A method for breeding a plant resistant to powdery mildew, and use of a mesophyll-specific expression vector

Abstract

The application relates to the technical field of plant breeding, and discloses a cultivation method of a powdery mildew-resistant plant and application of a mesophyll-specific expression vector, which comprises the following steps: transforming the mesophyll-specific expression vector into the powdery mildew-resistant plant, so that the mesophyll cells in the powdery mildew-resistant plant can specifically express a powdery mildew-resistant gene MLO; and the powdery mildew-resistant plant is obtained by making the powdery mildew-resistant gene MLO in the plant be mutated. According to the application, the mesophyll-specific expression vector is introduced into the powdery mildew-resistant plant (the plant has a premature aging phenomenon) with the function of the powdery mildew-resistant gene MLO being inactivated, so that the mesophyll cells in the plant can specifically express the powdery mildew-resistant gene MLO, and the plant which is resistant to powdery mildew and has no growth defects is obtained. The cultivation method provided by the application can eliminate the premature aging phenotype of the existing powdery mildew-resistant plant with premature aging, successfully decouples the mlo-mediated disease resistance and growth demand, and provides a new perspective for further analyzing the MLO-mediated disease mechanism research.

Description

Technical Field

[0001] This invention relates to the field of plant breeding technology, specifically to a method for cultivating plants resistant to powdery mildew and the application of a mesophyll-specific expression vector. Background Technology

[0002] Powdery mildew is a serious and important plant disease caused by powdery mildew fungi. With the proliferation of these fungi, crop yields and quality are severely reduced, and some severely infected plants may die due to physiological exhaustion. Powdery mildew can infest a wide variety of plants, including important food and cash crops such as wheat, barley, rapeseed, soybeans, and tobacco, posing a persistent threat to agricultural production.

[0003] Plant genomes contain a special class of genes—susceptibility genes (S genes). These genes promote pathogen infection and colonization while also playing important physiological roles in plant growth and development. Mutations or loss of function in these genes can enhance the pathogenicity of pathogens, granting plants broad-spectrum and durable resistance. MLO is a classic susceptibility gene, highly conserved across species. Its inactivation confers powdery mildew resistance, but is accompanied by severe growth defects such as premature aging, reduced plant height, and decreased yield. This coupling between disease resistance and growth is extremely detrimental to crop production. Therefore, achieving the separation of disease resistance mediated by MLO mutants from growth and developmental requirements has become a crucial problem that urgently needs to be solved in disease resistance breeding research based on susceptibility genes. Summary of the Invention

[0004] The purpose of this invention is to overcome the problem that while MLO inactivation confers resistance to powdery mildew to plants, it also results in serious growth defects such as premature aging, reduced plant height, and decreased yield. This invention provides a method for cultivating powdery mildew-resistant plants and the application of mesophyll-specific expression vectors, aiming to uncouple MLO-mediated disease resistance and growth requirements, and to provide a new perspective for further research on MLO-mediated disease susceptibility mechanisms.

[0005] To achieve the above objectives, the present invention provides a method for cultivating powdery mildew-resistant plants, the method comprising: transforming a mesophyll-specific expression vector into powdery mildew-resistant plants, so that the mesophyll cells in the powdery mildew-resistant plants can specifically express the powdery mildew resistance gene MLO; The powdery mildew-resistant plants were obtained by mutating the powdery mildew resistance gene MLO in the plants.

[0006] Preferably, the plant is selected from any one of barley, wheat, and Arabidopsis thaliana.

[0007] Preferably, the plant is Arabidopsis thaliana.

[0008] Preferably, the powdery mildew-resistant plant is the Arabidopsis thaliana Atmlo2 / 6 / 12 mutant.

[0009] Preferably, in the mesophyll-specific expression vector, the target gene is AtMLO2, and its nucleotide sequence is shown in SEQ ID NO: 1.

[0010] Preferably, in the mesophyll-specific expression vector, the mesophyll-specific promoter is AtRbcs_2b, and its nucleotide sequence is shown in SEQ ID NO: 2.

[0011] Preferably, the mesophyll-specific expression vector is a pC1300 binary vector.

[0012] Preferably, the pC1300 binary carrier contains kanamycin resistance and hygromycin resistance.

[0013] Preferably, the pC1300 binary carrier comprises a 35S promoter and a NOS terminator.

[0014] Preferably, the mesophyll-specific expression vector further contains the terminator HSP18.2, the nucleotide sequence of which is shown in SEQ ID NO: 3.

[0015] Preferably, the method further includes preparing a mesophyll-specific expression vector according to the following steps: (1) The promoter AtRbcs_2b, the target gene AtMLO2, the fluorescent protein YFP, and the terminator HSP18.2 were amplified respectively; (2) The pC1300 binary vector was digested with Hind III and Sac I to obtain a linearized pC1300 binary vector; (3) The linearized pC1300 binary vector, promoter AtRbcs_2b, target gene AtMLO2, fluorescent protein YFP and terminator HSP18.2 were constructed by multi-fragment homologous recombination to obtain the mesophyll-specific expression pC1300-Rbcs_2b-MLO2-YFP-tHSP18.2-tNOS vector.

[0016] A second aspect of the present invention provides an application of a mesophyll-specific expression vector in the breeding of powdery mildew-resistant and premature-aging plants, wherein the application includes: transforming the mesophyll-specific expression vector into powdery mildew-resistant plants, so that the mesophyll cells in the powdery mildew-resistant plants can specifically express the powdery mildew resistance gene MLO; wherein the powdery mildew-resistant plants are obtained by mutating the powdery mildew resistance gene MLO in plants.

[0017] Preferably, the plant is selected from any one of barley, wheat, and Arabidopsis thaliana. Preferably, when the plant is Arabidopsis thaliana, the powdery mildew-resistant plant is the Arabidopsis thaliana Atmlo2 / 6 / 12 mutant.

[0018] The technical solution provided by this invention involves introducing a mesophyll-specific expression vector into existing powdery mildew-resistant plants (which exhibit premature senescence) that have lost the function of the powdery mildew resistance gene MLO. This allows the mesophyll cells of the powdery mildew-resistant plant to specifically express the powdery mildew resistance gene MLO, thereby obtaining a powdery mildew-resistant plant without growth defects. The breeding method provided by this invention can eliminate the premature senescence phenotype of existing powdery mildew-resistant but prematurely senescent plants, successfully uncoupling MLO-mediated disease resistance and growth requirements. This provides a new perspective for further research on MLO-mediated susceptibility mechanisms, offers a novel technical pathway for breeding using susceptibility genes, and also provides a reference for the research and uncoupling of other pleiotropic genes. Attached Figure Description

[0019] Figure 1 This involves obtaining gene editing maps of the Arabidopsis thaliana Atmlo 6 / 12 double mutant and the Arabidopsis thaliana Atmlo 2 / 6 / 12 triple mutant used in the embodiments of this invention; Figure 2 This invention provides a diagram showing the vector for cultivating plants (mesophyll-specific MLO2 expression plants) and the MLO2-YFP expression level. (A): Schematic diagram of the mesophyll cell-specific MLO2 expression vector; the AtMLO2-YFP gene expression is driven by the 1744 bp promoter sequence upstream of the AtRbcs_2b gene ATG, represented by the abbreviation RMY. This plasmid is constructed in the pC1300 binary expression vector and transformed into the Atmlo2 / 6 / 12 mutant background; green arrows represent the proAtRbcs_2b promoter, purple rectangles represent the MLO2 coding sequence, blue rectangles represent the YFP coding gene, and gray rectangles represent the HSP18.2 terminator; (B): Real-time quantitative PCR was used to detect the relative expression level of MLO2-YFP in mesophyll cell-specific MLO2 expression plants. Data were normalized using AtActin8 as an internal reference gene; values ​​are mean ± standard deviation, n = 3. Figure 3 This is a diagram showing the growth phenotype of plants cultivated using the method provided in this invention; Note: Representative plants with different MLO2-YFP expression levels were selected for growth phenotype display. All Arabidopsis thaliana plants were grown under short-day conditions for 8 weeks before phenotype collection. All plants with mesophyll cells specifically expressing MLO2-YFP had similar growth recovery phenotypes; Bar = 1cm; Figure 4This is a graph showing the results of chlorophyll content and SAG13 expression levels in plants cultivated using the method provided in this invention. (A): Chlorophyll content of leaves from different genotypes of Arabidopsis thaliana. All Arabidopsis thaliana plants were grown under short-day conditions for 7 weeks. The 3rd to 5th rosette leaves of different genotypes were weighed, and chlorophyll was extracted using 80% acetone. The chlorophyll content was calculated using the experimental methods section, and the values ​​are mean ± standard deviation, n = 4. (B): Relative expression level of the senescence-related gene AtSAG13 in different genotypes of Arabidopsis thaliana. All Arabidopsis thaliana plants were grown under short-day conditions for 7 weeks. The 6th rosette leaf of different genotypes was taken, and the relative expression level of the senescence-related gene AtSAG13 was detected using real-time quantitative PCR. Data were normalized using AtActin8 as an internal reference gene, and the values ​​are mean ± standard deviation, n = 3. Figure 5 This is a diagram showing the accumulation of reactive oxygen species (ROS) in plants cultivated using the method provided in this invention. Note: DAB staining of leaves from different genotypes of Arabidopsis thaliana shows ROS accumulation. All plants were grown for 7 weeks under short-day conditions. The 7th rosette leaf was selected for DAB staining. The brown area indicates excessive ROS accumulation. The image below shows a magnified view of the corresponding complete leaf above. Bar = 2 mm. Figure 6 The following are the results of powdery mildew resistance testing of plants cultivated using the method provided in this invention: (A): Microscopic photographs of microcolon formation on leaves of different genotypes of Arabidopsis thaliana grown under short-day conditions for 3 weeks. Samples were taken three days after inoculation with *G. orontii* powdery mildew. Powdery mildew spores and microcolon formations were stained with Coomassie brilliant blue. Bar = 100 μm; (B): Percentage of microcolon formations formed by germination of *G. orontii* spores on leaves of different genotypes of plant. After 72 h of inoculation, each genotype of Arabidopsis thaliana had more than 1000 germinating spores. The values ​​are mean ± standard deviation, n = 3.

[0020] Figure 7The diagram shows the vector and relative expression level of MLO2-YFP in the epidermal cell-specific MLO2 plants in Comparative Example 1: (A): Schematic diagram of the epidermal cell-specific MLO2 expression vector. The AtMLO2-YFP gene expression was driven by the 1223 bp promoter sequence upstream of the AtLTP1 gene ATG, constructed in the pC1300 binary expression vector, with LMY abbreviation representing the plasmid, and transformed in the Atmlo2 / 6 / 12 mutant background; the yellow-green arrows represent the proLTP1 promoter, the purple rectangles represent the MLO2 coding sequence, the blue rectangles represent the YFP coding gene, and the gray rectangles represent the HSP18.2 terminator; (B): The relative expression level of MLO2-YFP in the epidermal cell-specific MLO2 expression plants was detected by real-time quantitative PCR. The data were normalized using AtActin8 as an internal reference gene; the values ​​are mean ± standard deviation, n = 3. Figure 8 This is a diagram showing the growth phenotype of plants expressing MLO2-specifically in epidermal cells in Comparative Example 1; Note: Representative plants with different MLO2-YFP expression levels were selected for growth phenotype display. All Arabidopsis plants were grown under short-day conditions for 8 weeks before phenotype collection. All plants expressing MLO2-YFP-specifically in epidermal cells had similar growth phenotypes; Bar = 1 cm. Figure 9 This figure shows the results of chlorophyll content and SAG13 expression levels in epidermal cell-specific MLO2-expressing plants in Comparative Example 1. (A): Chlorophyll content of leaves from different Arabidopsis thaliana genotypes. All Arabidopsis thaliana plants were grown under short-day conditions for 7 weeks. The 3rd to 5th rosette leaves of different genotypes were weighed, and chlorophyll was extracted using 80% acetone. The chlorophyll content was calculated using the experimental methods section, and the values ​​are mean ± standard deviation, n = 4. (B): Relative expression level of the senescence-related gene AtSAG13 in different Arabidopsis thaliana genotypes. All Arabidopsis thaliana plants were grown under short-day conditions for 7 weeks. The 6th rosette leaf of different genotypes was taken, and the relative expression level of the senescence-related gene AtSAG13 was detected using real-time quantitative PCR. Data were normalized using AtActin8 as an internal reference gene, and the values ​​are mean ± standard deviation, n = 3.

[0021] Figure 10 This is a diagram showing the results of the reactive oxygen species (ROS) accumulation test in the epidermal cells of plants specifically expressing MLO2 in Comparative Example 1; Note: DAB staining of leaves of different genotypes of Arabidopsis thaliana showed ROS accumulation; All plants were grown under short-day conditions for 7 weeks, and the 7th rosette leaf was selected for DAB staining. The brown area indicates excessive ROS accumulation. The figure below is a magnified view of the corresponding complete leaf above; Bar = 2 mm. Detailed Implementation

[0022] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.

[0023] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0024] The MLO gene is a typical pleiotropic gene. Mutants with inactivated MLO genes can produce near-complete resistance to powdery mildew, demonstrating significant breeding potential. However, the pleiotropic nature of the MLO gene also brings considerable negative effects. Mutants generally exhibit undesirable phenotypes such as premature aging, stunted growth, and reduced yield, severely limiting its widespread application in agricultural production. Therefore, this invention provides a method for cultivating powdery mildew-resistant plants, aiming to circumvent the negative phenotypes caused by the pleiotropic nature of the MLO gene while simultaneously conferring powdery mildew resistance.

[0025] In this invention, the method for cultivating the powdery mildew-resistant plant includes: transforming a mesophyll-specific expression vector into the powdery mildew-resistant plant, so that the mesophyll cells in the powdery mildew-resistant plant can specifically express the powdery mildew resistance gene MLO; The powdery mildew-resistant plants were obtained by mutating the powdery mildew resistance gene MLO in the plants.

[0026] In some implementations, the plant is selected from any one of barley, wheat, and Arabidopsis thaliana.

[0027] In one specific implementation, the plant is Arabidopsis thaliana.

[0028] In this invention, the powdery mildew-resistant plant refers to a plant that has undergone gene editing technology to mutate the powdery mildew resistance gene MLO, thereby inactivating the MLO gene and acquiring powdery mildew resistance. When the plant is Arabidopsis thaliana, in one specific embodiment, the powdery mildew-resistant plant is the Arabidopsis Atmlo2 / 6 / 12 mutant. The Arabidopsis Atmlo2 / 6 / 12 mutant is an existing Arabidopsis plant with complete immunity to powdery mildew, but it exhibits premature aging, limiting its application in disease resistance breeding. Specifically, the Arabidopsis Atmlo2 / 6 / 12 mutant is a triple mutant in Arabidopsis where the MLO2, MLO6, and MLO12 genes simultaneously lose function.

[0029] In this invention, when the plant is Arabidopsis thaliana, in one specific embodiment, the target gene in the mesophyll-specific expression vector is AtMLO2, and its nucleotide sequence is shown in SEQ ID NO: 1.

[0030] In this invention, when the plant is Arabidopsis thaliana, in one specific embodiment, the mesophyll-specific expression vector contains an AtRbcs_2b promoter (AT5G38420, 1744 bp upstream of ATG). Specifically, the nucleotide sequence of the AtRbcs_2b promoter is shown in SEQ ID NO: 2. This promoter exhibits high expression specificity and activity, meeting the requirements for mesophyll cell-specific expression in this invention.

[0031] In this invention, when the plant is Arabidopsis thaliana, the mesophyll-specific expression vector is a pC1300 binary vector (pCAMBIA1300 vector). This invention does not limit the source of the pC1300 binary vector; it can be a commercially available product.

[0032] Furthermore, the pC1300 binary vector contains kanamycin resistance and hygromycin resistance. Furthermore, the pC1300 binary vector contains a 35S promoter and a NOS terminator.

[0033] In one specific embodiment, the mesophyll-specific expression vector is a pC1300 binary vector, wherein the pC1300 binary vector contains kanamycin resistance and hygromycin resistance, and also contains a 35S promoter and a NOS terminator.

[0034] In this invention, when the vector in the mesophyll-specific expression vector is the aforementioned pC1300 binary vector containing the NOS terminator, the expression of the target gene can be achieved. To improve the expression effect of the target gene, in a preferred embodiment, the mesophyll-specific expression vector further contains the terminator HSP18.2 (AT5G59720), the nucleotide sequence of which is shown in SEQ ID NO: 3.

[0035] In a preferred embodiment, the method further includes preparing a mesophyll-specific expression vector according to the following steps: (1) The promoter AtRbcs_2b, the target gene AtMLO2, the fluorescent protein YFP, and the terminator HSP18.2 were amplified respectively; (2) The pC1300 binary vector was digested with Hind III and Sac I to obtain a linearized pC1300 binary vector; (3) The linearized pC1300 binary vector, promoter AtRbcs_2b, target gene AtMLO2, fluorescent protein YFP and terminator HSP18.2 were constructed by multi-fragment homologous recombination to obtain the mesophyll-specific expression pC1300-Rbcs_2b-MLO2-YFP-tHSP18.2-tNOS vector.

[0036] In this embodiment, the Atmlo2 / 6 / 12 mutant of Arabidopsis, which is completely immune to powdery mildew, was modified to eliminate the premature aging phenotype of the Atmlo2 / 6 / 12 mutant, thereby decoupling the MLO-mediated disease resistance and growth requirements. Since the AtMLO2 / 6 / 12 homologous genes of Arabidopsis, barley HvMLO, and wheat TaMLO have completely identical functions, the "disease resistance-premature aging balance molecular mechanism" identified in Arabidopsis can be used to guide barley and wheat improvement strategies. Therefore, the method provided by this invention offers a new solution and approach for disease resistance and high-yield breeding of wheat and barley.

[0037] The present invention also provides an application of a mesophyll-specific expression vector in the breeding of powdery mildew-resistant and premature-aging plants, wherein the application includes: transforming the mesophyll-specific expression vector into powdery mildew-resistant plants, so that the mesophyll cells in the powdery mildew-resistant plants can specifically express the powdery mildew resistance gene MLO; wherein the powdery mildew-resistant plants are obtained by mutating the powdery mildew resistance gene MLO in plants.

[0038] In some embodiments, the plant is selected from any one of barley, wheat, and Arabidopsis thaliana. In one specific implementation, when the plant is Arabidopsis thaliana, the powdery mildew-resistant plant is the Arabidopsis thaliana Atmlo2 / 6 / 12 mutant.

[0039] In one specific embodiment of the application described in this invention, the target gene in the mesophyll-specific expression vector is AtMLO2, and its nucleotide sequence is shown in SEQ ID NO: 1.

[0040] In one specific embodiment of the application described in this invention, the mesophyll-specific promoter in the mesophyll-specific expression vector is AtRbcs_2b, and its nucleotide sequence is shown in SEQ ID NO: 2.

[0041] In one specific embodiment of the application described in this invention, the terminator in the mesophyll-specific expression vector is HSP18.2, the nucleotide sequence of which is shown in SEQ ID NO: 3.

[0042] In a preferred embodiment, the application further includes preparing a mesophyll-specific expression vector according to the following steps: A1. The promoter AtRbcs_2b, the target gene AtMLO2, the fluorescent protein YFP, and the terminator HSP18.2 were amplified separately. A2. The pC1300 binary vector was digested with Hind III and Sac I to obtain a linearized pC1300 binary vector. A3. The linearized pC1300 binary vector, promoter AtRbcs_2b, target gene AtMLO2, fluorescent protein YFP, and terminator HSP18.2 were constructed through multi-fragment homologous recombination to obtain the mesophyll-specific expression pC1300-Rbcs_2b-MLO2-YFP-tHSP18.2-tNOS vector.

[0043] The present invention will be described in detail below through embodiments, but the scope of protection of the present invention is not limited thereto. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods in the art. Unless otherwise specified, the experimental materials used in the following embodiments are commercially available products.

[0044] The raw materials and experimental methods involved in the following embodiments include: 1. Raw materials: (1) Materials and reagents The Arabidopsis thaliana Atmlo 6 / 12 double mutant and the Arabidopsis thaliana Atmlo 2 / 6 / 12 triple mutant are existing Arabidopsis thaliana materials resistant to powdery mildew (see the paper: Consonni C, Humphry ME, Hartmann HA, Livaja M, Durner J, Westphal L, Vogel J, Lipka V, Kemmerling B, Schulze-Lefert P, Somerville SC, Panstruga R. Conserved requirement for a plant host cell protein in powderymildew pathogenesis. Nature Genetics, 2006, 38 (6):716-720. DOI:10.1038 / ng1806). (In this embodiment, for ease of operation, materials with the same effect as the mutants in the paper were obtained through gene editing technology. Specifically, the Arabidopsis thaliana Atmlo 6 / 12 double mutant and the Arabidopsis thaliana Atmlo 2 / 6 / 12 triple mutant are existing Arabidopsis thaliana materials resistant to powdery mildew (see the paper: Consonni C, Humphry ME, Hartmann HA, Livaja M, Durner J, Westphal L, Vogel J, Lipka V, Kemmerling B, Schulze-Lefert P, Somerville SC, Panstruga R. Conserved requirement for a plant host cell protein in powderymildew pathogenesis. Nature Genetics, 2006, 38 (6):716-720. DOI:10.1038 / ng1806). The 6 / 12 double mutant was obtained by CRISPR gene editing of MLO6 and MO12 in wild-type Arabidopsis thaliana Col-0; the Arabidopsis thaliana Atmlo2 / 6 / 12 triple mutant was obtained by CRISPR gene editing of MLO2 based on the Atmlo6 / 12 double mutant; the gene editing map is shown below. Figure 1 (as shown) Arabidopsis thaliana 1 / 2 MS solid medium (1 L): 2.22 g MS salt and 10 g sucrose were dissolved in water, and the pH was adjusted to 5.7 with 1 M KOH. The volume was brought to 1 L. 3 g plant gel powder was added. The sterilization conditions were 115℃ for 15 min.

[0045] Arabidopsis powdery mildew (Golovinomyces orontii): NCBI Taxonomy ID: 62715; Hygromycin B was purchased from Roche.

[0046] (2) Gene AtMLO2 (AT1G11310), the coding region nucleotide sequence is shown below (SEQ ID NO: 1):

[0047] AtRbcs_2b, its nucleotide sequence is shown below (SEQ ID NO: 2):

[0048] HSP18.2, its nucleotide sequence is shown below (SEQ ID NO: 3): ATATGAAGATGAAGATGAAATATTTGGTGTGTCAAATAAAAAGCTTGTGTGCTTAAGTTTGTGTTTTTTTCTTGGCTTGTTGTGTTATGAATTTGTGGCTTTTTCTAATATTAAATGAATGTAAGATCTCATTATAATGAATAAACAAATGTTTCTATAATCCATTGTGAATGTTTTGTTGGATCTCTTCTGCAGCATATAACTACTGTATGTGCTATGGTATGGACTATGGAATATGATTAAAGATAAG.

[0049] YFP, whose nucleotide sequence is shown below (SEQ ID NO: 4): .

[0050] 2. Experimental Methods (1) Plant culture For conventional soil cultivation of Arabidopsis thaliana, evenly scatter the dried seeds onto a thoroughly watered composite substrate (imported potting soil: vermiculite: perlite in a 10:4:1 ratio), cover with a film to retain moisture for 4 days. Carefully transplant the germinated Arabidopsis seedlings with unfolded cotyledons into the scalded composite substrate, cover with a transparent lid to retain moisture for 1 day, then uncover. Afterward, cultivate under normal light conditions, watering and adding nutrient solution as needed. The plant cultivation room conditions are: 22℃, 60% humidity, short-day cycle of 8 hours light and 16 hours dark, and long-day cycle of 16 hours light and 8 hours dark.

[0051] The dried seeds were disinfected with 10% 84 disinfectant and 1% Triton X-100 for 10 min. The disinfectant was then removed in a clean bench and the seeds were rinsed repeatedly with sterile water 6 times. The cleaned seeds were then evenly spotted onto 1 / 2 MS solid medium containing hygromycin (50 mg / mL) and treated at 4℃ for 2 days. After that, the seeds were placed in a plant light incubator for cultivation with a photoperiod of 8 h light and 16 h dark, 22℃ and 60% humidity. Then, the seeds were transplanted or sampled.

[0052] (2) DAB staining method To detect H2O2 accumulation caused by premature senescence in mutant plant leaves, this study employed DAB staining. Collected leaf samples were directly immersed in a 1 mg / mL DAB staining solution (DAB is photosensitive and must be wrapped in aluminum foil to protect from light). A vacuum pump was used to evacuate the samples for 30 min to ensure complete immersion of the leaves in the DAB solution. The samples were then incubated overnight at room temperature on a shaker at 40 rpm, protected from light by aluminum foil. The following day, the DAB-stained leaves were placed in a decolorizing solution (ethanol: glacial acetic acid: glycerol in a 3:1:1 v / v ratio) and then boiled in a 95℃ water bath for 20 min for decolorization. The decolorized leaves were approximately milky white and translucent, and could be directly laid flat for slide preparation for microscopic observation and photography. H2O2 accumulation was observed in brown areas.

[0053] Example 1 1. Cultivation methods for Arabidopsis thaliana resistant to powdery mildew and without premature aging.

[0054] (1) Construction of mesophyll-specific fusion expression vector: This experiment used the pC1300 binary vector, which contains kanamycin resistance and hygromycin resistance, and includes a 35S promoter and a NOS terminator; the mesophyll-specific promoter AtRbcs_2b was obtained by amplification of wild-type genome using high-fidelity DNA polymerase, the AtMLO2 CDS sequence was obtained by amplification of wild-type Arabidopsis cDNA, the YFP sequence was obtained by PCR amplification, the linearized pC1300 vector was obtained by double digestion with Hind III and Sac I, and the HSP18.2 terminator was obtained by PCR amplification; the yeast transformation and verification of the above materials were constructed by multi-fragment homologous recombination, and finally the pC1300-Rbcs_2b-MLO2-YFP-tHSP18.2-tNOS (mesophyll-specific expression) fusion expression vector was obtained, abbreviated as RMY (see Figure 2 A).

[0055] (2) Transformation: The pC1300-Rbcs_2b-MLO2-YFP-tHSP18.2-tNOS (mesophyll cell-specific expression) fusion expression vector was transformed into the Atmlo2 / 6 / 12 triple mutant and cultured to obtain Arabidopsis thaliana resistant to powdery mildew and without premature aging.

[0056] 2. The Arabidopsis thaliana strains resistant to powdery mildew and without premature aging obtained above were subjected to the following tests: 2.1 AtMLO2 expression in mesophyll cells eliminated the premature senescence phenotype in Atmlo2 / 6 / 12 plants. (1) The expression level of AtMLO2-YFP in the Arabidopsis thaliana obtained above was detected by qPCR, and the results are as follows: Figure 2 As shown in B. Figure 2 The results of B showed that these plants all had good transgene expression levels compared with the internal reference gene AtActin8.

[0057] (2) To evaluate the effect of mesophyll cell-specific expression on the negative phenotype of mutants, further detection was conducted on two core negative phenotypes: premature aging and ROS accumulation. This experiment combined macroscopic phenotypic observation with molecular index detection. First, 8-week-old seedlings were photographed and observed to macroscopically analyze premature aging characteristics such as yellowing and necrosis of leaves. Second, the relative chlorophyll content of the plants was measured, and senescence-related genes were detected by real-time quantitative PCR. AtSAG13 The expression level was further quantified to determine the degree of premature aging, and the results were as follows: Figure 3 and Figure 4 As shown.

[0058] The results showed that mesophyll cells specifically expressed... AtMLO2-YFP The transgenic plants have basically recovered to normal growth and development, with no obvious signs of premature aging such as yellowing or necrosis of leaves (see...). Figure 3 Furthermore, the relative chlorophyll content of the plant leaves was significantly restored (see...). Figure 4 A), in addition, aging-related genes AtSAG13 The expression level returned to normal, consistent with WT, both being at a low expression level (see...). Figure 4 B).

[0059] (3) Excessive ROS accumulation is one of the negative phenotypes of the Atmlo2 / 6 / 12 mutant. ROS accumulation is mainly manifested as the enrichment of hydrogen peroxide (H2O2) and superoxide anions. These substances have strong oxidizing properties and can react with 3,3'-diaminobenzidine (DAB) to form a brown precipitate. Therefore, the DAB staining method was used to detect the ROS accumulation status of the leaves of 7-week-old seedlings obtained above. The results are as follows. Figure 5 As shown. Figure 5The results showed that the leaves were translucent milky white after DAB staining, consistent with the WT and Atmlo6 / 12 double mutants, and no obvious brown precipitate was observed.

[0060] The above results indicate that the premature senescence phenotype and excessive ROS accumulation of the Atmlo2 / 6 / 12 triple mutant are mainly caused by the absence of AtMLO2 in mesophyll cells, and the premature senescence phenotype of Atmlo2 / 6 / 12 plants was eliminated by AtMLO2 expression in mesophyll cells.

[0061] 2.2 AtMLO2 expression in mesophyll cells maintained the disease resistance of Atmlo2 / 6 / 12 plants. To clarify the effect of mesophyll cell-specific MLO2 expression on powdery mildew resistance in Atmlo2 / 6 / 12 plants, this invention inoculated three-week-old transgenic plants with powdery mildew. Three days later, leaves were harvested, decolorized, and stained with Coomassie brilliant blue. The microcolony formation rate of germinating spores on the leaves was counted. The results are as follows: Figure 6 As shown.

[0062] The results showed that plants expressing mesophyll-specific MLO2 largely maintained the strong resistance of the Atmlo2 / 6 / 12 mutant, with extremely low microcolony formation rates consistent with the mutant, and no significant increase was observed even in plants with higher transgene expression levels (see...). Figure 2 B and Figure 6 This indicates that AtMLO2 expression in mesophyll cells maintains the disease resistance of Atmlo2 / 6 / 12 plants.

[0063] As can be seen from the above, this invention maintains the disease resistance of the Atmlo2 / 6 / 12 mutant by specifically expressing the AtMLO2 gene in the mesophyll cells of the Atmlo2 / 6 / 12 mutant, while eliminating the premature senescence phenotype of the Atmlo2 / 6 / 12 plant, thus obtaining an Arabidopsis thaliana resistant to powdery mildew and without premature senescence, and successfully uncoupling the mlo-mediated disease resistance and growth requirements.

[0064] Comparative Example 1 The epidermal cell-specific expression vector was constructed using the same method as in Example 1, except that the promoter was replaced with the promoter of the epidermal cell-specific expression gene, AtLTP1 (AT2G38540, 1223 bp upstream of ATG). This resulted in the pC1300-LTP1-MLO2-YFP-tHSP18.2-tNOS (epidermal cell-specific expression) fusion expression vector, abbreviated as LMY (see [link to example]). Figure 7 A); The vector was transformed into the Arabidopsis thaliana Atmlo2 / 6 / 12 triple mutant and cultured to obtain plants that specifically express MLO in epidermal cells.

[0065] The transgenic level of the cultured plants was detected by qPCR, and the results are as follows: Figure 7 As shown in B. Figure 7 The results of B showed that these plants all had good transgene expression levels compared with the internal reference gene AtActin8. However, because it was only expressed in epidermal cells, the expression level was not as good as that of plants that specifically expressed the gene in mesophyll cells.

[0066] To clarify the impact of epidermal-specific MLO2 expression on the negative phenotype of the Arabidopsis Atmlo2 / 6 / 12 triple mutant, a systematic examination was conducted targeting two core negative phenotypes: premature aging and ROS accumulation. The results are as follows: Figure 8 and Figure 9 As shown. The results showed that transgenic plants specifically expressing AtMLO2-YFP in epidermal cells still exhibited a significant premature aging phenotype (see...). Figure 8 The relative chlorophyll content did not recover (see...). Figure 9 A), the aging-related gene AtSAG13 still exhibits high expression levels (see A). Figure 9 B), whose overall phenotype is more similar to that of the Atmlo2 / 6 / 12 triple mutant.

[0067] The ROS accumulation status of the leaves of 7-week-old seedlings obtained above was detected using the DAB staining method. The results are as follows: Figure 10 As shown. Figure 10 The results showed that transgenic plants that specifically expressed AtMLO2-YFP in epidermal cells still exhibited excessive accumulation of reactive oxygen species. Compared with the Atmlo2 / 6 / 12 triple mutant, the brown precipitate area was not reduced, and there was still more brown precipitate compared with WT.

[0068] The above results indicate that the absence of epidermal cell-specific AtMLO2 expression and the failure to eliminate Atmlo2 / 6 / 12 premature senescence in plants has been observed.

[0069] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. A method for cultivating a plant resistant to powdery mildew, characterized in that, The method includes: transforming a mesophyll-specific expression vector into a powdery mildew-resistant plant, so that the mesophyll cells in the powdery mildew-resistant plant can specifically express the powdery mildew resistance gene MLO; The powdery mildew-resistant plants were obtained by mutating the powdery mildew resistance gene MLO in the plants.

2. The method according to claim 1, characterized in that, The plant was selected from any one of barley, wheat, and Arabidopsis thaliana.

3. The method according to claim 1, characterized in that, The plant in question is Arabidopsis thaliana.

4. The method according to claim 3, characterized in that, The plant resistant to powdery mildew is the Arabidopsis thaliana Atmlo2 / 6 / 12 mutant.

5. The method according to claim 4, characterized in that, In the mesophyll-specific expression vector, the target gene is AtMLO2, and its nucleotide sequence is shown in SEQ ID NO: 1; Preferably, in the mesophyll-specific expression vector, the mesophyll-specific promoter is AtRbcs_2b, and its nucleotide sequence is shown in SEQ ID NO:

2.

6. The method according to claim 4, characterized in that, The mesophyll-specific expression vector is a pC1300 binary vector. Preferably, the pC1300 binary carrier contains kanamycin resistance and hygromycin resistance; Preferably, the pC1300 binary carrier comprises a 35S promoter and a NOS terminator.

7. The method according to claim 6, characterized in that, The mesophyll-specific expression vector also contains the terminator HSP18.2, the nucleotide sequence of which is shown in SEQ ID NO:

3.

8. The method according to any one of claims 1-7, characterized in that, The method also includes preparing a mesophyll-specific expression vector according to the following steps: (1) The promoter AtRbcs_2b, the target gene AtMLO2, the fluorescent protein YFP, and the terminator HSP18.2 were amplified respectively; (2) The pC1300 binary vector was digested with Hind III and Sac I to obtain a linearized pC1300 binary vector; (3) The linearized pC1300 binary vector, promoter AtRbcs_2b, target gene AtMLO2, fluorescent protein YFP and terminator HSP18.2 were constructed by multi-fragment homologous recombination to obtain the mesophyll-specific expression pC1300-Rbcs_2b-MLO2-YFP-tHSP18.2-tNOS vector.

9. Application of a mesophyll-specific expression vector in breeding plants resistant to powdery mildew and free from premature aging, wherein, The application includes: transforming a mesophyll-specific expression vector into a powdery mildew-resistant plant, so that the mesophyll cells in the powdery mildew-resistant plant can specifically express the powdery mildew resistance gene MLO; wherein the powdery mildew-resistant plant is obtained by mutating the powdery mildew resistance gene MLO in the plant.

10. The application according to claim 9, characterized in that, The plant was selected from any one of barley, wheat, and Arabidopsis thaliana; Preferably, when the plant is Arabidopsis thaliana, the powdery mildew-resistant plant is the Arabidopsis thaliana Atmlo2 / 6 / 12 mutant.

Images