A method for identifying eublemma amalthealis and eublemma ministralis

Abstract

The application discloses a method for identifying Ectropis oblique and Ectropis grisescens, and belongs to the technical field of molecular biology. The application takes Ectropis oblique and Ectropis grisescens as research objects, systematically screens diagnostic different sites in the whole genome based on population genome resequencing data, and develops a nucleic gene molecular marker which can be used for rapid and accurate identification of close species. COI Compared with the mitochondrial markers in the prior art, the method has wider applicability and higher genetic variation sensitivity at the species and population levels. The molecular identification method established in the application provides reliable technical support for accurate identification of close pests and application of the close pests in plant quarantine and monitoring.

Description

Technical Field

[0001] This invention relates to a method for identifying closely related species, tea geometrid moth and grey tea geometrid moth, and belongs to the field of molecular biology technology. Background Technology

[0002] Whether based on thermal cycling amplification (such as polymerase chain reaction, PCR) or isothermal amplification techniques (such as loop-mediated isothermal amplification, LAMP; recombinase polymerase amplification, RPA; recombinase-assisted amplification, RAA), the core of most molecular detection methods relies on the specific binding of species-specific oligonucleotide primers to the target DNA in the sample. This principle supports the widespread application of DNA barcoding, quantitative PCR (qPCR), DNA microarrays, and various isothermal amplification detection techniques. In plant quarantine and pest monitoring, accurate and stable primer design is crucial for achieving rapid and reliable molecular diagnosis. PCR amplification using species-specific primers remains one of the most reliable, economical, and efficient pest detection methods currently available.

[0003] However, genetic variations within the target species may reduce primer binding efficiency or even trigger cross-amplification with non-target species, leading to false positive results. To maximize detection accuracy, the ideal target gene region should meet the following conditions: (1) the amplification fragment is short to improve amplification efficiency; (2) it targets a single-copy orthologous gene to avoid interference from paralogous genes from multi-copy gene families; (3) the primer binding region is 18-30 bp in length, highly conserved within the target species, and has at least 3 base differences between the target species and closely related non-target species, and contains at least one mismatch at the 3′ end of the primer to effectively reduce the risk of non-specific amplification.

[0004] Traditional species identification primers are mostly based on molecular markers from the Sanger sequencing era, such as mitochondrial genes ( COI , cytb ) or ribosomal RNA gene ( ITS , 18S , 28S These genes have high detection sensitivity due to their high copy numbers, but their resolution is often insufficient in distinguishing closely related species, especially morphologically recessive species. With the development and widespread application of next-generation sequencing (NGS) technology, genome-wide diagnostic variant screening has become possible. Population genomics methods can identify single nucleotide polymorphisms (SNPs) and insertion / deletion sites across the entire genome, providing a new technical pathway for the development of highly specific molecular diagnostic primers, even for taxonomically closely related groups.

[0005] Tea geometrid moth ( Ectropis obliquaProut and its closely related species, the gray tea geometrid moth ( Ectropis grisescens Warren belongs to the order Lepidoptera, family Geometridae, and genus Geometriidae. Ectropis The tea geometrid moth (Tea Looper) is one of the most important leaf-eating pests on tea trees, seriously affecting tea yield and quality and causing significant economic losses to tea production. The two types of geometrid moths share similar diets, appearances, and ecological niches, often leading to confusion in production. Recent surveys have found that the tea geometrid moth is mainly distributed in the border areas of Jiangsu, Zhejiang, and Anhui provinces in my country, and is primarily found in Japan and the Korean Peninsula abroad. The grey tea geometrid moth is distributed in all major tea-producing areas of my country, and occurs mixed with the tea geometrid moth in tea-producing areas of Jiangsu, Zhejiang, and Anhui provinces; no reports have been found abroad. Due to the considerable uncertainty in morphological identification, accurately distinguishing these two closely related pests is of great significance for studying their host adaptability, seasonal phenology, and regional population dynamics.

[0006] The geographical distribution characteristics of closely related inchworm species suggest that their overlapping regional distributions may promote natural hybridization and population competition among these species. The morphological characteristics of hybrid individuals often fall between those of the two parents or exhibit a backcross transitional state; relying solely on morphology or... COI Barcodes are insufficient to definitively identify genetic identity, easily misclassifying hybrid individuals as purebreds, thus obscuring the true composition of the population and reducing the accuracy of field monitoring and quarantine identification. If hybridization or gene introgression occurs between two inchworm species, it may affect the offspring's population dispersal ability, environmental adaptability, and response characteristics to control measures such as pesticides and natural enemies. Furthermore, reliable identification of hybrid offspring is a necessary technical prerequisite for explaining phenomena such as abnormal sex ratios, local population substitution, and cross-species diffusion of resistance genes. The lack of effective nuclear gene markers will severely limit a deeper understanding of the population dynamics and evolutionary mechanisms of these two inchworm species. Previous molecular differentiation studies have mainly relied on mitochondria. COI While gene (DNA barcoding) markers are used, their ability to distinguish between different inchworm species is limited due to the strict maternal inheritance of mitochondrial genes, particularly in mixed regions and hybridization backgrounds. Furthermore, current technologies for determining whether hybridization or gene introgression exists between two inchworm species typically require whole-genome resequencing and large-scale SNP data analysis. Although this method can accurately resolve an individual's genetic background, its high sequencing costs, complex data analysis, and long detection cycle make it difficult to meet the needs of rapid identification of field samples and grassroots quarantine monitoring.

[0007] Therefore, developing a rapid identification method based on nuclear gene molecular markers is of great value. This method can stably amplify and accurately distinguish the tea geometrid moth, the gray tea geometrid moth, and their hybrid offspring. It also has the advantages of simple operation, rapid detection, low cost, and suitability for large-scale sample screening. It is of great application value for the accurate identification of closely related pests and plant quarantine monitoring. Summary of the Invention

[0008] To address the aforementioned problems, this invention provides a method for identifying the closely related tea geometrid moth and the grey tea geometrid moth. This invention uses the tea geometrid moth and the grey tea geometrid moth as research subjects. Based on population genome resequencing data (43 grey tea geometrid moth individuals from 13 geographical regions and 12 tea geometrid moth individuals from 4 geographical regions, covering major tea-producing areas in my country), a systematic screening of whole-genome diagnostic differential loci was conducted, and based on this, a nuclear gene molecular marker for rapid and accurate identification of closely related species was developed. This differs from previous methods that primarily relied on mitochondria. COI This invention, based on nuclear gene variation information, designs and validates three pairs of universal nuclear gene primers for molecular identification research. These primers can stably amplify and accurately distinguish between the tea geometrid moth and the grey tea geometrid moth at the species level. Furthermore, they can identify their hybrid offspring. Compared to... COI Using mitochondrial markers, this method has broader applicability and higher sensitivity to genetic variation at the species and population levels, and is unaffected by maternal genetic bias. The molecular identification method established in this study provides reliable technical support for the accurate identification of closely related pests and their application in plant quarantine and monitoring.

[0009] The first objective of this invention is to provide a method for identifying the tea geometrid moth and the grey tea geometrid moth and their hybrid offspring, comprising the following steps: DNA was extracted from the sample to be tested; PCR amplification was performed on the DNA of the sample using nuclear gene primer pairs to obtain nuclear gene amplification products; the nuclear gene amplification products were sequenced, and the sequencing results were compared with the nucleotide sequences of the corresponding tea geometrid moth and gray tea geometrid moth, and base type analysis was performed at the corresponding diagnostic differential sites, combined with mitochondrial... COI Genetic identification results help distinguish between the tea geometrid moth and the grey tea geometrid moth, as well as their hybrid offspring: When a diagnostic differential site in a nuclear gene presents a single base type and is consistent with the nucleotide sequence of the tea geometrid moth, the sample is identified as a tea geometrid moth. The presence of 1 to 5 differential sites is allowed and can be regarded as intraspecific polymorphism, sequencing error or individual variation, and the sample is still identified as a tea geometrid moth. When the diagnostic differential site of the nuclear gene shows a single base type and is consistent with the nucleotide sequence of the tea looper, the sample is identified as the tea looper; the presence of 1 to 5 differential sites is allowed, which can be regarded as intraspecific polymorphism, sequencing error or individual variation, and the sample is still identified as the tea looper. When only 1 to 5 diagnostic differential sites in nuclear genes show characteristic base types of two species, and the remaining diagnostic differential sites are all single species bases, it is determined to be a pure species, and the difference can be regarded as sequencing error or intraspecific difference. When the nuclear gene determination result indicates purebred but differs from mitochondrial genes... COI When the species origin of the genetic identification is inconsistent, the sample is determined to be a hybrid individual or an individual with a genetic introgression background; When more than 5 diagnostic differential sites of nuclear genes simultaneously show the characteristic base types of two species, they are identified as hybrid offspring or individuals with interspecific gene introgression background. The nucleotide sequence of the tea geometrid moth compared with the nuclear gene amplification product is shown in SEQ ID NO: 1, and the nucleotide sequence of the gray tea geometrid moth is shown in SEQ ID NO: 2.

[0010] In one embodiment, the sequences of the nuclear gene primer pair are shown in SEQ ID NO: 7 and SEQ ID NO: 8.

[0011] In one implementation, mitochondria COI The genetic identification method is as follows: DNA was extracted from the sample to be tested and amplified using universal primers to obtain... COI Gene amplification products, COI After sequencing the gene amplification products, the sequences were compared with those of the tea geometrid moth and the grey tea geometrid moth. Species were determined based on sequence similarity and phylogenetic analysis. in, COI The nucleotide sequence of the tea geometrid moth compared with the gene amplification product is shown in SEQ ID NO: 15, and the nucleotide sequence of the grey tea geometrid moth is shown in SEQ ID NO: 16.

[0012] In one implementation, the sequences of the universal primers are shown in SEQ ID NO: 13 and SEQ ID NO: 14.

[0013] In one implementation, the characteristic base types of two species are manifested as bimodal or heterozygous sites in the sequencing peak diagram.

[0014] In one implementation, the diagnostic differential sites are fixed differential sites that are stable in multiple individuals, and the base types are species-specific between the tea geometrid moth and the grey tea geometrid moth, and highly conserved within the same species.

[0015] The second objective of this invention is to provide a method for identifying closely related species, the tea geometrid moth and the grey tea geometrid moth, comprising the following steps: DNA was extracted from the sample to be tested; PCR amplification was performed on the DNA of the sample using nuclear gene primer pairs to obtain amplification products; the amplification products were sequenced separately, and the sequencing results were compared with the nucleotide sequences of the corresponding tea geometrid moth and gray tea geometrid moth, respectively. Base type analysis was performed at the corresponding diagnostic differential sites to distinguish between the tea geometrid moth and gray tea geometrid moth. When a diagnostic differential site in a nuclear gene presents a single base type and is consistent with the nucleotide sequence of the tea geometrid moth, the sample is identified as a tea geometrid moth. The presence of 1 to 5 differential sites is allowed and can be regarded as intraspecific polymorphism, sequencing error or individual variation, and the sample is still identified as a tea geometrid moth. When the diagnostic differential site of the nuclear gene shows a single base type and is consistent with the nucleotide sequence of the tea looper, the sample is identified as the tea looper; the presence of 1 to 5 differential sites is allowed, which can be regarded as intraspecific polymorphism, sequencing error or individual variation, and the sample is still identified as the tea looper. The nucleotide sequences of the tea geometrid moth nucleus and the gray tea geometrid moth nucleus compared with the nuclear gene amplification products are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively; or in SEQ ID NO: 3 and SEQ ID NO: 4; or in SEQ ID NO: 5 and SEQ ID NO: 6.

[0016] In one embodiment, the nuclear gene primer pair sequences used when performing alignment with the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 are as shown in SEQ ID NO: 7 and SEQ ID NO: 8; The nuclear gene primer pairs used for alignment with the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 are shown in SEQ ID NO: 9 and SEQ ID NO: 10. The nuclear gene primer pairs used for alignment with the sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6 are shown in SEQ ID NO: 11 and SEQ ID NO: 12.

[0017] A third objective of this invention is to provide a kit for identifying the tea geometrid moth and the grey tea geometrid moth and their hybrid offspring, the kit containing primer pairs with sequences as shown in SEQ ID NO: 7 and SEQ ID NO: 8, or as shown in SEQ ID NO: 9 and SEQ ID NO: 10, or as shown in SEQ ID NO: 11 and SEQ ID NO: 12.

[0018] A fourth object of the present invention is to provide the application of any of the methods or kits described above in the identification of the tea geometrid moth and the grey tea geometrid moth and their hybrid offspring.

[0019] Beneficial effects 1. Overcome the limitations of mitochondrial labeling and significantly improve identification accuracy. Current technologies mainly rely on mitochondrial markers. COI Genes are used for species identification, but these markers are maternally inherited and susceptible to genetic drift, selection pressure, and symbiotic bacteria (such as...). Wolbachia Infection and other factors can lead to species identification bias or even misjudgment. This invention constructs a molecular marker system based on nuclear gene variation information and uses parental genetic characteristics to reflect genetic differences between species at the overall genome level, thereby effectively improving the accuracy and reliability of identifying the closely related tea geometrid moth and gray tea geometrid moth.

[0020] 2. Whole-genome screening of diagnostic loci enhances marker stability and specificity. This invention, based on population genome resequencing data, systematically screens for stable diagnostic differential loci across species across the entire genome, and develops nuclear gene molecular markers accordingly. Compared to traditional single-gene marker methods, the selected loci exhibit higher conservation and consistency, are less susceptible to individual differences or local mutations, and thus significantly improve the stability, reproducibility, and species specificity of the identification results.

[0021] 3. The primers exhibit stable amplification performance and are applicable to samples from different geographical populations. The three pairs of universal primers designed in this invention can stably amplify the target fragment, demonstrating good amplification consistency and reproducibility in samples from populations of different geographical origins. This method is highly adaptable to sample sources and genetic backgrounds, and can meet the identification needs under multi-regional and multi-population conditions, possessing good versatility and promotional value.

[0022] 4. Possesses high resolution and is suitable for species identification in complex genetic backgrounds. The nuclear gene molecular identification method established in this invention can accurately distinguish between the tea geometrid moth and the grey tea geometrid moth at the species level, and is particularly suitable for closely related species with similar morphological characteristics that are difficult to identify using traditional methods. Furthermore, even under complex genetic backgrounds such as interspecific hybridization, gene introgression, or interference from symbiotic bacteria, this method still maintains high stability and discriminative ability, effectively reducing the risk of misidentification and providing reliable technical support for pest monitoring and control. Attached Figure Description

[0023] Figure 1 The results are from agarose gel electrophoresis using universal primers.

[0024] Figure 2 Tea geometrid moth and gray tea geometrid moth Egri001425.1 Fragment sequence alignment.

[0025] Figure 3 Tea geometrid moth and gray tea geometrid moth Egri017832.1 Fragment sequence alignment.

[0026] Figure 4 Tea geometrid moth and gray tea geometrid moth Egri002297.1 Fragment sequence alignment.

[0027] Figure 5 Constructing an ML phylogenetic tree using iqtree: Mitochondrial genes COI Tree construction (left, K3Pu+F+G4), tandem construction of 3 nuclear genes (right, HKY+F+R3).

[0028] Figure 6 The survival status of offspring from hybrids of the tea geometrid moth and the grey tea geometrid moth. Detailed Implementation

[0029] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those familiar with the art.

[0030] The measurement methods involved in the examples are as follows: mitochondria COI Genetic identification methods In this embodiment, mitochondrial cytochrome c oxidase subunit I ( COI Genes are used as molecular barcodes for species identification. The specific method is as follows: using extracted genomic DNA as a template, universal primers are employed... COI -F (sequence as shown in SEQ ID NO: 13) and COI -R (sequence shown in SEQ ID NO: 14) was used for PCR amplification under standard DNA barcoding amplification conditions. The PCR products were detected by agarose gel electrophoresis and then sent to a sequencing company for bidirectional sequencing. The obtained... COI The sequences were compared with reference sequences of the tea geometrid moth (SEQ ID NO: 15) and the grey tea geometrid moth (SEQ ID NO: 16) in the database using an alignment analysis (e.g., BLAST). Species determination was made based on sequence similarity and phylogenetic analysis results. When a sample sequence showed the highest similarity to a reference sequence of a certain species and clustered within the same branch, it was identified as belonging to that species.

[0031] Example 1: Screening of gene markers The screening of gene markers includes the following steps: (1) Data acquisition: The raw data was acquired from the NCBI-SAR database (PRJNA983079).

[0032] (2) Data cleaning: Fastp v1.0.1 was used to perform quality control on the raw reads obtained from Illumina paired-end sequencing. Low-quality reads, adapter sequences, and reads containing poly-N were removed using default parameters to obtain high-quality cleaned data for subsequent analysis.

[0033] (3) Reference genome mapping: Minimap2 v2.30-r1287 (default parameters) was used to align the cleaned whole genome data of tea geometrid moth and gray tea geometrid moth to the reference genome of gray tea geometrid moth (Genbank: GCA_017562165.1); the alignment results were converted to BAM format and sorted.

[0034] (4) Alignment quality check: Picard v3.4.0 was used to remove duplicate reads. Samtools v1.22.1 was used to further evaluate alignment quality and coverage, and samples with genome coverage of less than 60% were removed and not included in subsequent analysis.

[0035] (5) SNP detection and filtering: Variation detection was performed using GATK v4.6.2.0. The obtained SNP loci were first quality filtered using GATK with the parameters "--filter expression QD<2.0 | | MQ<40.0 | | FS>60.0 | | SOR>3.0 | | MQRankSum<-12.5 | | ReadPosRankSum<-8.0". Then, they were filtered using vcftools v0.1.17 with the parameters "--maf 0.05 - - min-alleles 2 - - max-alleles 2 - - max-missing 0.9" to improve the genotypic accuracy of small samples or low-coverage loci and ensure the consistency of SNPs between different samples. The filtered SNPs were then used for downstream analysis.

[0036] (6) SNP analysis: The obtained SNPs were analyzed using a Perl v5.32.1 script to identify SNP sites that are highly conserved within the species but exhibit stable differences between the tea geometrid moth and the grey tea geometrid moth. SNP clusters were identified on the reference genome, i.e., regions containing 10 or more SNPs within a 1 kb area. Combined with genome annotation information, SNP clusters located within protein-coding genes were screened as candidate regions for subsequent nuclear gene marker development. Finally, 13 candidate genes that met the expectations were initially screened, and their gene information is shown in Table 1.

[0037] Table 1. Information on 13 candidate genes (SNP>20) based on genome-wide differential screening.

[0038] Example 2: Screening and Validation of Nuclear Gene Primers Further screening was conducted to identify genes that can quickly and accurately distinguish between the tea geometrid moth and the grey tea geometrid moth. The method is as follows: 1. Sample processing and primer screening Ten male adults from each of the long-term subcultured tea geometrid moth and gray tea geometrid moth strains were randomly selected in the laboratory, and genomic DNA was extracted using a TIANamp Genomic DNA kit. The extracted DNA was subjected to agarose gel electrophoresis and concentration detection before being used for subsequent PCR amplification. Based on the previous whole-genome analysis results, nuclear genes with complete annotation information and single copies were selected as candidate target genes, and primers were designed accordingly. Primer information is shown in Table 2. The extracted sample DNA was amplified by PCR using the primers in Table 2 to screen primers with stable amplification effects and species-discriminating ability. The PCR reaction system was 25 µL: 8.5 µL ddH2O, 12.5 µL Taq PCR StarMix (Dye), 2 µL DNA template, 1 µL forward primer (10 µM), and 1 µL reverse primer (10 µM). The reaction procedure was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 sec, 72℃ extension for 45 s, repeated 30 times; final extension at 72℃ for 5 min. The PCR amplification products were detected by 1.2% agarose gel electrophoresis to confirm the amplification of the target band. Three primer pairs that initially met the requirements were selected. The PCR agarose gel electrophoresis results are as follows. Figure 1 As shown.

[0039] 2. Establishment of gene sequence alignment and identification standards The PCR products with clearly amplified bands were sent to a sequencing company for bidirectional sequencing. The sequencing results were then compared with those of the three selected nuclear genes (…). Egri001425.1 , Egri017832.1 and Egri002297.1 The sequences of the tea geometrid moth and / or tea geometrid moth corresponding to the SEQ ID NO: 1~6 were compared (the nucleotide sequences of the tea geometrid moth and the gray tea geometrid moth corresponding to different nuclear genes are shown in SEQ ID NO: 1~6). The comparison results are shown in [link to SEQ ID NO: 1~6]. Figure 2 , Figure 3 and Figure 4 The NGS sequences were reference sequences derived from whole-genome resequencing data, and the Sanger sequencing results were sequencing data from 10 representative samples in the laboratory. Sequence alignment analysis of the amplified fragments was performed to screen for diagnostic differential sites that are stably present among different species. Based on the sequence characteristics of the amplified fragments and the diagnostic differential sites, the following species identification criteria were established: (1) When the sequencing sequence is consistent with the reference sequence of the tea geometrid moth at the diagnostic differential site and has a stable difference from the corresponding site of the gray tea geometrid moth, it is identified as the tea geometrid moth; (2) When the sequencing sequence is consistent with the reference sequence of the tea geometrid moth at the diagnostic differential site and has a stable difference from the corresponding site of the tea geometrid moth, it is identified as the tea geometrid moth; The diagnostic differential sites are fixed differential sites that are stable in multiple individuals, and their base types are consistent across different species, while remaining conserved within the same species. When a sample shows consistent species at diagnostic sites corresponding to multiple primer amplification fragments, it is considered the final identification result; differences of 1 to 5 sites are allowed, which can be regarded as intraspecific variation or sequencing error and do not affect species determination.

[0040] (3) Primer verification To verify the applicability and stability of the selected primers, 41 wild inchworm populations were collected from major tea-producing areas in my country, including 24 populations of *Tea looper* (90 individuals) and 28 populations of *Tea looper* (130 individuals). Specific sampling information is shown in Table 3. 10–20 larvae were randomly collected from each sampling point, with an interval of at least 10 km between sampling points. Although some sampling points were geographically close, their differences in topography and ecological environment allowed them to represent different types of tea garden habitats, thus ensuring the samples had good ecological representativeness.

[0041] The collected samples were first preliminarily identified based on morphological characteristics, then preserved in anhydrous ethanol, and... Store at 20°C for later use. In the laboratory, mitochondria were used... COI Molecular identification was performed using gene barcoding. Based on this, all samples (220 samples in total) were further tested using the three pairs of nuclear gene primers obtained in this embodiment. The results showed that the three primer pairs exhibited stable amplification in all tested samples, and the identification results based on nuclear gene markers were consistent with... COI The identification results were completely consistent, with an overall identification accuracy rate of 100% (see Table 3). Further tandem analysis based on the three nuclear gene sequences was used to construct a phylogenetic tree (…). Figure 5 The results showed that the tea geometrid moth and the gray tea geometrid moth clustered into independent branches, further verifying the effectiveness and reliability of the screened nuclear gene markers.

[0042] In summary, all three pairs of nuclear gene primers screened were able to stably and accurately distinguish between the closely related tea geometrid moth and the grey tea geometrid moth, demonstrating promising application prospects.

[0043] Table 2 Candidate Primer Information

[0044] Table 3 Sample Collection Information

[0045] Table 4. Accuracy of Identification of Tea Geometrid Moth and Grey Tea Geometrid Moth

[0046] Example 3: Identification of offspring from hybridization of tea geometrid moth and grey tea geometrid moth To verify the applicability of the nuclear gene molecular markers of this invention in the identification of hybrid offspring, a hybridization system of tea geometrid moth and gray tea geometrid moth was constructed, and the hybrid offspring were molecularly identified, as follows: 1. Sample processing and hybridization system construction Select for Wolbachia Tetracycline hydrochloride, which has a good control effect, was prepared into a solution with a concentration of 2.5 mg / mL. Using a spraying method, fresh tea leaves were completely immersed in the tetracycline solution for 3 minutes. Afterward, the tea leaves were placed in a ventilated area until the solution on the leaf surface was completely dried. The treated leaves were then used to feed 50 larvae of the tea geometrid moth for three consecutive generations to establish a control mechanism. Wolbachia The Grey Tea Looper strain is named EG-WU. The untreated Grey Tea Looper strain is named EG-WI, and the untreated Tea Looper strain is named EO.

[0047] The intraspecific self-pollination combinations of the tea geometrid moth and the grey tea geometrid moth are as follows: ♂×♀: EG-WI × EG-WI, EG-WU × EG-WU, EO × EO; The interspecific hybridization between the tea geometrid moth and the grey tea geometrid moth is as follows: ♂×♀: EG-WI × EO, EO × EG-WI, EG-WU × EO, EO × EG-WU.

[0048] According to the hybridization combination, one-to-one male and female pairs were placed in a humidified plastic cup. After 5 days, the abdomen of the female was cut open with tweezers and scissors to observe whether there were spermatophores. Each group was repeated at least 15 times. If the female died prematurely during the oviposition period, the biological replicate was discarded.

[0049] Survival status of laboratory hybrid offspring, such as Figure 6 As shown in the figure. The results indicate that the hatching rate of the F1 generation of the hybrid tea geometrid moth and gray tea geometrid moth is unstable, with abnormal sex ratios and unsustainable offspring reproduction. Furthermore, the hybrids cannot be sustained long-term through self-pollination and backcrossing, and the F3 generation dies out. DNA was extracted from the hybrid larvae and adults for subsequent identification and analysis.

[0050] 2. Molecular identification standards for hybrid offspring Based on the nuclear gene molecular marker system established in this invention, the sequencing results of PCR amplification products were compared with the reference sequences of *Tea geometrid moth* and *Grey tea geometrid moth*, respectively. Base type analysis was performed at diagnostic differential sites, and the identification criteria for hybrid offspring are as follows: When only 1 to 5 diagnostic differential sites in nuclear genes show characteristic base types of two species, and the remaining diagnostic differential sites are all single species bases, it is determined to be a pure species, and the difference can be regarded as sequencing error or intraspecific difference. When the nuclear gene determination result indicates purebred but differs from mitochondrial genes... COI When the species origin of the genetic identification is inconsistent, the sample is determined to be a hybrid individual or an individual with a genetic introgression background; When more than 5 diagnostic differential sites of nuclear genes simultaneously show the characteristic base types of two species, they are identified as hybrid offspring or individuals with interspecific gene introgression background. Among them, nuclear gene markers serve as the primary criterion for identification, used to recognize species-specific differential sites and heterozygous characteristics; mitochondrial markers... COI Genes are used as auxiliary markers to determine maternal genetic origin; multiple nuclear gene markers are preferably analyzed in combination to improve the accuracy and stability of hybrid offspring identification.

[0051] 3. Identification Results A total of 29 hybrid samples of *Tea geometrid moth* and *Tea geometrid moth 'gray'* were obtained, including 27 F1 generation (EO♂:EG-WU♀, EG-WU♂:EO♀, EO♂:EG-WI♀) hybrids and 2 F2 generation [EG-WU♂:F1♀(EG-WU♂:EO♀)]. These were obtained based on mitochondrial DNA. COI Genes and 3 nuclear gene markers ( Egri001425.1 , Egri017832.1 and Egri002297.1 PCR amplification was performed on the sample DNA. The results showed that different nuclear gene markers exhibited different performance in the identification of hybrid offspring. Specifically: Egri017832.1 and Egri002297.1 The consistency in determining hybrid offspring is low, with an identification accuracy rate of less than 50%. Egri001425.1 In most hybridization samples, obvious heterozygous sites or bimodal signals could be detected, with an identification accuracy of 89.7%, significantly better than other markers. The relevant results are shown in Table 5.

[0052] The above results indicate that among the screened nuclear gene markers, Egri001425.1 It exhibits higher sensitivity and reliability in identifying hybrid offspring, effectively distinguishing between purebred and hybrid individuals. Therefore, Egri001425.1 It can be used as a preferred molecular marker for the molecular identification of hybrid offspring and introgressive individuals of the tea geometrid moth and the gray tea geometrid moth.

[0053] Table 5. Accuracy of Identification of Offspring from Hybridization of Tea Geometrid Moth and Grey Tea Geometrid Moth

[0054] The sequences involved in the embodiments are as follows: Egri001425.1The nucleotide sequence of the Ectropis obliqua region is shown as SEQ ID NO: 1: AGCACGCTCTCACTGAAGAAGACATAATTGAAAAGTTTGGAGATTTTTTGAGCACGGAAAATGAAATTTTGGGACCAGCATTCAAAAACATTTCTAAGACAGATAATACGCTCCTCCATCATGTCTTAGGTCGAATTTCCGAATCAATCTCTTTTATTAAAACCGATCACGAAGCGACTGAAACGCTACAAAAAGCTATAGTGTCAGCTGTTCAAGAAGCTTCCAAAAAAGATTTGGAAATAATGTTACAAGAAAACAACAAAGAAAATTTAAAAGAATTGATTGTACAATCTGTCGGGCTTGCCAGAATACTTGGTATGAGGGATGTAGCAACAAAACTTTTATCTGTGGTTAACGATGAAGACAGTATGGCTAAAATTTCTTCAGATTCTGAAAGTCTGAATATATTAAAAAGATTAACAGTAATGCGGAAACTCGCTGACAAAAATCCGACAATGCATTCCGCTCTACGCAAGTTAGAATCAGATTCGATACTAGCTCGTACAGACCCTAATCTTAGAGACTTGGTACGAGAGAGTGCAGCTCTGATGATAGTTCCTGAAGAACCACCTCTACTAACATCTGAAGACGTTCCGCTGAGCTTACTTCAACCAGAAAACAGTCTAGCTATGGAAGATTTCTTATTCAAACGCAAGAAACAATCCGGAGCT Egri001425.1 The nucleotide sequence of the Ectropis grisescens region is shown as SEQ ID NO: 2: AGCACGCTCTCACTGAAGAAGACATAATTGAAAAGTTTGGAGATTTTTTGAGTACGGAAAATGACATTTTGGGACCAGCATTCAAAAACATTTCTAAGACAGATAATACGCTCCTCCATCATGTCTTAGGTCGAATTTCCGAATCAATTTCTTTTATTAAAACCGACCACGAAGCGACTGAAACGCTACAAAAAGCTATCGTGTCAGCTGTTCAGGAAGCTTCCAATAAAGATTTGGAAATAATGTTACAAGAGAACAACAAAGAAAACTTAAAAGAATTGATTGTACAATCTGTCGGACTTGCCAGAATACTTGGCATGAGGGATGTAGCAACAAAACTTTTATCTGTGGTTAATGATGAAGACAGTATGGCTAAAATTTCTTCAGATCCTGAAAGTCTGAATATATTAAAAAGACTAACAGTAATGCGGAAACTTGCTGACAAAAATCCGACAATGCATTCCGCTCTACGTAAGTTAGAATCAGATTCGATACTAGCTCGTACAGACCCTAATCTTAGAGACTTGGTACGAGAGAGTGCAGCTCTGATGATAGTTCCAGAAGAACCACCTCTACTTACATCTGAAGACGTTCCGCTGAGCTTACTTCAACCAGAAAACAGTCTAGCTATGGAAGATTTCTTATTCAAACGCAAGAAACAATCCGGAGCT Egri017832.1 The nucleotide sequence of Ectropis grisescens from the region is shown as SEQ ID NO: 3: GCGGTAGGTGGATATAGAAGTGAGAGCGTAAGTTCTTCAGATTATCCACCAAATCAGTGGCTAGATGTGTTGTTATTGAAACACCCAGGATCTGCAGCCGTAGAAGTGTCTATTAATGATTACGATCGCTTGCATGTCTTTTTCGAAGAAATCGAAAATGTATCAAACACAAACGGCACATTTGAATATAGCTGCAAGTTGAAAGGACCTCACAAATGTCACTTGGTACTGTGTTCTGATGAAATTTTTGTTGGTGGGGTTCCTGACGAAATAAAATCAAGGATCGTTGGTGAAGAATTATCGTCATTTTCGGGGGTTGTCGCTTCGATGACTTTAAATAATGTTCTTCTCAACCTCAAAGATTTTACCGTAGAACGTTCAAAAGGAAGTATCGTACAAGTATCATCTAGAACCGCCAGTGTGTCGGGTTCCTATTATGAAACTTCGTGGGGGAAATCGAAAAAGCTGAATCTAACGTGTCTTCACACGCGTTCTGCTAGGTCTCCGAACTCCGCGCACTGGATTTATCTAGATTCTTCCATAGTCGGAGCTAATACGGAAAAGCACGTGCGTTCTGTGGACAACGGCAAAGTGCTAAGACTGTCGGCCACAGGTAATCACGATATTACAGGATTCTATACATGCCGAGTGTACCGTAATAAACGGCATAGAAATATTGTTACCTACGGCGTAGTAGGAGAAACTGATAACAAATTGTCAGGTCCAGACTTAACGACGACCATCACCG Egri017832.1 The nucleotide sequence of Ectropis grisescens in the region is shown in SEQ ID NO: 4: GCGGTAGGTGGATATAGAAGTGAGAGCGTAAGTTCTTCAGATTATCCGCCAAATCAGTGGCTAGATGTGTTGTTATTGAAACACCCTGGATCTGCAGCCGTAGAAGTGTCAATTAATGATTACGATCGGTTGCATGTCTTTTTCGAAGAAATTGAAAATGTATCAAACACAAACGGCACATTTGAATATAGCTGCAAGTTGAAAGGACCTCACAAATGTCACTTGGTACTGTGTTCTGATGAAATTTTTGTTGGTGGGGTTCCTGACGAAATAAAATCAAGGATCGTAGGTGAAGAATTATCTTCATTTTCGGGGGTTGTCGCTTCGATGACTTTAAATAATGTTCTTCTCAACCTCAAAGATTTTACCGTAGAACGTTCAAAAGGAAGTATCGTACAAGTATCATCTAGAACCGCCAGTGTGTCGGGTTCCTATTATGAAACTTCGTGGGGAAAATCGAAAAAGCTAAATCTAACGTGTCTTCATACGCGTTCTGCGAGGTCTCCGAATTCCGCGCACTGGATTTATCTAGATTCTTCCATAGTCGGGGCTAATACGGAAAAGCACGTGCGTTCTGTGGACAACGGCAAAGTGCTAAGACTGTCGGCCACAGGTAATCACGATATTACAGGATTCTACACATGCCGAGTATACCGTAATAAACGACATAGAAATATTGTTACCTACGGTGTAGTAGGAGAAACTGATAACAAATTGTCAGGTCCAGACTTAACGACGACCATCACCG Egri002297.1 The nucleotide sequence of Ectropis obliqua in the region is shown in SEQ ID NO: 5: CTTGGACGAGTTTGCAATGGGCTCCGGGACTATTGACTCGATATTTGGCCCTTGTCGCAATCCTTGGCAATATGATAGAGAGAAATGGAGGATTTCTGGCGGCAGTTCTGGGGGCAGCGCTGTCGCTGTTTCTTCAGGATCGTGCGTAGCTGCCATAGGATCAGACACCGGTGGATCGACGCGCAACCCGGCCGCTCTATGTGGTGTCGTCGGCCTCAAACCCACTTACGGCCTCGTCTCCCGATACGGGCTCATTCCTCTAGTCAACTCCATGGATGTACCGGGTGTCTTAGCTAGAACTGTTGAAGACGCTACCAACATTCTGAACTGCATCGCTGGACCAGACATTTTAGATTCGACAACAATGAAAGAAGAACATAGACCGATTGAGTTAAAAAATATAGACCTGTCGAAGTTAAAAATAGGAATACCAAAAGAATATCACTGTGAAGGCATGAGCCAGGAAGTAGTGGACACTTGGAGTCATGTTATAAATATCTTAGAGGATGAAAAAGCATCAGTCAAAACTGTATCTCTACCTCATACATCAGTCTCTATAGCTGTTTACTCAATCCTGAACCAATGTGAAGTCGCCAGCAACATGGCAAGATATGATGGCATTCAATACGGACTTCGAACAGACGAAACATATTCCACAGAAGAGTTGTATGCATCATCAAGATTAAAAGGCTTCAACAAAGTGGTCCGATCAAGAATCCTAGCT Egri002297.1 The nucleotide sequence of Ectropis grisescens in the region is shown as SEQ ID NO: 6: CTTGGACGAGTTTGCAATGGGCTCCGGGACTATTGACTCGATATTTGGCCCTTGTCGCAATCCTTGGCAGTATGATAGAGAGAAATGGAGGATTTCTGGCGGCAGTTCTGGGGGCAGCGCTGTCGCTGTTTCTTCAGGGGTCGTGCGTAGCTGCCATAGGATCAGACACCGGTGGATCGACG CGCAATCCGGCCGCTCTATGTGGTGTCGTCGGCCTCAAACCCACATACGGCCTCGTTTCCCGATACGGGCTCATTCCTCTAGTCAATTCCATGGATGTTCCGGGTGTCTTAGCAAGAACTGTTGAAGACGCTACAAACATTCTGAACTGCATCGCTGGACCAGACATTTTAGATTCGACAA CAATGAAAGAAGAACATAGACCGATTGAGTTAAAAAATATAGACCTTTCGAAGTTAAAAATAGGAATACCGAAAGAATATCACTGTGAAGGCATGAGCCAAGAAGTAGTGGACACTTGGAGTCATGTTATAAATATCTTAGAGGATGAAAAAGCATCAGTCAAATCTGTATCTCTACCTCA TACCTCAGTCTCTATAGCCGTTTACTCAATCCTGAACCAATGTGAAGTCGCCAGCAACATGGCAAGATATGATGGCATTCAATACGGACTTCGAACAGACGAAACATATTCTACAGAAGAGTTGTATGCATCATCACGATTAAAAGGCTTCAACAAAGTGGTCCGATCAAGAATCCTAGCT Universal primers COI The -F sequence is shown in SEQ ID NO: 13: ATTCAACCAATCATAAAGATATTGG Universal primers COI The sequence of -R is shown in SEQ ID NO: 14: CTCCWCCAGCAGGATCAAAA mitochondria COI The sequence of the tea geometrid moth in the genetic species identification is shown in SEQ ID NO: 15: ACATTGTATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGACTATTAATTCGAGCAGAATTAGGTAACCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAACTGATTAGTACCTTTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCATCTCTTACTTTACTAATTTCTAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCTCCTTTATCCTCTAATATTGCTCATGGTGGAAGATCTGTAGATTTAGCAATTTTTTCATTACATTTAGCTGGTATTTCTTCAATTCTTGGAGCTATTAACTTTATTACAACAATTATTAATATACGATTAAATAATTTATCATTTGACCAAATACCTTTATTTGTTTGAGCTGTTGGAATTACAGCATTTTTATTACTTTTATCTTTACCAGTTTTAGCTGGGGCTATTACAATATTACTAACTGATCGAAATTTAAATACATCTTTTTTT mitochondria COI The sequence of Ectropis grisescens in gene species identification is shown as SEQ ID NO: 16: ACATTATATTTTATTTTTGGAATTTGAGCTGGGATGGTAGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGTAACCCAGGTTCTTTAATTGGAGATGATCAAATTTATAATACTATTGTAACCGCTCATGCTTTTATTATAATTTTT TTTATAGTAATACCAATTATAATCGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTATTACCCCCATCTCTTACTTTATTAATTTCTAGAAGAATTGTA GAAAATGGAGCAGGAACAGGATGAACAGTTTATCCTCCTTTATCTTCTAATATTGCTCACGGTGGAAGATCAGTAGATTTAGCAATTTTTTCATTACATTTAGCTGGTATTTCCTCAATTCTTGGGGCTATTAATTTTATTACAACAATTATT AATATACGATTAAATAATTTATCATTTGATCAGATAACCTTTATTTGTTTGAGCTGTTGGAATTACAGCATTCTTATTACTCTTATCTTACCAGTTTTAGCTGGGGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCTTTTTTT Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A method for identifying the tea geometrid moth and the grey tea geometrid moth and their hybrid offspring, characterized in that, Includes the following steps: DNA was extracted from the sample to be tested; PCR amplification was performed on the DNA of the sample using nuclear gene primer pairs to obtain nuclear gene amplification products; the nuclear gene amplification products were sequenced, and the sequencing results were compared with the nucleotide sequences of the corresponding tea geometrid moth and gray tea geometrid moth, and base type analysis was performed at the corresponding diagnostic differential sites, combined with mitochondrial... COI Genetic identification results help distinguish between the tea geometrid moth and the grey tea geometrid moth, as well as their hybrid offspring: When a diagnostic differential site in a nuclear gene presents a single base type and is consistent with the nucleotide sequence of the tea geometrid moth, the sample is identified as a tea geometrid moth. The presence of 1 to 5 differential sites is allowed and can be regarded as intraspecific polymorphism, sequencing error or individual variation, and the sample is still identified as a tea geometrid moth. When the diagnostic differential site of the nuclear gene shows a single base type and is consistent with the nucleotide sequence of the tea looper, the sample is identified as the tea looper; the presence of 1 to 5 differential sites is allowed, which can be regarded as intraspecific polymorphism, sequencing error or individual variation, and the sample is still identified as the tea looper. When only 1 to 5 diagnostic differential sites in nuclear genes show characteristic base types of two species, and the remaining diagnostic differential sites are all single species bases, it is determined to be a pure species, and the difference can be regarded as sequencing error or intraspecific difference. When the nuclear gene determination result indicates purebred but differs from mitochondrial genes... COI When the species origin of the genetic identification is inconsistent, the sample is determined to be a hybrid individual or an individual with a genetic introgression background; When more than 5 diagnostic differential sites of nuclear genes simultaneously show the characteristic base types of two species, they are identified as hybrid offspring or individuals with interspecific gene introgression background. The nucleotide sequence of the tea geometrid moth compared with the nuclear gene amplification product is shown in SEQ ID NO: 1, and the nucleotide sequence of the gray tea geometrid moth is shown in SEQ ID NO:

2.

2. The method according to claim 1, characterized in that, The sequences of the nuclear gene primer pairs are shown in SEQ ID NO: 7 and SEQ ID NO:

8.

3. The method according to claim 1, characterized in that, mitochondria COI The genetic identification method is as follows: DNA was extracted from the sample to be tested and amplified using universal primers to obtain... COI Gene amplification products, COI After sequencing the gene amplification products, the sequences were compared with those of the tea geometrid moth and the grey tea geometrid moth. Species were determined based on sequence similarity and phylogenetic analysis. in, COI The nucleotide sequence of the tea geometrid moth compared with the gene amplification product is shown in SEQ ID NO: 15, and the nucleotide sequence of the grey tea geometrid moth is shown in SEQ ID NO:

16.

4. The method according to claim 3, characterized in that, The sequences of the universal primers are shown in SEQ ID NO: 13 and SEQ ID NO:

14.

5. The method according to claim 1, characterized in that, The characteristic base patterns of the two species are manifested in the sequencing peak diagram as bimodal or heterozygous sites.

6. The method according to claim 1, characterized in that, Diagnostic differential loci are fixed differential loci that are stable in multiple individuals. The base types are species-specific between the tea geometrid moth and the grey tea geometrid moth, and are highly conserved within the same species.

7. A method for identifying closely related species *Tea geometrid moth* and *Tea geometrid moth*, characterized in that, Includes the following steps: Extract DNA from the sample to be tested; Using nuclear gene primer pairs, DNA from the test samples was amplified by PCR to obtain amplification products. The amplification products were then sequenced, and the sequencing results were compared with the nucleotide sequences of the corresponding tea geometrid moth and gray tea geometrid moth. Base type analysis was performed at corresponding diagnostic differential sites to distinguish between the two species. When a diagnostic differential site in a nuclear gene presents a single base type and is consistent with the nucleotide sequence of the tea geometrid moth, the sample is identified as a tea geometrid moth. The presence of 1 to 5 differential sites is allowed and can be regarded as intraspecific polymorphism, sequencing error or individual variation, and the sample is still identified as a tea geometrid moth. When the diagnostic differential site of the nuclear gene shows a single base type and is consistent with the nucleotide sequence of the tea looper, the sample is identified as the tea looper; the presence of 1 to 5 differential sites is allowed, which can be regarded as intraspecific polymorphism, sequencing error or individual variation, and the sample is still identified as the tea looper. The nucleotide sequences of the tea geometrid moth nucleus and the gray tea geometrid moth nucleus compared with the nuclear gene amplification products are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively; or in SEQ ID NO: 3 and SEQ ID NO: 4; or in SEQ ID NO: 5 and SEQ ID NO:

6.

8. The method according to claim 7, characterized in that, The nuclear gene primer pairs used for alignment with the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2 are shown in SEQ ID NO: 7 and SEQ ID NO:

8. The nuclear gene primer pairs used for alignment with the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4 are shown in SEQ ID NO: 9 and SEQ ID NO:

10. The nuclear gene primer pairs used for alignment with the sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6 are shown in SEQ ID NO: 11 and SEQ ID NO:

12.

9. A kit for identifying the tea geometrid moth and the grey tea geometrid moth and their hybrid offspring, characterized in that, The kit contains primer pairs with sequences as shown in SEQ ID NO: 7 and SEQ ID NO: 8, or as shown in SEQ ID NO: 9 and SEQ ID NO: 10, or as shown in SEQ ID NO: 11 and SEQ ID NO:

12.

10. The use of the method of any one of claims 1 to 6 or the kit of claim 9 in the identification of tea geometrid moth and gray tea geometrid moth and their hybrid offspring.

Images