Wheat auto-immune gene wai-5, related biological materials and applications thereof

Abstract

The application discloses a wheat spontaneous immunity gene WAI-5, related biological materials and application thereof, and belongs to the technical field of biotechnology.The amino acid sequence of the protein coded by the aforementioned spontaneous immunity gene WAI-5 is SEQ ID NO:1, and the application also provides biological materials related to the aforementioned protein.The application proves through experiments that the wheat spontaneous immunity gene WAI-5 can be widely applied in the fields of wheat genetic breeding, germplasm resource improvement, genome editing breeding and plant cultivation of WAI-5 gene transformation, and has an important role in improving and improving the germplasm resources of crops such as wheat.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the wheat spontaneous immune gene WAI-5, related biomaterials and their applications. Background Technology

[0002] Wheat (Triticum aestivum L.) is one of the world's three major food crops and is widely cultivated worldwide (Peng et al., 2011). Currently, wheat ranks first in global production among food crops. Wheat is grown across a vast area spanning from 67 degrees north latitude to 45 degrees south latitude, and 40% of the world's population relies on wheat as their staple food. With 17% of the world's crop-producing areas covered by wheat, it provides over 20% of the world's food calories.

[0003] Diseases can significantly reduce wheat yield and quality, and breeding disease-resistant wheat varieties is the most economical and effective measure to mitigate the threat of diseases. However, the disease-resistant genes discovered and currently in use typically only possess race-specific resistance, and their value gradually diminishes after several years of use due to pathogen mutations. For the goal of food security, it is necessary to enrich wheat disease resistance methods and provide a variety of resources and strategies for breeding disease-resistant wheat varieties. Summary of the Invention

[0004] The technical problem to be solved by this invention is to provide a gene that induces spontaneous immune necrosis in plants. The technical problem to be solved is not limited to the described technical subject matter; other technical subject matter not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0005] To solve the above-mentioned technical problems, the present invention provides the following technical solutions:

[0006] This invention provides a protein, said protein being any of the following:

[0007] A1) The amino acid sequence is that of the protein SEQ ID NO:1;

[0008] A2) A protein that has more than 80% identity with and has the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in A1).

[0009] A3) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acids shown in A1) or A2).

[0010] The protein in question is the broad-spectrum, multi-effect disease-resistant gene WAI-5.

[0011] The protein is derived from wheat.

[0012] The tagged proteins include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His-tag), MBP (maltose-binding protein) tagged protein, Flag tagged protein, SUMO tagged protein, HA tagged protein, Myc tagged protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tagged protein.

[0013] Those skilled in the art can readily mutate the nucleotide sequence encoding the aforementioned protein using known methods, such as directed evolution or point mutation. Any artificially modified nucleotides that possess 75% or more of the nucleotide sequence identity with the aforementioned protein isolated according to this invention, as long as they encode and possess the aforementioned protein function, are derived from and equivalent to the nucleotide sequence of this invention.

[0014] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0015] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of amino acid sequences, then the identity value (%) can be obtained.

[0016] In this document, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0017] The present invention also provides biomaterials related to the aforementioned proteins, which are any of the following:

[0018] B1) Nucleic acid molecules that encode the aforementioned proteins;

[0019] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0020] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0021] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0022] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0023] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0024] B7) Transgenic plant organs containing the nucleic acid molecules described in B1) or transgenic plant organs containing the expression cassette described in B2).

[0025] The expression cassette containing nucleic acid molecules described in B2) above refers to DNA capable of expressing the proteins described above in a host cell. The expression cassette may also include single-stranded or double-stranded nucleic acid molecules containing all the regulatory sequences necessary for the expression of any of the aforementioned proteins. The regulatory sequences, under compatible conditions, guide the coding sequence to express any of the aforementioned proteins in a suitable host cell. The regulatory sequences include, but are not limited to, leader sequences, polyadenylated sequences, propeptide sequences, promoters, signal sequences, and transcription terminators. At a minimum, the regulatory sequences must include a promoter and termination signals for transcription and translation. To introduce specific restriction enzyme sites into the vector for linking the regulatory sequences to the coding region of the nucleic acid sequence encoding the protein, a regulator-linked regulatory sequence may be provided. The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence that can be recognized by the host cell expressing the nucleic acid sequence. The promoter sequence contains a transcriptional regulatory sequence that mediates protein expression. The promoter may be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutated, truncated, and heterozygous promoters, and may be derived from genes encoding extracellular or intracellular proteins that are homologous or heterologous to those of the host cell. The regulatory sequence can also be a suitable transcription termination sequence, i.e., a sequence that can be recognized by the host cell and thus terminate transcription. The termination sequence is operatively attached to the 3' end of the nucleic acid sequence encoding the protein. Any terminator that can function in the selected host cell can be used in this invention. The regulatory sequence can also be a suitable leader sequence, i.e., an untranslated region of mRNA that is crucial for translation in the host cell. The leader sequence is operatively attached to the 5' end of the nucleic acid sequence encoding the protein. Any leader sequence that can function in the selected host cell can be used in this invention. The regulatory sequence can also be a signal peptide coding region, which encodes an amino acid sequence attached to the amino terminus of a protein that guides the encoded protein into the cellular secretory pathway. Signal peptide coding regions that guide the expressed protein into the secretory pathway of the host cell can be used in this invention. Adding a regulatory sequence that can regulate protein expression according to the growth status of the host cell may also be necessary. Examples of regulatory sequences are those that respond to chemical or physical stimuli (including in the presence of regulatory compounds), thereby opening or closing gene expression. Other examples of regulatory sequences are those that can amplify genes.

[0026] In the aforementioned biological materials, the carrier may be a plasmid, a granule, a bacteriophage, or a viral vector.

[0027] In the above-mentioned biological materials, the microorganisms may be yeast, bacteria, algae or fungi, such as Agrobacterium.

[0028] Among the aforementioned biological materials, the transgenic plant cell lines do not include propagation materials.

[0029] In the above-mentioned biological materials, the nucleic acid molecule described in B1) is a cDNA molecule or a DNA molecule whose coding sequence is SEQ ID NO:2.

[0030] This invention also provides a method for preparing spontaneous immune necrosis model plants, stunted growth model plants, and / or leaf necrosis model plants, comprising upregulating or enhancing or increasing the expression of the coding genes of the aforementioned proteins in the target plant, or upregulating or enhancing or increasing the activity and / or content of the proteins, to obtain spontaneous immune necrosis model plants, stunted growth model plants, and / or leaf necrosis model plants, wherein the spontaneous immune necrosis model plants, stunted growth model plants, and / or leaf necrosis model plants exhibit spontaneous immune necrosis, stunted growth, and / or leaf necrosis phenotypes.

[0031] In the above method, the upregulation, enhancement, or increase of the expression of the gene encoding the aforementioned protein in the target plant, or the upregulation, enhancement, or increase of the protein activity and / or content, includes introducing a nucleic acid molecule encoding the aforementioned protein into the starting plant, or introducing an expression cassette containing the nucleic acid molecule, or introducing a recombinant vector containing the expression cassette.

[0032] In the above method, the target plant is any one of the following:

[0033] M1) Dicotyledons or monocotyledons;

[0034] M2) Plants of the order Poales;

[0035] M3) Gramineae plants;

[0036] M4) Wheat genus plants;

[0037] M5 wheat.

[0038] The present invention also provides the use of the aforementioned protein, or a substance regulating the expression of the gene encoding the protein, or a substance regulating the activity and / or content of the protein, in any of the following:

[0039] D1) Cultivating spontaneous immune necrosis model plants;

[0040] D2) Preparation of products for cultivating spontaneous immune necrosis model plants;

[0041] D3) Cultivating model plants with delayed development;

[0042] D4) Products for preparing and cultivating stunted growth model plants;

[0043] D5) Cultivate leaf necrosis model plants;

[0044] D6) Prepare products for cultivating leaf necrosis model plants.

[0045] In the above applications, the regulation refers to upregulating or enhancing or increasing the expression of the gene encoding the aforementioned protein, or the content or activity of the protein.

[0046] In the above applications, the target plant is any one of the following:

[0047] M1) Dicotyledons or monocotyledons;

[0048] M2) Plants of the order Poales;

[0049] M3) Gramineae plants;

[0050] M4) Wheat genus plants;

[0051] M5 wheat.

[0052] This invention also provides any of the following applications of biomaterials:

[0053] D1) Cultivating spontaneous immune necrosis model plants;

[0054] D2) Preparation of products for cultivating spontaneous immune necrosis model plants;

[0055] D3) Cultivating model plants with delayed development;

[0056] D4) Products for preparing and cultivating stunted growth model plants;

[0057] D5) Cultivate leaf necrosis model plants;

[0058] D6) Prepare products for cultivating leaf necrosis model plants.

[0059] The present invention also provides a method for preparing a growth retardation model plant, comprising upregulating or enhancing or increasing the expression of the gene encoding SEQ ID NO:4 in a recipient plant to obtain a growth retardation model plant, wherein the growth retardation model plant exhibits a growth retardation phenotype.

[0060] In the above applications or methods, the plant is any of the following:

[0061] M1) Dicotyledons or monocotyledons;

[0062] M2) Plants of the order Poales;

[0063] M3) Gramineae plants;

[0064] M4) Wheat genus plants;

[0065] M5 wheat.

[0066] The plants mentioned above include, but are not limited to, wheat.

[0067] The wheat in question can specifically be Fielder.

[0068] This invention provides gene localization, map-based cloning, and functional verification of the wheat spontaneous immune gene WAI-5. The wheat spontaneous immune gene WAI-5 of this invention can be widely applied in wheat genetic breeding, germplasm resource improvement, genome editing breeding, and the cultivation of plants transgenic with the WAI-5 gene. It plays an important role in improving and refining germplasm resources of crops such as wheat, specifically for cultivating spontaneous immune necrosis model plants or growth retardation model plants. It can provide new germplasm resources for genetic breeding work and has a positive effect on accelerating the improvement of wheat varieties. Attached Figure Description

[0069] Figure 1 The phenotypes of wild-type 621-7-1, mutant M815, Fielder, and F1 plants are shown. From left to right, the plants are wild-type 621-7-1, mutant M815, Fielder, and F1 plants, which are the offspring of a cross between M815 and Fielder.

[0070] Figure 2 The distribution of SNPs associated with the WAI-5 gene on wheat chromosomes.

[0071] Figure 3 This is a map-based clone of the WAI-5 gene.

[0072] Figure 4 To verify the function of the WAI-5 transgenic wheat. In the figure, plant number "1" is wheat obtained by overexpressing the wild-type WAI-5 gene (SEQ ID NO:4) in Fielder, plant number "2" is Fielder, plant number "3" is complementary WAI-5 transgenic wheat, plant number "4" is Fielder, and the two leaves numbered "5" are leaves of complementary WAI-5 transgenic wheat. Detailed Implementation

[0073] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0074] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0075] The wheat complementary expression vector pCAMBIA1300 was disclosed in the literature "Lu et al. (2020) A rare gain of function mutation in a wheat tandem kinase confers resistance to powderymildew. Nat. Commun. 11, 680". The public can obtain the above biological material from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The obtained biological material is only for repeating the experiments of this invention and cannot be used for other purposes.

[0076] The wheat overexpression vector pTCK303 is disclosed in the literature "Li et al., A CNL protein in wild emmerwheat confers powdery mildew resistance. New Phytologist, 2020, 228:1027-1037", and is named pTCK303 in the literature. The public can obtain the above-mentioned biological material from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The obtained biological material is only used for repeating the experiments of this invention and should not be used for other purposes.

[0077] The transgenic recipient material, Fielder wheat, was preserved in our laboratory and published in the literature "Li et al., A CNL protein in wild emmer wheat confers powdery wheat resistance. New Phytologist, 2020, 228:1027-1037". The public can obtain the above-mentioned biological material from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The obtained biological material is only used for repeating the experiments of this invention and cannot be used for other purposes.

[0078] Example 1: Creation of the spontaneously immunized wheat mutant M815

[0079] 10,000 plump seeds of the common wheat variety 621-7-1 were selected and soaked in a large beaker filled with tap water for 12 hours. Then, the M0 generation seeds were treated with 0.8% EMS phosphate buffer for 8 hours, rinsed with tap water for 24 hours, and placed in petri dishes until they showed signs of sprouting. The sprouted M0 generation seeds were planted in the field and managed normally. At maturity, individual plants were harvested and numbered. Twenty plump M1 generation seeds were randomly selected from each package and sown in rows 1.5 meters long and 0.25 meters apart in the field. Normal field management was maintained, and phenotypic screening was conducted throughout the entire growth period to identify mutants. A mutant segregating family, M815, was identified, exhibiting spontaneous immune necrosis of leaves in seedlings, displaying a phenotype similar to cell death in disease resistance responses (see...). Figure 1 ), Figure 1 From left to right, the images show wild-type 621-7-1, mutant M815, Fielder, and the F1 plants resulting from a cross between M815 and Fielder. The M815 mutant was harvested and sown in the field to obtain a stable homozygous mutant system, M815.

[0080] Example 2: Genetic analysis of the wheat spontaneous immunity gene WAI-5

[0081] Common wheat variety Fielder was sown in the field in rows 1.5 meters long and 0.25 meters apart. Under normal field management, the leaves of the mutant M815 did not exhibit the leaf necrosis phenotype throughout the growing season. To conduct genetic analysis of the spontaneous immune necrosis trait in M815 leaves, M815 and Fielder were crossed to obtain F1 plants. F1 plants showed a mild leaf necrosis phenotype in the seedling stage. Self-pollination of the F1 generation resulted in F2 plants exhibiting leaf necrosis: normal leaves, conforming to a genetic segregation ratio of 3:1 (see Table 2). This genetic analysis indicates that the gene controlling the leaf necrosis phenotype in the spontaneous immune mutant M815 is controlled by a single dominant gene, named Wheat AutoImmunity-5 (WAI-5).

[0082] Table 1 shows the genetic analysis of WAI-5.

[0083]

[0084] Example 3: Map-based cloning of the wheat spontaneous immune gene WAI-5

[0085] To locate the WAI-5 gene, a first segregating population was constructed by crossing the M815 mutant with AK58, and genetic and BSR analyses were performed. During the mapping process, it was found that the 2A chromosome of this segregating population showed little difference, making it difficult to develop markers for fine mapping. Subsequently, a second segregating population was constructed by crossing the M815 mutant with Fielder. In the F2 segregating population constructed from the M815 and Fielder cross, 40 families with homozygous normal leaf characteristics at the heading stage and 40 families with spontaneously immune leaf characteristics at the heading stage were selected. Equal amounts of leaves were taken from each family to construct mixed pools of normal and necrotic leaves, from which RNA was extracted. RNA-Seq was performed using Illumina Hi-seq 4000. The transcriptome data underwent quality control, alignment, and filtering. Finally, SNP variation mining was performed to identify candidate SNP sites significantly associated with normal and necrotic leaves for molecular marker development and prediction of the genomic segment containing the target gene. BSR-Seq analysis results showed that the 2A chromosome had the most candidate SNP sites (see...). Figure 2 This indicates that the WAI-5 gene is very likely located on chromosome 2AL.

[0086] To finely map the WAI-5 gene, molecular markers were developed based on BSR-Seq analysis using SSR repeat sequences and candidate SNPs / InDels sites on the wheat 2AL chromosome. A total of 12 markers polymorphic between M815 and Fielder were used to identify and finely map the genotypes of 3072 F2 individuals. Ultimately, WAI-5 was located between molecular markers 2CS1 and SSR226, with a genetic distance of 0.212 cm, corresponding to a physical distance of 1.15 Mb from the Chinese Spring 2.1 reference genome. This interval contained 17 high-confidence genes, among which TraesCS2A03G1007900, TraesCS2A03G1008000, TraesCS2A03G1008100, and TraesCS2A03G1008200 had 100% sequence identification values, leading the inventors to believe it is a multi-copy gene. No mutation sites were found after amplification of other high-confidence genes and low-confidence genes with significantly different expression levels within the interval. The inventors determined through marker screening that chromosome 2A of mutant M815 originated from the wheat line WE35. Given that the inventors' laboratory had previously completed resequencing of WE35, the inventors compared the developed polymorphic molecular markers with the WE35 chromosome 2A resequencing data, ultimately determining the corresponding location interval of the target gene in WE35.

[0087] By simply annotating the genes within the WE35 localization region, the inventors determined that the four genes with 100% Identities values ​​in the Chinese Spring 2.1 annotation version had up to six copies in WE35. These were annotated as RagTag_711, RagTag_715, RagTag_721, RagTag_726, RagTag_732, and RagTag_737, respectively. After simultaneously amplifying and sequencing single clones of these six gene copies, a single-base mutation from G to A was found in the exon region of one copy. This mutation resulted in a change from glycine to glutamic acid in the encoded amino acid sequence, located at position 107. To determine which copy contained the mutation, the inventors compared the sequences upstream and downstream of each copy for 5000 bp. Due to the extremely high sequence similarity between the upstream and downstream sequences of each copy, the inventors designed large-fragment amplification primers based on the minor differences between the upstream and downstream sequences of each copy. The amplified products were then subjected to single-clone sequencing in a 10 μL amplification system at 57°C. To improve resolution efficiency, the inventors added distinctive sorting markers to each fragment and ultimately identified the mutated copy as RagTag_737 through full-length sequencing and full-sequence alignment, corresponding to TraesCS2A01G421900.1 in the Chinese Spring 1.0 annotation version. Based on this, the inventors identified RagTag_737 as a candidate gene and conducted functional analysis on it as a candidate gene for the WAI-5 gene in the M815 spontaneous immune mutant.

[0088] Table 2 shows the primer sequences of this invention.

[0089] Primer name Forward primer (5'-3') Reverse primer (5'-3') Function SSR156 CTCCATTGCAAAAGTTGCTT AAACTCTCGGAGTCCCACTT Precise positioning indel420 CAGAGATGGAATTTTTTTACAA AAGTCGTCTCCCACAGAAAA Precise positioning SC12 TGGATCATTTCTACCTGCTGTG TGAATCGCAACTCTGTCTCATT Precise positioning indel406 TAGCCCTCGTAGAGAACAGG GCTGATGAATCACAGGATGA Precise positioning SNP4 TGCCACACAGCTTATTAACAAG TTCAGGTTAAAGTTGCATTGCT Precise positioning 2CS1 GCATGAGAACCTAACATTGAGG GACGGTTTATACATGTGGACAG Precise positioning M815-6 CATATGGCGAGGTATACAAT AACTAGAGGCCCTTCTGGAG Precise positioning M815-15 TCGCTGTCGTATCAGTGAAG ACGCACTACGGTTTCTGTCT Precise positioning CS102 GCTAACAATACGAAGCTATGCA GACCATTATATGCGGGCTAAAA Precise positioning SSR226 CGCACCATCTATAGAAGAAGAAG GATAGAGGGAGAAGCGTGTACT Precise positioning SSR246 AGAGTACAAGAGTGCTCACACC GCTAGCTCTCATTCCTCATCAT Precise positioning SSR182 CATCGTAGATCAATGGCTTG GGGTACAGATCTACTCCCCATA Precise positioning

[0090] Example 4: Functional verification of the WAI-5 gene

[0091] 1. Genomic sequence amplification

[0092] Using primers HB1-L / HB1-R and high-fidelity DNA polymerase, the sequence was amplified at 57°C and verified by sequencing. A 7333bp DNA fragment ProWAI-5:WAI-5 (SEQ ID NO:3) was obtained from the leaf DNA of mutant M815. The fragment (SEQ ID NO:3) contains 4816bp upstream of the start codon (SEQ ID NO:3 positions 1-4816), a full gene length of 1135bp (SEQ ID NO:3 positions 4817-5951bp), and 1382bp downstream of the stop codon (SEQ ID NO:3 positions 5952-7333).

[0093] HB1-L: 5'-CATTCCTGATAAGCATATGTGAAT-3';

[0094] HB1-R: 5'-GGTGCCTCATGATGTATGTGTA-3';

[0095] Using primers HB1M-F / HB1M-R and high-fidelity DNA polymerase, the plasmid containing the 7333bp DNA fragment ProWAI-5:WAI-5 (SEQ ID NO:2) obtained after amplification using HB1 primers was amplified at 60°C.

[0096] HB1M-F: 5'-aattcgagctcggtacccgggCATTCCTGATAAGCATATGTGAAT-3';

[0097] HB1M-R: 5'-tgtaaaacgacggccagtgccaGGTGCCTCATGATGTATGTGTA-3';

[0098] The lowercase letters are homologous sequences of the pCAMBIA1300 vector, used for homologous recombination with the pCAMBIA1300 vector.

[0099] 2. Obtaining complementary transgenic plants

[0100] (1) Vector construction and Agrobacterium transformation

[0101] Using the pEASY-Uni Seamless Cloning and Assembly Kit (CU101-01), the fragment between the BamHI and HindIII restriction sites of the pCAMBIA1300 vector was replaced with the DNA fragment ProWAI-5:WAI-5 (SEQ ID NO:3) to obtain the recombinant expression vector pCAMBIA1300-ProWAI-5:WAI-5. The recombinant plasmid was transformed into *E. coli*, and single clones were selected for sequencing. The recombinant plasmid was then extracted and sequenced in its full length. The correctly sequenced plasmid was then transformed into *Agrobacterium* EHA105 to obtain the recombinant strain EHA105 / pCAMBIA1300-ProWAI-5:WAI-5. The recombinant expression vector pCAMBIA1300-ProWAI-5:WAI-5 is a recombinant expression vector obtained by replacing the small fragment between the BamHI and HindIII restriction sites of the pCAMBIA1300 vector with a DNA molecule whose nucleotide sequence is SEQ ID NO:3, while keeping the other sequences of the pCAMBIA1300 vector unchanged. This recombinant vector expresses a protein whose amino acid sequence is SEQ ID NO:1.

[0102] (2) Fielder wheat variety, a transgenic recipient

[0103] The previously verified recombinant strain EHA105 / pCAMBIA1300-ProWAI-5:WAI-5 was introduced into the callus tissue of the recipient wheat variety Fielder using Agrobacterium-mediated genetic transformation. The callus-differentiated seedlings were transferred to a growth selection medium and cultured at 22-24°C under light. Regenerated wheat plants (T0 generation transgenic plants of the WAI-5 gene) were obtained by transculturing pCAMBIA1300-ProWAI-5:WAI-5, and subsequently cultured at 16°C under light to observe the phenotype. Genomic DNA was extracted from the transgenic wheat samples. Using the genomic DNA as a template, PCR amplification was performed using primers JCHB9, JCHB11, JCHB13, and JCHB14. The recombinant expression plasmid pCAMBIA1300-ProWAI-5:WAI-5 was used as a positive control, and the wheat Fielder genome was used as a negative control. The obtained T0 generation transgenic plants were screened, with expected amplified product fragment sizes of approximately 1700 bp, 2000 bp, 900 bp, and 700 bp, respectively. Amplification was performed using a high-fidelity enzyme. The PCR reaction program was: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 1 min 30 s, 35 cycles; 72℃ extension for 5 min. The PCR amplification products were detected by 1% agarose gel electrophoresis and UV photography, and the results were recorded. Eight T0 generation transgenic positive plants were obtained by PCR testing and were named WAI-815-L13, WAI-A1-L16, WAI-A1-L17, WAI-A1-L19, WAI-A1-L20, WAI-A1-L21, WAI-A1-L25, and WAI-A1-L28, which are complementary WAI-5 transgenic wheat.

[0104] Plant phenotypes such as Figure 4 As shown, compared with the control Fileder and transgenic negative seedlings, the leaves of transgenic positive plants showed necrotic spots during the seedling stage, and the transgenic positive seedlings showed stunted growth and dwarfing. Figure 4 In the diagram, plant number "1" is wheat obtained by overexpressing the wild-type WAI-5 gene (SEQ ID NO:4) in Fielder wheat; plant number "2" is Fielder wheat; plant number "3" is complementary WAI-5 transgenic wheat; plant number "4" is Fielder wheat; and the two leaves of plant number "5" are leaves of complementary WAI-5 transgenic wheat. However, overexpression of WT ( Figure 4Plant number 2 only showed slow development, but the leaves had no spontaneous immune spots and the leaves were a normal bright green color.

[0105] The wheat overexpressing the wild-type WAI-5 gene (SEQ ID NO:4) in the Fielder can be obtained by referring to the above-described method for obtaining complementary transgenic wheat plants. The overexpression vector is pTCK303. The recombinant vector transformed into the Fielder is obtained by replacing the small fragment between the two restriction sites of pTCK303 with SEQ ID NO:4 while keeping other nucleotide sequences unchanged. The promoter is the maize UBI promoter, and the detection primers are OE3, OE4, and OE5.

[0106] JCHB9-F:5'-ACCCTGACTTTCAGCACTACAT-3';

[0107] JCHB9-R:5'-gcgattaagttgggtaacgc-3';

[0108] JCHB11-F:5'-CAAGTCAAGAACCAAGCTTCA-3';

[0109] JCHB11-R:5'-gcgattaagttgggtaacgc-3';

[0110] JCHB13-F:5'-ccaggctttacactttatgc-3';

[0111] JCHB13-R:5'-CAGCTAAGAAAATGATCACGAG-3';

[0112] JCHB14-F:5'-ccaggctttacactttatgc-3';

[0113] JCHB14-R:5'-TACTAGGAGGGGGAAGGAAGT-3';

[0114] OE3-F:5'-tttagccctgccttcatacg-3';

[0115] OE3-R:5'-CACGAACTCTTCGTTGGTGA-3';

[0116] OE4-F:5'-tttagccctgccttcatacg;

[0117] OE4-R:5'-GAGGTCGGAGAACTGGTTGA-3';

[0118] OE5-F: 5'-tgcagccctaggcctacta-3';

[0119] OE5-R: 5'-CGGTACCCGAGGTGCTTCT-3'.

[0120] SEQ ID NO:1 (Amino acid sequence of WAI-5 protein):

[0121] MAPIHSNSSRRHDGTLLALLLALVAATAFVGAAAARGDALAARHERWMAKYGRAYTDAAEKLHRQEVFAANARHVDAVNRAGNRTYTLGLNQFSDLTNEEFVEKHLEYRHQPGGLRPEDTPVAAVNMSKAQFQSTPDSMDWRAQGAVTQVKNQASCGSCWAFAAVAATEGLVQIATGNLISMSEQQVLDCTGDTSTCKGGSVIAALRYVAASGGLQPEAAYAYTGQRGACRSVMPNSAASVGAPRWVGLNGDEDALRELAASQPVAVGVEADPDFQHYMSGVFVGSSSCGQNLNHAVTVVGYGADGGGQEYWLVKNQWGTGWGEGGYMRLTRGNGGNCGMATVAYYPTMNSS.

[0122] SEQ ID NO:2 (CDNA sequence of WAI-5):

[0123] 5'-ATGGCGCCGATTCACAGTAACAGCTCTCGCCGCCACGACGGCACACTGCTCGCGCTTCTGCTCGCGCTCGTGGCCGCCACTGCCTTTGTCGGCGCTGCCGCGGCGCGAGGGGACGCGCTGGCCGCCCGGCACGAGCGGTGGATGGCCAAGTACGGGCGCGCGTACACCGACGCTGCCGAGAAATTGCACCGGCAGGAGGTGTTCGCGGCCAACGCGCGCCACGTAGACGCTGTCAACCGGGCGGGCAACCGGACGTACACCCTCGGGCTCAACCAGTTCTCCGACCTCACCAACGAAGAGTTCGTGGAGAAGCACCTCGAGTACCGTCACCAGCCGGGCGGGCTCCGTCCCGAGGACACGCCGGTGGCCGCGGTGAACATGTCCAAGGCTCAGTTCCAGTCCACACCGGACAGCATGGACTGGAGGGCCCAGGGCGCCGTCACCCAAGTCAAGAACCAAGCTTCATGTGGGAGTTGCTGGGCGTTCGCGGCGGTGGCGGCGACCGAGGGGCTCGTACAGATCGCCACCGGTAACCTCATCTCCATGTCAGAGCAGCAGGTGCTCGACTGCACGGGCGACACTAGCACCTGCAAGGGTGGCTCCGTCATCGCCGCCCTACGTTACGTCGCCGCAAGCGGCGGCCTGCAGCCGGAGGCAGCCTACGCGTATACCGGCCAGCGGGGCGCGTGCCGCAGCGTCATGCCAAATTCGGCCGCCTCCGTTGGCGCCCCCCGCTGGGTGGGCCTGAACGGCGATGAGGACGCGCTGCGGGAGCTGGCGGCCAGCCAACCGGTGGCCGTGGGCGTGGAGGCGGACCCTGACTTTCAGCACTACATGAGCGGCGTGTTCGTCGGTAGTTCATCGTGCGGGCAGAACCTGAACCACGCCGTGACGGTGGTGGGGTACGGGGCGGACGGCGGCGGGCAGGAATACTGGTTGGTGAAGAATCAGTGGGGGACGGGGTGGGGTGAGGGGGGCTACATGCGCCTCACGCGCGGGAACGGCGGCAACTGCGGCATGGCCACCGTCGCCTACTATCCAACCATGAACAGCTCTTAA-3'。

[0124] SEQ ID NO:3 (Sequence containing the promoter, full-length gene, and terminator of WAI-5 for obtaining complementary transgenic wheat):

[0125]

[0126] SEQ ID NO:4 (cDNA sequence of wild-type WAI-5):

[0127] 5'-ATGGCGCCGATTCACAGTAACAGCTCTCGCCGCCACGACGGCACACTGCTCGCGCTTCTGCTCGCGCTCGTGGCCGCCACTGCCTTTGTCGGCGCTGCCGCGGCGCGAGGGGACGCGCTGGCCGCCCGGCACGAGCGGTGGATGGCCAAGTACGGGCGCGCGTACACCGACGCTGCCGAGAAATTGCACCGGCAGGAGGTGTTCGCGGCCAACGCGCGCCACGTAGACGCTGTCAACCGGGCGGGCAACCGGACGTACACCCTCGGGCTCAACCAGTTCTCCGACCTCACCAACGAAGAGTTCGTGGAGAAGCACCTCGGGTACCGTCACCAGCCGGGCGGGCTCCGTCCCGAGGACACGCCGGTGGCCGCGGTGAACATGTCCAAGGCTCAGTTCCAGTCCACACCGGACAGCATGGACTGGAGGGCCCAGGGCGCCGTCACCCAAGTCAAGAACCAAGCTTCATGTGGGAGTTGCTGGGCGTTCGCGGCGGTGGCGGCGACCGAGGGGCTCGTACAGATCGCCACCGGTAACCTCATCTCCATGTCAGAGCAGCAGGTGCTCGACTGCACGGGCGACACTAGCACCTGCAAGGGTGGCTCCGTCATCGCCGCCCTACGTTACGTCGCCGCAAGCGGCGGCCTGCAGCCGGAGGCAGCCTACGCGTATACCGGCCAGCGGGGCGCGTGCCGCAGCGTCATGCCAAATTCGGCCGCCTCCGTTGGCGCCCCCCGCTGGGTGGGCCTGAACGGCGATGAGGACGCGCTGCGGGAGCTGGCGGCCAGCCAACCGGTGGCCGTGGGCGTGGAGGCGGACCCTGACTTTCAGCACTACATGAGCGGCGTGTTCGTCGGTAGTTCATCGTGCGGGCAGAACCTGAACCACGCCGTGACGGTGGTGGGGTACGGGGCGGACGGCGGCGGGCAGGAATACTGGTTGGTGAAGAATCAGTGGGGGACGGGGTGGGGTGAGGGGGGCTACATGCGCCTCACGCGCGGGAACGGCGGCAACTGCGGCATGGCCACCGTCGCCTACTATCCAACCATGAACAGCTCTTAA-3'。

[0128] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A protein, characterized in that, The protein is any one of the following: A1) The amino acid sequence is that of the protein SEQ ID NO:1; A2) A protein that has more than 80% identity with and has the same function as the protein shown in A1) obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in A1). A3) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acids shown in A1) or A2).

2. The biomaterial related to the protein of claim 1 is any one of the following: B1) A nucleic acid molecule encoding the protein of claim 1; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) Transgenic plant organs containing the nucleic acid molecules described in B1) or transgenic plant organs containing the expression cassette described in B2).

3. The biomaterial according to claim 2, characterized in that, B1) The nucleic acid molecule is a cDNA molecule or a DNA molecule whose coding sequence is SEQ ID NO:

2.

4. A method for preparing spontaneous immune necrosis model plants, or growth retardation model plants, and / or leaf necrosis model plants, characterized in that, This includes upregulating or enhancing or increasing the expression of the gene encoding the protein described in claim 1 in the target plant, or upregulating or enhancing or increasing the activity and / or content of the protein, to obtain a spontaneous immune necrosis model plant, a growth retardation model plant, or / and a leaf necrosis model plant, wherein the spontaneous immune necrosis model plant, the growth retardation model plant, or / and the leaf necrosis model plant exhibits spontaneous immune necrosis, growth retardation, or / and leaf necrosis phenotypes.

5. The method according to claim 4, characterized in that, The target plant is any one of the following: M1) Dicotyledons or monocotyledons; M2) Plants of the order Poales; M3) Gramineae plants; M4) Wheat genus plants; M5 wheat.

6. Application, characterized in that, The use of a protein, or a substance that regulates the expression of the gene encoding the protein, or a substance that regulates the activity and / or content of the protein, in any of the following: D1) Cultivating spontaneous immune necrosis model plants; D2) Preparation of products for cultivating spontaneous immune necrosis model plants; D3) Cultivating model plants with delayed development; D4) Products for preparing and cultivating stunted growth model plants; D5) Cultivate leaf necrosis model plants; D6) Prepare products for cultivating leaf necrosis model plants.

7. The application according to claim 6, characterized in that, The regulation is to upregulate or enhance or increase the expression of the gene encoding the protein in claim 1, or the content or activity of the protein.

8. The application according to claim 6 or 7, characterized in that, The plant is any one of the following: M1) Dicotyledons or monocotyledons; M2) Plants of the order Poales; M3) Gramineae plants; M4) Wheat genus plants; M5 wheat.

9. Any of the following applications of the biomaterials related to claim 2 or 3: D1) Cultivating spontaneous immune necrosis model plants; D2) Preparation of products for cultivating spontaneous immune necrosis model plants; D3) Cultivating model plants with delayed development; D4) Products for preparing and cultivating stunted growth model plants; D5) Cultivate leaf necrosis model plants; D6) Prepare products for cultivating leaf necrosis model plants.

10. The application according to claim 9, characterized in that, The plant is any one of the following: M1) Dicotyledons or monocotyledons; M2) Plants of the order Poales; M3) Gramineae plants; M4) Wheat genus plants; M5 wheat.

Images