A nucleic acid aptamer binding to mpn-372 protein and application thereof
By designing the high-affinity, high-specificity nucleic acid aptamer MPN-01, the problems of low specificity and complex operation of traditional detection methods have been solved, enabling rapid and accurate detection and diagnosis of MPN-372 protein, and supporting disease prevention and control.
Patent Information
- Application Number
- CN202610945277.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-29
- Publication Date
- 2026-07-24
AI Technical Summary
Existing technologies are insufficient for the rapid and accurate detection of the expression level of MPN-372 protein, a CARDS toxin from Mycoplasma pneumoniae. Traditional detection methods are characterized by low specificity, complex operation, and high cost, which hinders disease prevention and control.
We designed and synthesized the high-affinity, high-specificity nucleic acid aptamer MPN-01, screened and modified it using SELEX technology, and bound it to the MPN-372 protein to develop nucleic acid aptamers and their derivatives suitable for detection, diagnosis and treatment.
It achieves highly sensitive and low-cost detection and diagnosis of MPN-372 protein, simplifies operation, is suitable for promotion at the grassroots level, can reflect the severity of infection, and supports the formulation of treatment plans.
Smart Images

Figure CN122445656A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and more particularly to a nucleic acid aptamer that binds to the MPN-372 protein and its applications. Background Technology
[0002] Mycoplasma pneumoniae is a key pathogen of community-acquired respiratory infections. It belongs to the genus Mycoplasma in the class Mycoplasmata. It has no cell wall and is highly pleomorphic. It can cause bronchitis, primary atypical pneumonia, hemolytic anemia, and extrapulmonary complications such as nervous system damage, endangering human health.
[0003] Its pathogenicity is related to the synergistic effect of multiple virulence factors. CARDS toxin (MPN-372 protein) is the core pathogenic molecule, a 59 kDa protein encoded by Mycoplasma pneumoniae. It damages host cells through the following mechanisms: (1) ADP-ribosylation activity: It has ADP-ribosyltransferase activity, catalyzing NAD+. + ADP-ribose groups are transferred to host target proteins such as G protein subunits and actin, leading to signaling pathway disorder, cytoskeleton damage and respiratory epithelial cell apoptosis. (2) Immune escape: inhibits the secretion of pro-inflammatory cytokines such as tumor necrosis factor-α, induces an immunosuppressive microenvironment, and weakens the host's ability to clear pathogens. (3) Direct membrane damage: causes erythrocyte cold agglutination and hemolysis, destroys the integrity of the respiratory mucosal barrier, and aggravates infection.
[0004] Diagnostic techniques for CARD toxins face numerous challenges. Traditional serological tests (such as cold agglutination tests and antibody ELISA) rely on whole pathogen antigens, which suffer from low specificity due to cross-antigens and a window period lag, making timely diagnosis difficult. While PCR-based nucleic acid testing offers high sensitivity, it cannot reflect the expression level and pathogenicity of CARD toxins, making it difficult to predict infection severity and impacting treatment planning. Furthermore, existing testing technologies are complex, time-consuming, and costly, requiring specialized equipment and personnel, hindering their widespread adoption at the grassroots level. The aforementioned problems limit the accuracy and timeliness of diagnosis for Mycoplasma pneumoniae infection, impacting disease control. Nucleic acid aptamers targeting the MPN-372 protein are of great significance. As oligonucleotide fragments with high specificity and high affinity for binding target molecules, they can specifically recognize the MPN-372 protein, directly reflecting its expression level. This overcomes the inherent limitations of traditional serological detection methods, such as long window periods, high cross-reactivity, and the inability of PCR detection to assess toxin pathogenicity. Furthermore, the aptamer has a small molecular weight, and its stability can be optimized through modification, facilitating storage and transportation. Its ease of operation promises to reduce costs and facilitate widespread adoption at the grassroots level. Therefore, developing diagnostic technologies based on this aptamer has significant clinical value in improving diagnostic efficacy. Summary of the Invention
[0005] To overcome at least one of the defects described in the prior art, the present invention provides a nucleic acid aptamer that binds to MPN-372 protein and its application. It provides a nucleic acid aptamer with small molecular weight, stable chemical properties, easy storage and labeling, which can bind to MPN-372 protein with high affinity. Moreover, it can maintain high affinity and high specificity binding to MPN-372 protein and can be used for detection, diagnosis, imaging and treatment, etc., with broad application prospects.
[0006] The technical solution adopted by this invention to solve its problem is: A nucleic acid aptamer that binds to the MPN-372 protein, said nucleic acid aptamer having a nucleotide sequence as shown in SEQ ID NO.1; or a nucleotide sequence that has at least 30% homology with SEQ ID NO.1 and binds to the MPN-372 protein; or an RNA sequence transcribed from a nucleotide sequence as shown in SEQ ID NO.1.
[0007] Based on SELEX technology, the inventors designed and synthesized a random single-stranded DNA library and corresponding primers to screen for nucleic acid aptamers that can bind to MPN-372 protein with high affinity, are chemically stable, easy to store and label, and have small molecular weight. A nucleic acid aptamer that binds to MPN-372 protein with high affinity was obtained, namely MPN-01 (SEQ ID NO.1). This nucleic acid aptamer has high affinity and high specificity for MPN-372 protein.
[0008] It is understood that any nucleotide sequence that has at least 30%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% homology with the nucleic acid aptamer provided by the present invention and binds to the MPN-372 protein, for example, by deleting or adding a portion of the nucleotide sequence shown in any of the above-mentioned nucleic acid aptamers, still has a high affinity for the MPN-372 protein and is still within the protection scope of the present invention.
[0009] In some approaches, as an improvement to the above-mentioned technical solutions, a certain position on the nucleotide sequence of the nucleic acid aptamer can be modified, for example, by phosphorylation, methylation, aminoation, thiolation, substitution of oxygen with sulfur, substitution of oxygen with selenium, or isotopization, provided that the nucleic acid aptamer sequence obtained after such modification has the desired properties. For example, it can have the same or higher affinity for binding MPN-372 protein as the original parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.
[0010] Therefore, in some embodiments, the nucleotide sequence of the nucleic acid aptamer is modified and the modified nucleic acid aptamer specifically binds to the MPN-372 protein. The modification is selected from at least one of phosphorylation, methylation, amination, thiolation, substitution of oxygen with sulfur, substitution of oxygen with selenium, and isotopization, which is still within the scope of protection of this invention.
[0011] On the other hand, the present invention provides a conjugate or derivative of a nucleic acid aptamer having a nucleotide sequence as shown in SEQ ID NO.1; the conjugate of the nucleic acid aptamer includes a fluorescent label; the derivative of the nucleic acid aptamer includes a phosphate thioester backbone or peptide nucleic acid that binds to MPN-372 protein, modified from the nucleotide sequence backbone of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer.
[0012] The conjugate of the nucleic acid aptamer described in this invention refers to the attachment of other groups to the nucleic acid aptamer, such as fluorescent markers with labeling functions, such as FAM, radioactive substances, therapeutic substances, biotin, digoxigenin, nanoluminescent materials, small peptides, siRNA, or enzyme labeling, so that the modified nucleic acid aptamer sequence has the desired properties. For example, it can have the same or higher affinity for binding MPN-372 protein as the original parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.
[0013] In other words, all of the above nucleic acid aptamers, whether partially substituted or modified, have the same or similar molecular structure, physicochemical properties and functions as the original nucleic acid aptamers, and can all be used to bind to the MPN-372 protein.
[0014] Furthermore, this invention also provides nucleic acid aptamer derivatives, which are obtained by modifying the nucleotide sequence backbone of the aforementioned nucleic acid aptamer into a phosphate thioester backbone that binds to the MPN-372 protein, or by modifying the nucleic acid aptamer or its conjugate as described in any of the foregoing technical solutions into a peptide nucleic acid that binds to the MPN-372 protein. The condition is that all derivatives have essentially the same or similar molecular structure, physicochemical properties, and functions as the original nucleic acid aptamer, and all bind to the MPN-372 protein.
[0015] The term "thiophosphate backbone" as used in this invention has the meaning commonly understood by those skilled in the art, referring to the fact that the non-bridging oxygen atoms of the phosphodiester backbone of RNA and DNA nucleic acid aptamers can be replaced by one or two sulfur atoms, respectively, to produce a thiophosphate backbone with thiophosphate or dithiophosphate bonds. Such thiophosphate backbones are known to have increased binding affinity to their targets and enhanced resistance to nuclease degradation.
[0016] The term "peptide nucleic acid" as used in this invention has the meaning commonly understood by those skilled in the art, referring to a synthetically produced DNA molecule analog first reported by Nielsen et al. in 1991. By replacing the sugar-phosphate backbone with N-2-(aminoethyl)-glycine units as repeating structural units, oligonucleotide analogs linked by peptide bonds were synthesized, called peptide nucleic acids. Because peptide nucleic acids (PNAs) lack phosphate groups like those on DNA or RNA, there is no electrostatic repulsion between PNAs and DNA, resulting in a stronger binding strength between them than between DNA molecules.
[0017] In another aspect, the present invention provides a product for purifying or detecting MPN-372 protein, the product comprising the nucleic acid aptamer as described above or a conjugate or derivative of the nucleic acid aptamer as described above; the product comprises any one or more of a kit, a detection chip, and a chromatography detection device.
[0018] In another aspect, the present invention provides a method for screening nucleic acid aptamers that bind to the MPN-372 protein, the method comprising the following steps: (1) Synthesize random single-stranded DNA libraries and primers; (2) Magnetic bead screening: Perform at least 6 rounds of reverse screening and screening, and add serum in the 6th round.
[0019] Further, in step (2), 5% serum is added in the 5th round, the serum being human serum (normal human serum, purchased from Beijing Solarbio Technology Co., Ltd., item number: SL010).
[0020] The method for screening nucleic acid aptamers that bind to MPN-372 protein provided in this invention is based on the SELEX screening method. In the magnetic bead screening step, serum is added from the 5th round for blocking to further improve the specificity and stability of the nucleic acid aptamers.
[0021] Nucleic acid aptamer screening is routinely performed in ion-buffered saline. However, adding a certain concentration of serum to the screening process serves two purposes. First, serum is rich in proteins that can competitively bind to the library along with the proteins on the magnetic bead surface, thus removing sequences that have weak binding affinity to the target MPN-372 protein or are merely adsorbed. Second, the binding of aptamers to the target in a serum environment better meets the practical detection requirements for future applications developed based on nucleic acid aptamers.
[0022] Studies have shown that using high concentrations of serum in subsequent rounds of screening can yield nucleic acid aptamers with higher affinity and better specificity.
[0023] In another aspect, the present invention provides the use of the nucleic acid aptamer as described above, or conjugates or derivatives of the nucleic acid aptamer as described above, for preparing reagents for detecting or purifying MPN-372 protein.
[0024] In another aspect, the present invention provides the use of the nucleic acid aptamer as described above, or conjugates or derivatives of the nucleic acid aptamer as described above, for the preparation of a drug targeting the MPN-372 protein.
[0025] In some embodiments, the present invention provides for use of the above-described nucleic acid aptamers, their conjugates, or derivatives thereof in any one of the group consisting of: 1) Quantitative or qualitative detection of MPN-372 protein; 2) Purify MPN-372 protein; 3) Imaging of the MPN-372 protein; 4) Prepare drugs targeting the MPN-372 protein; 5) Prepare reagents or drugs for the diagnosis and treatment of abnormal MPN-372 expression.
[0026] The beneficial effects of the nucleic acid aptamer for binding MPN-372 protein provided by this invention are as follows: 1. By improving the screening conditions, a chemically stable, easily preserved and labeled nucleic acid aptamer capable of binding to MPN-372 protein with high affinity and high specificity was obtained; 2. The structure is relatively stable, simple, easy to modify, and can be artificially synthesized in a short period of time; it is chemically stable, easy to store, and easy to label. 3. It can be used in detection, diagnosis, imaging and treatment, such as for purifying or highly sensitively detecting MPN-372 protein; for preparing drugs that target MPN-372 protein; and for reagents or drugs for diagnosing and treating abnormal MPN-372 expression, etc., with broad application prospects. Attached Figure Description
[0027] Figure 1 This is a schematic diagram showing the binding ability of the enriched libraries obtained in rounds 1, 3-5 of screening to the MPN-372 target protein, as detected by SPR in Example 1. Figure 2 This is a graph showing the SPR affinity detection data of the nucleic acid aptamer MPN-01 and the target protein MPN-372 in Example 2; Figure 3 This is a graph showing the SPR affinity detection data of nucleic acid aptamer MPN-01 with non-target proteins such as CD331, C4B, and CK19 in Example 3. Figure 4This is an example of the dot blot hybridization experiment based on the nucleic acid aptamer MPN-01 to detect the binding of different concentrations of the MPN-372 target protein. Detailed Implementation
[0028] To better understand and implement this invention, the technical solutions in the embodiments of this invention will be clearly and completely described and discussed below with reference to the accompanying drawings. Obviously, what is described here is only a part of the examples of this invention, not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the protection scope of this invention.
[0029] To facilitate understanding of the embodiments of the present invention, further explanations and descriptions will be provided below with reference to the accompanying drawings and specific embodiments. These embodiments do not constitute a limitation on the embodiments of the present invention.
[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
[0031] Example 1: Screening of ssDNA aptamers for MPN-372 target protein The method for screening ssDNA aptamers that bind to the MPN-372 target in this embodiment includes the following steps: 1. Synthesize the random single-stranded DNA library and primers shown in the following sequences: Random single-stranded DNA library: 5'-TTCAGCACTCCACGCATAGC(37N)CCTATGCGTGCTACCGTGAA-3' (SEQ ID NO. 2); In this context, "37N" represents a sequence consisting of 37 arbitrary nucleotide bases linked together. This library was synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0032] Primer information is shown in Table 1, synthesized by Nanjing GenScript Biotech Co., Ltd.
[0033] Table 1. Primers and their sequences
[0034] In the primer names, S represents the forward primer and A represents the reverse primer.
[0035] Primers were prepared into 100 μM stock solutions using DPBS buffer (calcium chloride 0.1 g / L, potassium chloride 0.2 g / L, potassium dihydrogen phosphate 0.2 g / L, magnesium chloride hexahydrate 0.1 g / L, sodium chloride 8 g / L, disodium hydrogen phosphate dodecahydrate 2.8915 g / L; pH 7.4, 25℃) and stored at -20℃ for later use.
[0036] 2. Screening using target immobilization magnetic beads The magnetic bead method was used for screening, and a total of 6 rounds of screening were conducted. The screening process for each round is shown in Table 2.
[0037] Table 2. Screening process for MPN-372 target protein aptamers
[0038] The specific screening process is as follows: 1) Immobilization of MPN-372 protein with carboxyl magnetic beads Take 50 μL of carboxyl magnetic beads (Jiangsu Zecheng Biotechnology Co., Ltd., product number: FM2221), wash 4 times with 200 mL DPBS, use a magnet to fish the magnetic beads, and discard the supernatant. Take 100 μL each of prepared NHS (N-hydroxysuccinimide; 0.1 M aqueous solution) and EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4 M aqueous solution), mix them in equal volumes, add them to the magnetic beads, and incubate at 25 °C for 20 minutes to activate the carboxyl groups on the surface of the magnetic beads. Wash the magnetic beads twice with DPBS buffer and set aside.
[0039] Take 10 μL of MPN-372 protein (concentration 1 mg / mL), add 80 μL of 10 mM sodium acetate (pH 4.5), mix well, and then add to the activated magnetic beads. Incubate at 25°C on a vertical mixer for 60 minutes. The MPN-372 protein will couple to the surface of the magnetic beads through the amino groups on its surface.
[0040] After coupling, place the coupling tube on a magnetic rack, discard the supernatant, and add 100 μL of 1M ethanolamine (pH 8.5) to the magnetic beads. Incubate at 25°C on a vertical mixer for 10 minutes to block unreacted activation sites on the surface of the magnetic beads. Place the tube on a magnetic rack and discard the blocking solution. Wash the magnetic beads four times with 200 μL of DPBS and label them MB-MPN-372.
[0041] 2) Reverse screening and screening Preparation of reverse screening magnetic beads: His protein, synthesized by Genscript Biotech, was coupled to the magnetic beads. The His protein consisted of nine consecutive histidine residues. The coupling procedure for His protein was the same as that for MPN-372 protein. The concentration of His protein was 1 mg / mL, diluted with 10 mM NaAC solution at pH 4.0. Specifically, 10 μL of His protein was added to 80 μL of 10 mM NaAC solution at pH 4.0 and mixed thoroughly. The remaining steps were the same. The coupled magnetic beads were labeled MB-His.
[0042] Library dissolution and renaturation: Take 1 OD of random single-stranded nucleotide library, centrifuge at 12000 rpm for 5 minutes, and centrifuge to the bottom of the tube. Dissolve in DPBS buffer to 10 μM, mix well, and aliquot into PCR tubes for renaturation. The process is as follows: Set the PCR instrument to 95℃ for 10 minutes to unfold the strands, then incubate at 4℃ for 5 minutes, and then equilibrate to room temperature. Add the treated library to 50 μL of MB-His magnetic beads, mix well, and incubate at room temperature for 30 minutes on a vertical mixer. Place on a magnetic rack, collect the supernatant, and label it pool-. The supernatant is used as the single-stranded nucleic acid library for positive screening with MB-MPN-372 magnetic beads. Before each round of magnetic bead screening for MPN-372 protein target positive screening, MB-His is used for reverse screening. The supernatant from the reverse screening is used as the single-stranded nucleotide library for positive screening with MB-MPN-372 magnetic beads. Specifically, the back-screened library pool- was added to 50 μL of MB-MPN-372 magnetic beads and incubated at 25°C for 40 minutes on a vertical mixer. Then, the mixture was placed on a magnetic rack, the supernatant was discarded, and the magnetic beads were washed four times with 200 μL of DPBS. Finally, 200 μL of DPBS was added to the washed magnetic beads, and the mixture was incubated in a boiling water bath for 10 minutes. The supernatant was collected and labeled elution-MPN-372.
[0043] Using the nucleic acid molecules in elution-MPN-372 as templates, amplification was performed using conventional PCR. The method is as follows: All elution-MPN-372 template was added to 2 mL of PCR mix and mixed thoroughly. The template and PCR mix mixture was then aliquoted into 100 μL tubes and added to PCR tubes. The amplification conditions were as follows: 95℃ pre-denaturation for 2 minutes, 95℃ denaturation for 60 seconds, 60℃ annealing for 60 seconds, and 72℃ extension for 60 seconds, for a total of 25 cycles. The mixture was stored at 4℃. The PCR mix was prepared using dNTPs (P031-02) purchased from Novizan and rtaq enzyme (R500Z) purchased from Takara Bio.
[0044] The amplification products were purified using commercially available Tiandiren SA magnetic beads (SM017100) to prepare a secondary library for the next round of screening. 2 mL of PCR product was mixed with 1 / 5 volume of 4M sodium chloride, followed by 160 μL of SA magnetic beads that had been washed with DPBS and had their supernatant removed. The mixture was incubated on a shaker at room temperature for 30 min, after which the PCR supernatant was removed. The magnetic beads were then washed three times with DPBS containing 0.02% Tween 20, and after removing the supernatant, 100 μL of 40 mM sodium hydroxide solution was added. After incubation for three minutes, the magnetic beads were magnetically removed. 4 μL of 1M hydrochloric acid was added to the supernatant to neutralize the single strands, followed by 104 μL of 2×DPBS for salt dilution and neutralization. Finally, 208 μL of the secondary library dissolved in 1×DPBS was obtained, which can be used as the library for the next round of screening.
[0045] The magnetic bead method was repeated for six rounds. Each operation used the secondary library obtained from the previous operation as the starting nucleic acid library. After renaturation treatment, the library was incubated with MB-His and MB-MPN-372 magnetic beads for reverse and forward screening, respectively. Figure 1 As shown, SPR was used to detect changes in the ability of each round of single-stranded DNA library to recognize the MPN-372 protein during the screening process. Figure 1 In this diagram, Pool1 represents the enriched library from the first round, and Pool(n) represents the affinity of the single-stranded DNA library for the magnetic screening beads in each round. Pool1, Pool3, Pool4, and Pool5 represent the libraries obtained from the first, third, fourth, and fifth rounds of positive screening, respectively. When the recognition ability of the single-stranded DNA library for the MPN-372 protein meets the requirements, i.e., the binding affinity between the screened single-stranded DNA library and the target protein is higher than the gradually increasing (…). Figure 1 It can be seen that the single-stranded DNA library obtained in the 5th round has a high affinity for the target, and Pool5 has a much higher affinity than Pool4 and Pool3, which meets the sequencing requirements. The obtained single-stranded DNA library was then analyzed by high-throughput sequencing.
[0046] 3. Analysis and identification of the nucleic acid aptamers obtained after screening: After high-throughput sequencing analysis of the enriched library products, several sequences were selected and synthesized by Genewiz Biotechnology (Jiangsu) Co., Ltd., and their affinity was tested.
[0047] In subsequent testing, one sequence with the strongest binding ability was identified from the 20 sequences obtained in the final 6th round. The nucleic acid aptamer with the nucleotide sequence shown in SEQ ID NO.1 was named MPN-01. The specific sequence of SEQ ID NO.1 is TTCAGCACTCCACGCATAGCGACTAGGTTTGGTTAGGTTGGTGTCGCACTATCATTCCCTATGCGTGCTACCGTGAA.
[0048] Example 2: Surface plasmon resonance (SPR) detection of the affinity between nucleic acid aptamer MPN-01 and the target protein MPN-372. The nucleic acid aptamer MPN-01 (SEQ ID NO.1) was synthesized by Suzhou Genewiz Biotechnology Co., Ltd., and diluted with DPBS buffer to 500 nM, 250 nM, 125 nM, 62.5 nM, 31.25 nM and 15.63 nM respectively.
[0049] 1. The MPN-372 protein was coupled to channel 2 of the CM5 chip surface using the following method: First, the chip was cleaned with 50 mM NaOH, and 20 μL of the mixture was injected at a flow rate of 10 μL / min. Then, 50 μL of a mixture of equal volumes of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4 M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1 M aqueous solution) was injected to activate the chip at a flow rate of 5 μL / min. The MPN-372 protein was then diluted with 10 mM sodium acetate at pH 4.5 to a final concentration of 50 μg / mL and injected at a flow rate of 5 μL / min, resulting in an MPN-372 protein coupling amount of 8369 Ru. After injection, 100 μL of ethanolamine was injected to block the chip at a flow rate of 10 μL / min. The first channel was processed as described above, with the steps for coupling His protein, activation, and blocking being exactly the same, serving as a control channel.
[0050] 2. Detection: Using a surface plasmon resonance spectrometer (GE Healthcare, model: Biacore 8K), the detection parameters were set, and the diluted samples of the 6 aptamers were sequentially flowed through channels 1 and 2. The procedure for each aptamer was as follows: injection 30 μL / min, time 3 min; dissociation 30 μL / min, time 3 min; regeneration 1M NaCl 30 μL / min, time 30 s. The diluted 6 nucleic acid aptamers were injected sequentially.
[0051] Affinity assay data for nucleic acid aptamers MPN-01 and MPN-372 proteins are shown in [link to data]. Figure 2The KD value was 37.9 nM, indicating the binding affinity between the corresponding nucleic acid aptamer and the target protein MPN-372. These data demonstrate that the MPN-01 nucleic acid aptamer exhibits excellent binding to the MPN-372 protein, as detected by SPR (Self-Rating Precipitation) analysis.
[0052] Example 3: Specificity study of nucleic acid aptamer MPN-01 In this embodiment, CD331, C4B, and CK19 proteins were used instead of MPN-372 protein, following the same method as in Example 3 where MPN-372 protein was immobilized onto the SPR chip for testing. CD331, C4B, and CK19 proteins were coupled to the second channel of five channels on the CM5 chip surface, with coupling amounts of 10331 RU, 234 RU, and 779 RU, respectively. The diluted MPN-01 aptamers were then injected sequentially.
[0053] Affinity assay data for nucleic acid aptamer MPN-01 with CD331, C4B, and CK19 proteins are shown in [link to data]. Figure 3 .Depend on Figure 3 It can be seen that the nucleic acid aptamer MPN-01 cannot bind to CD331, C4B, or CK19 proteins, demonstrating its excellent specificity.
[0054] Example 4: Detection of MPN-372 protein using dot blot hybridization based on nucleic acid aptamer MPN-01 The dot blot hybridization experiment performed in this embodiment follows these steps: 1. Take an 8cm×2cm nitrocellulose membrane (purchased from Millipore), dilute MPN-372 protein with DPBS to 0.500mg / ml, 0.250mg / ml, 0.125mg / ml, 0.063mg / ml and 0.032mg / ml respectively, spot 2ul of each sample onto the nitrocellulose membrane, and air dry for 30 minutes.
[0055] 2. After drying, place the test strip in a homemade incubation box, add 3 mL of 5% BSA to moisten it, and block it on a shaker at room temperature for 1 hour. After blocking, use DPBS-T (containing 5 mM Mg) 2+ Wash with 0.02% Tween 20 for 15 minutes, repeat 3 times, and then aspirate the washing solution off the membrane.
[0056] 3. Dilute the biotin-modified MPN-01 nucleic acid aptamer to 500 nM with DPBS containing 5 mM Mg2+, and then incubate the diluted nucleic acid aptamer and the protein on the nitrocellulose membrane on a shaker at room temperature for 30 minutes.
[0057] 5. After incubation, wash three times with DPBS-T containing 5mM Mg2+, placing the container on a shaker for 5 minutes each time.
[0058] 6. Add 5mM Mg 2+ The DPBS was diluted 1:2000 with HRP-Streptavidin (purchased from Beyotime, catalog number A0303) and incubated on a shaker at room temperature for 30 minutes.
[0059] 7. Contains 5mM Mg 2+ Wash the DPBS-T solution three times, placing it on a shaker for two minutes each time.
[0060] 8. Add the colorimetric reagent (BeyoECL Star Ultrasensitive ECL Chemiluminescence Reagent Kit, purchased from Beyotime, catalog number P0018A, solutions A and B are the solutions provided with the kit) at a ratio of A:B = 1:1 (v / v) and develop the color at room temperature in the dark for 5 minutes.
[0061] 9. Imaging system observation and photography: The instrument used was the ImageQuant™ LAS 4000 digital imaging system from GE Healthcare Life Sciences.
[0062] The results are as follows Figure 4 As shown, after diluting MPN-372 protein to 0.500 mg / ml, 0.250 mg / ml, 0.125 mg / ml, 0.063 mg / ml, and 0.032 mg / ml, respectively, the MPN-372 protein showed obvious color development, indicating that biotin-modified MPN-01 can be used for the detection of MPN-372 protein in membrane hybridization.
[0063] It can also be demonstrated that MPN-01 can be used to accurately detect 63ug / ml of MPN-372 protein.
[0064] The technical means disclosed in this invention are not limited to those disclosed in the above embodiments, but also include technical solutions composed of any combination of the above technical features. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications are also considered within the scope of protection of this invention.
Claims
1. A nucleic acid aptamer that binds to the MPN-372 protein, characterized in that, It has a nucleotide sequence as shown in SEQ ID NO.
1.
2. A product for detecting MPN-372 protein, characterized in that, The product includes the nucleic acid aptamer as described in claim 1, and the product includes any one or more of the following: a reagent kit, a detection chip, and a chromatography detection device.
3. A product for purifying MPN-372 protein, characterized in that, The product includes the nucleic acid aptamer as described in claim 1, or a conjugate or derivative of the nucleic acid aptamer as described in claim 1; the product includes any one or more of the following: a reagent kit, a detection chip, and a chromatography detection device.
4. The use of the nucleic acid aptamer as described in claim 1 for preparing reagents for detecting or purifying MPN-372 protein.