Use of a gene BvMRS2-3 in improving salt tolerance of plants

Abstract

The application of a gene BvMRS2-3 in improving plant salt tolerance, and belongs to the technical field of biological genes, and particularly relates to the application of a gene BvMRS2-3 in improving plant salt tolerance.The salt stress positive regulation gene BvMRS2-3, and the CDS sequence of the gene BvMRS2-3 is shown as SEQ ID NO.1.The protein encoded by the salt stress positive regulation gene BvMRS2-3, and the amino acid sequence of the protein is shown as SEQ ID NO.2.The application of the salt stress positive regulation gene BvMRS2-3 in improving plant salt tolerance.The BvMRS2-3 gene in the BvMRS2-3 gene heterologous overexpression plant prepared by the BvMRS2-3 gene can be stably inherited, wherein the heterologously expressed BvMRS2-3 gene can alleviate the inhibition of salt stress on the germination of the plant, promote the growth of the root length of the BvMRS2-3 heterologous overexpression plant, promote the Mg 2+ absorption and maintain the ion homeostasis in cells, which indicates that the BvMRS2-3 gene positively regulates the salt tolerance of the plant.

Description

Technical Field

[0001] This invention relates to the field of biogenetics, specifically to the application of the gene BvMRS2-3 in improving plant salt tolerance. Background Technology

[0002] Soil salinization is the accumulation of salts in surface soil caused by irrigation, water pollution, climate, and other factors. It is a global resource and ecological problem that damages soil quality and threatens agricultural production. Global soil salinization levels continue to rise. The total area of ​​saline soil in my country has reached 3.69 × 10⁻⁶. 7 hm 2 Saline soils, as an important potential arable land resource in my country, have significant development and utilization value. Therefore, research on the mechanisms of plant salt tolerance not only provides a breakthrough for the theory of plant stress response but also has important application value for the development and ecological management of saline soils. Plant growth requires suitable temperature, humidity, soil salinity, pH value, and adequate nutrients. Salt stress typically affects the enzymatic reactions required for normal plant life activities, as well as nutrient absorption and protein synthesis, thus reducing plant growth. Salt stress affects plants primarily in three ways: First, ionic stress disrupts intracellular ionic homeostasis. Excessive sodium ions entering the cytoplasm not only cause an imbalance in the potassium-sodium ratio but also hinder the absorption of other essential ions (such as potassium, magnesium, ammonium, nitrate, and phosphate), leading to nutrient deficiencies and consequently affecting root vigor, cell pH stability, and key metabolic activities such as photosynthesis. Second, osmotic stress arises because a high-salt environment increases external osmotic pressure, hindering normal water absorption by plants, causing physiological water shortage, and further reducing stomatal conductance and carbon dioxide supply, thus inhibiting photosynthesis. Finally, oxidative stress is mainly caused by excessive reactive oxygen species (ROS). While these ROS normally play an important role in signal transduction, excessive accumulation can oxidize and damage macromolecules such as proteins, lipids, and DNA, disrupting cell structure and function. These three stresses are interconnected and collectively constrain plant growth and development.

[0003] In the complex molecular mechanisms by which plants cope with salt stress, maintaining intracellular ion homeostasis, especially magnesium ion homeostasis, is a crucial but often overlooked core link. Magnesium, as an essential macronutrient for plants, is not only a core component of chlorophyll but also a key cofactor involved in numerous energy metabolism and enzymatic reactions. However, high-salt environments severely disrupt the absorption of magnesium ions and intracellular balance in plants, leading to a series of cascading physiological damages. To precisely regulate magnesium ion homeostasis, plants have evolved a specialized family of magnesium ion transport proteins, among which the MRS2 / MGT family is the main executor. These proteins have unique structures that selectively mediate the crossing of magnesium ions across the cell membrane, responsible for the entire process of absorption from the roots and distribution among various intracellular organelles (such as chloroplasts and mitochondria). Their functions extend far beyond nutrient transport, deeply participating in the plant's stress signaling response network. Under salt stress, excess sodium ions in the soil competitively inhibit magnesium ion absorption, leading to a "physiological magnesium deficiency" dilemma in plants.

[0004] In conclusion, effectively improving the salt tolerance of plants is of great significance for promoting sustainable agricultural development, especially for ensuring food security. Summary of the Invention

[0005] To effectively improve the salt tolerance of plants, this invention provides an application of the gene BvMRS2-3 in enhancing plant salt tolerance.

[0006] The application of gene BvMRS2-3 in improving plant salt tolerance.

[0007] The CDS sequence of the above-mentioned gene BvMRS2-3 is shown in SEQ ID NO.1.

[0008] The amino acid sequence of the protein encoded by the gene BvMRS2-3 is shown in SEQ ID No. 2.

[0009] Furthermore, a recombinant expression vector containing the gene BvMRS2-3 was constructed and then introduced into recipient plants to integrate the gene BvMRS2-3 into the plant genome.

[0010] The CDS of the gene BvMRS2-3 of this invention is 1440 bp, which encodes 479 amino acids.

[0011] The protein molecular formula of the protein encoded by the gene BvMRS2-3 of this invention (BvMRS2-3) is C0. 2324 H 3721 N 647 O 743 S 17The relative molecular mass is 53.16 kD and the isoelectric point is 4.75. The amino acid composition of BvMRS2-3 protein has the highest proportion of Leu (L), which is 11.7%, and the instability index is 44.93. Therefore, BvMRS2-3 protein is classified as unstable.

[0012] This invention utilizes the BvMRS2-3 gene to prepare heterologous overexpression plants in which the BvMRS2-3 gene is stably inherited. The heterologously expressed BvMRS2-3 gene can alleviate the inhibitory effect of salt stress on plant germination, significantly reducing the hindering effect on root and leaf growth in heterologously expressed BvMRS2-3 gene plants under salt stress, promoting root growth, and enhancing the plant's resistance to magnesium. 2+ The absorption of nutrients helps maintain intracellular ion homeostasis, indicating that the BvMRS2-3 gene positively regulates plant salt tolerance and can improve the salt tolerance of heterologous expression plants, thereby enhancing their adaptability under salt stress. Attached Figure Description

[0013] Figure 1 This is a 1% agarose gel electrophoresis image of the full-length PCR amplification product of the BvMRS2-3 gene CDS in Specific Implementation Method 1. Lane M is DL 2000 DNA Maker; Lane 1 is the negative control; Lanes 2-5 are the full-length PCR amplification products of the BvMRS2-3 gene CDS.

[0014] Figure 2 This is a tertiary structure diagram of the BvMRS2-3 protein in Specific Implementation Method 1;

[0015] Figure 3 This describes the response of the BvMRS2-3 gene in the leaves / roots of the sugar beet M14 strain under 200 mM NaCl treatment in Specific Implementation Method 3.

[0016] Figure 4 This describes the response of the BvMRS2-3 gene in the leaves / roots of the sugar beet M14 strain under 400 mM NaCl treatment in Specific Implementation Method 3.

[0017] Figure 5 The figure shows the stable transformation of wild-type Arabidopsis thaliana using the Agrobacterium-mediated transformation of pCAMBIA1300S-3×FLAG-BvMRS2-3 recombinant vector in Implementation Method 4, the harvesting of T0 generation transgenic seeds, vernalization at 4℃, and growth on 1 / 2 MS medium.

[0018] Figure 6 This is a 1% agarose gel electrophoresis image of the PCR product of Arabidopsis thaliana plants with transgenic BvMRS2-3 gene in Specific Implementation Method 4.

[0019] Figure 7This is a 1% agarose gel electrophoresis image of the PCR product of reverse transcription of cDNA from total RNA of Arabidopsis thaliana plants transfected with the BvMRS2-3 gene in Specific Implementation Method 4.

[0020] Figure 8 The germination appearance of wild-type and BvMRS2-3 transgenic Arabidopsis thaliana in the control group culture medium in the fourth specific implementation method;

[0021] Figure 9 The germination appearance of wild-type and BvMRS2-3 transgenic Arabidopsis thaliana in culture medium under 150 mM NaCl stress according to specific implementation method four;

[0022] Figure 10 This is a statistical result of the germination rate of wild-type and BvMRS2-3 transgenic Arabidopsis thaliana in the control group and culture medium under 150 mM NaCl stress in the fourth specific implementation method;

[0023] Figure 11 The root length phenotype of wild-type and BvMRS2-3 transgenic Arabidopsis thaliana cultured in the control group and 150 mM NaCl stress medium in Specific Implementation Method 4;

[0024] Figure 12 The results are statistical analysis of root length phenotypes in wild-type and BvMRS2-3 transgenic Arabidopsis thaliana in the control group and in culture medium under 150 mM NaCl stress, according to the fourth specific implementation method.

[0025] Figure 13 The phenotypes of wild-type and BvMRS2-3 transgenic Arabidopsis thaliana in mixed soil under control and 150 mM NaCl stress are described in Specific Implementation Method 4.

[0026] Figure 14 This is the statistical result of the fresh weight of wild-type and BvMRS2-3 transgenic Arabidopsis thaliana plants in mixed soil under control and 150 mM NaCl stress in Specific Implementation Method 4;

[0027] Figure 15 This is the statistical result of the dry weight of wild-type and BvMRS2-3 transgenic Arabidopsis thaliana plants in mixed soil under control and 150 mM NaCl stress in Specific Implementation Method 4;

[0028] Figure 16 K is in the fourth specific implementation method + Ion content standard curve;

[0029] Figure 17 Na in the fourth specific implementation method + Ion content standard curve;

[0030] Figure 18 In the fourth specific implementation method, Mg2+ Ion content standard curve;

[0031] Figure 19 In the fourth specific implementation method, wild-type and BvMRS2-3 gene transgenic Arabidopsis thaliana plants under control and 150 mM NaCl stress showed Kt in their leaves. + / Na + Measurement results graph;

[0032] Figure 20 In the fourth specific implementation method, wild-type and BvMRS2-3 gene transgenic Arabidopsis thaliana plants under control and 150 mM NaCl stress showed Kk in their roots. + / Na + Measurement results graph;

[0033] Figure 21 In the fourth specific implementation method, wild-type and BvMRS2-3 gene transgenic Arabidopsis thaliana plants under control and 150 mM NaCl stress had Na+ in their roots. + Measurement results graph;

[0034] Figure 22 In the fourth specific implementation method, wild-type and BvMRS2-3 transgenic Arabidopsis thaliana plants under control and 150 mM NaCl stress showed Mg content in their leaves. 2+ Measurement results graph;

[0035] Figure 23 In the fourth specific implementation method, wild-type and BvMRS2-3 transgenic Arabidopsis thaliana plants were subjected to root Mg2+ stress under control and 150 mM NaCl stress. 2+ Measurement results diagram. Detailed Implementation

[0036] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0037] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other.

[0038] Specific implementation method one: Obtaining the salt stress tolerance gene BvMRS2-3.

[0039] This embodiment uses the salt stress tolerance gene BvMRS2-3, and the CDS sequence of the gene BvMRS2-3 is shown in SEQ ID NO.1.

[0040] 1. Cloning of the salt stress tolerance gene BvMRS2-3:

[0041] In this embodiment, total RNA was extracted from the leaves of sugar beet plants. Using the total RNA as a template, full-length sugar beet cDNA was obtained through reverse transcription using the First Strand cDNA Synthesis Kit. Then, PCR amplification was performed using specific primers BvMRS2-3-s and BvMRS2-3-as with KOD high-fidelity enzyme. The PCR reaction system is shown in Table 1.

[0042] The primer sequences are as follows:

[0043] BvMRS2-3-s: 5'-GAATGAGGCCCGACGATGAG-3';

[0044] BvMRS2-3-as: 5'-AGACCAATGACAACAAAGCATC-3';

[0045] Table 1

[0046] System components Volume (μL) <![CDATA[Mg 2+ ]]> 2.5 beet cDNA 1 KOD enzyme 0.5 BvMRS2-3-s 0.75 BvMRS2-3-as 0.75 dNTP Mixture 2.5 10×KOD Buffer 2.5 <![CDATA[ddH2O]]> 15.5

[0047] The PCR reaction program was as follows: 94℃ for 2 min; 98℃ for 10 s, 55℃ for 30 s, 68℃ for 1 min 50 s, 30 cycles; stored at 4℃.

[0048] 2. Purify the PCR product (BvMRS2-3) using the following steps:

[0049] (1) Cut the target strip in the UV analysis rubber tapping instrument and put it into a pre-weighed 1.5 mL centrifuge tube;

[0050] (2) Weigh the gel block, add 3 times the volume of Buffer GM solution, place it in a 50℃ water bath for 5 minutes, tap the centrifuge tube every 30 seconds until the gel block is completely dissolved, add the gel solution to the adsorption column, and centrifuge at 8000 rpm for 30 seconds.

[0051] (3) Pour the filtrate in the collection tube back into the adsorption column and centrifuge at 8000 rpm for 30 s;

[0052] (4) Discard the filtrate, add 300 μL of Buffer GM solution, and centrifuge at 9000 rpm for 30 s;

[0053] (5) Discard the filtrate, add 700 μL of Buffer WB solution, and centrifuge at 10000 rpm for 30 s;

[0054] (6) Repeat (5) once;

[0055] (7) Discard the filtrate in the collection tube and centrifuge at 11,000 rpm for 1 min;

[0056] (8) Place the adsorption column into a new 1.5 mL centrifuge tube, add 20 μL of ddH2O preheated at 50℃, incubate for 3 min, centrifuge at 12000 rpm for 1 min, collect the purified target fragment (BvMRS2-3 gene DNA fragment) and use the NanoDrop instrument to determine the DNA concentration.

[0057] 3. Ligation of DNA fragments with the pMD18-T vector:

[0058] The recovered purified PCR product (BvMRS2-3 gene DNA fragment) was tailed. The reaction system is shown in Table 2:

[0059] Table 2

[0060] System components Volume (μL) PCR purified products 10 rTaq enzyme rTaq Buffered NTP 0.252.52

[0061] The tailed BvMRS2-3 gene DNA fragment was mixed with the pMD18-T vector and ligated in a 16℃ metal bath for 16 h. The ligation system is shown in Table 3.

[0062] Table 3

[0063] System components Volume (μL) Tailing products 4 Solution ⅠpMD18-T 51

[0064] 4. The above ligation product was transformed into E. coli DH5α competent cells, as follows:

[0065] (1) In a sterile laminar flow hood, 10 μL of the ligation product was gently added to 50 μL of Escherichia coli DH5α competent cells, and then slowly aspirated to mix thoroughly. The mixture was then placed on ice and allowed to stand for 30 min.

[0066] (2) The conversion product was placed in a 42℃ water bath for 90 s for heat shock;

[0067] (3) Place the conversion product on ice for 3 min;

[0068] (4) Add 700 μL of LB liquid culture medium (antibiotic-free) to the conversion product in a sterile laminar flow hood and revive it in an air shaker at 37°C for 2 h;

[0069] (5) Spread the transformed bacterial culture onto LB plates (containing 50 mg·L⁻¹ Amp) and incubate upside down at 37°C for 12 h.

[0070] 5. Screening of positive recombinants:

[0071] Single colonies from the LB agar plates were transferred to 1 mL of LB liquid medium (containing 50 mg·L⁻¹ Amp) and incubated at 37°C on an air shaker for 4 h. PCR verification was performed using the bacterial culture as a template, followed by 1% agarose gel electrophoresis. The PCR system is shown in Table 4. Positive bacterial cultures were then transferred to 50 mL of LB liquid medium (containing 50 mg·L⁻¹ Amp) and incubated at 37°C on an air shaker for 12 h.

[0072] Table 4

[0073] System components Volume (μL) rTaq enzyme 0.25 Bacterial template 1 BvMRS2-3-s 1 BvMRS2-3-as 1 dNTP Mixture 2 10×rTaq Buffer 2.5 <![CDATA[ddH2O]]> 17.25

[0074] The PCR reaction program was as follows: 94℃ for 2 min; 98℃ for 10 s, 55℃ for 30 s, 68℃ for 1 min 50 s, 30 cycles; stored at 4℃.

[0075] 6. Extraction and sequencing of recombinant plasmids, the specific steps are as follows:

[0076] (1) Take 5 mL of the bacterial culture from the previous step into a 10 mL centrifuge tube and centrifuge at 13000 rpm for 10 min at 4℃;

[0077] (2) Discard the supernatant, add 200 μL of pre-cooled Solution I solution to resuspend the bacterial cells, and mix by pipetting;

[0078] (3) Slowly add 300 μL of Solution II solution to lyse the cells, and gently invert to mix;

[0079] (4) Slowly add 200 μL of Solution Ⅲ solution to renature the DNA, gently invert to mix, let stand for 10 min, and centrifuge at 13000 rpm for 10 min;

[0080] (5) Transfer the supernatant to a new 1.5 mL centrifuge tube, add an equal volume of DNA extraction buffer (phenol: chloroform: isoamyl alcohol = 25: 24: 1), mix gently, and centrifuge at 13000 rpm for 5 min;

[0081] (6) Transfer the supernatant to a new 1.5 mL centrifuge tube, add an equal amount of pre-cooled isopropanol, gently invert to mix, let stand at -20℃ for 30 min, and you will see flocculent DNA. Centrifuge at 13000 rpm for 5 min.

[0082] (7) Discard the supernatant, add 1 mL of pre-cooled 75% ethanol to wash the precipitate, and centrifuge at 13000 rpm for 1 min;

[0083] (8) Repeat (7) once;

[0084] (9) Discard the supernatant and place the centrifuge tube containing the DNA precipitate in a laminar flow hood and blow until the ethanol completely evaporates;

[0085] (10) Add 50 μL of ddH2O preheated at 50℃ and add 1 μL of RNase enzyme to remove RNA;

[0086] (11) The concentration was determined using a NanoDrop instrument and detected by 1% agarose gel electrophoresis.

[0087] The full-length PCR amplification product of the BvMRS2-3 gene coding sequence (CDS) was obtained by 1% agarose gel electrophoresis. Figure 1 As shown in the figure. The results indicate that the target band appears between 1000 bp and 2000 bp, which is consistent with the expected full-length CDS of the BvMRS2-3 gene.

[0088] The recombinant plasmid that successfully passed electrophoresis was sent to Shanghai Bioengineering Co., Ltd. for sequencing. Sequencing revealed the CDS sequence of the gene BvMRS2-3 as shown in SEQ ID NO.1. The CDS of the gene BvMRS2-3 is 1440 bp and encodes 479 amino acids.

[0089] Specific implementation method two: The protein encoded by the salt stress tolerance gene BvMRS2-3 in this implementation method has the amino acid sequence shown in SEQ ID No.2.

[0090] Bioinformatics analysis of the salt stress tolerance gene BvMRS2-3:

[0091] In this embodiment, the protein encoded by the salt stress tolerance gene BvMRS2-3 contains 479 amino acids. The physicochemical properties of the protein encoded by gene BvMRS2-3 (BvMRS2-3) were predicted using the ProtParam online software. The results showed that the molecular formula of BvMRS2-3 protein is C2. 2324 H 3721 N 647 O 743 S 17 The relative molecular mass is 53.16 kD and the isoelectric point is 4.75. The amino acid composition of BvMRS2-3 protein has the highest proportion of Leu (L), which is 11.7%, and the instability index is 44.93. Therefore, BvMRS2-3 protein is classified as unstable.

[0092] Predicting the tertiary structure of the BvMRS2-3 protein using the SWISS-MODEL online software, such as... Figure 2 As shown, the protein's tertiary structure prediction indicates that it has a C-terminus located in the first transmembrane domain.

[0093] Specific implementation method 3: Expression analysis of salt stress tolerance gene BvMRS2-3 in leaves / roots of sugar beet M14.

[0094] 1. RNA extraction and reverse transcription, the specific methods are as follows:

[0095] Total RNA was extracted from leaves and roots of the sugar beet M14 strain treated with 0, 200, and 400 mM NaCl using the Trizol method. The RNA concentration was adjusted to 500 ng / μL using enzyme-free ddH2O. Reverse transcription was then performed, and the reverse transcription system is shown in Table 5.

[0096] Table 5

[0097] System components Volume (μL) 5×Prime Script RT Master Mix 2 Total RNA 1 <![CDATA[ddH2O]]> 7

[0098] 2. Real-time quantitative PCR of the salt stress tolerance gene BvMRS2-3, the specific method is as follows:

[0099] Primers BvMRS2-3-qs and BvMRS2-3-q-as for real-time quantitative PCR of the salt-stress-tolerant gene BvMRS2-3 were designed using the Primer 3 Plus website (https: / / www.primer3plus.com / ), and their specificity was verified using NCBI-Primer BLAST. Primers Bv18S-s and Bv18S-as were designed using sugar beet 18S rRNA as an internal reference gene. Salt stress response analysis of the BvMRS2-3 gene was performed using the first strand of cDNA from the roots and leaves of sugar beet M14 subjected to salt stresses of 0 mM NaCl, 200 mM NaCl, and 400 mM NaCl. Sampling time points for salt stress treatment were: 0 h, 0.5 h, 1 h, 3 h, 6 h, 9 h, 12 h, 24 h, and 48 h. The reverse transcription reaction system is shown in Table 6.

[0100] Primer sequences are as follows: BvMRS2-3-qs: GCTTTTAGACATTGAGGCAAGC,

[0101] BvMRS2-3-q-as: TGGACTCCATCACCAACGTAATT,

[0102] Bv18S-s:CCCCAATGGATCCCGTTA,

[0103] Bv18S-as: TGACGGAGAATTAGGGTTCG.

[0104] Table 6

[0105] System components Volume (μL) 2× SGExcel FastSYBR Mixture 15 Upstream primer (10 μM) 0.6 Downstream primer (10 μM) 0.6 cDNA template 2 100× ROX Reference Dye 0.3 RNase-Free ddH2O Up to 30

[0106] Set the fluorescence quantification program as shown in Table 7.

[0107] Table 7

[0108] The data results were analyzed, and after calculation and integration using Excel, 2 -ΔΔCT The method is used to calculate the relative expression levels of genes. The results are as follows: Figure 3-4 As shown, with 0 h as the control, the relative expression level of the BvMRS2-3 gene was highest in leaves at 12 h and highest in roots at 24 h under 200 mM salt treatment; under 400 mM salt treatment, the relative expression level was highest in leaves at 12 h and highest in roots at 9 h, indicating that the BvMRS2-3 gene can respond to salt stress.

[0109] Specific Implementation Method 4: Application of the salt stress tolerance gene BvMRS2-3 in improving plant salt tolerance.

[0110] 1. Construction of the pCAMBIA1300S-3×FLAG-BvMRS2-3 expression vector, the specific method is as follows:

[0111] The plasmid of the pCAMBIA1300S-3×FLAG vector was extracted using the alkaline lysis method. The pCAMBIA1300S-3×FLAG vector was then digested with BamHI restriction endonuclease. The digestion system is shown in Table 8.

[0112] Table 8

[0113] System components Volume (μL) BamH I 1 Kpn I 1 pCAMBIA1300S-3×FLAG 10 <![CDATA[ddH2O]]> 6 10×K Buffer 2

[0114] The obtained pCAMBIA1300S-3×FLAG-BvAGER linearized vector was purified and ligated with BvMRS2-3 in a 16℃ metal bath for 12 h. The ligation system is shown in Table 9.

[0115] Table 9

[0116] System components Volume (μL) T4 Ligase 2 BvMRS2-3 2 pCAMBIA1300S-3×FLAG linearization carrier 1 <![CDATA[ddH2O]]> 5

[0117] The recombinant vector obtained from the above ligation was transformed into *E. coli* DH5α competent cells (the transformation method for the recombinant vector in Specific Implementation Method 1 can be used); then, positive recombinants were screened and the recombinant vector was extracted (the positive recombinant screening method and recombinant plasmid extraction method in Specific Implementation Method 1 can be used), and the recombinant vector pCAMBIA1300S-3×FLAG-BvMRS2-3 was transformed into *Agrobacterium tumefaciens* GV3101, the specific method of which is as follows:

[0118] (1) Take 1 μg of pCAMBIA1300S-3×FLAG-BvMRS2-3 recombinant plasmid, add 50 μL of Agrobacterium tumefaciens GV3101 competent cells, and freeze, thaw, and incubate in a 28℃ water bath, and freeze again for 5 min each time.

[0119] (2) After transformation, add 800 μL of LB liquid medium (antibiotic-free) and revive in an air shaker at 28°C for 4 h;

[0120] (3) Centrifuge the transformed bacterial culture at 6000 rpm for 1 min to collect the bacterial cells, take 100 μL of culture medium, gently aspirate and resuspend the bacterial cells, and spread them on LB solid medium (containing 50 mg·L⁻¹ Kan and 30 mg·L⁻¹ Rif), and incubate upside down at 28℃ for 48 h.

[0121] (4) Pick a single colony from the above LB solid medium and transfer it to 1 mL of sterile LB medium (containing 50 mg·L⁻¹ Kan and 30 mg·L⁻¹ Rif). Incubate at 28°C in an air shaker for 12 h. Use the bacterial culture as a template for PCR. Detect the PCR product by 1% agarose gel electrophoresis. The PCR system is shown in Table 10.

[0122] Table 10

[0123] System components Volume (μL) <![CDATA[Mg 2+ ]]> 2.5 Bacterial template 1 KOD enzyme 0.5 FLAG-BvMRS2-3-s 0.75 FLAG-BvMRS2-3-as 0.75 dNTP Mixture 2.5 10×KOD Buffer 2.5 <![CDATA[ddH2O]]> 15.5

[0124] The primer sequences are as follows:

[0125] FLAG-BvMRS2-3-s: 5'-ACGATGATAAGGGCGGTACCATGAGGCCCGACGATGAG-3';

[0126] FLAG-BvMRS2-3-as: 5'-AGGCTACGTAGGATCCCTCAAGCAAACGCTTGTG-3';

[0127] The PCR reaction program was as follows: 94℃ for 2 min; 98℃ for 10 s, 55℃ for 30 s, 68℃ for 1 min 50 s, 30 cycles; stored at 4℃.

[0128] Positive bacterial cultures identified by PCR were sent to Shanghai Bioengineering Co., Ltd. for sequencing.

[0129] 2. Obtaining heterologous expression plants of the salt-tolerance gene BvMRS2-3:

[0130] The pCAMBIA1300S-3×FLAG-BvMRS2-3 recombinant vector was stably transformed into wild-type Arabidopsis thaliana using Agrobacterium-mediated transformation. The specific method is as follows:

[0131] (1) A single positive colony of Agrobacterium tumefaciens GV3101 containing the recombinant vector pCAMBIA1300S-3×FLAG-BvMRS2-3 was amplified into 50 mL LB liquid medium (containing 50 mg·L⁻¹ Kan and 30 mg·L⁻¹ Rif) and cultured in an air shaker at 28°C until OD. 600 The bacterial culture concentration reached 0.8-1.2; 50 mL of bacterial culture was centrifuged at 6000 rpm for 10 min.

[0132] (2) Discard the supernatant, add 25 mL of osmotic conversion buffer to resuspend the bacterial cells, and centrifuge at 6000 rpm for 10 min;

[0133] (3) Discard the supernatant and resuspend the bacterial cells in 25 mL of osmotic conversion buffer until the OD value is reached. 600 Once the value reaches 1.0, it is ready to be used for immersion in Arabidopsis inflorescences;

[0134] (4) Water thoroughly the day before soaking and cut off any open flowers and pods of Arabidopsis thaliana;

[0135] (5) Immerse the terminal inflorescence of Arabidopsis thaliana completely in the transformation solution for 1 min, blot off the excess transformation solution with filter paper, and then culture the Arabidopsis thaliana in the dark for 24 h and under light for 24 h while keeping it moist. Repeat the immersion process three times.

[0136] (6) Harvest T0 generation transgenic seeds, vernalize them at 4℃, and then culture them in 1 / 2 MS medium (containing 25 mg·L⁻¹ HYG) (e.g. Figure 5 As shown in the figure, after culturing for 12 days, the transgenic seedlings with normal root growth and no whitening were transplanted into the soil to continue growing, and T1 generation seeds were obtained.

[0137] (7) Collect T1 generation seeds, repeat the above screening process, and after a certain period of cultivation, select transgenic seedlings with normal root growth and no whitening and transplant them into the soil, and identify them at the DNA and RNA levels.

[0138] The results are as follows Figure 6-7 As shown, heterologous expression plants were screened up to the T3 generation using the above method, and three plants (OE#1, OE#2 and OE#3) were randomly selected from the six obtained T3 generation heterologous expression plants for subsequent experiments.

[0139] 3. Determination of germination rate of plants heterologously expressing the salt-tolerance gene BvMRS2-3:

[0140] Seeds from BvMRS2-3 gene heterologous overexpression positive plants (OE#1, OE#2, OE#3) and wild-type plants (WT) were sown in 1 / 2 MS medium and subjected to stress treatment with 150 mM NaCl. Germination rate was measured with no stress as a control. Three biological replicates were performed.

[0141] The results are as follows Figures 8-10 As shown, there was no significant difference in seed germination rate between wild-type and heterologous expression plants under no NaCl stress treatment; however, under 150 mM NaCl stress, the seed germination rate of heterologous expression plants was significantly higher than that of wild-type plants (P < 0.05). The results indicate that heterologous expression of the BvMRS2-3 gene can effectively improve the seed germination rate of plants under salt stress.

[0142] 4. Measurement of root length in plants heterologously expressing the salt-stress tolerance gene BvMRS2-3:

[0143] Seeds from heterologous BvMRS2-3 gene-expressing plants (OE#1, OE#2, OE#3) and wild-type plants (WT) were sown in 1 / 2 MS medium and cultured for 7 days. They were then transferred to fresh 1 / 2 MS medium and subjected to salt stress treatment with 150 mM NaCl. The unstressed plants served as a control. Root length under salt stress was measured after 5 days of culture, with three biological replicates.

[0144] The results are as follows Figures 11-12 As shown, in the absence of NaCl stress, the root growth of the heterologous expression line was significantly better than that of the wild-type WT. However, under 150 mM NaCl stress, both wild-type and heterologous expression plants had shorter roots, indicating that salt stress affects root growth. However, compared to the wild-type, the root length of the heterologous expression plants was significantly longer (P < 0.05). These results indicate that heterologous expression of the BvMRS2-3 gene can effectively increase root length in plants under salt stress.

[0145] 5. Phenotypic observation and dry and fresh weight determination of plants heterologously expressing the salt stress tolerance gene BvMRS2-3:

[0146] Seeds from heterologous BvMRS2-3 gene-expressing plants (OE#1, OE#2, OE#3) and wild-type plants (WT) were planted in mixed soil (vermiculite:soil = 1:2). After four weeks of growth, the plants were subjected to 150 mM NaCl stress treatment (150 mM NaCl solution was applied every other day), with no stress as the control. Phenotypic results and dry and fresh weights were observed on day 6, and the experiment was repeated three times.

[0147] Experimental results are as follows Figures 13-15As shown, the plants grew well under the absence of NaCl stress. However, under 150 mM NaCl stress, compared with the wild type, the heterologously expressed plants exhibited better growth under salt stress, and their fresh weight and dry weight were significantly increased (P < 0.05). These results indicate that heterologous expression of the BvMRS2-3 gene can effectively increase plant biomass and improve its adaptability to salt stress.

[0148] 6. Determination of ion content in plants heterologously expressing the salt-tolerance gene BvMRS2-3:

[0149] Seeds from heterologous BvMRS2-3 gene-expressing plants (OE#1, OE#2, OE#3) and wild-type plants (WT) were sown in a mixed soil (vermiculite:soil = 1:2). After four weeks of growth, the plants were subjected to 150 mM NaCl stress treatment (150 mM NaCl solution was applied every other day), with no stress as a control. Ion content was determined by flame atomic absorption spectrometry. Three biological replicates were performed. The specific method is as follows:

[0150] (1) Take 0.01 g of Arabidopsis leaf tissue, dry it at 70℃, grind it into powder and pass it through a 60-mesh sieve, and add 5 mL of concentrated sulfuric acid;

[0151] (2) Digest in a fume hood overnight at 180°C. When no brown gas is produced, add H2O2, 1.5 mL of cesium chloride / lanthanum chloride solution, and add ddH2O to make up to 10 mL. Filter with a filter membrane and then test.

[0152] (3) K was measured at wavelengths of 766.5 nm, 589 nm and 285.2 nm using atomic absorption spectrometry. + Na + Mg 2+ content.

[0153] (4) Prepare standard solutions, the specific formulas are shown in Tables 11-13. Use a flame atomic absorption spectrometer to determine the ion content, and calculate the ion content of each strain using the standard curve. The ion content standard curve is shown in Tables 11-13. Figures 3-5 As shown.

[0154] Table 11

[0155]

[0156] Table 12

[0157] Table 13

[0158]

[0159] The results are as follows Figures 19-20 As shown, under salt stress, the K+ / Na+ ratio in the leaves and roots of BvMRS2-3 heterologous expression plants was higher, and the heterologous expression plants were able to maintain a better physiological state under salt stress and were less affected by salt stress.

[0160] The results are as follows Figure 21 As shown, the proportion of Na+ in the roots of BvMRS2-3 heterologous expression plants was significantly higher than that of wild-type plants under salt stress.

[0161] The results are as follows Figure 22-23 As shown, under 0 mM NaCl treatment, there was no significant difference in Mg2+ content in the leaves of BvMRS2-3 heterologous expression plants and wild-type plants, while the Mg2+ content in the roots of BvMRS2-3 heterologous expression plants was significantly higher. Under 150 mM NaCl treatment, the Mg2+ content in both the leaves and roots of heterologous expression plants was higher than that in wild-type plants. This indicates that the BvMRS2-3 gene may enhance plant salt tolerance by increasing the plant's Mg2+ content.

Claims

1. Application of gene BvMRS2-3 in improving plant salt tolerance.

2. The application according to claim 1, characterized in that, The CDS sequence of the gene BvMRS2-3 is shown in SEQ ID NO.

1.

3. The application according to claim 1, characterized in that, The amino acid sequence of the protein encoded by the gene BvMRS2-3 is shown in SEQ ID No.

2.

4. The application according to claim 1, characterized in that, A recombinant expression vector containing the gene BvMRS2-3 was constructed and then introduced into recipient plants to integrate the gene BvMRS2-3 into the plant genome.

Images