATCGAAG ATCGTCC ATGCTTC ATGGCGA ACTTAGCACCATCG ACCGGTT AGGTACC TATGCGT TACTCCG TACCTGC TACGACC TAGAACG TAGCCACTTCCATG TTCCGAT TTCGCAA TTGATCC TTGCAGC TTGCCTA TCAACGC TCGAATC TCGCTAGTGATGCG TGCAAGG TGCTATC CAATAGC CATACGC CCTATAG CCTTATG CCGCATA CCGGAATCGAATTG CGTAACC CGCAATA CGGTAAG GTAATGC GTAACCG GCATAAC GCTATTC GCCAATGGCCTTAG GGTATCG GGCCTAA AATCCGG AATGGCC ATACCGC ATAGGCG TAACGCC TAGGTGGCTTGTTA GGTAGGT AACGCCA
[0070] (5) Using the tagged primers described above, PCR amplification was performed on each individual. Each amplification primer in each amplification reaction was tagged with a sample for individual sample identification. Reaction system: 1 μL DNA template (120~200 ng), 1 μL each of forward and reverse primers (20 μmol / L), 2× Taq Add 12.5 μL of Master Mix and ddH2O to a final volume of 25 μL. Reaction conditions: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 51℃~56℃ annealing for 1 min (see Table 2 for specific annealing temperatures for each primer pair), 72℃ extension for 80 s, 35 cycles; 72℃ extension for 10 min.
[0071] PCR products were detected by electrophoresis on a 1.5% agarose gel. PCR products with similar brightness were mixed and then excised from the gel to avoid contamination with non-specific bands from some samples. After gel purification, the concentration was determined using a Nanodrop One micro-volume spectrophotometer (Thermo Fisher Scientific). Equimolar amounts of... Vkorc1 Fragment mixing.
[0072] (6) This experiment was performed using 8 libraries for high-throughput sequencing. Each library can hold 50–70 striped field mice, 20–40 Brandt's voles, and 12–30 long-clawed gerbils. The actual library capacity can be adjusted as needed.
[0073] Library construction was performed on the purified PCR products using the NEXTFLEX@Rapid DNA-Seq Kit: 1) adapter ligation; 2) removal of adapter self-ligated fragments using magnetic beads; 3) enrichment of library templates using PCR amplification; 4) recovery of PCR products using magnetic beads to obtain the final library. Sequencing was performed using an Illumina PE300 / PE250 platform (Shanghai Meiji Biotechnology Co., Ltd.).
[0074] (7) Data Analysis
[0075] After sequencing, the raw data was filtered using the following FastP commands: (1) Remove adapter contamination at the 3' end; (2) Quality filtering was performed using a sliding window method with a window size of 9 bp and a step size of 1 bp. Each time, one base was moved forward, and the average Q value of the window was calculated using 9 bases. If the average Q value of the window was ≤20, only the second to last base and the bases before it were retained. (3) Sequences containing more than 5 N were removed to obtain Clean data. The join_paired_ends.py script in qiime1.9 (http: / / qiime.org / index.html) was used to perform paired-end merging on the remaining sequences; then, fastx_toolkit-0.0.13.2 (http: / / hannonlab.cshl.edu / fastxtoolkit / ) was used to match the sequences and samples based on the individual barcode sequence; after converting the fastq to a fasta sequence, the barcode sequence was removed using split_libraries.py. Sequences with fewer than 20 repetitive sequences were removed using VSEARCH 2.8.1 software. Haplotypes with high repetition counts were selected, and the coding regions were preserved. DNA mutations in the coding regions that could lead to amino acid changes were analyzed. Based on currently published resistance variant sites in rodents worldwide, or combined with bioinformatics analysis methods, it was analyzed whether variations at these sites would lead to drug resistance, and the drug resistance level of the population was assessed.
[0076] (8) Results Analysis
[0077] Analysis results of the striped field mouse
[0078] After filtering the amplicon sequencing data from striped field mice, the following statistics were compiled: Vkorc1 The sequence counts of the three exons of the gene were obtained from 502 samples of striped field mice. The first exon sequences of 500 samples had a minimum repeat count of 15 times per sequence and an average repeat count of 752.3 times per sequence. The second exon sequences of 346 samples had a minimum repeat count of 8 times per sequence and an average repeat count of 153.8 times per sequence. The third exon sequences of 490 samples had a minimum repeat count of 12 times per sequence and an average repeat count of 644.6 times per sequence.
[0079] The distribution of different missense mutations in striped field mice across various provinces and cities is shown in Table 4.
[0080] Table 4
[0081] For all samples Vkorc1 Polymorphism analysis revealed 18 mutations, including 7 missense mutations (as shown in Table 4) and 11 synonymous mutations. The first exon carried 11 mutations, including 7 silent mutations (Gly2Gly, Arg12Arg, Lu15Leu, Ala18Ala, Leu24Leu, His28His, Arg40Arg) and 4 missense mutations (Ala14Val, Leu17Phe, Asp36Asn, Ser50Asn); the second exon region had no mutations; the third exon carried 7 mutations, including 4 silent mutations (Val104Val, Val112Val, Val114Val, and Ser117Ser) and 3 missense mutations (Gly99Arg, Val118Leu, His161Tyr).
[0082] Currently Vkorc1 All mutations leading to drug resistance in rodents identified in the coding region were missense mutations, with Ala14Val being the most widespread. The allele frequency of this mutation was highest in the Zunyi population of Guizhou (33.33%), followed by the Hinggan League population of Inner Mongolia (27.27%), the Shangrao population of Jiangxi (10.00%), the Qiqihar population of Heilongjiang (8.70%), the Harbin population (5.30%), the Jiamusi population (3.33%), the Daqing population (3.13%), the Beijing population (3.57%), the Changchun population of Jilin (3.33%), and the Hulunbuir population of Inner Mongolia (5.00%).
[0083] The Asp36Asn mutation was detected in eight provinces and Beijing, with Beijing showing the presence of the mutation, and four other provinces also showing the mutation. The allele frequency of this mutation was highest in the Yichun population of Jiangxi (17.50%), followed by Nanchang (6.67%), Daqing (6.25%), Qiqihar (3.62%), Suihua (3.13%), and Harbin (1.14%) in Heilongjiang; Beijing (3.57%), Songyuan (2.94%), and Changchun (1.67%) in Jilin; and Hulunbuir (0.63%) in Inner Mongolia.
[0084] His161Tyr was detected in eight provinces and Beijing, with the mutation present in Beijing and four other provinces. The allele frequency of this mutation was highest in the Beijing population (17.86%), followed by Harbin (8.33%), Jiamusi (6.67%), and Qiqihar (5.97%) in Heilongjiang Province; Songyuan (5.88%) and Changchun (2.00%) in Jilin Province; Hinggan League (4.55%) and Hulunbuir (4.43%) in Inner Mongolia; and Zunyi (3.33%) in Guizhou Province. The mutation was also verified using first-generation sequencing, as shown in the peak diagram below. Figure 4 As shown (His161TyrCAC→TAC).
[0085] The remaining four missense mutations were distributed in only one population, with only one individual carrying each mutation and existing in a heterozygous form. Gly99Arg was distributed in Jilin City, Ser50Asn in Shangrao, Jiangxi, Val118Leu in Hulunbuir, Inner Mongolia, and Leu17Phe in Harbin, Heilongjiang, with allele frequencies of 25%, 10%, 0.63%, and 0.38%, respectively.
[0086] The binding affinity between 9 anticoagulant rodenticides and 7 different VKORC1 protein mutants was predicted using AutoDockVina. The results in Table 5 showed that compared with the wild type, the binding ability of VKORC1 proteins carrying missense mutations decreased to varying degrees with different anticoagulant rodenticides. Compared with the wild type, the range of changes in binding scores for the 7 VKORC1 mutants was from -6.063 to 6.355. Among the 63 binding score change values, 44.4% of the binding score change values were positive, indicating that the amino acid changes more or less affected the binding affinity with different types of anticoagulant rodenticides. Among them, Ala14Val significantly affected the binding of VKORC1 protein with bromadiolone and flocoumafen (BSCs > 1.5 kcal / mol), Leu17Phe significantly affected the binding of VKORC1 protein with flocoumafen, Asp36Asn significantly affected the binding of VKORC1 protein with coumatetralyl, chlorophacinone and bromadiolone, Gly99Arg significantly affected the binding of VKORC1 protein with warfarin, sodium diphacinone, chlorophacinone, bromadiolone and flocoumafen, His161Tyr significantly affected the binding of VKORC1 protein with bromadiolone, and Ser50Asn and Val118Leu had only a slight effect on the binding ability of anticoagulant rodenticides (0 kcal / mol < BSCs < 1.5 kcal / mol). This indicates that there are significant differences in the binding affinity of the same mutation with different rodenticides.
[0087] Table 5
[0088] Sequencing results of Brandt's voles
[0089] A total of 191 Brandt's voles from 15 sampling sites were obtained Vkorc1 sequences, covering 191, 186 and 184 sequences of the first, second and third exons respectively (Table 6). Due to low quality of sample genomic DNA, failed PCR amplification or failed second-generation sequencing, some exon sequences were missing. Among the 15 sampling sites, the sample size of 10 sampling sites was ≥ 10 (Table 6). The geographical location, sample size and Vkorc1 mutation status of Brandt's voles in different regions of Inner Mongolia are shown in Table 6.
[0090] Table 6 Brandt's voles in Xilingol League Vkorc1 Polymorphism in the gene coding region
[0091] "-" indicates not detected Vkorc1 Silent mutation or missense mutation. The numbers in parentheses are the allele numbers of the mutation
[0092] Brandt's voles in different regions of Inner Mongolia Vkorc1 Polymorphism revealed four mutations, including four silent mutations: Ala72Ala, Leu92Leu, Val107Val, and His129His. Furthermore, 21 mutations containing only... Vkorc1 Individual fragments with silent mutations were validated using first-generation Sanger sequencing, and the results were completely consistent with amplicon sequencing. In summary, within the Brandt's vole population... Vkorc1 Only silent mutations were found in the gene exons, and no missense mutations that could lead to amino acid mutations were found, indicating that the Brandt's vole population tested did not develop resistance variants in the target genes of the anticoagulant.
[0093] Sequencing results of long-clawed gerbils
[0094] A total of 120 long-clawed gerbils were obtained from 12 sampling sites. Vkorc1 The sequences covered 120, 117, and 114 sequences of the first, second, and third exons, respectively (Table 7). Some exon sequences were missing due to low genomic DNA quality, PCR amplification failure, or next-generation sequencing failure. Geographical location, sample size, and... (The text abruptly ends here, likely due to an incomplete sentence or missing information.) Vkorc1 The mutation details are shown in Table 7.
[0095] Table 7 Long-clawed gerbils Vkorc1 Polymorphism in gene coding regions "-" indicates that no detection was detected. Vkorc1 Silent mutations or missense mutations. The numbers in parentheses indicate the number of alleles for that mutation. For long-clawed gerbils Vkorc1 Polymorphism analysis revealed four mutations, including two missense mutations and two synonym mutations. Specifically, the first exon region contained no mutations; the second exon region carried one synonym mutation (Asp72Asp) and one missense mutation (Leu76Glu); and the third exon region carried two mutations, including one synonym mutation (Gly144Gly) and one missense mutation (Val115Leu).
[0096] Val115Leu was distributed across four geographic populations. The highest frequency of this mutation was observed in the Abaga Banner M_AB3 population, with 2 out of 9 long-clawed gerbils carrying the mutation (allele frequency 25%). In the Abaga Banner M_AB2 population, 1 out of 8 long-clawed gerbils carried the mutation (allele frequency 11.1%). In the Xilinhot M_XC1 population, 2 out of 8 long-clawed gerbils carried the mutation (allele frequency 18.75%). In the Xilinhot M_XC2 population, 1 out of 8 long-clawed gerbils carried the mutation (allele frequency 12.5%). The results of first-generation sequencing validation of Val115Leu (GTT→C) are as follows... Figure 5 As shown.
[0097] Leu76Glu was distributed across three geographic populations. The mutation had the highest frequency in the M_XB population of Xiwuqi, where 1 in 10 long-clawed gerbils carried the mutation (allele frequency of 5%). In the M_SZ1 population of Siziwangqi, 1 in 16 long-clawed gerbils carried the mutation (allele frequency of 3.13%), and in the M_SZ2 population of Siziwangqi, 1 in 18 long-clawed gerbils carried the mutation (allele frequency of 2.78%). Cytb analysis of the population genetic structure showed low differentiation between the M_SZ1 and M_SZ2 populations in Siziwangqi, suggesting that Leu76Glu may have been exchanged and dispersed between the two populations in the Siziwangqi area.
[0098] The binding affinity between nine anticoagulant rodenticides and two different VKORC1 protein mutants was predicted using AutoDockVina. Table 8 shows that, compared to the wild type, the VKORC1 protein carrying the missense mutation exhibited varying degrees of decreased binding affinity to different anticoagulant rodenticides. The binding scores of the two VKORC1 mutants ranged from -9.180 to 5.463 compared to the wild type. Of the 18 BSC values, 67% were positive, indicating that amino acids more or less affected the binding affinity with different types of anticoagulants. Specifically, Leu76Glu significantly affected the binding affinity of VKORC1 protein to warfarin and fluoroquinolones (BSCs > 1.5 kcal / mol), while Val115Leu significantly affected the binding affinity of VKORC1 protein to both warfarin and fluoroquinolones, suggesting that these two mutations may have a significant impact on the binding affinity of VKORC1 protein to first-generation anticoagulant rodenticides.
[0099] Table 8. Changes in binding fractions (BSCs) of different missense mutations
[0100] In summary, we can determine the correlation between Vkorc1 variation and drug resistance, and assess the drug resistance level of the population. Vkorc1 Synonymous mutations in genes generally do not affect drug resistance in rodents. However, many missense mutations, such as Tyr139Cys, Leu120Gln, and Leu128Ser, exhibit resistance to first-generation anticoagulants and some second-generation anticoagulants, such as bromadiolone, in house mice and brown rats. Ala26Thr and Arg58Gly show moderate resistance. Missense mutations found in striped field mice and long-clawed gerbils have not been reported in house mice, brown rats, roof rats, plateau mole rats, and yellow-breasted rats. Further research could combine lethal poisoning (LFP) assays or in vitro resistance detection using cell or yeast expression systems to further identify the correlation between these mutations and resistance. Then, the frequency of the mutation in the population could be used to assess the level of drug resistance.
[0101] The above embodiments illustrate and describe the main features and advantages of the present invention in detail. However, the present invention is not limited to the embodiments described. Those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention. All such equivalent modifications or substitutions are included within the scope defined by the claims of the present invention.
Claims
1. A primer combination for amplifying the Vkorc1 gene in various rodent species, wherein, The primer combination includes three pairs of primers for amplifying the three exons of the Vkorc1 gene, respectively. The primer sequences for amplifying the first exon are shown in SEQ ID NO.1-2 or SEQ ID NO.3-4, the primer sequences for amplifying the second exon are shown in SEQ ID NO.5-6 or SEQ ID NO.7-8, and the primer sequences for amplifying the third exon are shown in SEQ ID NO.9-10.
2. The primer combination according to claim 1, wherein, The primer combination includes combinations of SEQ ID NO.1-2, SEQ ID NO.5-6 and SEQ ID NO.9-10.
3. The primer combination according to claim 2, wherein, The various rodents mentioned include, but are not limited to, the following 15 species: Yellow-tailed gerbil (Eolagurus luteus), Large gerbil (Rhombomys opimus), Long-clawed gerbil (Meriones unguiculatus), Meriones meridianus, Pamir vole (Microtus juldaschi), Oriental vole (Microtus fortis), Brandt's vole (Lasiopodomys brandtii), Mole vole (Ellobiustalpinus), Black-edged gerbil (Rattus andamanensis), Yellow-breasted rat (Rattus tanezumi), Yellow-haired rat (Rattus losea), Brown rat (Rattus norvegicus), Ural field mouse (Apodemus uralensis), Striped field mouse (Apodemus agrarius), and Small forest field mouse (Apodemus sylvaticus).
4. A kit for high-throughput assessment of drug resistance levels in rodent populations, wherein, The kit comprises the primer combination as described in any one of claims 1-3.
5. A high-throughput method for assessing drug resistance levels in rodent populations, wherein, The method includes the following steps: (1) Provide M rodent populations as a sample library to be tested, each population containing N rodent individual samples, and extract genomic DNA from each sample; wherein M≥1, and each N is independently ≥10; (2) Using the genomic DNA of each sample extracted in step (1) as a template, primers shown in SEQ ID NO.1-2 or SEQ ID NO.3-4, primers shown in SEQ ID NO.5-6 or SEQ ID NO.7-8, and primers shown in SEQ ID NO.9-10 were used to amplify the first, second, or third exon of the Vkorc1 gene, respectively; each amplification primer in each amplification reaction was labeled with a sample tag for identification of individual samples; (3) Mix the target amplification products to construct a library, perform second-generation sequencing, and obtain the number of individuals carrying different mutations and allele frequencies in each population; The drug resistance level of rodent populations was assessed based on the number of individuals carrying different mutations and the allele frequency in each population.
6. The method according to claim 5, wherein, In step (2), the sample tags are added in the following ways: a tag sequence is added only to the 5' end of the forward primer; or, different tag sequences are added to the 5' ends of the forward and reverse primers respectively, and the identification of the sample is achieved by combining the tags. Preferably, in step (2), the sample tag is an oligonucleotide sequence with a length of 5-9 bp, and each tag sequence satisfies the following: it contains only four bases: ATCG, the GC content is 40%-60%, there are no more than 3 consecutive identical bases, the Hamming distance between any two tag sequences is ≥3, and there is no reverse complementary conflict.
7. The method according to claim 5, wherein, The amplification procedure described in step (2) is as follows: pre-denaturation at 95℃ for 5 min; denaturation at 95℃ for 30 s, annealing at 51℃~56℃ for 1 min, extension at 72℃ for 80 s, repeated 30-40 times; and finally extension at 72℃ for 10 min. Preferably, the second-generation sequencing in step (2) is the PE250 or PE300 paired-end sequencing mode of the Illumina platform.
8. The method according to claim 5, wherein, In step (3), each sequencing library contains data from 50-200 individual samples.
9. The method according to claim 5, wherein, In step (3), the samples to be tested are grouped according to the region of origin of the individuals, and the number of individuals carrying different mutations and the frequency of alleles in each population in each region are counted. Preferably, in step (3), when assessing the drug resistance level of the rodent population, the population... Vkorc1 Synonymous mutations in genes have virtually no effect on drug resistance in mice.
10. The use of the primer combination according to any one of claims 1-3, or the kit according to claim 4, or the method according to any one of claims 5-9 in the preparation of a product for monitoring rodent drug resistance.