An indel-snp molecular marker linked to pepper style color trait and application thereof

Abstract

The application discloses an InDel-SNP molecular marker linked with a pepper style color character and application, the InDel marker is located in the region of the 10th chromosome Chr10:184898109-184898257 of a pepper 'CM334' v1.55 reference genome, and is named Marker149; the SNP marker is a Chr10:184898202 site; if the Chr10 does not contain the Marker149, or contains the Marker149 and the base of the Chr10:184898202 site is C, a pepper style white is identified; if the Chr10 contains the Marker149 and the base of the Chr10:184898202 site is T, a pepper style purple is identified. The molecular marker can be used to identify the style color of the pepper at an early growth stage, and the accuracy can reach 100%.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to an InDel-SNP molecular marker linked to the color trait of pepper pistils and its application. Background Technology

[0002] Anthocyanins are widely distributed secondary metabolites in plants, with multiple applications in plant physiology, ecology, and human health. In plant growth and development, they attract pollinating insects and seed dispersals by displaying diverse colors; simultaneously, as a natural photoprotective barrier, they efficiently absorb excess visible light and ultraviolet radiation, mitigating photo-oxidative damage by scavenging reactive oxygen species (ROS) and ensuring the stability of the photosynthetic system; furthermore, anthocyanins exhibit multi-functional stress resistance in the face of abiotic stresses (such as drought, salinity, and low temperatures) and biotic stresses (such as pathogen infection).

[0003] Although the core enzymatic reaction chain of the anthocyanin synthesis pathway in pepper has been systematically elucidated, the regulatory mechanism of this metabolic process exhibits extremely complex dynamic regulatory characteristics. Furthermore, current research on the regulation of anthocyanin accumulation in pepper focuses on stems, leaves, and fruits. For example, our previous research has shown that the CaMYBA-CaMYC-CaTTG1 complex regulates anthocyanin biosynthesis in pepper leaves, while research on the regulatory mechanism of anthocyanin accumulation in floral organs (such as styles, filaments, and anthers) remains relatively limited.

[0004] The chili pepper material 'PM' involved in this invention accumulates anthocyanins in its style (purple), but the main regulatory mechanism of this process has not been reported before. Elucidating the main mechanism of anthocyanin accumulation in the purple style of chili peppers can provide a theoretical basis for further research into the molecular mechanisms regulating anthocyanin biosynthesis in chili peppers. Simultaneously, developing a time-saving, labor-saving, and efficient molecular marker linked to style color traits can better facilitate chili pepper variety selection based on style color. Style color can serve as a direct morphological marker, associated with excellent agronomic traits such as disease resistance, significantly improving the efficiency of chili pepper breeding and screening, and shortening the breeding cycle. Summary of the Invention

[0005] The purpose of this invention is to provide an InDel-SNP molecular marker linked to the color trait of chili pepper pistils and its application, in order to overcome the shortcomings of the prior art.

[0006] To achieve the above-mentioned objectives, the technical solution adopted by this invention is as follows:

[0007] The first aspect of this invention provides an InDel-SNP molecular marker linked to the color trait of pepper pistils, comprising an InDel marker and an SNP marker. The InDel marker is located in the Chr10: 184898109-184898257 region on chromosome 10 of the pepper 'CM334'v1.55 reference genome and is named Marker149. The SNP marker is located at the Chr10:184898202 locus on chromosome 10 of the pepper 'CM334'v1.55 reference genome. If Chr10 does not contain Marker149, or contains Marker149 and the base at the Chr10:184898202 locus is C, the pepper pistil color is identified as white. If Chr10 contains Marker149 and the base at the Chr10:184898202 locus is T, the pepper pistil color is identified as purple.

[0008] A second aspect of the present invention provides a set of primer pairs for detecting the InDel-SNP molecular markers linked to the color trait of pepper pistils, said primer pairs comprising:

[0009] Marker149 forward primer: 5'-ACCCGCTCGATTTTTTAGTATGAG-3';

[0010] Marker149 reverse primer: 5'-TCCCAAAATCGGAGTACTGTTC-3'.

[0011] A third aspect of this invention provides the application of the above-mentioned primer pairs in molecular marker-assisted breeding of the style color trait of pepper.

[0012] Furthermore, the application includes the following steps:

[0013] (1) Extract genomic DNA from the peppers to be tested;

[0014] (2) Using the genomic DNA of the pepper to be tested as a template, the primer pair was used to perform PCR amplification on the InDel site where Marker149 is located, and the PCR amplification product was obtained.

[0015] (3) The PCR amplification product is detected by agarose gel electrophoresis. If the electrophoresis result shows only a single band of 366bp, the color of the pepper style is directly identified as white. If the electrophoresis result shows a single band of 515bp or two bands of 515bp and 366bp, then proceed to step (4).

[0016] (4) The PCR amplification products were purified by gel extraction, and the purified products were digested with PciI restriction endonuclease. The PciI restriction endonuclease was used to digest the products when the base at Chr10:184898202 was T, otherwise it was not used.

[0017] (5) The enzyme digestion products were detected by polyacrylamide gel electrophoresis. If two bands of 271bp and 244bp appeared in the enzyme digestion products, the color of the pepper flower style was identified as purple; otherwise, the color of the pepper flower style was identified as white.

[0018] A fourth aspect of the present invention provides a kit for identifying the color of pepper style, comprising the primer pair described above.

[0019] The beneficial effects of this invention are:

[0020] This invention provides an InDel-SNP molecular marker linked to the pepper pistil color trait. The InDel marker is located in the Chr10:184898109-184898257 region on chromosome 10 of the pepper 'CM334'v1.55 reference genome, named Marker149; the SNP marker is located at the Chr10:184898202 locus on chromosome 10 of the pepper 'CM334'v1.55 reference genome. When using this molecular marker to identify pepper pistil color, if Chr10 does not contain Marker149, or contains Marker149 and the base at Chr10:184898202 is C, the pepper pistil color is identified as white; if Chr10 contains Marker149 and the base at Chr10:184898202 is T, the pepper pistil color is identified as purple.

[0021] This invention utilizes the InDel-SNP molecular marker to identify the style color trait in chili peppers at an early stage of growth (after true leaves emerge), eliminating the need for artificial phenotypic discrimination after flowering, and achieving 100% accuracy. This method offers advantages such as ease of operation, rapid detection, accurate results, and good reproducibility. It eliminates the need for field cultivation and artificial phenotypic discrimination from planting to flowering, significantly shortening the breeding cycle and greatly saving time and labor costs. It is suitable for marker-assisted breeding of chili pepper style color traits. Attached Figure Description

[0022] Figure 1 The style phenotypes of the two parents, 'PM' and 'CM'.

[0023] Figure 2 The BSA-seq localization results are for the candidate intervals.

[0024] Figure 3The alignment results are for the local (Marker149) sequence of the CA10g11710 promoter in the two parent lines 'PM' and 'CM'.

[0025] Figure 4 Electrophoretic detection of PCR fragments amplified by primer pairs in the F2 population.

[0026] Figure 5 The sequence alignment results for InDel are shown for some purple and white styled pepper varieties.

[0027] Figure 6 The results are from polyacrylamide gel electrophoresis. Detailed Implementation

[0028] The technical solution of the present invention will be described in detail below with reference to specific implementation schemes and accompanying drawings. The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods; the instruments, materials and reagents used are commercially available unless otherwise specified.

[0030] Example 1: Obtaining the InDel marker closely related to the gene for forming the purple style of pepper.

[0031] Specifically, the following steps are included:

[0032] 1. Localization of genes regulating purple style formation in chili peppers

[0033] To investigate the molecular mechanism of purple style formation in peppers, this study used the purple-styled inbred line pepper 'PM' (genotype AA) as the female parent and the white-styled inbred line pepper 'CM' (genotype aa) as the male parent. Figure 1 Genetic hybrid populations were constructed. Both 'PM' and 'CM' were obtained from pepper 'CM334' through multiple generations of self-pollination, with 'PM' having a precession generation earlier than 'CM'. F1 plants were obtained through artificial pollination and then self-pollinated to construct an F2 segregating population. Phenotypic identification results showed that all F1 plants exhibited purple styles; in the F2 population, 244 plants had purple styles and 69 plants had white styles, with a segregation ratio close to 3:1 (χ²). 2 = 0.72 < χ 2 0.05= 3.84, P > 0.05), consistent with Mendel's single-gene dominant inheritance law, indicating that the purple style trait is a dominant single-gene controlled trait. In the F2 population, 30 plants with purple styles and 30 plants with white styles were strictly selected. Genomic DNA was extracted from the leaves of each plant using the TPS method, and mixed pools of purple and white styles were constructed. Whole-genome sequencing was performed using BSA-seq technology, and association analysis was conducted using the pepper 'CM334'v1.55 reference genome. Analysis of genes within the association region, combined with variant site information, ultimately located the candidate gene regulating the purple style trait of pepper on chromosome 10. Figure 2 ).

[0034] 2. Candidate gene analysis and InDel marker development

[0035] Based on the sequence differences between the two pooled samples, the physical location of the candidate region on chromosome 10 was determined to be 182.0–185.2 Mb. This candidate region contains 21 annotated genes, including four genes encoding MYB transcription factors (CA10g11650, CA10g11690, CA10g11710, and CA10g11660) that are related to anthocyanin synthesis. Combined with the differences in candidate gene expression levels obtained from qPCR detection of the pooled samples, CA10g11710 was identified as a key candidate gene regulating the formation of the purple style in pepper. Primers were designed based on the pepper 'CM334' v1.55 reference genome and information from the NCBI Genome Database. The primer sequences are as follows:

[0036] Forward primer for CDS-CA10g11710: 5'-ATGAACAGTACTCCGATTTTGGGA-3' (as shown in SEQ ID NO. 1), Reverse primer for CDS-CA10g11710: 5'-CTAATCAAGTAGATCCCATAGGTCA-3' (as shown in SEQ ID NO. 2);

[0037] Forward primer for gDNA-CA10g11710: 5'-TGACATCAAATTATCATGAACAGTA-3' (as shown in SEQ ID NO. 3), Reverse primer for gDNA-CA10g11710: 5'-TGTGGCAGGTGGCATTCTTGT-3' (as shown in SEQ ID NO. 4);

[0038] The forward primer for proCA10g11710 is 5'-ATACTGTGGGCATTCGGTTTGT-3' (as shown in SEQ ID NO.5), and the reverse primer for proCA10g11710 is 5'-TCCTGCATCTGTTCAGACCTGT-3' (as shown in SEQ ID NO.6).

[0039] The sequences of the CA10g11710 gene from both parents were amplified (including CDS, gDNA, and promoter (pro)). The amplification products were sequenced by Hangzhou Youkang Biotechnology Co., Ltd. The results showed that a 149 bp gene fragment was specifically inserted into the CA10g11710 promoter in 'PM' pepper. Figure 3 Located on chromosome 10 (Chr10:184898109-184898257) of the chili pepper 'CM334'v1.55 reference genome, the sequence is: TATATTTGTGCACTGTCAAAGTTTAAGGTTATATTTATGTATTATGCCCTTAGATTTTAAGCTGGACGCCCCCAGTTTTGCGTGTTGAACATG T GTTTTGCCGCGTAGGATTGGAGGTCATATTTGTGCAGTTTTGAATAGTTAAAGGT (as shown in SEQ ID NO.7). The underlined sites are the SNP sites described in Example 3.

[0040] The above PCR amplification reaction system is 50 μL, including 100-200 ng template DNA, 25 μL 2 × Phanta FlashMaster Mix, 2 μL each of forward and reverse primers (10 μmol / L), and sterile ddH2O to make up to 50 μL.

[0041] The PCR amplification reaction program was as follows: 98℃ pre-denaturation for 30s; 98℃ for 10s, 56℃ for 5s, 72℃ for 10s, for 35 cycles; and finally, extension at 72℃ for 1 min.

[0042] Sequencing of PCR amplification products: The above PCR products were sent to Hangzhou Youkang Biotechnology Co., Ltd. for sequencing.

[0043] 3. The relationship between the InDel marker and the color of the chili pepper pistil.

[0044] Using a 149 bp gene fragment specifically inserted at the CA10g11710 promoter in 'PM' pepper, an InDel marker (named Marker149) was developed. Primers were designed across this insertion site: Marker149 forward primer 5'-ACCCGCTCGATTTTTTAGTATGAG-3' (as shown in SEQ ID NO.8), and Marker149 reverse primer 5'-TCCCAAAATCGGAGTACTGTTC-3' (as shown in SEQ ID NO.9). PCR amplification was performed to detect whether this specific insertion co-segregated with the purple trait in the pepper population. The detection method is as follows:

[0045] Genomic DNA was extracted from leaves of randomly selected parental plants, F1 and F2 plants (white and purple styles were separated) using the TPS method, and then amplified by PCR using Marker149 primers.

[0046] The PCR amplification reaction system is 10 μL, including 100-200 ng template DNA, 5 μL Green Taq Mix, 0.5 μL each of forward and reverse primers (10 μmol / L), and sterile ddH2O to make up to 10 μL.

[0047] The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ for 15 s, 56℃ for 15 s, 72℃ for 15 s, 35 cycles; and a final extension at 72℃ for 5 min.

[0048] The PCR amplification products were detected by agarose gel electrophoresis, and the analysis of the electrophoretic bands revealed ( Figure 4 The InDel marker produces a 515 bp band (AA) in the parent 'PM' and a 366 bp band (aa) in the parent 'CM'. The F1 population, being heterozygous, exhibits both 515 bp and 366 bp bands (Aa). In the F2 population, the band types separate according to the genotype (AA, Aa, aa).

[0049] Example 2: Application of InDel markers closely related to the gene for forming the purple style of pepper.

[0050] This study used 100 chili pepper samples (see Table 1) to verify the molecular markers in Example 1, including 17 purple-styled chili pepper samples and 83 white-styled chili pepper samples. All chili pepper samples were provided by Zhejiang Wuwangnong Seed Industry Co., Ltd.

[0051] Genomic DNA was extracted from 100 chili pepper materials (leaves) using the TPS method. The style color and genotype of the 100 chili pepper materials were identified using the Marker149 primers in Example 1 and the PCR amplification reaction system and procedure in step 3 of Example 1.

[0052] Table 1 shows that the PCR amplification products of 17 purple-styled pepper materials contained only a 515 bp DNA fragment (i.e., AA genotype) or both 515 bp and 366 bp fragments (i.e., Aa genotype). Among the 83 white-styled pepper materials, 48 ​​white-styled pepper materials contained only a 366 bp DNA fragment (i.e., aa genotype), 6 white-styled pepper materials contained only a 515 bp DNA fragment (i.e., AA genotype), and 29 white-styled pepper materials contained both 515 bp and 366 bp fragments (i.e., Aa genotype). The results indicate that the InDel marker Marker149 cannot completely distinguish between purple and white-styled peppers; it can only identify individuals with a single 366 bp band as white-styled peppers.

[0053] Table 1. Identification results of 100 chili pepper samples and their molecular markers

[0054] Example 3: Obtaining SNP markers closely related to the gene for forming the purple style of pepper

[0055] Specifically, the following steps are included:

[0056] InDel sequence analysis and SNP marker development

[0057] Referring to the reference genome of chili pepper 'CM334' v1.55 and the NCBI genome database, genomic DNA was extracted from 17 purple-styled chili pepper materials, 6 white-styled chili pepper materials whose PCR amplification products contained only a 515 bp DNA fragment, and 29 white-styled chili pepper materials (leaves) whose PCR amplification products contained two fragments, 515 bp and 366 bp, using the primers from step 3 of Example 1, the PCR amplification reaction system from step 2 of Example 1, and the PCR amplification reaction program to perform PCR amplification at the InDel site where Marker 149 is located. The PCR amplification products were subjected to agarose gel electrophoresis, and the target bands were excised and purified by gel extraction. Part of the purified gel extraction products were sent to Hangzhou Youkang Biotechnology Co., Ltd. for sequencing, and the other part was used for subsequent experiments. Based on the sequence differences of the 515bp sequences of purple and white styles on InDel, the physical location of the SNP related to style color on chromosome 10 was determined to be Chr10:184898202. Chili peppers with a C base at Chr10:184898202 have white styles, while those with a T base at Chr10:184898202 have purple styles. Figure 5 ).

[0058] Another portion of the gel-recovered and purified product was digested with restriction endonucleases.

[0059] The enzyme digestion reaction system consisted of 50 μL, including 1 μg of gel-purified product, 1 μL of PciI restriction endonuclease (10 U / μL), 5 μL of 10x cut Buffer C, and sterile ddH2O to a final volume of 50 μL. The PciI restriction endonuclease (10 U / μL) and 10x cut Buffer C were purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., catalog number: 15220ES70. The PciI restriction endonuclease cleaved the DNA fragment at the Chr10:184898202 site when the base was T; otherwise, it did not cleave.

[0060] The enzyme digestion reaction program is as follows: 37℃ for 15 min-1 h; 80℃ for 20 min.

[0061] The enzyme digestion products were analyzed by polyacrylamide gel electrophoresis. The pepper style color and genotype were identified based on the electrophoretic bands: the presence of two bands (271bp and 244bp) indicated a homozygous purple style genotype; the presence of three bands (366bp, 271bp, and 244bp) indicated a heterozygous purple style genotype; the presence of only a single band (515bp or 366bp) indicated a homozygous white style genotype; and the presence of both 515bp and 366bp bands indicated a heterozygous white style genotype. Figure 6Among them, the third band may be due to insufficient enzyme digestion, resulting in 515 bands. That is, the style color of pepper material with 271bp and 244bp DNA fragments in the enzyme digestion product is identified as purple, and the style color of pepper material without 271bp and 244bp DNA fragments is identified as white.

[0062] Example 4: Application of InDel-SNP molecular markers closely related to the gene for forming the purple style of pepper.

[0063] This study used 21 chili pepper samples (see Table 2, including the maternal and paternal parents from Example 1, some samples from Table 1, and newly added samples) to verify the molecular markers in Examples 1-3. These included 8 samples of purple-styled chili peppers and 13 samples of white-styled chili peppers. Except for 'PM' and 'CM', all other chili pepper samples were provided by Zhejiang Wuwangnong Seed Industry Co., Ltd.

[0064] Genomic DNA was extracted from 21 chili pepper materials (leaves) using the TPS method. The style color and genotype of the 21 chili pepper materials were identified using the Marker149 primers in Example 1 and following the PCR amplification reaction system and procedure in step 2 of Example 1, as well as the sequencing, restriction endonuclease digestion reaction system and procedure in Example 3.

[0065] The results are shown in Table 2. The enzyme digestion products of 8 purple-styled pepper materials contained 271bp and 244bp DNA fragments; however, these 271bp and 244bp DNA fragments were not found in the 13 white-styled pepper materials. Based on these results, the accuracy of identifying pepper style color using the InDel-SNP molecular marker of this invention is 100%. This result demonstrates that the pepper molecular marker of this invention has high specificity and accurate detection, and can be used for the identification and screening of pepper style color.

[0066] Table 2. Identification results of chili germplasm resources and their molecular markers

[0067] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. An InDel-SNP molecular marker linked to the color trait of chili pepper styles, characterized in that, The assay includes an InDel marker and an SNP marker. The InDel marker is located in the Chr10:184898109-184898257 region on chromosome 10 of the chili pepper 'CM334'v1.55 reference genome and is named Marker149. The SNP marker is located at the Chr10:184898202 locus on chromosome 10 of the chili pepper 'CM334'v1.55 reference genome. If Chr10 does not contain Marker149, or if it contains Marker149 and the base at the Chr10:184898202 locus is C, the chili pepper style is identified as white. If Chr10 contains Marker149 and the base at the Chr10:184898202 locus is T, the chili pepper style is identified as purple.

2. A set of primer pairs for detecting the InDel-SNP molecular markers linked to the pepper style color trait as described in claim 1, characterized in that, The primer pair includes: Marker149 forward primer: 5'-ACCCGCTCGATTTTTTAGTATGAG-3'; Marker149 reverse primer: 5'-TCCCAAAATCGGAGTACTGTTC-3'.

3. The application of the primer pair described in claim 2 in molecular marker-assisted breeding of pepper style color trait.

4. The application according to claim 3, characterized in that, When applying it, the following steps are included: (1) Extract genomic DNA from the peppers to be tested; (2) Using the genomic DNA of the pepper to be tested as a template, the primer pair was used to perform PCR amplification on the InDel site where Marker149 is located, and the PCR amplification product was obtained. (3) The PCR amplification product is detected by agarose gel electrophoresis. If the electrophoresis result shows only a single band of 366bp, the color of the pepper style is directly identified as white. If the electrophoresis result shows a single band of 515bp or two bands of 515bp and 366bp, then proceed to step (4). (4) The PCR amplification products were purified by gel extraction, and the purified products were digested with PciI restriction endonuclease. The PciI restriction endonuclease was used to digest the products when the base at Chr10: 184898202 was T, otherwise it was not used. (5) The enzyme digestion products were detected by polyacrylamide gel electrophoresis. If two bands of 271bp and 244bp appeared in the enzyme digestion products, the color of the pepper flower style was identified as purple; otherwise, the color of the pepper flower style was identified as white.

5. A reagent kit for identifying the color of pepper style, characterized in that, Includes the primer pair described in claim 2.

Images