A VIGS recombinant vector targeting tomato leafminer CYP314A1 and insect-resistant application
By constructing a VIGS recombinant vector targeting the tomato leafminer CYP314A1 and Agrobacterium-mediated transformation, a highly efficient, long-lasting, and low-cost control of the tomato leafminer was achieved. This solves the problems of low insecticidal efficiency, unstable dsRNA, and high cost in existing technologies, and is suitable for long-term insect-resistant applications in Solanaceae crops.
Patent Information
- Application Number
- CN202610995180.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-07-06
- Publication Date
- 2026-08-25
AI Technical Summary
In existing technologies, RNAi targets for tomato leafminer have low insecticidal efficiency, free dsRNA is easily degraded, has short-lasting effects, and is costly. Chemical pesticide control leads to increased pest resistance and excessive pesticide residues. Traditional VIGS technology has not been applied to tomato leafminer and is difficult to promote in large fields.
A VIGS recombinant vector system targeting the tomato leafminer CYP314A1 was constructed. Agrobacterium engineered bacteria were used to express dsRNA endogenously in plants, achieving long-term insect resistance through leaf infection. The key gene TaCYP314A1 for molting development was selected, combined with pTRV1 and pTRV2 recombinant vectors, and Agrobacterium GV3101 was used as the vector for delivery, simplifying the operation and reducing costs.
It achieves highly efficient insecticidal effects, with a larval mortality rate of over 80%, and the dsRNA has a lasting effect of more than 30 days. It reduces application costs, is safe for non-target organisms, is suitable for insect control throughout the entire growth period of Solanaceae crops, and is suitable for industrial application.
Smart Images
Figure CN122629121A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological control technology for agricultural pests, particularly to the fields of green control of invasive pests, RNA interference and virus-induced gene silencing (VIGS), and especially to a VIGS vector targeting the tomato leafminer CYP314A1, engineered bacteria, a method for endogenous expression of dsRNA in plants, and its insect-resistant applications. Background Technology
[0002] The tomato leafminer (Tuta absoluta) is a major invasive pest, primarily damaging solanaceous crops such as tomatoes, eggplants, and peppers. The larvae bore into the leaf tissue and fruits, inducing disease and causing significant yield reductions. Currently, field control relies mainly on chemical pesticides, but long-term use has led to increased pesticide resistance in pests, excessive pesticide residues, the death of natural enemies, and damage to the farmland ecosystem. RNA interference (RNAi) is a mainstream green control technology. Existing RNAi targets for the tomato leafminer are mostly detoxification and metabolic P450 genes and heat shock proteins. Silencing these genes only reduces pesticide resistance, resulting in slow lethality and weak efficacy. CYP314A1 is a molting developmental P450 gene responsible for the synthesis of insect molting hormones. Silencing it can directly block the insect's metamorphosis, resulting in significant lethality. Currently, there is no research on using CYP314A1 combined with VIGS technology for insecticidal control of the tomato leafminer. Tobacco brittle virus (TRV) is a universal VIGS vector for Solanaceae crops, consisting of two vectors, pTRV1 and pTRV2. It can induce continuous synthesis of exogenous dsRNA in plants through Agrobacterium infection. Existing VIGS insect control technologies primarily target aphids and thrips, and have not been applied to tomato leafminer. Traditional in vitro synthesized dsRNA is easily degraded by nucleases and ultraviolet light, resulting in short duration of effectiveness and high cost, hindering large-scale field application. To address these shortcomings, this invention constructs a VIGS vector system targeting TaCYP314A1, achieving long-term endogenous expression of dsRNA in plants, thus solving the problems of low target efficiency, unstable dsRNA, and short control cycle.
[0003] To address this issue, a VIGS recombinant vector targeting the tomato leafminer CYP314A1 and its insect-resistant application were designed to provide an alternative technical solution. Summary of the Invention
[0004] Based on this, it is necessary to provide a VIGS recombinant vector targeting the tomato leafminer CYP314A1 and its insecticidal application to address the above-mentioned technical problems, in order to solve the technical problems of low insecticidal efficiency of existing RNAi targets; easy degradation of free dsRNA; short duration of effect; and high cost.
[0005] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:
[0006] A VIGS recombinant vector system targeting the CYP314A1 gene of the tomato leafminer moth comprises a pTRV1 helper vector and a pTRV2 recombinant vector; the pTRV2 recombinant vector inserts a specific interference fragment of the CYP314A1 gene of the tomato leafminer moth; the nucleotide sequence of the open reading frame of the pTRV2 gene is as shown in SEQ ID NO.1, and the specific nucleotide sequence is as shown in SEQ ID NO.2.
[0007] Preferably, the SEQ ID NO.2 fragment is 350~460 bp in length, specifically binds to the TaCYP314A1 coding region, and has no off-target homologous sequences.
[0008] An engineered Agrobacterium, Agrobacterium GV3101, is introduced into the VIGS recombinant vector system as described in any one of claims 1 or 2.
[0009] A method for expressing TaCYP314A1 in tomato plants using VIGS technology, the steps of which are as follows:
[0010] (1) Cultivate the Agrobacterium engineered strain as described in claim 3 until the bacterial solution reaches OD500. 600 The concentration of the dye solution was 0.6~0.8.
[0011] (2) Leaf needle piercing and staining of tomato seedlings at the two-leaf stage;
[0012] (3) After inoculation, the plants were cultured in the dark for 24 hours and then cultured under normal light to obtain insect-resistant plants.
[0013] The carrier system of claim 1, and / or the engineered bacteria of claim 3, and / or the method of claim 4, are used in the preparation of biological agents for controlling tomato leafminer, and / or in the cultivation of insect-resistant Solanaceae crops.
[0014] It is clear without a doubt that the technical problems to be solved by the present invention can be solved by the above-described technical solutions of the present invention.
[0015] Meanwhile, through the above technical solutions, the present invention has at least the following beneficial effects:
[0016] 1. This invention provides a VIGS recombinant vector targeting the tomato leafminer CYP314A1 and its insecticidal application. It selects the key gene TaCYP314A1 for molting development, and the larval mortality rate exceeds 80% after 7 days, with a control effect far superior to traditional detoxification genes. At the same time, the plant continuously expresses endogenous dsRNA, and the effect lasts for more than 30 days after a single infection, without the need for repeated spraying.
[0017] 2. The Agrobacterium tumefaciens infection operation of this invention is simple, does not require in vitro synthesis of dsRNA, has low application cost, and is suitable for various Solanaceae crops.
[0018] 3. This invention is a non-GMO technology, the product is easily degradable, and it is safe for non-target organisms such as tobacco stink bugs, earthworms, and parasitic wasps. It also solves the problems of easy degradation of free dsRNA, short duration of effect, and poor control efficacy of traditional target organisms. It can achieve long-term insect resistance in Solanaceae crops throughout their entire growth period and has broad prospects for industrial application. Attached Figure Description
[0019] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0020] Figure 1 This is a schematic diagram showing the effect of different time points on the expression of the TaCYP314A1 gene mRNA after the tomato leafminer larvae of the present invention feed on tomato leaves carrying pTRV2-eGFP and pTRV2-TaCYP314A1 synthesized in SEQ ID NO.2.
[0021] Figure 2 This is a schematic diagram showing the survival rate of tomato leafminer larvae 7 days after feeding on tomato leaves carrying pTRV2-eGFP and pTRV2-TaCYP314A1 synthesized in SEQ ID NO.2.
[0022] Figure 3 This is a schematic diagram comparing the normal and abnormal molting morphology of tomato leafminer larvae after feeding on tomato leaves carrying pTRV2-eGFP and pTRV2-TaCYP314A1 synthesized in SEQ ID NO.2.
[0023] Figure 4 This is a comparative schematic diagram showing the epidermal formation of tomato leafminer larvae 24 and 72 hours after feeding on tomato leaves carrying pTRV2-eGFP and pTRV2-TaCYP314A1 synthesized in SEQ ID NO.2. Detailed Implementation
[0024] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.
[0025] To enable those skilled in the art to better understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings.
[0026] It should be noted that, unless otherwise specified, the embodiments and features and technical solutions in the present invention can be combined with each other.
[0027] It should be noted that similar labels and letters in the following figures indicate similar items. Therefore, once an item is defined in one figure, it does not need to be further defined and explained in subsequent figures.
[0028] The tomato leafminer, tomato varieties, strains, and carriers used in the experiments of this invention are all commercially available conventional biological materials.
[0029] Example 1: Cloning and Expression Analysis of the CYP314A1 Gene of Tomato Leafminer
[0030] Tomato leafminer moths were reared indoors under the following conditions: 25 ℃, 16 h light / 8 h dark. Eggs, 1st-4th instar larvae, 1st-2 day old adults, and heads, prothoraxes, epidermis, foregut, midgut, hindgut, Malpighian tubules, and fat bodies of 2nd-3rd instar larvae were collected and flash-frozen in liquid nitrogen. Open reading frame sequence primers and dsRNA-specific primers were designed using DNAMAN and Primer Premier 5.0 software, and specific primers (Table 1) were obtained using the online software Primer3 (https: / / primer3.ut.ee / ) for subsequent experiments.
[0031] Table 1: Specific Primers
[0032] Note: Underlined portion indicates T7 promoter sequence; F: Forward primer; R: Reverse primer.
[0033] Total RNA was extracted using the Trizol method, and cDNA was obtained by reverse transcription. The open reading frame sequence of the TaCYP314A1 gene was obtained by PCR amplification, and the sequence is shown in SEQ ID NO.1.
[0034]
[0035] Expression levels were detected by qRT-PCR, and the results showed that the gene was specifically highly expressed in the epidermis of 2nd-3rd instar larvae, thus identifying it as the optimal interference target.
[0036] Example 2 Construction of pTRV2-TaCYP314A1 recombinant vector
[0037] The conserved region of TaCYP314A1 was selected and amplified to obtain a 350-460 bp, specifically a 452 bp interference fragment. The TaCYP314A1 sequence is shown in SEQ ID NO.2.
[0038] AGATCGTGCAGGTCTACCGCAGGAGCCGCCCCGACAGATACGCCTCCAGGACTTGTCAACGAACAAGGAGAGAAATGGTATCACCTGAGGAAGAACTTGACGGCGGAGCTGACGAGCCCGCAGACCATGCAGGGATTCGTGCCGCAGCTGAATGGCATCTGCGACGACTTCATAGAGCTGCTGCGCTCGTGCCGCCGCCCCGACGGCTCCGTCGCTGGCTTCGA CCAGCTCACCAACCGGGTGGGCCTCGAATCGGTTTGCGCGCTGATGCTGGGCGTGCGCCTGGGCTTCCTCGAGCGGCGCATGTCCGGCCGCGCCGCCGCGCTCCGCATCCGCGGTCAAGGTGCATTTCCGCCGCAACGCGACTCCTACTACGGCGCGCCGCTTTGGAAGCTCGCGCCCACCACGCTCTACAGGACGTTCGTCAGAAGCGAAGAGACTATTCACACT
[0039] The interference fragment was digested with BamH I and Sac I and ligated into the empty pTRV2 vector with T4 ligase. The vector was then transformed into E. coli DH5α. After resistance screening and sequencing verification, the recombinant vector pTRV2-TaCYP314A1 was obtained.
[0040] Example 3 Construction of Agrobacterium GV3101 engineered strain
[0041] pTRV1 and pTRV2-TaCYP314A1 were co-transformed into Agrobacterium GV3101 competent cells, cultured at 28 ℃, and then plated on antibiotic-resistant plates containing kanamycin and rifampin. Single clones were picked and identified by PCR to obtain positive engineered bacteria.
[0042] Example 4: Tomato plant infection and dsRNA expression detection
[0043] The engineered bacteria were cultured until OD 600 = 0.6–0.8, and the cells were collected by centrifugation at 5000 rpm. The cells were resuspended in a staining buffer (10 mM MgCl2, 10 mM MES, 200 μM acetylsylgenone, pH 5.6), and the OD 600 was adjusted to 0.6. The cells were then incubated at room temperature for 3 h. Two-leaf stage tomato seedlings were selected, and the leaves were stained using a needle prick method, with 2–3 sites per plant. Empty pTRV2 vector staining served as a control group. After staining, the plants were cultured in the dark for 24 h under standard conditions. Samples were taken at 2, 4, and 30 days for analysis. The plants showed stable expression of TaCYP314A1, with an expression period ≥ 30 days.
[0044] Example 5 Insect resistance effect determination
[0045] 1) Detection of gene silencing after insects feed on tomato leaves infected with pTRV2-TaCYP314A1
[0046] Seven days after infection, 20 2nd-3rd instar larvae were introduced into each group of plants, with three biological replicates. Tomato leafminers that had fed on pTRV2-eGFP and pTRV2-TaCYP314A1-infected tomato leaves were collected 24 h and 48 h later for total RNA extraction and reverse transcription into first-strand cDNA. mRNA expression levels were detected using a CF×96 Real-Time PCR Detection System. The results showed that, compared with the control group, the expression of the dsTaCYP314A1 gene in the pTRV2-TaCYP314A1-infected group was significantly reduced to 80% and 70% at 24 h and 48 h, respectively. Figure 1 (in P < 0.001).
[0047] 2) Survival rate detection of tomato leaves infected with pTRV2-TaCYP314A1 after being fed by test insects
[0048] Seven days after infection, 20 2nd-3rd instar larvae were introduced into each group of plants, with three biological replicates. The survival rate of tomato leafminers that fed on tomato leaves infected with pTRV2-eGFP and pTRV2-TaCYP314A1 was recorded within 8 days. The results showed that, compared with the control group, the survival rate of insects fed on pTRV2-TaCYP314A1 was significantly reduced by 90%. Figure 2 (in P < 0.001).
[0049] 3) Phenotypic observation after test insects fed on and infected tomato leaves with pTRV2-TaCYP314A1
[0050] Seven days after infection, 20 2nd-3rd instar larvae were introduced into each group of plants, with three biological replicates. Tomato leafminers feeding on pTRV2-eGFP-infected tomato leaves were able to pupate and emerge normally, exhibiting normal morphology and epidermal formation. Figure 3 The upper part, and the tomato leafminer that feeds on tomato leaves infected with pTRV2-TaCYP314A1, showed that during molting and development, the insects either stopped developing and could not enter the pupal stage, or were able to enter the pupal stage but could not detach from the pupal shell and eventually died. Figure 3 The lower half is shown.
[0051] 4) Observe sections of tomato leaves after they have been infected with pTRV2-TaCYP314A1 by insect feeding.
[0052] H&E staining of sections of tomato leafminers that had fed on tomato leaves infected with pTRV2-eGFP and pTRV2-TaCYP314A1 for 24 and 72 hours revealed that, compared with the control group, epidermal formation was inhibited in the test insects that fed on tomato leaves infected with pTRV2-TaCYP314A1. At 72 hours, it was observed that the test insects could not form new epidermis while the old epidermis could not shed, ultimately leading to the death of the test insects. Figure 4 .
[0053] Example 6: Safety evaluation of non-target organisms
[0054] The survival rate of plants fed on the tobacco mirid bug for 14 days was not significantly different from that of the control group;
[0055] Earthworms: After 21 days of soil-infused plant tissue culture, their growth and survival rates were normal.
[0056] Parasitic wasps: After contact with the plant, the emergence rate and parasitism ability were not affected.
[0057] The results demonstrate that the present invention is safe for non-target organisms in farmland.
[0058] The preferred embodiments of the present invention disclosed above are merely illustrative of the invention. These preferred embodiments do not exhaustively describe all details, nor do they limit the invention to the specific implementations described. Clearly, many modifications and variations can be made based on the content of this specification. This specification selects and specifically describes these embodiments to better explain the principles and practical applications of the invention, thereby enabling those skilled in the art to better understand and utilize the invention. The invention is limited only by the claims and their full scope and equivalents.
Claims
1. A VIGS recombinant vector system targeting the CYP314A1 gene of the tomato leafminer moth, characterized in that, It consists of a pTRV1 helper vector and a pTRV2 recombinant vector; the pTRV2 recombinant vector inserts a specific interference fragment dsTaCYP314A1 of the tomato leafminer CYP314A1 gene; the open reading frame nucleotide sequence of the CYP314A1 gene is as shown in SEQ ID NO.1, and the nucleotide sequence of dsTaCYP314A1 is as shown in SEQ ID NO.
2.
2. The VIGS recombinant vector system targeting the CYP314A1 gene of the tomato leafminer moth according to claim 1, characterized in that, The dsTaCYP314A1 fragment is 350~460 bp in length, specifically binds to the CYP314A1 coding region, and has no off-target homologous sequences.
3. An engineered Agrobacterium, characterized in that, It is Agrobacterium GV3101, and is introduced into the VIGS recombinant vector system as described in any one of claims 1 or 2.
4. A method for inducing tomato plants to express dsTaCYP314A1 using VIGS technology, characterized in that, The steps are as follows: (1) Cultivate the Agrobacterium engineered strain as described in claim 3 until the bacterial solution reaches OD500. 600 The concentration of the dye solution was 0.6~0.
8. (2) Leaf needle piercing and staining of tomato seedlings at the two-leaf stage; (3) After inoculation, the plants were cultured in the dark for 24 hours and then cultured under normal light to obtain insect-resistant plants.
5. The carrier system of claim 1, and / or the engineered bacteria of claim 3, and / or the method of claim 4, in the preparation of biological agents for controlling tomato leafminer, and / or the cultivation of insect-resistant Solanaceae crops.