A primer pair, a kit and a method for identifying the gender of Chinese soft-shelled turtles and application thereof

Abstract

The application discloses a primer pair, a kit, a method for identifying the gender of Chinese soft-shelled turtles and application of the method. The primer pair comprises an upstream primer shown in SEQ ID NO: 2 and a downstream primer shown in SEQ ID NO: 3. The inventors of the application find a female-specific fragment SEQ ID NO: 1 by performing genome sequencing on male and female Chinese soft-shelled turtles, and design the above primer pair based on the fragment. The primer pair is used to perform PCR amplification on the genomic DNA of Chinese soft-shelled turtles as a template, and a 548 bp specific band containing the sequence shown in SEQ ID NO: 1 can be amplified from female individuals, and no band can be amplified from male individuals. The application further discloses a kit containing the primer pair, a method for identifying the gender of Chinese soft-shelled turtles and application of the primer pair, the kit or the method in gender identification and breeding of Chinese soft-shelled turtles. The application provides a new molecular marker selection for gender identification of Chinese soft-shelled turtles, and is simple in operation, rapid in detection and clear and reliable in result.

Description

Technical Field

[0001] This application relates to the field of sex identification technology for Chinese soft-shelled turtles, specifically to a primer pair for identifying the sex of Chinese soft-shelled turtles, a kit containing the primer pair, a method for identifying the sex of Chinese soft-shelled turtles using the primer pair or kit, and the application of the above primer pair, kit or method in sex identification or breeding of Chinese soft-shelled turtles. Background Technology

[0002] The Chinese softshell turtle (Pelodiscus sinensis), commonly known as the turtle or softshell turtle, belongs to the class Reptilia, order Testudines, family Trionychidae, and genus Pelodiscus. It is an important aquaculture species in my country.

[0003] In the farming of Chinese soft-shelled turtles, there are significant differences in growth rate, size, and economic benefits between male and female turtles. Therefore, accurately identifying the sex of Chinese soft-shelled turtles at the seedling stage is of great practical significance for carrying out single-sex farming, optimizing the farming structure, improving economic benefits, and conducting targeted breeding.

[0004] However, Chinese soft-shelled turtles lack obvious secondary sexual characteristics in their juvenile stage. Traditional methods of sex identification mainly rely on external morphological observation or dissection during the adult stage. This not only requires waiting until the Chinese soft-shelled turtles have grown to a sufficiently large size, but also involves cumbersome and time-consuming operations, which may cause damage or even death to the individual. It is difficult to meet the needs for early, rapid, and non-destructive sex identification. Summary of the Invention

[0005] In view of this, the purpose of this application is to provide a primer pair, reagent kit, method, and application for sex identification of the Chinese soft-shelled turtle. The inventors of this application performed genome sequencing on female and male Chinese soft-shelled turtles, discovering female-specific fragments between them, and designed a primer pair based on this. Using this primer pair with Chinese soft-shelled turtle genomic DNA as a template for PCR amplification, the sex of the turtle can be effectively distinguished based on the presence or absence of the amplified product or sequence characteristics. This application provides a new molecular marker and primer pair selection method for sex identification of the Chinese soft-shelled turtle. Experimental verification shows that this method has good specificity and clear results, and can meet the needs of early sex identification of the Chinese soft-shelled turtle.

[0006] To achieve the above objectives, this application provides the following technical solution:

[0007] Firstly, this application provides a primer pair comprising the DNA shown in SEQ ID NO:2 and the DNA shown in SEQ ID NO:3. Using this primer pair to perform PCR amplification of the genomic DNA of the Chinese soft-shelled turtle, the sex of the turtle can be identified based on the amplification products.

[0008] Secondly, this application provides a kit for identifying the sex of the Chinese soft-shelled turtle, the kit comprising the primer pair described in the first aspect, and other reagents for PCR amplification.

[0009] In some embodiments, the other reagents used for PCR amplification include 2×Phanta Flash MasterMix.

[0010] Thirdly, this application provides a method for identifying the sex of the Chinese soft-shelled turtle, comprising the following steps:

[0011] Using the genomic DNA of the Chinese softshell turtle to be tested as a template, PCR amplification was performed using the primer pair described in the first aspect; and the sex of the Chinese softshell turtle to be tested was identified based on the amplification product.

[0012] In some embodiments, the step of identifying the sex of the Chinese softshell turtle to be tested based on the amplification product includes: performing electrophoretic detection on the amplification product; if a band is detected, the Chinese softshell turtle to be tested is a female individual; if no band is detected, the Chinese softshell turtle to be tested is a male individual.

[0013] In some embodiments, the step of identifying the sex of the Chinese softshell turtle to be tested based on the amplification product includes: sequencing the amplification product; if the sequence shown in SEQ ID NO:1 is detected, the Chinese softshell turtle to be tested is a female individual; if the sequence shown in SEQ ID NO:1 is not detected, the Chinese softshell turtle to be tested is a male individual.

[0014] In some preferred embodiments, the PCR amplification reaction system, in 25 μL, comprises: 1 μL of genomic DNA at a concentration of 100 ng / μL, 12.5 μL of 2×Phanta Flash Master Mix, 1 μL of upstream primer, 1 μL of downstream primer, and 9.5 μL of ddH2O.

[0015] In some preferred embodiments, the PCR amplification reaction program is as follows: 98 °C pre-denaturation for 30 s; 98 °C denaturation for 10 s, 58 °C annealing for 5 s, 72 °C extension for 5 s, 32 cycles; 72 °C extension for 1 min.

[0016] In some preferred embodiments, the genomic DNA of the Chinese soft-shelled turtle to be tested is extracted from its muscle tissue.

[0017] Thirdly, this application provides the application of the primer pairs described in the first aspect, the reagent kit described in the second aspect, or the method described in the third aspect in the sex identification of Chinese soft-shelled turtles and / or breeding using sex identification.

[0018] Compared with existing technologies, it has at least the following advantages:

[0019] 1. This application discovers and provides a new molecular marker, such as the female-specific fragment of the Chinese soft-shelled turtle shown in SEQ ID NO:1, and a primer pair containing the DNA shown in SEQ ID NO:2 and SEQ ID NO:3, providing a completely new technical option for sex identification of the Chinese soft-shelled turtle, enriching the available molecular markers in this field, and solving the problem of the relative insufficiency of available sex-specific molecular markers in the prior art.

[0020] 2. The technical solution provided in this application is simple to operate, rapid in detection, and provides clear results. After PCR amplification using the primer pair, the sex can be directly determined based on the presence or absence of bands using conventional agarose gel electrophoresis.

[0021] 3. Using the technical solution of this application to test individual Chinese soft-shelled turtles, female individuals all amplified the product shown in SEQ ID NO:1 and produced an electrophoretic band, while male individuals did not amplify any bands. The results of sex identification were clear and without overlap. Therefore, the technical solution of this application can be effectively used for sex identification of Chinese soft-shelled turtles and for breeding using sex identification, providing practical technical support for single-sex farming and genetic breeding of Chinese soft-shelled turtles. Attached Figure Description

[0022] Figure 1 The results of genome alignment of the female-specific fragments provided in the embodiments of this application.

[0023] Figure 2 The image shows the electrophoresis results of the method for identifying the sex of the Chinese soft-shelled turtle provided in this application embodiment. In the image, females show an amplified band, while males do not. Detailed Implementation

[0024] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.

[0025] The materials used in the following embodiments are not limited to those listed below, and other similar materials may be used instead. Unless otherwise specified, the instruments shall be used under conventional conditions or as recommended by the manufacturer. Those skilled in the art should have relevant knowledge of the use of conventional materials and instruments.

[0026] In the following examples, unless otherwise specified, all operations were performed in accordance with the methods provided in Molecular Cloning: A Laboratory Manual (3rd Edition, translated by Huang Peitang et al., Beijing: Science Press, 2002).

[0027] In this application, unless the context clearly indicates otherwise, the terms “including,” “comprising,” “containing,” “having,” etc., shall be understood as open-ended and mean “including but not limited to.”

[0028] To better understand this teaching and without limiting its scope, all figures and other numerical values ​​used in the specification and claims to express quantities, percentages, or proportions should, in all cases, be understood to be modified by the term "about." Therefore, unless otherwise stated, the numerical parameters set forth in the following specification and appended claims are approximate values ​​that may be adjusted according to the desired performance. At a minimum, each numerical parameter should be interpreted based on the reported significant figures and by applying common rounding techniques.

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter of this application pertains.

[0030] The inventors of this application performed genome sequencing on female and male Chinese softshell turtles, and compared and analyzed the sequencing results, discovering a female-specific fragment between the two individuals. Specifically, this female-specific fragment exists only in the genome of female individuals, and is absent or shows significant sequence differences in the genome of male individuals. The sequence of this specific fragment is shown in SEQ ID NO:1.

[0031] Specific fragment (SEQ ID NO:1):

[0032] TGTGTGAACACAATTTGCCTCTGTTGCCCTCTCCAGCCCCGGGGGTAGAGGCGGGAGGTAGGGAATTAAGTAAAGTTTCACAAGAGACCGCCCATAGACTCAGTTCACTTCCAAAGACATTGGAAATTACTTTGTAAAAGCCGACTACCCGG GCCTCTGCCTTTCCTTCTCTTCCCCCTGCAGGTCCAGCGCCCTTTGCTAGCTGCCAGGTATGGGGCATCCCCTCCTTGTTTTGAGCTGTAGATGCTGCGAGCTTTCTCATGCAGATTTCCCTGTTAACACCT TCCAAACAAAGGCAAATGAGGGCATTGCATAGCTATATCAACACGCAATCATTAGCGGCAGAGGGGGGGAGAGAGAGAATTTCTCTAGCAAAGTACGAGTCATTCAAAAGGGTAATTAAACTAACAAGGGGGTATAATAGAAAAGGGTTGCAACCAAAATGTGAATCAACAACACTACACAAACCCTCCCCCGTGTTAACAAAGACAGAATAATTATGCCTCGGGCTATTTTGCTCCTGCTGCACGTACATGCTTGCTCACAGC

[0033] NCBI BLAST alignment showed that this female-specific sequence is highly homologous to chromosome 15 (accession number: NC_134725.1) of the Chinese soft-shelled turtle genome (accession number: GCA_049634645.1) (98.81% identity, 92% coverage, E value = 0), with a localization interval of chr15:14122226-14122731. Specific alignment results are as follows... Figure 1 As shown.

[0034] Based on the discovered female-specific fragment sequence, a pair of primers was designed and named INDEL-1-F and INDEL-1-R. The specific sequences are as follows:

[0035] INDEL-1-F:5'-TGTGTGAACACAATTTGCCTC-3' (SEQ ID NO:2);

[0036] INDEL-1-R:5'-GCTGTGAGCAAGCATGTACG-3' (SEQ ID NO:3);

[0037] Using this primer pair for PCR amplification with Chinese soft-shelled turtle genomic DNA as a template, the sex of the Chinese soft-shelled turtle can be effectively distinguished based on the presence or absence of the amplification product or its sequence characteristics.

[0038] The following are specific examples:

[0039] Example 1: Extraction of Chinese soft-shelled turtle genomic DNA

[0040] This embodiment provides a method for extracting genomic DNA from the muscle tissue of the Chinese soft-shelled turtle, the specific steps of which are as follows:

[0041] Take approximately 0.5 g of muscle tissue from an individual Chinese softshell turtle (Changhuai No. 1 from Xijia, Bengbu, Anhui), and finely chop it before placing it into a 1.5 mL centrifuge tube. Add 500 μL of HOM buffer and 10 μL of proteinase K to the centrifuge tube, and digest in a 55 ℃ water bath or metal bath for at least 3 hours, inverting and shaking the tube every hour.

[0042] After digestion, add 500 μL of NaCl solution (4.5 M) to the centrifuge tube, followed by 300 μL of chloroform. Mix by inverting for 20 minutes. Centrifuge at 13000 rpm for 10 minutes. Carefully aspirate 500 μL of the supernatant and transfer it to a new centrifuge tube, being careful not to aspirate the intermediate layer (protein layer).

[0043] Add 350 μL of isopropanol to the aspirated supernatant, gently invert to mix, and allow a flocculent precipitate to form. Let stand for 20 minutes. Centrifuge at 13000 rpm for 10 minutes and discard the supernatant. Add 500 μL of 75% ethanol to the precipitate and let stand at room temperature for 5 minutes. Centrifuge at 13000 rpm for 10 minutes; a white precipitate will be visible at the bottom of the tube. Repeat the above steps of 75% ethanol treatment and centrifugation once. Discard the supernatant, aspirate as much residual liquid as possible, and let stand until the ethanol in the tube evaporates and dries.

[0044] The dry white precipitate at the bottom of the tube is genomic DNA. Depending on the amount of precipitate, add 50-100 μL of sterile water to dissolve the DNA. The resulting genomic DNA solution has a concentration of approximately 100 ng / μL and is ready for use.

[0045] Example 2: PCR amplification, sequencing verification, and electrophoresis detection

[0046] In this embodiment, the extracted Chinese soft-shelled turtle genomic DNA was used as a template, and PCR amplification was performed using the INDEL-1-F / INDEL-1-R primer pair. The sequence characteristics and fragment size of the amplified products of female individuals were confirmed by sequencing. Then, the amplified products were detected by agarose gel electrophoresis, and the sex of the Chinese soft-shelled turtle was determined based on the electrophoretic bands.

[0047] 2.1 PCR amplification

[0048] The specific primer sequences are as follows:

[0049] INDEL-1-F:5'-TGTGTGAACACAATTTGCCTC-3' (SEQ ID NO:2);

[0050] INDEL-1-R:5'-GCTGTGAGCAAGCATGTACG-3' (SEQ ID NO:3).

[0051] For example, with a total volume of 25 μL, the PCR reaction system contains 1 μL of genomic DNA at a concentration of 100 ng / μL, 12.5 μL of 2×Phanta Flash Master Mix, 1 μL of upstream primer (10 μM), 1 μL of downstream primer (10 μM), and 9.5 μL of ddH2O.

[0052] The PCR reaction program was as follows: 98 °C pre-denaturation for 30 s; 98 °C denaturation for 10 s, 58 °C annealing for 5 s, 72 °C extension for 5 s, 32 cycles; 72 °C extension for 1 min.

[0053] After PCR amplification, the amplification products are obtained and stored at 4 ℃ or -20 ℃ for later use.

[0054] 2.2 Agarose gel electrophoresis detection

[0055] After PCR amplification, a suitable amount of the amplification product was subjected to 1.2% agarose gel electrophoresis at 120V for 30 minutes. After electrophoresis, the gel was placed in a gel imaging system for observation and photography. The electrophoresis results are as follows. Figure 2 As shown.

[0056] 2.3 Gender Determination Criteria

[0057] The criteria for interpreting electrophoresis test results are as follows:

[0058] If a band is detected in the swim lane of the sample to be tested (located at the position corresponding to the expected size of 548 bp of SEQ ID NO:1), then the Chinese softshell turtle to be tested is determined to be a female individual;

[0059] If no bands are detected in the swim lane of the sample to be tested, the Chinese soft-shelled turtle to be tested is determined to be a male individual.

[0060] 2.4 Experimental Results

[0061] The above method was used to test 12 Chinese softshell turtle individuals (6 of which were known males and 6 of which were known females). The results are as follows: Figure 2As shown, a single band (F1-F6) at the 548 bp position was detected in all six female individuals' lanes, while no amplified band (M1-M6) was detected in any of the six male individuals' lanes. These results demonstrate that PCR amplification combined with electrophoresis can clearly and reliably distinguish the sex of the Chinese soft-shelled turtle.

[0062] 2.5 Sequencing verification of PCR amplification products

[0063] The PCR amplification products of female Chinese softshell turtles were sequenced.

[0064] The sequence of the amplified product from female individuals is shown in SEQ ID NO:1, with a length of 548 bp; while male individuals did not have specific amplified products, and corresponding sequencing results could not be obtained.

[0065] Based on the results of the above embodiments, the embodiments of this application also exemplarily illustrate the application of the primer pairs, kits, or methods of this application in sex identification and breeding of Chinese soft-shelled turtles, specifically in the following aspects:

[0066] (1) Application in early gender screening

[0067] Muscle tissue or other usable tissue samples, such as blood or tail tissue, were collected from juvenile Chinese soft-shelled turtles. Genomic DNA was extracted according to the method in Example 1, and PCR amplification, electrophoresis detection, and sex determination were performed according to the method in Example 2. Based on the determination results, female and male individuals were separated for rearing to achieve single-sex rearing.

[0068] (2) Application in breeding

[0069] In the genetic breeding of Chinese soft-shelled turtles, the method provided in this application is used to identify the sex of breeding parents or offspring, and individuals of a specific sex are selected for mating or breeding in a targeted manner, so as to improve breeding efficiency and economic benefits.

[0070] Based on the results of the above embodiments, the following conclusions can be drawn:

[0071] This application provides a primer pair (INDEL-1-F / INDEL-1-R) containing the sequences shown in SEQ ID NO:2 and SEQ ID NO:3, a kit containing this primer pair, and an identification method based on this primer pair, which can effectively distinguish between female and male Chinese soft-shelled turtles. Specifically, female individuals can amplify a specific band containing the sequence shown in SEQ ID NO:1, while male individuals do not amplify a band. This method is simple to operate, rapid in detection, and provides clear and reliable results, and can be widely applied in the sex identification and breeding practices of Chinese soft-shelled turtles.

[0072] The present application has been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the present application. The descriptions of the embodiments above are only for the purpose of helping to understand the present application and its core ideas. It should be noted that those skilled in the art can make several improvements and modifications to the present application without departing from the principles of the present application, and these improvements and modifications also fall within the protection scope of the claims of the present application.

Claims

1. A primer pair, characterized in that, The primer pair includes the DNA shown in SEQ ID NO:2 and the DNA shown in SEQ ID NO:

3.

2. A reagent kit for identifying the sex of the Chinese soft-shelled turtle, characterized in that, The kit includes the primer pair as described in claim 1, and other reagents for PCR amplification.

3. The reagent kit according to claim 2, characterized in that, Other reagents used for PCR amplification include 2×Phanta Flash Master Mix.

4. A method for identifying the sex of the Chinese soft-shelled turtle, characterized in that, Includes the following steps: Using the genomic DNA of the Chinese softshell turtle to be tested as a template, PCR amplification was performed using the primer pair described in claim 1; and the sex of the Chinese softshell turtle to be tested was identified based on the amplification product.

5. The method according to claim 4, characterized in that, The step of identifying the sex of the Chinese softshell turtle to be tested based on the amplification product includes: performing electrophoretic detection on the amplification product; if a band is detected, the Chinese softshell turtle to be tested is a female individual; if no band is detected, the Chinese softshell turtle to be tested is a male individual.

6. The method according to claim 5, characterized in that, The step of identifying the sex of the Chinese softshell turtle to be tested based on the amplification product includes: sequencing the amplification product; if the sequence shown in SEQ ID NO:1 is detected, the Chinese softshell turtle to be tested is a female individual; if the sequence shown in SEQ ID NO:1 is not detected, the Chinese softshell turtle to be tested is a male individual.

7. The method according to claim 4, characterized in that, The PCR amplification reaction system, in 25 μL increments, contains: 1 μL of genomic DNA at a concentration of 100 ng / μL, 12.5 μL of 2×Phanta Flash Master Mix, 1 μL of upstream primer, 1 μL of downstream primer, and 9.5 μL of ddH2O.

8. The method according to claim 4, characterized in that, The PCR amplification reaction program was as follows: 98 °C pre-denaturation for 30 s; 98 °C denaturation for 10 s, 58 °C annealing for 5 s, 72 °C extension for 5 s, 32 cycles; 72 °C extension for 1 min.

9. The method according to claim 4, characterized in that, The genomic DNA of the Chinese soft-shelled turtle to be tested was extracted from its muscle tissue.

10. The application of the primer pair of claim 1, the kit of claim 2 or 3, or the method of any one of claims 4-9 in sex identification of Chinese soft-shelled turtles and / or breeding using sex identification.

Images