Plant exine development-related protein EXA3 and its coding gene and application

Abstract

The present application discloses a plant pollen wall development related protein EXA3, a coding gene thereof and an application. The protein provided by the present application is a protein of (a) or (b) as follows: (a) a protein consisting of an amino acid sequence shown in SEQ ID NO. 1; (b) a protein derived from SEQ ID NO. 1, which is substituted and / or deleted and / or added with one or more amino acid residues and related to plant pollen wall development. The plant pollen development related protein of the present application affects the male gametophyte development process of a plant. Inhibition of the expression of the protein coding gene can cause abnormal development of the male gametophyte of the plant and affect the formation of grains, so that a transgenic plant with abnormal pollen wall development and a transgenic plant with male sterility can be cultivated.

Description

Technical Field

[0001] This invention relates to a plant pollen wall development-related protein EXA3, its encoding gene, and its applications. Background Technology

[0002] Rice (Oryza sativa L.) is one of the most important food crops for humankind, accounting for about one-third of the global food crop planting area. Stable and high rice yields are directly related to global social stability and development. Hybrid rice production relies on the discovery and utilization of male-sterile materials. Three-line (sterile line, maintainer line, restorer line) and two-line (photoperiod-temperature-sensitive male-sterile line, restorer line) hybrid crops based on male-sterile lines exhibit strong heterosis. Statistics show that using male-sterile materials for hybrid production of crops such as rice, maize (Zeamays), wheat (Triticum aestivum), and rapeseed (Brassica napus) can increase yields by 15% to 50%, demonstrating strong heterosis and significantly improving crop yields, thereby ensuring my country's food security. However, germplasm resources of nucleocytoplasmic male sterile lines are limited, while photoperiod-temperature-sensitive nucleocytoplasmic male sterile lines are highly dependent on the external environment. Ordinary nucleocytoplasmic male sterile lines are unaffected by external light, temperature, and other conditions, and are controlled only by a single nucleus gene, exhibiting stability in fertility. DuPont Pioneer invented the hybrid seed production technology—SPT (Seed Production Technology). This technology introduces closely linked pollen fertility restorer genes, pollen lethal genes, and marker selection genes into recessive nucleocytoplasmic male sterile mutants to obtain corresponding maintainer lines. This effectively solves the problems of maintaining and propagating recessive nucleocytoplasmic male sterile lines, achieving dual-purpose use of a single line, and also completely activates the potential of recessive nucleocytoplasmic male sterile materials in seed production. Therefore, the creation of stable recessive nucleocytoplasmic male sterile lines is of great significance for the utilization of heterosis in rice and the development of hybrid rice. Summary of the Invention

[0003] The purpose of this invention is to provide a plant pollen wall development-related protein, its encoding gene, and its applications.

[0004] The pollen wall development-related protein (EXA3) provided by this invention is derived from rice (Oryza sativa var. Ningjing 4) and is a protein as shown in (a) or (b):

[0005] (a) A protein consisting of the amino acid sequence shown in SEQ ID NO.1;

[0006] (b) A protein derived from SEQ ID NO.1 with one or more amino acid residues substituted and / or deleted and / or added, and which is associated with plant pollen wall development.

[0007] SEQ ID NO.1 consists of 952 amino acid residues, with F-Box domains from N-terminus 156 to 197, and LRR domains from N-terminus 328 to 426, 510 to 568, 580 to 610, 643 to 694, 717 to 769, and 888 to 913.

[0008] To facilitate the purification of EXA3 in (a), a tag as shown in Table 1 can be attached to the amino or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID NO.1.

[0009] Table 1: Label Sequence

[0010] Label amino acid residues sequence Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK

[0011] EXA3 in (b) above can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically. The encoding gene of EXA3 in (b) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in SEQ ID NO.2, and / or by performing a missense mutation of one or more base pairs, and / or by attaching the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0012] The gene EXA3, which encodes the proteins related to pollen wall development in the aforementioned plants, also falls within the scope of protection of this invention.

[0013] The gene may be a DNA molecule as follows: 1) or 2) or 3) or 4):

[0014] 1) CDS of EXA3 shown in SEQ ID NO.2;

[0015] 2) Genomic DNA of EXA3 as shown in SEQ ID NO.3;

[0016] 3) A DNA molecule that hybridizes to the DNA sequence defined in 1) or 2) under stringent conditions and encodes the protein;

[0017] 4) DNA molecules that have more than 90% homology with the DNA sequence defined in 1), 2), or 3) and encode proteins related to plant pollen wall development.

[0018] SEQ ID NO.2 consists of 2859 nucleotides and is the CDS of the gene EXA3.

[0019] Recombinant expression vectors containing any of the genes described above.

[0020] Recombinant expression vectors containing the gene can be constructed using existing plant expression vectors.

[0021] The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microbombardment. These vectors may also contain the 3' untranslated region of a foreign gene, i.e., a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3' end of the mRNA precursor; similar functions exist in the untranslated regions transcribed at the 3' end of Agrobacterium crown gall tumor-inducing (Ti) plasmid genes (such as the Nos gene for lipase) and plant genes (such as the soybean storage protein gene).

[0022] When constructing recombinant plant expression vectors using the aforementioned genes, any type of enhancing promoter or constitutive promoter, such as the cauliflower mosaic virus (CAMV) 35S promoter or the maize ubiquitin promoter, can be added before the transcription initiation nucleotide. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0023] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS gene, green fluorescent protein gene, etc.), antibiotic resistance markers (gentamicin marker, kanamycin marker, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes).

[0024] The recombinant expression vector is preferably a recombinant plasmid obtained by inserting the gene EXA3 into the recombinant site BamHI of the pCAMBIA1305 vector, named pCAMBIA1305-EXA3.

[0025] Expression cassettes, transgenic cell lines, and recombinant bacteria containing any of the genes (EXA3) mentioned above.

[0026] Primer pairs that amplify the full length of the gene (EXA3) or any fragment thereof are also within the scope of protection of this invention.

[0027] This invention provides a male-sterile mutant sequence of the EXA3 gene and the resulting mutant material causing male sterility. Specifically, the male-sterile mutant material is generated by mutating the endogenous OsSTRL3 gene in rice, or by mutating the nucleotide sequence of a highly homologous gene, thereby rendering the plant incapable of male reproduction. Mutation methods include, but are not limited to, gene mutations induced by physical or chemical methods, with chemical methods including mutagenesis using mutagens such as EMS. These mutations can be base substitutions, insertions or deletions of DNA fragments, and can also be generated using genetic engineering techniques such as RNAi and CRISPR. Recipients for creating male-sterile material include all currently known rice varieties.

[0028] A method for restoring the fertility of male gametes in plants.

[0029] The method for restoring the fertility of male gametophytes in plants provided by this invention involves introducing the gene into male-sterile plants to obtain transgenic plants with normal male gametophyte development. The male-sterile plants are those with abnormal pollen wall development that do not produce seeds. The transgenic plants with normal male gametophyte development are those whose male gametophyte development is equivalent to that of the normal type. Specifically, the gene is introduced into male-sterile plants via the recombinant expression vector; the male-sterile plant is designated as number 148.

[0030] The protein, the gene, the recombinant expression vector, the expression cassette, the transgenic cell line or recombinant bacteria, or the method can all be applied to rice breeding.

[0031] By using any vector capable of guiding the expression of exogenous genes in plants, the gene encoding the stated protein can be introduced into plant cells to obtain transgenic cell lines and transgenic plants. The expression vector carrying the stated gene can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants. The plant host being transformed can be either monocotyledonous or dicotyledonous, such as tobacco, birdsfoot, Arabidopsis, rice, wheat, corn, cucumber, tomato, poplar, turfgrass, and alfalfa.

[0032] Beneficial effects:

[0033] This invention is the first to discover, locate, and clone a novel gene, EXA3, for a plant pollen wall development-related protein. This pollen wall development-related protein affects the development of male gametophytes in plants. Inhibiting the expression of the gene encoding this protein leads to abnormal development of male gametophytes and affects seed formation, thereby enabling the cultivation of transgenic plants with abnormal pollen wall development and male-sterile transgenic plants. Introducing the gene encoding this protein into male-sterile plants can cultivate plants with normally developing male gametophytes. This protein and its encoding gene can be applied to plant genetic improvement. Attached Figure Description

[0034] Figure 1 Phenotypic comparison of wild-type Ningjing No. 4 and Tu 148 plants.

[0035] Figure 2 Comparison of anther and pollen morphology between wild-type Ningjing 4 and mutant 148.

[0036] Figure 3 Comparison of semi-thin sections of developing anthers from wild-type Ningjing 4 and mutant 148.

[0037] Figure 4 Comparison of the subcellular structure of developing anthers in wild-type Ningjing 4 and mutant 148.

[0038] Figure 5 Location diagram, EXA3 gene diagram and 148 mutation forms.

[0039] Figure 6 Observation of anther and pollen morphology of Crispr-exa3 plants.

[0040] Figure 7 Phenotypic and genotypic identification of EXA3 genomic DNA complementation 148. Detailed Implementation

[0041] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0042] Example 1: Discovery of plant pollen wall development-related proteins and their encoding genes

[0043] I. Phenotypic observation and genetic analysis of mature male gametophytes of rice male-sterile mutant 148

[0044] In the mutant library of the japonica rice variety Ningjing 4 (from the research group of Bao Yiqun at Nanjing Agricultural University), a line with abnormal pollen wall development and extremely low seed setting was screened out through natural planting in the field and named 148.

[0045] Compared with the wild-type Ningjing 4, the main characteristic of 148 is that only 4% of the grains are formed at maturity. Figure 1 The anthers are small and whitish. Figure 2 A: Wild-type anthers, Figure 2 B: 148 anther abnormality), pollen shriveled and without starch filling ( Figure 2 C: Wild-type pollen can be stained with iodine normally. Figure 2 D: 148 pollen abortion).

[0046] Observation of semi-thin sections of developing anthers revealed that pollen development abnormalities in pollen 148 began in stage 9. Figure 3 The exine of pollen 148 was significantly thicker than that of the wild type under transmission electron microscopy. Figure 4 C: wild type pollen wall, Figure 4 D: 148 pollen wall thickens, and the mutant pollen grains shrink ( Figure 4 A: wild type pollen, Figure 4 B: Pollen 148). Therefore, it is inferred that the thickening of the exine of pollen 148 leads to pollen atrophy, ultimately resulting in male infertility.

[0047] II. Mutant Gene Location

[0048] 1. Mutant gene localization

[0049] Artificial pollination of 148 was performed using pollen from Ningjing 4, and all F1 plants produced normal fruit. After self-pollination of the F1 plants, the number of normally fruiting plants and male-sterile plants in the F2 generation population met the segregation ratio of 3:1. Therefore, the male-sterile phenotype in 148 is controlled by a single recessive nuclear gene.

[0050] Mutant 148 was crossed with Ningjing 4 (from the rice germplasm resource bank of Nanjing Agricultural University). Two groups of individuals with extreme phenotypic differences were selected from the F2 generation to construct separate hybrid pools. Genomic DNA was extracted from the leaves of each plant, and SNPs in the hybrid samples were detected using high-throughput sequencing. Allele frequencies were analyzed in each hybrid pool, and the results were compared with one of the parents to obtain the SNP-index for each locus. Figure 5 A).

[0051] 1. Extract total DNA from the selected single plants as a template, using the following method:

[0052] (1) Take about 0.2g of tender rice leaves, place them in an Eppendorf tube, put a steel ball in the tube, freeze the Eppendorf tube containing the sample in liquid nitrogen for 5 minutes, and then crush the sample for 1 minute on a GENO / GRINDER instrument of type 2000.

[0053] (2) Add 660 μL of extraction buffer (a solution containing 100 mM Tris-HCl pH 8.0, 20 mM EDTA pH 8.0, 1.4 M NaCl, and 0.2 g / ml CTAB), vortex vigorously on a vortex mixer, and incubate on ice for 30 min.

[0054] (3) Add 40 μL of 20% SDS, incubate at 65°C for 10 min, and gently invert the container every 2 min to mix.

[0055] (4) Add 100 μL of 5M NaCl and mix gently;

[0056] (5) Add 100 μL of 10×CTAB, incubate at 65℃ for 10 min, and gently invert the container intermittently to mix.

[0057] (6) Add 900 μL of chloroform, mix thoroughly, and centrifuge at 12000 rpm for 3 min;

[0058] (7) Transfer the supernatant to a 1.5 mL Eppendorf tube, add 600 μL of isopropanol, mix well, and centrifuge at 12000 rpm for 5 min.

[0059] (8) Discard the supernatant, rinse the precipitate once with 70% (v / v) ethanol, and air dry at room temperature;

[0060] (9) Add 100 μL of 1×TE (121 g Tris dissolved in 1 L of water, and the pH was adjusted to 8.0 with hydrochloric acid) to dissolve the DNA;

[0061] (10) Take 2 μL of DNA for electrophoresis to detect DNA quality and use a DU800 spectrophotometer to determine the concentration (Bechman Instrument Inc., USA).

[0062] 2. Obtaining the mutant gene

[0063] Sequencing revealed a single-base mutation in the EXA3 gene in mutant 148. Figure 5 B),

[0064] Primers were designed based on sequences published online, as follows:

[0065] Primer 1: 5'ATGAGGTGGACGATGCCTCC 3'

[0066] Primer 2: 5'CGCATCCAAAGCAGCCTTATCACA 3'

[0067] Using Primer 1 and Primer 2 as primers and cDNA from the developing anthers of Ningjing 4 as a template, PCR amplification was performed to obtain the target gene. The amplification reaction was conducted on a PTC-200 (MJ Research Inc.) PCR instrument: 94℃ for 3 min; 94℃ for 30 s, 60℃ for 30 s, 72℃ for 3 min, 35 cycles; 72℃ for 5 min. The PCR product was recovered, purified, and ligated into pMD18-T (Takara, Japan), transformed into *E. coli* DH5α competent cells (Tiangen CB101, Beijing), and positive clones were selected for sequencing.

[0068] Sequencing results showed that the fragment obtained by PCR had the nucleotide sequence shown in SEQ ID NO.2, encoding a protein consisting of 480 amino acid residues (see SEQ ID NO.1 in the sequence listing). The protein shown in SEQ ID NO.1 was named EXA3, and the gene encoding the protein shown in SEQ ID NO.1 was named EXA3.

[0069] Example 2: Obtaining and Identifying Transgenic Plants

[0070] I. Construction of CRISPR / Cas9 knockout vector

[0071] The CRISPR website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR / CRISPR) was used to screen for 20-bp sequences in the exon region of gene EXA3 with good specificity as targets. The sequence is as follows: 5'GGCAATGTCGCGACACCTAAGCGG 3'. Primers were designed based on the target as follows:

[0072] Primer 3: 5'GGCAATGTCGCGACACCTAAGCGG 3'

[0073] Primer 4: 5'AAACCCGCTTAGGTGTCGCGACAT 3'

[0074] The primers were then annealed and cloned into the TKC vector. Sequencing confirmed the CRISPR-EXA3 knockout vector. The process is as follows:

[0075] (1) Dissolve the forward and reverse target sequences in 1×TE to form a 100μM stock solution, and take 1μL of each and add it to 98μL of 0.5×TE solution to mix and dilute to 1μM.

[0076] (2) Hold at 95℃ for 3 minutes, then move to room temperature to cool and complete the annealing.

[0077] (3) The enzyme digestion and ligation system (Thermo Scientific) is as follows:

[0078]

[0079]

[0080] The reaction procedure was as follows: incubation at 37℃ for 5 min, followed by incubation at 20℃ for 5 min. These two conditions were maintained for 10 cycles. Positive single clones were then obtained through transformation and verified by PCR using culture shaking. Finally, the clones were sent to a biotechnology company for sequencing identification.

[0081] II. Obtaining Recombinant Agrobacterium

[0082] CRISPR-EXA3 was transformed into Agrobacterium tumefaciens strain EHA105 (purchased from Ingenium Biotech, USA) using electroporation to obtain a recombinant strain. Plasmids were extracted and identified by PCR and enzyme digestion. The recombinant strain that was correctly identified by PCR and enzyme digestion was named EH-CRISPR-EXA3.

[0083] III. Obtaining Transgenic Plants

[0084] The specific method for transforming wild-type Ningjing 4 with EH-CRISPR-EXA3 is as follows:

[0085] (1) Incubate EH-CRISPR-EXA 316 h at 28℃, collect the cells, and dilute them in N6 liquid medium (Sigma, C1416) to a concentration of OD. 600 ≈0.5, to obtain bacterial culture;

[0086] (2) Mix the F375 rice mature embryo embryonic callus cultured for one month with the bacterial solution in step (1) and infect for 30 min. After the bacterial solution is dried with filter paper, transfer it to co-culture medium (N6 solid co-culture medium, Sigma) and co-culture at 24℃ for 3 days.

[0087] (3) The callus from step (2) was inoculated onto N6 solid screening medium containing 100 mg / L hygromycin for the first screening (16 days).

[0088] (4) Select healthy callus and transfer it to N6 solid selection medium containing 100 mg / L hygromycin for a second selection. Subculture every 15 days.

[0089] (5) Select healthy callus and transfer them to N6 solid selection medium containing 50 mg / L hygromycin for the third selection, and subculture every 15 days.

[0090] (6) Select resistant callus and transfer it to differentiation medium for differentiation;

[0091] T0 generation positive plants that differentiated into seedlings were obtained.

[0092] IV. Identification of Transgenic Plants

[0093] 1. PCR molecular identification

[0094] Primer design: A pair of primers was designed using Primer 5.0 software based on the target sequence location. The primer sequences are as follows: Primer 5:

[0095] 5'GTAGAAACGGGACGAGATGAGC 3'

[0096] Primer 6:

[0097] 5'CCAACGCGACTTCAAACTACTTAT 3'

[0098] PCR reaction system: DNA (20 ng / μL) 2 μL, Primer 5 (10 pmol / μL) 2 μL, Primer 6 (10 pmol / μL) 2 μL. Max Buffer 25 μL, dNTP (10 mM) 1 μL, DNA Polymerase 1 μL, ddH2O 17 μL, total volume 50 μL.

[0099] The amplification reaction was performed on a PTC-200 (MJ Research Inc.) PCR instrument: 94℃ for 3 min; 94℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min.

[0100] The PCR products were purified and recovered according to the kit (Beijing Tiangen) procedure and sent to a biotechnology company for sequencing.

[0101] 2. Phenotypic identification

[0102] T0 generation CRISPR-EXA3 transgenic plants and Ningjing 4 were planted at the Baima planting base of Nanjing Agricultural University, respectively. Ningjing 4 and CRISPR-EXA3 plants were harvested separately. Figure 6 The anthers were observed during the flowering period, and the pollen was stained with iodine. The anther morphology and color phenotype of the CRISPR-EXA3 transgenic plants were the same as those of the mutant. Figure 6 It is evident that the 148 mutation phenotype is caused by a mutation in EXA3.

[0103] II. Construction of Recombinant Expression Vectors

[0104] Using genomic DNA from Ningjing 4 (from the rice germplasm resource bank of Nanjing Agricultural University) as a template, the EXA3 gene was obtained by PCR amplification. The PCR primer sequences are as follows:

[0105] Primer 7:

[0106] 5'CATGATTACGAATTCGAGCTCTGGTTCTCAGACGAGATATCCCA 3'

[0107] Primer 8:

[0108] 5'TCGTATGTTCAAGCCACTAATCGTCAGATCTTAAAGCGGCCGCCCG 3'

[0109] The primers described above are located 2.5 kb upstream and 1.5 kb downstream of the gene shown in SEQ ID NO.2. The amplification product contains the promoter portion of this gene. The PCR product was recovered and purified. The PCR product was inserted into the SacI and BglII restriction sites of the vector pCAMBIA1305.1 using the INFUSION recombination kit (Takara Corporation, Japan).

[0110] The recombinant reaction system (10 μL) consisted of: 1.0 μL PCR product, 6.0 μL pCAMBIA1305.1, 2.0 μL 5× infusion buffer, and 1 μL infusion enzyme mix. After brief centrifugation, the mixture was incubated at 37°C for 15 min, followed by incubation at 50°C for 15 min. 2.5 μL of the reaction mixture was then used to transform *E. coli* DH5α competent cells (Beijing Tiangen Biotech Co., Ltd.; CB101) using the heat shock method. All transformed cells were evenly spread on LB agar containing 50 mg / L kanamycin. After incubation at 37°C for 16 h, positive clones were picked and sequenced. Sequencing results showed that a recombinant expression vector containing the gene shown in SEQ ID NO.3 was obtained. The pCAMBIA1305.1 containing EXA3 was named pCAMBIA1305.1-EXA3, and the EXA3 gene fragment is located between the SacI and BglII restriction sites of this vector.

[0111] 1. Obtaining recombinant Agrobacterium

[0112] pCAMBIA1305.1-EXA3 was transformed into Agrobacterium tumefaciens strain EHA105 (purchased from Ingenium Biotech, USA) using an electroporation method to obtain a recombinant strain. Plasmids were extracted and identified by PCR and enzyme digestion. The recombinant strain that was correctly identified by PCR and enzyme digestion was named EH-pCAMBIA1305.1-EXA3.

[0113] III. Obtaining Transgenic Plants

[0114] The EH-pCAMBIA1305.1-EXA3 was transformed into the rice male-sterile mutant F375. The specific method was as follows:

[0115] (7) Incubate EH-pCAMBIA1305.1-EXA3 at 28℃ for 16 h, collect the bacterial cells, and dilute them in N6 liquid medium (Sigma, C1416) to a concentration of OD200. 600 ≈0.5, to obtain bacterial culture;

[0116] (8) Mix the embryogenic callus of mature rice embryos cultured for one month with the bacterial solution in step (1) and infect for 30 min. After the bacterial solution is dried with filter paper, transfer it to co-culture medium (N6 solid co-culture medium, Sigma) and co-culture at 24℃ for 3 days.

[0117] (9) The callus from step (2) was inoculated onto N6 solid screening medium containing 100 mg / L hygromycin for the first screening (16 days).

[0118] (10) Select healthy callus and transfer them to N6 solid selection medium containing 100 mg / L hygromycin for a second selection. Subculture every 15 days.

[0119] (11) Select healthy callus and transfer them to N6 solid selection medium containing 50 mg / L hygromycin for the third selection, and subculture every 15 days.

[0120] (12) Select resistant callus and transfer it to differentiation medium for differentiation;

[0121] T0 generation positive plants that differentiated into seedlings were obtained.

[0122] 2. Identification of transgenic plants

[0123] 1. PCR molecular identification

[0124] In this study, dCAPS markers were used to identify transgenic plants. Primer design: Based on the differences between 148 and Ningjing 4 in SEQ ID NO.1, mismatched PCR primers were designed using "dCAPS Finder 2.0" software to create restriction enzyme sites. Simultaneously, a corresponding primer was designed using Primer 5.0 software. The primer sequences are as follows:

[0125] Primer 9:

[0126] 5'ACTTCCTCTATATGCAAAATGCTTGGTTGAAG 3'

[0127] Primer 10:

[0128] 5'TCAGAAGTCCTCATGCATACTTGCAGAGC 3'

[0129] PCR reaction system for dCAPS labeling analysis: DNA (20 ng / μL) 2 μL, Primer 3 (10 pmol / μL) 2 μL, Primer 4 (10 pmol / μL) 2 μL, 10x Buffer (MgCl2 free) 2 μL, dNTP (10 mM) 0.4 μL, MgCl2 (25 mM) 1.2 μL, rTaq (5 U / μL) 0.4 μL, ddH2O 10 μL, total volume 20 μL.

[0130] The amplification reaction was performed on a PTC-200 (MJ Research Inc.) PCR instrument: 94℃ for 3 min; 94℃ for 30 s, 55℃ (adjusted according to different primers) for 45 s, 72℃ for 2.5 min, 35 cycles; 72℃ for 5 min.

[0131] The PCR products were purified and recovered according to the kit (Beijing Tiangen) instructions. After overnight digestion with SacI (Takara, Japan), the PCR products were detected by 4% agarose gel electrophoresis.

[0132] The results showed that 7 plants were positive for PCR testing. Figure 7 Lanes 3, 5, 6, 7, 11, and 13 in the middle band represent mutants of 148, while lanes 1, 2, 4, 8, 9, 10, and 12 represent seven transgenic pCAMBIA1305.1-EXA3 plants obtained through transformation. The wild-type band is 120 bp, while 148, due to the introduction of restriction enzyme sites, yields a 100 bp fragment after enzyme digestion. The seven transgenic lines, containing both the 148 background fragment and the introduced Ningjing 4 fragment, exhibit heterozygous bands, displaying both 100 bp and 120 bp bands on electrophoresis.

[0133] 3. Phenotypic identification

[0134] T0 generation plants transformed with pCAMBIA1305.1-EXA3, 148, and Ningjing 4 were planted at the Baima planting base of Nanjing Agricultural University. Plants of Ningjing 4 and pCAMBIA1305.1-EXA3 were harvested separately. Figure 7 (L1, L2, and L3 are three independent transgenic lines) Anthers were observed during the flowering period, and the anthers were stained with iodine. The anther morphology and color of the pCAMBIA1305.1-EXA3 transgenic plants were restored to the wild-type level. Figure 7 ), and pollen can be normally iodized ( Figure 7Therefore, the phenotype of line 148 is caused by a mutation in EXA3. pCAMBIA1305.1-EXA3 can restore the male fertility of line 148 to normal levels.

Claims

1. EXA3, a plant pollen wall development-related protein, selected from either (a) or (b) of the following proteins: (a) A protein consisting of the amino acid sequence shown in SEQ ID NO.1; (b) A protein derived from SEQ ID NO.1 that is associated with plant pollen development by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence of SEQ ID NO.

1.

2. The gene encoding EXA3, the plant pollen wall development-related protein of claim 1. EXA3.

3. The gene according to claim 2 EXA3 Its characteristics are, The gene may be a DNA molecule as follows: 1) or 2) or 3) or 4): 1) As shown in SEQ ID NO.2 EXA3 CDS; 2) As shown in SEQ ID NO.3 EXA3 Genomic DNA; 3) A DNA molecule that hybridizes to the DNA sequence defined in 1) or 2) under stringent conditions and encodes the protein; 4) DNA molecules that have more than 90% homology with the DNA sequence defined in 1), 2), or 3) and encode proteins related to plant pollen wall development.

4. Containing the gene as described in claim 2 or 3 EXA3 Recombinant expression vectors.

5. Containing the gene as described in claim 2 or 3 EXA3 Expression cassettes, transgenic cell lines, or recombinant bacteria.

6. The use of at least one of the following in plant breeding: the protein EXA3 of claim 1, the gene of claim 2, the recombinant expression vector of claim 3, and the expression cassette, transgenic cell line, or recombinant bacteria of claim 4.

7. The application according to claim 5, characterized in that, The mutation described EXA3 Genes that result in rice with abnormal pollen wall development.

8. The application according to claim 5, characterized in that, The use of at least one of the following in restoring the fertility of male gametes in plants: the protein EXA3 of claim 1, the gene of claim 2, the recombinant expression vector of claim 3, and the expression cassette, transgenic cell line, or recombinant bacteria of claim 4.

9. A method for restoring the fertility of male gametes in plants, characterized in that: The gene described in claim 2 is introduced into a male-sterile plant to obtain a transgenic plant with normal male gametophyte development; the male-sterile plant is a plant with abnormal pollen wall development that does not produce seeds; the transgenic plant with normal male gametophyte development is a transgenic plant with male gametophyte development equivalent to the normal type.

10. The method according to claim 8, characterized in that: The gene of claim 2 is introduced into male-sterile plants using the recombinant expression vector of claim 4 or 5.

11. A method for cultivating transgenic plants with abnormal male gametophyte development, characterized in that: Suppressing the expression of the gene described in claim 2 in a target plant yields a male-sterile transgenic plant; the target plant is a plant carrying the gene described in claim 2.

Images