Asymmetric plasmid partitioning

Abstract

The invention provides a parent cell comprising at least one nucleoprotein complex comprising at least one DNA-binding scaffold tethered to at least one control plasmid; and wherein the at least one n

Description

Technical Field of the Invention The present invention relates to plasmid partitioning. The invention further relates to a plasmid partitioning system which effects asymmetric cell division and cell differentiation. The present invention also relates to plasmid partitioning within a cell for programmable output or payload production. Background to the Invention Well-characterised bacteria that have a diverse toolkit for manipulating gene expression and recombinant protein production, such as Escherichia coli, are often used in biotechnology to produce high-value drugs, enzymes, or biofuels. In such systems, genetic engineering and synthetic biology generally aim to control product production and to maximise efficiency and yield of the product production processes. A major obstacle of microbe-based product production processes is the trade-off between the growth rate of microbes and product synthesis, where the latter requires significant cellular energy and resources that negatively impact growth of the producer strain. The formation of escape mutants that have lost their ability to synthesise product is common and reduces yields or impacts the quality and homogeneity of the products. In particular, biosynthesis of toxic products, or those with a very high metabolic burden, display low efficiency and benefit from division of labour. Division of labour results in multiple co-existing strains or consortia that share the metabolic burden or detriment of product synthesis. Other approaches aim to redirect metabolic fluxes and release the metabolic burden of synthesis by rational metabolic and genetic engineering. However, the use of consortia introduces complexity and the likelihood of the process failing and can increase costs. Similar obstacles are encountered when using microbes as “living medicines” to deliver and synthesise payloads in-situ into tumours or the gastrointestinal tract. Here, important considerations not only concern the safety and stability of the engineered bacterial “chassis” host strain and its synthetic genetic circuitry, but its ability to produce specified amounts of therapeutic payload over a given time window, or “dose”, within the target environment. The “dose” is of exceptional importance to determine the pharmacodynamics and efficacy of such approaches, and the establishment of doseresponse relationships. The major limitation of such approaches is imposed by exponential microbial growth and consequently uncontrolled or difficult-to predict payload production and release. Strategies to overcome these problems include engineered “smart” bacteria that are equipped with sensory circuits, and that produce payload only upon sensing of the target or the desired environment. Other strategies exploit quorum sensing for density-triggered pay load delivery in spatially restricted environments (e.g., solid tumours). In this case, synthetic quorum sensing circuits control payload synthesis and cell lysis that is enabled once the bacterial population reaches a critical density, leading to payload release. A few surviving individual cells then reseed the population and the process repeats. Nevertheless, the output of such quorum devices is pulsatile with long lag times between release phases, and their amplitudes (or “dosages”) are determined by the bacterial population size at the time of payload synthesis and cell lysis. Furthermore, given their dependence on large population densities, quorum devices are unlikely to work robustly in open environments such as the gut environment. It is an aim of embodiments of the invention to provide tools and systems that can be implemented in cells to deliver precisely targeted therapeutic payloads into a target environment, such as a tumour microenvironment or the gastrointestinal tract. It is also an aim of embodiments of the invention to overcome or mitigate one or more of the following major roadblocks that occur during current methods of microbe-based product production and payload release: (i) the production of payload depends on the size of an exponentially growing population of bacteria and is therefore hard to predict or control in clinically and biotechnologically relevant settings, and (ii) the synthesis of products detrimental to the production strain suffers from low yields or low homogeneity, and mutations that disrupt intended functions of engineered strains become difficult to prevent. Embodiments of the present invention provide a novel asymmetric plasmid partitioning (APP) implemented in cells to effect cell differentiation. APP and subsequent cell differentiation enables cell fate programming and the implementation of non-natural modes of growth, destructive outputs leading to cell lysis and division of labour, and / or the delivery of payload in a continuous reaction. It is also an aim of embodiments to the invention to overcome or mitigate at least one problem of the prior art, whether disclosed herein or not. Summary of the Invention The term “asymmetric plasmid partitioning” or “APP” is used herein to describe a system wherein a parent cell containing one or more plasmids undergo asymmetric cell division, which produces one differentiated daughter cell and one cell retaining the phenotype of the parent cell (i.e. the parent cell itself of a copy of the parent cell). According to a first aspect of the invention there is provided a parent cell comprising at least one nucleoprotein complex comprising at least one DNA-binding scaffold tethered and / or immobilised to at least one control plasmid; and wherein the at least one nucleoprotein complex is configured so that upon cell division of the parent cell, a copy of the parent cell that retains the at least one nucleoprotein complex is formed and a daughter cell that is devoid of the at least one nucleoprotein complex is formed. A “copy of the parent cell” may be referred to as a “parent cell” hereinafter, as the copy of the parent cell has the same phenotype as the parent cell (e.g., it contains the nucleoprotein complex). In some embodiments, the at least one nucleoprotein complex binds to, tethers to, is retained by or associates with at least one component of the parent cell. In some embodiments, the at least one nucleoprotein complex is associated with at least one region of the parent cell. In preferred embodiments, the at least one nucleoprotein complex accumulates in at least one region of the parent cell. Most preferably, the at least one nucleoprotein complex may accumulate in at least one of the parent cell pole regions. The parent cell may be a prokaryotic or eukaryotic cell. Preferably, the parent cell is a genetically engineered bacterium. In some embodiments, the parent cell is selected from a bacterium from the group consisting of: Bifidobacterium ssp, Streptococcus thermophilus, Lactobacillus helveticus, Lactobacillus acidophilus (La-5), Bifidobacteria bifidum, Bifidobacteria breve, Bifidobacteria longum, Bifidobacteria infantis, Lactobacillus animalis, Lactobacillus rhamnosus, Lactobacillus casei, Lactobacillus plantarum, Lactobacillus paracasei, Lactobacillus bulgaricus, Streptococcus thermophilus (formerly known as Streptococcus salivarius subsp. thermophilus'), Bacteroides thetaiotaomicron, Lactobacillus, Akkermansia, Methanobrevibacter, Roseburia, Clostridiales, Ruminococcaceae, Methanobrevibacter smithii, Bifidobacterium adolescentis, Lactic acid bacteria (LAB), Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus, Weissella, species of Bacillus, species of Bifidobacterium, species of Brachybacterium, species of Brevibacterium, species of Propionibacterium, species of Arthrobacter, species of Hafnia, Pediococcuspentosaceus CIAL-86, Escherichia coli CIAL-153, L. lactis BH5, L. citreum GJ7, P. pentosaceus, Weissella cibaria, Acetobacter aceti subsp. aceti, A. pasteurianus subsp. pasteurianus, Bacilllus acidopulluluticus, B. coagulans, B. licheniformis, B. subtilis, Bifidobacterium animalis subsp. lactis, B. breve, Brachybacterium alimentarium, Brevibacteriumflavum, Corynebacterium ammoniagenes, Enterobacter aerogenes, Enterococcus durans, E. faecium, Klebsiella pneumoniae subsp. ozaenae, Lactobacillus acetototolerans, L. acidophilus, L. alimentarius, L. brevis, L. buchneri, L. casei subsp. casei, L. delbruecki subsp. bulgaricus, L. fermentum, L. ghanensis, L. helveticus, L. hilgardii, L. kefiri, L. kimchi, L. oeni, L. paracasei subsp. paracasei, L. pentosus, L. plantarum subsp. plantarum, L. sakei subsp. sakei, L. salivarious subsp. salivarius, L. sanfranciscensis, L. versmoldensis, Lactococcus lactis subsp. lactis, L. lactis, L. mesenteroides subsp. Cremoris, L. mesenteroides subsp. Dextranicum, L. mesenteroides subsp. mesenteroides, Oenococcus oeni, Pediococcus acidilactici, P. pentosaceus, Propionibacterium aciclipropionici, P. arabinosum, P. freudenreichii subsp. freudenreichii, Streptococcus natalensis, Weisella ghanensis and Zymomonas mobilis subsp. Mobilis, Bacillus coagulans BC30, Lactobacillus acidophilus NCFM, Lactobacillus rhamnosus HN001 (DR20), Bifidobacterium lactis HN019 (DR10), L. cases strain Shirota and B. breve strain Yakult, L.fermentum VRI003 (PCC), L. rhamnosus R0011, Streptococcus oralis KJ3, Saccharomyces cerevisiae (boulardii), Rhizobium, Bradyrhizobium, Azorhizobium, Allorhizobium, Sinorhizobium, Mesorhizobium, Azotobacter, Bacillus subtilis, B. mycoides, B. ramosus, Azospirillum, Enterobacter, Klebsiella, Pseudomonas ssp. (Azospirillum brasilense, Pseudomonas fluorescens and Pseudomonas synxantha, Bradyrhizobium, Burkholderia, Streptomyces pulveraceus), Bacillus spp., Bacillus subtilis subsp. natto, B. subtilis, B. amyloliquefaciens, Vagococcus camiphilus, V. lutrae, Enterococcus faecalis, E. faecium, E. gallinarum, P. acidilactici, Virgibacillus halodenitrificans SKI-3-7, non-pathogenic strains of Klebsiella pneumoniae and Citrobacter freundii, Corynebacterium glutamicum, Rhodococcus opacus, Thermoanaerobacterium thermosaccharolyticum strain TG57, Eactobacillus gasseri JV-V03, Bacillus thuringiensis, Burkholderia ambifaria, Alcaligens, Achromobacter, Acinetobacter, Alcanivorax, Alteromonas, Arthrobacter, Burkholderia, Bacillus, Cycloclasticus, Enterobacter, Flavobacterium, Marinobacter, Oleispira, Pseudomonas, Thaliassolituus, Oceanospirillales and Alteromonadales, including Alcanivorax, Halomonas, Marinobacter, Oleispira, Thalassolituus, and Oleiphilus (in detail, Alcaligenes aquatilis BU33N, Alcanivorax sp. IO_7, Alcanivorax sp. 24, Cupriavidus metallidurans CH34, Cycloclasticus sp. strain BG-2. Cycloclasticus sp. 78-ME, Cycloclasticus sp. strain Pl, Halomonas sp. strain MCTG39a, Halomonaspacifica strain Cnaph3, Marinobacter hydrocarbonoclasticus SdK644, Oleispira antarctica RB-8, Pseudomonas aeruginosa N6P6, Pseudomonaspseudoalcaligenes NP103, Pseudomonas sp. sp48, Pseudomonas aeruginosa GOMI, Ralstonia pickettii), Halophilic bacteria consortia, Ochrobactrum halosaudis, Stenotrophomonas maltophilia, Achromobacter xylosoxidans, and Mesorhizobium halosaudis Staphylococcus CO 100 and Paracoccus sp. MJ9, Pseudomonas aeruginosa (AHV-KH10), Ideonella sakaiensis 201-F6, Betaproteobacteria, Bacteroidetes, Acidobacteria, Chloroflexi, Tetrasphaera, Trichococcus, Candidatus Microthrix, Rhodoferax, Rhodobacter, Hyphomicrobium, Anammox bacteria, Accumulibacter, Comammox bacteria. In preferred embodiments the parent cell is from the genus Escherichia. More preferably, the parent cell is Escherichia coli. In preferred embodiments, the parent cell comprises a nucleoprotein complex that comprises one DNA-binding scaffold and one control plasmid. The at least one DNA-binding scaffold may comprise at least one scaffold protein and at least one plasmid DNA-binding moiety. The at least one plasmid DNA-binding moiety of the DNA-binding scaffold may bind to the at least one control plasmid DNA. Preferably, the plasmid DNA-binding moiety of the DNA-binding scaffold may tether and / or immobilise the at least one control plasmid DNA to the DNA-binding scaffold. In further embodiments, chromosomal DNA also binds to the DNA-binding scaffold. In some embodiments, the scaffold protein of the DNA-binding scaffold binds to, tethers to, and / or associates with at least one component of the parent cell. In other embodiments, the scaffold protein accumulates within at least one region of the parent cell. In preferred embodiments, the scaffold protein accumulates at one of the cell poles during cell division of the parent cell. Scaffold proteins may be designed de-novo and may include synthetic biomolecular condensates. The scaffold protein may be a self-nucleating scaffold protein. In preferred embodiments, the scaffold protein comprises the Caulobacter crescentus pole-organising protein (PopZ). The scaffold protein may comprise a codon optimised PopZ protein. The gene sequence encoding the codon optimised PopZ protein may comprise the sequence SEQ ID NO: 1. PopZ is a scaffolding protein that forms a long-term stable three-dimensional scaffold structure. In other embodiments, the scaffolding protein may comprise ParS protein fused to hydrophobic or disordered leader peptides, or synthetically or naturally disordered proteins fused to a DNA binding moiety. Alternatively, scaffolding proteins may be based on metazoan peptide motifs including GBD, SH3, and PDZ domains and orthogonal synthetic leucine zipper protein domains. In preferred embodiments, the plasmid DNA-binding moiety comprises a tetracycline repressor, TetR. The TetR repressor may comprise sequence SEQ ID NO: 2. In such preferred embodiments, the control plasmid may encode one or more tetracycline operator sites, e.g., tetO. The control plasmid may comprise a tetO array comprising the sequence SEQ ID NO: 4. TetR binding to tetO site(s) is amongst the strongest reported protein-DNA interactions in nature and thus the binding of the plasmid to the DNA-binding scaffold via tetO-TetR binding is exceptionally strong and substantially irreversible. In alternative embodiments, the plasmid DNA-binding moiety comprises at least one other repressor protein and / or DNA-binding protein, for example naturally occurring or synthetic DNA-binding proteins. Suitable DNA-binding repressor proteins and / or DNA-binding proteins are those that display very high affinity to its target. Examples thereof include the bacteriophage lambda repressor, cl, and the bacteriophage 434 repressor, RRtres. The DNA-binding scaffold may further comprise at least one component independently selected from the group consisting of; a fluorescent protein, a DNA tether, a tethering moiety, a transcriptional regulator, a transcriptional repressor, a transcriptional activator, a recombinase, or any combination of the aforementioned. The parent cell may be genetically engineered to express the DNA-binding scaffold, or parts thereof. Gene expression of the DNA-binding scaffold may by induced by using at least one of; a chemical inducer, light stimulation, or a shift in temperature. Chemical inducers may include L-arabinose, IPTG (Isopropyl P-D-l-thiogalactopyranoside), rhamnose, xylose, anhydrous tetracycline, or quorum-sensing molecules. The shift in temperature may be above 37 °C, above 38 °C, above 39 °C, above 40 °C, above 41 °C, above 42 °C, above 43 °C, above 44 °C, or above 45 °C. The at least one control plasmid may be comprised of any of the following origins of replication: pSClOl, pl5A, pMBl, R6K, RSF1010, pBBRl, pRO1600, ColEl, or pMBl. The control plasmid may have a temperature-sensitive origin of replication. The temperature-sensitive origin of replication may be SC101repAts or RK2ts. A control plasmid with a temperature-sensitive origin of replication contributes to an exceptionally stable nucleoprotein complex at a physiological temperature, 37 °C. The temperature sensitivity of the control plasmid also contributes to achieving cell differentiation with high efficiency in a single transient event. In some embodiments, the control plasmid comprises the sequence SEQ ID NO: 7 for pl5A origin of replication, SEQ ID NO: 8 for pRK2 origin of replication, or SEQ ID NO: 9 pSClOl RepAts temperature-sensitive origin of replication. The parent cell may further comprise at least one gene regulatory control sequence. The gene regulatory control sequence, or at least a part thereof, may be located on the control plasmid. In some embodiments, the gene regulatory control sequence comprises at least one gene encoding at least one transcriptional repressor that exerts gene expression control over an output and / or a payload gene sequence. In some embodiments, the at least one transcriptional repressor gene comprises a degradation sequence. In some embodiments, the gene regulatory sequence comprises at least one gene encoding at least one transcriptional activator that exerts gene expression control over an output and / or a target gene sequence. The gene regulatory control sequence may comprise at least one gene encoding at least one transcriptional repressor, or at least one gene encoding at least one transcriptional activator, or both. In addition to the at least one transcriptional repressor and / or transcriptional activator gene, the control plasmid may further comprise a constitutive gene promoter, or a regulatory gene promoter. The promoter may be associated with the gene regulatory control sequence. In some embodiments, the control plasmid further comprises a transcriptional repressor gene promoter and / or a transcriptional activator gene promoter. The transcriptional repressor gene promoter and / or transcriptional activator gene promoter may comprise at least one mutation in the transcriptional repressor gene promoter. In preferred embodiments, the control plasmid comprises at least one Laci gene repressor and at least one Laci gene promoter which comprises a mutation in the Laci gene promoter. The mutated Laci gene promoter has the effect of increasing transcription of the Laci gene and results in higher levels of Lac repressor within the cells. The control plasmid may comprise the sequence SEQ ID NO: 5 encoding a mutated Laci gene promoter and the sequence SEQ ID NO: 6 encoding the LaqI gene repressor. SEQ ID NO: 6 may originate in Escherichia coli. The gene regulatory control sequence may be used to construct a genetic switch. The gene regulatory control sequence may enable cell fate programming of daughter cells. This may result in the implementation of non-natural modes of growth, destructive outputs leading to cell lysis in daughter cells and the release of payload into the supernatant or environment and subsequently division of labour between parent and daughter cells, and / or the continuous and controlled production and release of a payload by daughter cells. The control plasmid may further comprise at least one sequence or gene selected from the group consisting of; an ampicillin resistance gene (bla) or genes for other selectable markers (e.g. other antibiotic and non-antibiotic markers), a parS site, a gene encoding a fluorescent protein, sequences comprising further transcriptional repressors and / or transcriptional activators, sequences comprising DNA recombinases, sequences encoding proteins that can be affected by light stimulation, gene sequences encoding proteins essential for cellular function absent from the bacterial host genome, or any combination of the aforementioned. Each of the parent cell and daughter cell may comprise one or more separate plasmids comprising at least one promoter sequence comprising at least one operator sequence, and a gene and / or a nucleic acid sequence encoding a payload or output moiety. Each of the parent cell and daughter cell may comprise one or more plasmid comprising the at least one operator sequence which forms part of a promoter sequence and that is repressed or activated by the transcriptional repressor or transcriptional activator expressed by the at least one transcriptional repressor or transcriptional activator gene of the gene regulatory control sequence. The at least one operator sequence may be associated with the gene regulatory control sequence. Preferably, the operator sequence is LacO. The promoter / operator sequence may be located on a separate plasmid contained within the parent or daughter cell that is not part of / bound into, the nucleoprotein complex. Alternatively, the sequence may be located on the parent or daughter cell genome. Thus, each parent or daughter cell may comprise one or more separate plasmids in addition to the control plasmid which is part of / bound into the nucleoprotein complex. Each separate plasmid may be selected from the group consisting of an origin of replication; RK2, pl5A, pMBl, R6K, RSF1010, pBBRl, pRO1600, ColEl,pMBl, and pSClOl. Each separate plasmid may have a temperature-sensitive origin of replication. The temperature-sensitive origin of replication may be SC101repAts or RK2ts. In some embodiments, each separate plasmid comprises at least one sequence comprising the sequence identity SEQ ID NO: 7 for pl5A origin of replication, SEQ ID NO: 8 for pRK2 origin of replication, or SEQ ID NO: 9 pSClOl RepAts temperaturesensitive origin of replication. The at least one operator / promoter sequence may be coupled to at least one nucleic acid sequence, preferably a DNA sequence, encoding a payload or output moiety. The at least one operator / promoter sequence and the at least one nucleic acid sequence encoding a payload or output moiety may each be located on different separate plasmids, or both sequences may be located on the same separate plasmid, contained within the parent or daughter cell that is not part of / bound into the nucleoprotein complex. Alternatively, the sequence may be located on the parent or daughter cell genome. The payload or output moiety may be selected from the group consisting of: a bacteriophage, a biologically active peptide, an enzyme, a protein, a virus like particle (VLP), a toxin, a virus-like particle endowed with additional payloads, a nanobody, an antibody or antibody fragment, a cytokine, a receptor ligand comprising an agonist or antagonist, an adhesin, a polymer, biochemical goods (e.g. enzymes, drugs, valuable chemicals, biogas, vitamins, products or nutritional or cosmetic interest, bio preservative for the food industry, construction materials (e.g. derived from microbiologically induced calcite precipitation and engineered natural products), probiotics, therapeutics, biopesticides, enzybiotics, or any combination thereof. The gene regulatory control sequence and / or the promoter / operator sequence contributes to the production of a continuous, deterministic and linear production of pay load or output moiety in the daughter cells. The nucleoprotein complex may be stably maintained and localised in the parent cell during at least one round of cell division. In some embodiments, the nucleoprotein complex is stably maintained and localised in the parent cell for up to at least 60,50,40, 35, 30, 25, 20, 15, or 10 cell generations. Preferably, the nucleoprotein complex may be stably maintained and localised in the parent cell for at least 25 cell generations. More preferably, the nucleoprotein complex may be stably maintained and localised in the parent cell for at least 30 cell generations. In some embodiments, each of the daughter cell and parent cell further comprise an output or payload release mechanism. The payload or output release mechanism may act to enable the release of payload or output when said payload or output reaches a minimum or maximum concentration with a daughter cell. In one embodiment, the payload or output moiety release mechanism comprises cell lysis. In such embodiments, the payload or output further comprises, in addition to the payload or output moiety, at least one lysis protein, for example LysE. In such embodiments, daughter cells comprise a finite amount of transcriptional repressor protein controlling the expression of LysE lysis protein, and the transcriptional repressor protein is then diluted by consecutive cell divisions until a critical repressor threshold is reached, after which, the daughter cells express the LysE lysis protein and lyse due to the loss of / reduction in transcriptional repressor protein within the daughter cell. The payload or output release mechanism may further comprise a fail-safe mechanism in the event that the main payload or output release mechanism fails, and ensures daughter cell death. The fail-safe mechanism may be comprise removing an essential gene that encodes an essential protein from the parent cell genome and re introducing it onto the control plasmid. Subsequent cell division of the parent cell may produce daughter cells with finite amount of the essential protein that may be diluted by consecutive cell divisions until a critical threshold is reached. When the critical threshold is reached, daughter cell death may occur by loss of a cellular core process. Essential genes to serve this purpose may preferentially include genes associated with essential processes relating to structural elements of the cell such as the cell wall, the outer membrane, or the phospholipid membrane. In preferred embodiments, the onset of daughter cell death by the fail-safe mechanism is programmed to exceed or start during or after the timing of payload production and the payload or output release mechanism. The fail-safe mechanism may be combined and / or stacked with the main payload or output release mechanism. In a specific embodiment, the fail-safe mechanism comprises removing the essential gene dap A (4-hydroxy-tetrahydrodi picolinate synthase or dihydrodipicolinate synthase, dapA) from the parent cell genome and encoding the dapA gene on the control plasmid. The control plasmid may comprise the nucleic acid sequence SEQ ID NO: 10. In such embodiments, daughter cells comprise a finite amount of dapA protein, which is then diluted by consecutive cell divisions until a critical threshold is reached, after which, the daughter cells lyse due to the loss of / reduction in dapA protein in the daughter cell. The above-mentioned fail-safe mechanism has the following advantages: a) “escape mutants”, i.e. daughter cells that have lost the output (payload production and cell lysis mechanism) either by loss of output plasmid or by genetic changes to the output, are non-viable and will ultimately lyse / destruct. b) loss of the essential gene function, such as in the case of dapA described above, can be used as sole mechanism of payload release by cell lysis. c) therapeutic applications require that synthetic bacteria cannot escape into the environment. In this context, our expanded technology acts like a “firewall” that strictly controls and limits the life span of daughter cells by preventing their long-term survival. d) propagation and further manipulation of the chassis organisms devoid of dapA is possible in the presence of diaminopimelic acid (DAP) which enables straight-forward engineering of the chassis organism. e) The dapA gene sequence on the control plasmid may replace the ampicillin resistance gene from the plasmid and enable plasmid engineering and application of APP without the use of antibiotic resistance genes, a desired feature of engineered therapeutic bacteria. In some embodiments, the pay load or output release mechanism may comprise secretion. The daughter cells may produce or release a pay load or an output moiety that can be controlled by the initial transcriptional repressor and / or transcriptional activator concentration of the daughter cells, which may be, for example at the first generation and / or when a minimum threshold amount of transcriptional repressor and / or transcriptional activator is reached in a daughter cell. The daughter cells may produce bacteriophages as pay loads. Pay load bacteriophage families may include one or more selected from the group consisting of: family Myoviridae (AH-1, AH-4, AH-5, CP8, CP30, 12673, ESP 732-1, PE37, EC9, _vB_EcoS_FFH_l, el 1 / 2, PP01, FAHEcl, ECML-4, ECML-117, ECML-134, C203, P206, DTI, DT5, DT6, OSY-SP, SA-C12, A511, P100, LPSEYT, CAU-SEP-1, CAU- SEP-2, CAU-SEP-3, CAU-SEP-4, Felix Ol / Felix O1-E2, Dl-2, UAB_Phi87, vBSenM-PA13076 (PA13076) vBSenM-PC2184 (PC2184), PS5, SSP5, SppYZUOl to SppYZUlO, SF-A2, SD-11, SS-92), family Siphoviridae (PBC1, CTP1, ESP 1^3. EC6, Rol45clw, vB_EcoS_FFH_l, e4 / lc, ggg, A500 ATCC® 23074-B1™, H387, H387-A 2671, IZSAM-1, PspYZU5415, wksl3, P29C, LPSTLL, LPSE1, vB_SalS_SJ_3, SP-3, SSP6, T156, H5 (phiPLA88), A72 (phiPLA35), SA13m, SA13m), family Podoviridae (ECI 1, HUI, IBB-PF7A, LPST153, Pu20, P22 [Argo4], UAB_Phi 20, UAB_Phi78, SP-1, SA46-CTH2, vB_VpaS_OMN (designated as phage OMN)), family Corticoviridae (EcpYZUOl), tailed dsDNA phages (such as CNPSA 1, CNPSA3, CNPSA4), family Ackermannviridae (LPST94). family Autographivirinae (LPST153), or other nonidentified families (e.g. A3, Cj6, KHE KH4, KH5, LiMN4L, LiMN4p, - LiMN17, FWLLml, Wy, C35, PSE5, PHL4, P7, SJ2), Fiersviridae (MS2, Qbeta) and other positive or negative sense RNA phages or double-stranded RNA phages, filamentous phages (Ff, M13). The daughter cells may produce virus-like particles (VLPs) as payloads, wherein the VLPs may be engineered and loaded with therapeutic modalities. Therapeutic modalities may include one or more mRNA or small interfering RNAs (siRNA). Therapeutic modalities on the surface of the VLPs, such as receptor ligands, receptor agonists or antagonists, may be used as payloads. Therapeutic modalities may include one or more siRNA blocking cell cycle progression or eliciting apoptosis. Therapeutic modalities may include antibodies, fragments of antibodies, or nanobodies. The therapeutic modalities may be used to target diseases with very high specificity. The therapeutic modalities may be used as vaccine. The therapeutic modalities may be used to target cancers and gastro-intestinal autoimmune diseases. Therapeutic modalities may include VLPs loaded with mRNA encoding base editors, recombinases and / or other eukaryotic proteins. In some embodiments, cell division of the parent cell effects asymmetric cell partitioning (APP) and cell differentiation. The parent cell allows for the induction of cell differentiation by a single transient event. For example, a single transient event may comprise the addition of at least one of a chemical inducer, light stimulation to the cell culture, and / or a shift in temperature of the cell culture for a time period of around 45-60 minutes, followed by the withdrawal of the at least one of a chemical inducer, light stimulation, and / or a shift in temperature. Chemical inducers may include L-arabinose, Isopropyl B-D-l-thiogalactopyranoside (IPTG), rhamnose, xylose, anhydrous tetracycline, or quorum-sensing molecules. Cell differentiation of the parent cell into different cell types (i.e. cells containing the nucleoprotein complex and those that do not) enables cell fate programming and the implementation of non-natural modes of growth, destructive outputs leading to cell lysis and division of labour, and / or the constant and / or controlled production of a payload. Division of labour between the parent and daughter cells decreases the variability of the final product. According to a second aspect of the invention there is provided a method of manufacturing a parent cell of the first aspect of the invention, the method comprising: (i) genetically engineering a host cell by including at least one gene or DNA sequence that expresses the DNA-binding scaffold, or parts thereof; (ii) inducing expression of the at least one DNA-binding scaffold; and (iii) tethering and / or immobilising the at least one control plasmid to the plasmid DNA-binding moiety of the at least one DNA-binding scaffold. The host cell may be a prokaryotic or eukaryotic cell. Preferably, the host cell is a bacterium. In preferred embodiments, the host cell is from the genus Escherichia, more preferably, Escherichia coli. Gene expression of the DNA-binding scaffold may by induced by using at least one of; a chemical inducer, light stimulation, or a shift in temperature. Chemical inducers may include L-arabinose, IPTG, rhamnose, xylose, anhydrous tetracycline, or quorumsensing molecules. The shift in temperature may be above 37 °C, above 38 °C, above 39 °C, above 40 °C, above 41 °C, above 42 °C, above 43 °C, above 44 °C, or above 45 °C. The parent cell and its components may be as described hereinabove for the first aspect of the invention and may include any optional feature or combination of optional features described for the first aspect. According to a third aspect of the invention there is provided a method of asymmetric plasmid partitioning (APP) comprising the steps of: (i) providing a parent cell comprising at least one nucleoprotein complex comprising at least one DNA-binding scaffold tethered and / or immobilised to at least one control plasmid and wherein the at least one nucleoprotein complex is configured so that upon cell division of the parent cell, a copy of the parent cell that retains the at least one nucleoprotein complex is formed and a daughter cell that is devoid of the at least one nucleoprotein complex is formed; and (ii) effecting cell division to form a daughter cell which is devoid of the at least one nucleoprotein complex and a copy of the parent cell which comprises the at least one nucleoprotein complex. The parent cell and daughter cells may be as described hereinabove for the first aspect of the invention and may include any optional feature or combination of optional features described for the first aspect. In some embodiments, the parent cell may be genetically engineered to express the DNA-binding scaffold. In some embodiments, the method of APP further comprises an initial first step comprising the induction of gene expression of the DNA-binding scaffold. The induction of gene expression may comprise using at least one of; a chemical inducer, light stimulation, or a shift in temperature. Chemical inducers may include L-arabinose, IPTG, rhamnose, xylose, anhydrous tetracycline, or quorum-sensing molecules. The shift in temperature may be above 37 °C, above 38 °C, above 39 °C, above 40 °C, above 41 °C, above 42 °C, above 43 °C, above 44 °C or above 45 °C. Preferably, gene expression may occur for a set period of time. The period of time may be less than 10 minutes, 20 minutes, 30 minutes, less than 45 minutes, less than 1 hour, less than 2 hours, less than 3 hours, less than 4 hours, less than 5 hours, or less than 10 hours. More preferably, expression occurs in around 45 minutes to 1 hour with the addition of L-arabinose. Following the further initial step of inducing gene expression of the DNA-binding scaffold, the method of APP may also further comprise a subsequent step of forming the nucleoprotein complex. The step of forming the nucleoprotein complex may include the plasmid DNA-binding moiety of the DNA-binding scaffold binding and / or tethering to the control plasmid. This may be induced by a shift in temperature. Upon a shift in temperature, the plasmid ceases replication / replicates less frequently and is bound / tethered to the DNA-binding scaffold and bound into the nucleoprotein complex. The method of APP may induce asymmetric cell division and cell differentiation. According to a fourth aspect of the invention there is provided a method of APP according to the third aspect of the invention wherein the parent cell comprises; a gene regulatory control sequence comprising at least one transcriptional repressor and / or transcriptional activator gene located on the nucleoprotein complex, and each parent cell and daughter cell comprises at least one operator sequence which is repressed or activated by the transcriptional repressor or transcriptional activator expressed by the transcriptional repressor or transcriptional activator gene of the gene regulatory control sequence, and wherein the operator gene is coupled to at least one nucleic acid sequence encoding a payload or output moiety. The fourth aspect of the invention may comprise a further step: (iii) further dividing the daughter cell and a parent cell to form more daughter cells; and wherein upon cell division a finite amount of transcriptional repressor and / or transcriptional activator is contained within each daughter cell and wherein upon each round of cell division the amount of transcriptional repressor and / or transcriptional activator contained within each subsequent daughter cell is reduced or diluted; and wherein the operator sequence effects expression of the pay load or output when a daughter cell contains a minimum threshold amount of transcriptional repressor and / or transcriptional activator. The nucleoprotein complex may be stably maintained in the parent cell (i.e. the nucleoprotein complex remains localised in the parent cell) during at least one round of cell division. In some embodiments, the nucleoprotein complex may be stably maintained and localised in the parent cell for up to at least 60, 50, 40, 35, 30, 25, 20, 15, or 10 cell generations. Preferably, the nucleoprotein complex may be stably maintained and localised in the parent cell for at least 25 cell generations. More preferably, the nucleoprotein complex may be stably maintained and localised in the parent cell for at least 30 cell generations. The gene regulatory control sequence may comprise at least one transcriptional repressor and / or transcriptional activator gene located on the control plasmid. In some embodiments, gene regulatory control sequence may comprise at least one transcriptional repressor gene. Preferably, the control plasmid may comprise a Laci repressor gene. Upon cell division of the parent cell, each daughter cell formed may contain a finite amount of transcriptional repressor and / or transcriptional activator. Each daughter cell formed does not contain the nucleoprotein complex or control plasmid comprising the transcriptional repressor and / or transcriptional activator gene and thus lacks the source of transcriptional repressor and / or transcriptional activator gene expression. Therefore, each daughter cell may contain only the free transcriptional repressor and / or transcriptional activator molecules passed down to the daughter cell during cell division, and each subsequent round of cell division further dilutes or reduces the concentration of free transcriptional repressor and / or transcriptional activator molecules. In addition to the at least one transcriptional repressor and / or transcriptional activator gene, the control plasmid may further comprise a constitutive gene promoter or a regulatory gene promoter. The promoter may be associated with the gene regulatory control sequence. The control plasmid may comprise a transcriptional repressor and / or transcriptional activator gene promoter, which may comprise at least one mutation in the transcriptional repressor and / or transcriptional activator gene promoter. Preferably, the control plasmid comprises at least one Laci gene repressor and at least one Laci gene promoter which comprises a mutation in the Laci gene promoter. The mutated Laci gene promoter has the effect of increasing transcription of the Laci gene and results in higher levels of Lac repressor within the cells. The control plasmid may comprise the sequence SEQ ID NO: 5 encoding the Laci repressor and the sequence SEQ ID NO: 6 encoding the mutated Laci promoter. Each of the parent cell and daughter cell may comprise at least one operator gene sequence which forms part of the promoter sequence that is repressed or activated by the at least one transcriptional repressor or transcriptional activator gene of the gene regulatory control sequence described above. The at least one promoter / operator gene sequence may be associated with the gene regulatory control sequence. In some embodiments, the operator sequence is LacO. The promoter / operator sequence may be located on a separate plasmid contained within the parent or daughter cell that is not part of / bound into the nucleoprotein complex. Alternatively, the sequence may be located on the parent or daughter cell genome. Thus, each parent and daughter cell may comprise one or more separate plasmids in addition to the control plasmid which is part of / bound into the nucleoprotein complex. Each separate plasmid may be selected from the group consisting of an origin of replication: RK2, pl5A, pMBl, R6K, RSF1010, pBBRl, pRO1600, ColEl, pMBl, and pSClOl. Each separate plasmid may have a temperature-sensitive origin of replication. The temperature-sensitive origin of replication may be SC101repAts or RK2ts. In some embodiments, each plasmid comprises at least one DNA sequence comprising the sequence identity SEQ ID NO: 7 for p!5A origin of replication, SEQ ID NO: 8 for pRK2 origin of replication, or SEQ ID NO: 9 pSClOl RcpAlh temperaturesensitive origin of replication. The minimum threshold amount of repressor may be a concentration threshold. The at least one operator / promoter sequence may be coupled to at least one nucleic acid sequence, preferably a DNA sequence, encoding a payload or output moiety. The at least one operator / promoter sequence and the at least one nucleic acid sequence encoding a payload or output moiety may each be located on different separate plasmids, or both sequences may be located on the same separate plasmids, contained within the parent or daughter cell that is not part of / bound into the nucleoprotein complex. Alternatively, the sequence may be located on the parent or daughter cell genome. The payload or output moiety may be as described for the first aspect of the invention and may include any optional or preferred feature or combination of optional or preferred features described for the first aspect. In some embodiments, each of the daughter cell and parent cell further comprise an output or payload release mechanism. In such embodiments, the method of APP according to the fourth aspect of the invention may further comprise the step of release of at least one payload or output moiety from at least one daughter cell when a minimum threshold of payload or output moiety is reached within the daughter cell. The payload or output release mechanism may be as described for the first aspect of the invention and may include any optional or preferred feature or combination of optional or preferred features described for the first aspect. The pay load or output release mechanism may further comprise a fail-safe mechanism as described for the first aspect of the invention. The minimum threshold of payload or output moiety may be a concentration threshold. The daughter cell population may be amplified by the method of APP according to the fourth aspect of the invention in conjunction with the gene regulatory sequence and / or promoter / operator sequence. The daughter cells may release a payload or an output moiety that can be controlled by the initial transcriptional repressor and / or transcriptional activator concentration of the daughter cells, which may be, for example at the first generation and / or when a minimum threshold amount of transcriptional repressor and / or transcriptional activator is reached in a daughter cell. In some embodiments, the method of APP according to the third or fourth aspects of the invention effects cell differentiation. In some embodiments, the method of APP according to the fourth aspect of the invention is used to deliver targeted therapeutic payloads. The therapeutic payloads may be as described by the therapeutic payloads of the first aspect of the invention. In some embodiments, the method of APP according to the fourth aspect of the invention is used to dose at least one pay load or output moiety. In some embodiments, the method of APP according to the fourth aspect of the invention is used to deliver a continuous and / or linear pay load or output moiety. In some embodiments, the method of APP may be used to deliver a continuous and / or linear payload or output moiety, for a defined or limited time span. According to a fifth aspect of the invention there is provided an asymmetric plasmid partitioning system comprising a nucleoprotein complex comprising, (a) a DNA-binding scaffold comprising a scaffold protein and a plasmid DNA-binding moiety, wherein the scaffold protein is the Caulobacter crescentus pole-organising protein (PopZ), and (b) a control plasmid. The asymmetric plasmid partitioning system of the fifth aspect may include any of the optional and preferred features of the first to fourth aspects of the invention described hereinabove. According to sixth aspect of the invention there is provided a cell comprising the APP system according to the fifth aspect of the invention. The cell may be as described in relation to any of the first aspect of the invention and may include any of the optional and preferred features of the first aspect of the invention described herein above. In some embodiments, the cell is a parent cell as described for the first aspect of the invention and may include any optional or preferred feature or combination of optional or preferred features described for the first aspect. According to a seventh aspect of the invention there is provided a cell comprising one or more gene sequences for the formation of a nucleoprotein complex, comprising at least one sequence encoding a DNA-binding scaffold; and control plasmid; and wherein the DNA-binding scaffold sequence comprises sequences encoding a Caulobacter crescentus pole-organising protein (PopZ) and a tetracycline repressor, TetR, and the control plasmid comprises a sequence encoding a tetracycline resistance operator sequence, tetO. The cell may be as described in relation to the parent cell described in the first aspect of the invention and may include any of the optional and preferred features of the first aspect of the invention described hereinabove. The parent and daughter cells as described in the first to seventh aspect of the invention may form a therapeutic or biological device, or part thereof, that may precisely deliver targeted therapeutic pay loads. The parent and daughter cells as described in the first to seventh aspects of the invention may be used for the following applications: to produce biosynthetic pathways, to produce enzymes for biotechnological production or degradation for biotechnological production or degradation in a continuous reaction-like process. Other examples may include: production of biochemical goods (e.g., enzymes, drugs, valuable chemicals, biogas and products of nutritional (e.g., vitamins) or cosmetic interest), production of bio-preservative for the food industry (e.g., Pediocin, Natamycin, Enterocin, and Leucocin), construction materials (derived from microbiologically induced calcite precipitation) and engineered natural products production, probiotics, bioleaching, bioregulation and biocontainment, systemic and in-situ drug delivery (therapeutics), food production (fermented food) and food bio-preservation, biofertilizers and biopesticides, product degradation (naturally or in bio-reactors bioremediation: direct land and water treatment for transformation and removal of contaminants due to gas stations and refineries spillages or to deal with chlorinated hydrocarbons (pentachlorophenol), pesticides and gaseous products or styrene and heavy metals), or composting and sewage water treatment. The parent and daughter cells as described in the first to seventh aspect of the invention may be used as a cancer therapy, such as an interactive cancer therapy. Other possible disease targets or payload-related applications may include: leaky gut syndrome, editing of invasive gut species (microbiome editing), Chron’s disease, Inflammatory bowel syndrome / disease, colorectal cancer (adenocarcinomas and adenomas), or solid tumours (sarcomas, carcinomas, lymphomas). According to an eighth aspect of the invention there is provided a pharmaceutical composition comprising the first the seventh aspect of the invention, and a suitable pharmaceutical carrier. Detailed Description of the Invention In order that the invention may be more clearly understood embodiments thereof will now be described, by way of example only, with reference to the accompanying drawings, of which: Figure 1 illustrates the two components of a first embodiment of an asymmetric plasmid partitioning system of the invention; (a) the DNA-binding scaffold, and (b) the control plasmid. Figure 2 illustrates the induction of the asymmetric partitioning system shown in Figure 1 with L-arabinose and a shift to 40 °C leading to inactivation of plasmid replication and formation of a nucleoprotein complex that is asymmetrically distributed at cell division and retained in parent cells. Figure 3 illustrates the efficiency of asymmetric plasmid partitioning induction and the stability of the nucleoprotein complex, (a) Triplicate cultures comprising the asymmetric plasmid partitioning system according to this invention were grown at permissive 30 °C, induced with L-arabinose, and shifted to 40 °C to induce asymmetric plasmid partitioning for Ih. The following culture growth at 37 °C and the frequency of ampicillin resistant parent cells was tracked by plating culture aliquots at the indicated timepoints over a two-day period, (b) Cultures comprising a control asymmetric plasmid partitioning system lacking tetO sites. Figure 4 is a graph that illustrates the long-term stability of the asymmetric plasmid partitioning system and cells containing the same, according to this invention. The lifetime of nucleoprotein complexes retained at the cell poles in generations is scored by quantifying co-occurring mCherry and CFP foci of individual cells in a parent cell. Figure 5 illustrates an asymmetric plasmid partitioning system and cell according to a second aspect of the invention comprising a gene regulatory control sequence, and wherein the gene regulatory control sequence comprises the transcriptional repressor, Laci. Laci represses the output of Puacoi-YFP. The plasmid, and the Laci repressor gene, remain tethered in parent cells upon cell division and daughter cell proliferation leads to dilution of stable Laci molecules causing a delay of onset of expression of Puacoi-YFP. Figure 6 is a graph that illustrates that an asymmetric plasmid partitioning system as shown in Figure 5 comprising the Laci repressor gene causes a delay to the output as described in Figure 5 and wherein the delay length (in cell generations) until output activation scales exponentially with the final number of daughter cells with the activated output. Figure 7 illustrates an asymmetric plasmid partitioning using system and cells containing the same (a) wherein the system synthesises a payload and releases the payload through cell lysis; and (b) wherein at each cell division, a parent cell produces daughter cells that proliferate into subpopulations of finite size that lyse upon output expression. Figure 8 is a chart that illustrates the release of YFP into culture supernatants using an asymmetric plasmid partitioning system according to a second aspect of the invention (named pZA32-YFP LysE), comprising an output that controls release of YFP and the lysis protein, LysE. The control (named pZA32-YFP) is lacking the lysis protein, LysE, and so does not release YFP into culture supernatants. Figure 9 illustrates the use of asymmetric plasmid partitioning according to a third aspect of the invention for the controlled release of bacteriophages from daughter cells. Figure 10 illustrates the components of MS2 phage control using an asymmetric plasmid partitioning system according to third aspect of the invention. The components comprising Puacoi on plasmid, pZA32, controlling expression of a full-length MS2 phage DNA genome. Upon expression, 5 MS2 mRNA self-replicates leading to phage production and phage-driven cell lysis of daughter cells. Figure 11 illustrates the asymmetric plasmid partitioning-dependent MS2 phage release from daughter cells. After asymmetric plasmid partitioning (APP) induction, parent cells were serially diluted, incubated at 37°C, and 10 samples were taken at Oh, 5h and 20h after APP induction. Serial dilutions show dependence of MS2 production on initial parent cell density, with decreasing parent cell density leading to slower release dynamics. Figure 12 illustrates the detection of MS2-HiBit phage particles using a split 15 luminescence complementation assay. Figure 13 shows a schematic diagram of a fail-safe mechanism involving the essential dapA gene stacked with the payload or output release mechanism as described according to the second aspect of the invention. Figure 14 shows a graph of experimentally measured delays to cell lysis by LysE 20 expression and cell death by loss of DapA function in daughter cells. Numbers next to the shapes are average delay in generations to cell death / lysis. Figure 15 illustrates an APP system comprising a fail-safe mechanism wherein the control plasmid encodes the only genetic copy of dapA in the cell, and lacl and dapA are coupled into a single transcriptional unit driven by Placlq. Example 1 - Asymmetric Plasmid Partitioning (APP) An APP system according to the present invention comprises two components; (i) a DNA-binding scaffold, bound to (ii) a control plasmid (named pCONTROL), as shown in Figure 1. The DNA-binding scaffold comprises the Caulobacter crescentus pole-organising protein, PopZ, fused to the tetracycline repressor, TetR. In this example, the DNA-binding scaffold also comprises a red fluorescent mCherry protein for analysis purposes. The DNA-binding scaffold is named TetR-mCherry-PopZ herein (SEQ ID NO: 3). Plasmid pSClOl repAts (SEQ ID NO: 9) was used as pCONTROL which encodes an array of tetracycline operator sites, tetO, and has a temperature-sensitive origin of replication. TetR of the DNA-binding scaffold (TetR-mCherry-PopZ) binds to the tetO sites (SEQ ID NO: 4) of the control plasmid to form the nucleoprotein complex, as shown in Figure 2. TetR binding to tetO is amongst the strongest reported protein-DNA interactions in nature (—10-11 M), which makes it an ideal system to substantially irreversibly tether control plasmid molecules and to eventually control gene expression during the tethering process. The control plasmid further comprises; an ampicillin resistance gene, bla, genes encoding fluorescent proteins, such as yellow fluorescent protein (YFP) or cyan fluorescent protein (CFP), and a parS site. Example 1 also demonstrates a method of APP according to this invention. Figure 2 demonstrates that upon transient induction of the DNA-binding scaffold (TetR-mCherry-PopZ) from a genetically engineered Escherichia coli genome using L-arabinose and a shift to 42°C, the control plasmid (pCONTROL) ceases replication and is bound into a nucleoprotein complex by TetR-mCherry-PopZ. Cell division then gives rise to a copy of the parent cell containing the nucleoprotein complex, and a daughter cell devoid of the nucleoprotein complex. Thus, APP of the present invention induces cell differentiation. The temperature sensitive SC101repAts origin of replication strongly reduces unwanted replication of the control plasmid bound to the DNA-binding scaffold (TetR-mCherry-PopZ) at physiological temperatures. The control plasmid remains in a transcriptionally active state while bound and immobilised by the DNA-binding scaffold (TetR-mCherry-PopZ). Figure 3a and 3b demonstrates that the nucleoprotein complex formation occurs rapidly, and that the formed nucleoprotein complex is stable for at least 48h at 37 °C. Further experiments also demonstrate the long-term stability of nucleoprotein complexes that remain immobilised at the cell poles, by being stable for up to at least 25 cell generations (Figure 4). Using a TetR repressor coupled with PopZ and a temperature sensitive origin of the control plasmid creates an exceptionally stable nucleoprotein complex. Furthermore, owing to the strength of the tether and the temperature-sensitivity of the control plasmid, cell differentiation is achieved with very high efficiency by a single transient induction event. Example 2 - Asymmetric plasmid partitioning (APP) system comprising a gene regulatory control sequence Example 2 illustrates a further aspect of the APP system, wherein the APP system further comprises a gene regulatory control sequence. In this example, the APP system described for Example 1 is further engineered to include a single transcriptional repressor, Laci (SEQ ID NO: 6), which forms part of the gene regulatory control sequence, which is constitutively expressed from the plasmid (pLadq-LacI), as shown in Figure 5. The APP system also includes a second plasmid which expresses an output or payload, which is in this case is encoded by PLacOi-YFP, a lac promoter (SEQ ID NO: 5) coupled to yellow fluorescent protein (YFP). Figure 5 illustrates how the pCONTROL plasmid comprising Laci controls an output from PLacOi-YFP. In this example, the Laci represses an operator gene, LacO, on PLacOi-YFP and therefore controls the outputs from Pt aroi-YFP. Cell division into daughter cells separates Puacoi-YFP from the only source of Laci expression in the parent cells (i.e. the nucleoprotein complex, which contains the Lal repressor gene, and which is retained only in the parent cell or copy of the parent cell). Daughter cell proliferation leads to dilution of stable Laci molecules (named the Laci decay phase), leading to a delay until the onset of output expression. Following separation from parent cells during cell division, daughter cells comprise a fixed number of Laci molecules, that due to their proteolytic stability, will decay exponentially by subsequent cell proliferation. This decay phase produces a delay before daughter cells activate the output. Daughter cells only activate the output when Laci concentrations have fallen below a critical threshold required for output repression. More formally, the length of the decay process and time until Laci levels reach a critical threshold can be approximated by decay time=log2(N / S) with one Laci half-life equalling one cell generation. N is the number of initial repressor molecules, and S is the critical threshold of repressor molecules required to repress the output. Surprisingly, the delay length in cell generations until output activation scales exponentially with the final number of daughter cells with the activated output. For a given delay length in cell generations, n, 2“ daughter cells will autonomously activate the output in the absence of any further input requirements, as shown in Figure 6. The APP system comprising the gene regulatory control sequence then acts as a daughter cell population amplifier whose output can be manipulated by changing the two parameters that affect the length of the decay process: the initial repressor concentration, N, and the critical threshold needed for output repression, S. Example 2 shows that using an APP system comprising a gene regulatory control sequence allows for daughter cell population amplification and the programmable expression of an output. Example 3 - Asymmetric plasmid partitioning (APP) system for the expression and release of a payload Example 3 demonstrates how APP according to this invention can act as a payload device and produce a constant and linear output behaviour based on division of labour between parent cells and daughter cells. To produce a payload device, the APP system of Example 2 further comprises; (i) an output that terminates daughter cell growth destructively by cell lysis, and (ii) a mechanism for producing a payload. Here, the parent cell comprises an APP system which includes a plasmid other than pCONTROL, the further plasmid encoding PLaCoi-YFP-LysE, comprising the Lac promoter Pt ^oi and combination of payload output comprising Yellow Fluorescent Protein (YFP) and lysis protein LysE. On cell division, each daughter cell includes plasmids which include the PLacOi-YFP-LysE combination, and expression of the YFP-LysE proteins is prevented by the Lac repressor binding to Pt^01, until enough cell divisions have taken place such that the Lac repressor is diluted to a point where PLacOi binding does not occur, which leads , to the release of YFP as a payload and also synthesis of the lysis protein, LysE, which in turn lyses the daughter cell upon output activation, as shown in Figure 7. Referring to Figure 7, at each round of cell division, the parent cell releases daughter cells that proliferate into subpopulations of finite size that lyse upon output expression (“ON”). Parent cells do not suffer from the detriment of payload production or cell lysis and serve as a replicative reservoir that at each round of cell division produces a daughter cell which then proliferates exponentially into a subpopulation until cell lysis, as shown in Figure 7. Figure 8 is a chart which illustrates the successful release of the payload, YFP, into the culture supernatant after induction of APP, compared to a control plasmid (pZA32-YFP) lacking LysE. The lifetime of the APP system is only limited by the carrying capacity of the environment, the lifetime of parent cells, or the genetic stability of the system. Moreover, the repressor decay dynamics is stringently coupled to daughter cell growth rather than actual time and is hence robust in producing concentrations of payload. The output rate of the APP system can be manipulated using two parameters; (i) the length of the delay until payload production and payload release through Laci dilution, and (ii) the initial density of parent cells. The output rate scales exponentially with the delay length or final daughter cell population size at payload release by cell lysis, and linearly with the number of parent cells that produce daughter cells at each cell division. Unlike exponentially growing populations, the output rate of this system is sensitive to the density of parent cells. The payload is controllable by either changing the parent cell density or by changing the copy number of the output. Furthermore, it is possible to control the lifetime of parent cells and restrict the duration of the output process. Example 3 shows that using the APP system of previous examples coupled with a mechanism for payload production and / or payload release mechanism, allows for the release of a payload, and with its output being highly scalable and controllable. Example 4 - Asymmetric plasmid partitioning (APP) system with fail-safe mechanism to ensure daughter cell death and payload release Example 4 builds on the APP system of Example 3 and further includes a fail-safe mechanism that will eliminate daughter cells that fail to release a payload by cell lysis (which may occur through a genetic mutation or loss of the output plasmid). Example 4 demonstrates that this can be achieved by removing the dapA gene that encodes dihydrodipicolinate synthase (DapA) from the parent cell or chassis organisms’ genome (AdapA) and re-introducing the gene sequence onto the control plasmid (SEQ ID NO: 10). After activation of APP, daughter cells are born with a fixed amount of DapA that will be diluted by consecutive cell divisions to a critical threshold. Loss of DapA up to the critical threshold leads to daughter cell death by cell lysis caused by cell wall rupture. In this example, the fail-safe mechanism is stacked with the main payload or output release mechanism described in the above examples (as shown in Figure 13). Importantly, the main payload or output release mechanism and the fail-safe mechanism have daughter cell death delays of different time lengths (as shown in Figure 14). All daughter cells are bom with a finite amount of Laci and DapA which are diluted by cell division. Cells with functional cell lysis mechanism will produce payload and release by lysis once the critical Laci threshold (“YES” branch, Figure 13) is reached. Cells that don’t execute payload release by cell lysis will undergo one more cell divisions after which DapA will fall below the critical threshold leading to cell death (“NO” branch, Figure 13). Referring to Figure 15, the control plasmid encodes the only genetic copy of the dapA gene in the cell, and the lacl gene and dapA gene are coupled into a single transcriptional unit driven by Placlq. This ensures that both Laci and DapA are expressed simultaneously and in a stable ratio. More importantly, the dapA gene carries its own very strong ribosome binding site (RBS) (RBS shown as the underlined sequence in SEQ ID NO: 10) that exceeds the strength of the RBS of lacl, and DapA is expressed in excess over Lacl. Consequently, presence of the control plasmid enables normal growth of the chassis organism by supplying DapA, while Lacl represses the payload and output / cell lysis mechanism encoded on the output plasmid pZA32-YFP-LysE. The fail-safe mechanism described in this example demonstrates a highly efficient system that enforces a “hard-limit” on the replicative capacity of daughter cells. Example 5 - The use of asymmetric plasmid partitioning (APP) for the controlled release of bacteriophages Example 5 demonstrates another embodiment of an APP system and the use of the APP system for the controlled release of bacteriophages (phages), as shown in Figure 9. In this example, a bacteriophage is used as an example of a payload. Bacteriophage MS2 is genetically encoded on pZA32 plasmid of the APP system of Example 2 that comprises the PLacOi promoter. Phage replication is then controlled by the PLacOi as described in Example 2. For an APP system comprising MS2 phage, a full-length DNA MS2 phage genome was cloned and assembled from synthetic DNA fragments into a plasmid (pZA32-MS2) under control of PLacOi, as shown in Figure 10. Expression of pZA32-MS2 after induction of APP led to induction of MS2 phage replication. Phage particle production was dependent on the density of parent cells, as shown in Figure 11. Using an engineered MS2-HiBit phage encoded on pZA32 that comprises a short split-luciferase polypeptide on the capsid surface and a luminescence complementation assay, down to 200 phage particles measured were released in a controlled manner by APP (Figure 12). For an APP system comprising phage X as a payload, the bacterial host strain encoding the APP system was lysogenised with a wildtype phage X carrying a kanamycin resistance. The phage X becomes part of the cell’s genome as a lysogen until its lytic life cycle is induced by the daughter cell’s SOS response. The SOS response is induced by cloning Cas9 with a strong degradation tag, LVA, to limit the negative effects of leaky Cas9 expression and a constitutively expressed sgRNA targeting the bacterial chromosome at three positions into the plasmid, pZA32. Cas9LVA expression is controlled by PLacOl. Upon output expression, Cas9LVA introduces double strand breaks into the genome of the daughter cells at three positions determined by the sgRNA targeting the naturally occurring three copies of isoleucine tNRA, ileTUV. The double strand breaks trigger the SOS response through the RecA-LexA pathway which activates the lytic phage X lifecycle, leading to X phage replication and release. Example 5 demonstrates another embodiment of the APP system of this invention, the release and production of bacteriophages in a controlled manner. The example shown here demonstrates how the APP system can produce MS2-based viruslike particles (VLPs) that could be engineered and loaded with a range of different therapeutic modalities, including small RNAs, to target cancer cells with very high specificity. In biotechnological settings, the APP system allows for the production of prespecified quantities of product or production of product at pre-specified rates. Product release may then feed back onto parent cells for autoregulatory control of product production rates, product concentrations, and the lifetime of parent cells. Autoregulation may occur through the released product or additional regulatory circuits based on quorum sensing. The above embodiments are described by way of example only. Many variations are possible without departing from the scope of the invention. SEQUENCES SEQ ID NO: 1 (PopZ, codon-optimised for expression in Escherichia coli) TAGCGACCAAAGCCAAGAGCCGACCATGGAGGAGATCCTGGCATCCATTC GTCGCATTATCAGTGAAGATGACGCACCCGCGGAACCCGCGGCTGAGGCT GCTCCGCCTCCACCGCCCGAACCGGAACCGGAACCCGTTTCGTTTGACGA CGAAGTGCTGGAATTAACAGATCCGATTGCACCTGAGCCTGAGCTTCCAC CuCiUUAAAC1 Cj 1 CCjCjACjACA1 CCjAICjI i 1A1 1C1CCCCCiCrAUCCUUACji CCGAGCCAGCATACACGCCTCCGCCAGCAGCGCCCGTCTTCGATCGTGAT GAAGTAGCAGAACAGCTTGTTGGTGTATCCGCTGCCAGCGCGGCTGCCTC CGCCTTTGGCTCCTTATCTAGCGCCCTTCTTATGCCCAAGGACGGGCGCAC TCTGGAGGACGTCGTTCGTGAATTACTTCGCCCATTGTTGAAGGAATGGTT GGATCAAAACTTACCCCGCATCGTCGAAACAAAGGTCGAGGAAGAGGTTC AACGCATTTCCCGCGGGCGTGGGGCATAA SEQ ID NO: 2 (TetR) ATGTCTAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCT TAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGC TAGGTGTAGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGGCT TTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTT TGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAAGGCTAA AAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTT AGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAG CCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCA GCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATC AAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCA TTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGC CTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAA ATGTGAAAGTGGGTCT SEQ ID NO :3 (TetR-mCherry-PopZ, popZ was codon-optimised for expression in Escherichia coli) ATGTCTAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCT TAATGAGGTCGGAATCGAAGGTTTAACAACCCGTAAACTCGCCCAGAAGC TAGGTGTAGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGGCT TTGCTCGACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTT TGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTACGTAATAAGGCTAA AAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTT AGGTACACGGCCTACAGAAAAACAGTATGAAACTCTCGAAAATCAATTAG CCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATGCACTCA GCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATC AAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTGATAGTATGCCGCCA TTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGC CTTCTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAA ATGTGAAAGTGGGTCTAATAACAATGGTGGCGGTGTTTCCAAGGGCGAGG AGGATAACATGGCTATCATTAAAGAGTTCATGCGCTTCAAAGTTCACATG GAGGGTTCTGTTAACGGTCACGAGTTCGAGATCGAAGGCGAAGGCGAGG GCCGTCCGTATGAAGGCACCCAGACCGCCAAACTGAAAGTGACTAAAGG CUUCCCCjC 1 CjCC i i i i UCU1 UCjCj AC A i CL i CjAUCCCCjC AA1 11A1 Cj 1 ACCjCj TTCTAAAGCGTATGTTAAACACCCAGCGGATATCCCGGACTATCTGAAGC TGTCTTTTCCGGAAGGTTTCAAGTGGGAACGCGTAATGAATTTTGAAGATG GTGGTGTCGTGACCGTCACTCAGGACTCCTCCCTGCAGGATGGCGAGTTC ATCTATAAAGTTAAACTGCGTGGTACTAATTTTCCATCTGATGGCCCGGTG ATGCAGAAAAAGACGATGGGTTGGGAGGCGTCTAGCGAACGCATGTATCC GGAAGATGGTGCGCTGAAAGGCGAAATTAAACAGCGCCTGAAACTGAAA GATGGCGGCCATTATGACGCTGAAGTGAAAACCACGTACAAAGCCAAGA AACCTGTGCAGCTGCCTGGCGCGTACAATGTGAATATTAAACTGGACATC ACCTCTCATAATGAAGATTATACGATCGTAGAGCAATATGAGCGCGCGGA GGGTCGTCATTCTACCGGTGGCATGGATGAGCTGTACAAAAGCGGTGGCA GCGGCGGTAGCGACCAAAGCCAAGAGCCGACCATGGAGGAGATCCTGGC A ypp * TTpriTCGG a tt a TC A GTG A A G A TG ACGC A CLCGCGG A A pppfiGGG CTGAGGCTGCTCCGCCTCCACCGCCCGAACCGGAACCGGAACCCGTTTCG TTTGACGACGAAGTGCTGGAATTAACAGATCCGATTGCACCTGAGCCTGA GCTTCCACCGCTGGAAACTGTCGGAGACATCGATGTTTATTCTCCCCCTGA UCCUUAU1 CCuAuCCAuCA 1 AL ACuCL i LLuLLAuLAIjLuLLLu 1 LI 1CU ATCGTGATGAAGTAGCAGAACAGCTTGTTGGTGTATCCGCTGCCAGCGCG GCTGCCTCCGCCTTTGGCTCCTTATCTAGCGCCCTTCTTATGCCCAAGGAC GGGCGCACTCTGGAGGACGTCGTTCGTGAATTACTTCGCCCATTGTTGAAG GAATGGTTGGATCAAAACTTACCCCGCATCGTCGAAACAAAGGTCGAGGA AGAGGTTCAACGCATTTCCCGCGGGCGTGGGGCATAA SEQIDNO:4 (35x tetO array) TGCGATGGATTCCCTATCAGTGATAGAGAGTCCTTAACTTCCCTATCAGTG ATAGAGACTGGCAGGAATCCCTATCAGTGATAGAGAATTAAAGCGATCCC TATCAGTGATAGAGAACGTATATACTCCCTATCAGTGATAGAGAAACGCA AAGATCCCTATCAGTGATAGAGAAGCTGGAAAATCCCTATCAGTGATAGA GATTGGCGAGGGTCCCTATCAGTGATAGAGAAATCCTGTTTTCCCTATCAG TGATAGAGACTGTCTATCCTCCCTATCAGTGATAGAGAAAGAATGGGCTC CCTATCAGTGATAGAGAATGAGGTGGCTCCCTATCAGTGATAGAGAAACC GTCGTGTCCCTATCAGTGATAGAGACTAGCGTACATCCCTATCAGTGATAG AGAGGCTGCACTTTCCCTATCAGTGATAGAGATGTAACCATTTCCCTATCA GTGATAGAGATGGGACACCGTCCCTATCAGTGATAGAGAGACACTCGCTT CCCTATCAGTGATAGAGAGTTTTCGAAATCCCTATCAGTGATAGAGATTAC CCTTTATCCCTATCAGTGATAGAGAAGCGCGGGTATCCCTATCAGTGATAG AGATTGAACCAGGTCCCTATCAGTGATAGAGACTTATGCCCATCCCTATCA GTGATAGAGAAGATCGTAGCTCCCTATCAGTGATAGAGAAAGCAGACTCT CCCTATCAGTGATAGAGAAAACAAGATATCCCTATCAGTGATAGAGATAT TTTGCCCTCCCTATCAGTGATAGAGAGCCTTACAGATCCCTATCAGTGATA GAGACGAAACTAGTTCCCTATCAGTGATAGAGATGGAGGTTATTCCCTAT CAGTGATAGAGAGGAGCATACTTCCCTATCAGTGATAGAGAATCACGTGG GTCCCTATCAGTGATAGAGACGGCCACTGGTCCCTATCAGTGATAGAGAT GAGTTACTATCCCTATCAGTGATAGAGACACCCCAGGGGCATGC SEO ID NO: 5 (ladpromoter) CCC Lil Cu 1 Cl 1C ACC 1CUAC AA11CUCUCUCU A ACCCUAAUCUUCA1CC ATTTACGTTGACACCATCGAATGGTGCAAAACCTTTCGCGGTATGGCATG ATAGCGCCCGGAAGAGAGTCAATTCAGG GTGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGG TGTCTCTTATCAGACCGTTTCCCGCGTGGTGAACCAGGCCAGCCACGTTTC TGGGAA A AGGGGGGA AAA AGTGGA AGGGGGGATGGGGGAGGTGA ATTAG ATTCCCAACCGCGTGGCACAACAACTGGCGGGCAAACAGTCGTTGCTGAT TGGCGTTGCCACCTCCAGTCTGGCCCTGCACGCGCCGTCGCAAATTGTCGC GGCGATTAAATCTCGCGCCGATCAACTGGGTGCCAGCGTGGTGGTGTCGA TGGTAG A AGGA AGGGGGGTGG A AGGGTGT A A AGGGGGGGTGG AG A ATGTT A xJ xJ A kJ zi / ixJ x-- vJ xJ x-- vJ A x^VJ / i / '*'—A V—I A jGVjGkz».vJ \_'XjxJ%_-«xJxJ A xj A v_z- A A CTCGCGCAACGCGTCAGTGGGCTGATCATTAACTATCCGCTGGATGACCA GGATGCCATTGCTGTGGAAGCTGCCTGCACTAATGTTCCGGCGTTATTTCT TGATGTCTCTGACCAGACACCCATCAACAGTATTATTTTCTCCCATGAAGA ri / -’rm a G^G"’G^G"’ a g^gpg"’G"’G"’g^ G"’g^ a g^g-’ a nr / ^nr / ^a nrnrG^g^g^htg^ a g^g^ a g^G"1 a a a LUU i ACCjCCj AC i CjCjCjCCj i UCr AUC A1 Cl CjU 1CUC A1 1 CjCjCj 1 CALC AUC A AA TCGCGCTGTTAGCGGGCCCATTAAGTTCTGTCTCGGCGCGTCTGCGTCTGG CTGGCTGGCATAAATATCTCACTCGCAATCAAATTCAGCCGATAGCGGAA CGGGAAGGCGACTGGAGTGCCATGTCCGGTTTTCAACAAACCATGCAAAT ripy r; A A th a GGGG A TG GTTGGG A GTGG G A TGGTGGTTGGG A A G G A TG AGA A xj / i / i, A \JZjl\Jx—lx—A v_^x—I A A x-'X-zV / iiAw' A VJv„-VJz». A xjx—■ A xjxj A A vJV^x^ / iZAXw'xJii A x_ / / ixjrt TGGCGCTGGGCGCAATGCGCGCCATTACCGAGTCCGGGCTGCGCGTTGGT GCGGATATCTCGGTAGTGGGATACGACGATACCGAAGACAGCTCATGTTA TATCCCGCCGTTAACCACCATCAAACAGGATTTTCGCCTGCTGGGGCAAA CCAuLU 1 uuACCUC i i ut 1UCAAC i C i C i CAuuuCCAuIjCuu i UAAuuuC AATCAGCTGTTGCCCGTCTCACTGGTGAAAAGAAAAACCACCCTGGCGCC CAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCT GGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTAA CTAGGGGATATATTCCGCTTCCTCGCTCACTGACTCGCTACGCTCGGTCGT TCGACTGCGGCGAGCGGAAATGGCTTACGAACGGGGCGGAGATTTCCTGG AAGATGCCAGGAAGATACTTAACAGGGAAGTGAGAGGGCCGCGGCAAAG CCGTTTTTCCATAGGCTCCGCCCCCCTGACAAGCATCACGAAATCTGACGC TCAAATCAGTGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTT TCCCCCTGGCGGCTCCCTCGTGCGCTCTCCTGTTCCTGCCTTTCGGTTTACC nra nrnr / ^ / ^ / ^ / ^nr / ^nrnr a nrG^G^ / ^ / ^ / ^ / ^ / ^nrnrnr / ^nr / ^nr / "’ a a a a z^nr Uli 1 u 1 LA 1 1CCUC1 UI 1A1 UUCCUCU 11 1U1C1 C A1 1CCACUCC1U AC AC 1 CAGTTCCGGGTAGGCAGTTCGCTCCAAGCTGGACTGTATGCACGAACCCC CCGTTCAGTCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA ACCCGGAAAGACATGCAAAAGCACCACTGGCAGCAGCCACTGGTAATTG ATTTAGAGGAGTTAGTCTTGAAGTCATGCGCCGGTTAAGGCTAAACTGAA AGGACAAGTTTTGGTGACTGCGCTCCTCCAAGCCAGTTACCTCGGTTCAAA GAGTTGGTAGCTCAGAGAACCTTCGAAAAACCGCCCTGCAAGGCGGTTTT TTCGTTTTCAGAGCAAGAGATTACGCGCAGACCAAAACGATCTCAAGAAG ATCATCTTATTAATCAGATAAAATATTTCTAGATTTCAGTGCAATTTATCT CTTCAAATGTAGCACCTGAAGTCAGCCCCATACGATATAAGTTGTTA SEQ ID NO: 8 (pRK2 origin of replication) CTAGCGTTTGCAATGCACCAGGTCATCATTGACCCAGGCGTGTTCCACCAG UCCUC1UCC1CUCAAC1C1 1CUCAUUC11CUCCUACC1UC1CUCUCCAC11 CTTCACGCGGGTGGAATCCGATCCGCACATGAGGCGGAAGGTTTCCAGCT TGAGCGGGTACGGCTCCCGGTGCGAGCTGAAATAGTCGAACATCCGTCGG GCCGTCGGCGACAGCTTGCGGTACTTCTCCCATATGAATTTCGTGTAGTGG TGGCC AGG A A A G A GG A GG AGG AtTTGGTGGTGG ATG A GG AGGTGGG A AGG A %—• x—1 x-z-x—-Zi'J Vw' / i / i / i —I k-'zVK—■ xJ ZiV'yJZi. AAA X-'X—* A x_« xJ A x—■ xJ zV A x_»zV xJ X—1 z*,x_<x_< A xJ xJK—'GAZjlV_-« xJ GGACGTTTTCTTGCCACGGTCCAGGACGCGGAAGCGGTGCAGCAGCGACA CCGATTCCAGGTGCCCAACGCGGTCGGACGTGAAGCCCATCGCCGTCGCC TGTAGGCGCGACAGGCATTCCTCGGCCTTCGTGTAATACCGGCCATTGATC G A CC A GCCC A GGTCCTGGC AAA gcTGGT AGA A GGTG A A GGTG A TGGGGTG X—l / i v-z V'kJ JL JL xJxJK—A x—A—1 A iikJii / iV'xJ A A V—111 A x—-\JxJ\_. A x_- GCCGATAGGGGTGCGCTTCGCGTACTCCAACACCTGCTGCCACACCAGTT CGTCATCGTCGGCCCGCAGCTCGACGCCGGTGTAGGTGATCTTCACGTCCT TGTTGACGTGGAAAATGACCTTGTTTTGCAGCGCCTCGCGCGGGATTTTCT ptz~^r rr rz"^ z^*z^ nr z~^ z~^ nr / ^ a a z~^ a z^* z^* a z~^ a z~^ z"« z~i z~i z^ z^z^z^ppz^ppz^z^ pppppp z~^ z~^ a ppz'-’z"’ z"1pp i U i i UCUCU1 uu i GAACAUGUCAUAUCUGUCCU1U1lb ill UULA1ICC i CGCATCGTGTCCGGCCACGGCGCAATATCGAACAAGGAAAGCTGCATTTC CTTGATCTGCTGCTTCGTGTGTTTCAGCAACGCGGCCTGCTTGGCTTCGCT GACCTGTTTTGCCAGGTCCTCGCCGGCGGTTTTTCGCTTCTTGGTCGTCATA z~^ppppz~^z~^ppz^’Z^,z^*z^ppz~^ppz~^z~^ a ppz~^z~^ppz^ a ppz~^z~^ a z^ppppz^z^z^z"^ a a a z^z~^ppz~^ UliCl1 CIjCCi 1 ulLUAiUU1CA1CUALi iCUCCAAALl iUCCUCC1CClul TCGAGACGACGCGAACGCTCCACGGCGGCCGATGGCGCGGGCAGGGCAG GGGGAGCCAGTTGCACGCTGTCGCGCTCGATCTTGGCCGTAGCTTGCTGG ACTATCGAGCCGACGGACTGGAAGGTTTCGCGGGGCGCACGCATGACGGT blbbl1 1 (jCuA i UU ill CuuC A1 CL i CuuCuuAAAACLCCuCu i CUA1 CA GTTCTTGCCTGTATGCCTTCCGGTCAAACGTCCGATTCATTCACCCTCCTTG CGGGATTGCCCCGGAATTAATTCCCCGGATCGATCCGTCGATCTTGATCCC CTGCGCCATCAGATCCTTGGCGGCAAGAAAGCCATCCAGTTTACTTTGCA UUUC i 1CCCAACC i i ACCACjACjUUCUCCCCAUC 1 UuCAA i i CLuu 1 1 Cut TTGCTGTCCATAAAACCGCCCAGTCTAGCTATCGCCATGTAAGCCCACTGC AAGCTACCTGCTTTCTCTTTGCGCTTGCGTTTTCCCTTGTCCAGATAGCCCA GTAGCTGACATTCATCCGGGGTCAGCACCGTTTCTGCGGACTGGCTTTCTA Z^’Z^’PPZ^'Z^Z~^PPZ^Z^Z~^ A PPPPPPPPPPZ"^ Z~^ Z~^Z~^PPZ~^ A Z^ Z^ Z^Z~^Z~^PPPPZ~^Z^Z^’Z^’Z^"Z~^Z^Z^ A Z^ Z^ Z~^ Z~^ Z~^Z~^Z~^ A Z^Z^Z-^ CUIUULIUCCAI i i i 1UUUU1 UACjCjCCaj 1 1CUCUUCCUAUUUUCUCAUCC CCTGGGGGGATGGGAGGCCCGCGTTAGCGGGCCGGGAGGGTTCGAGAAG GGGGGGCACCCCCCTTCGGCGTGCGCGGTCACGCGCACAGGGCGCAGCCC TGGTTAAAAACAAGGTTTATAAATATTGGTTTAAAAGCAGGTTAAAAGAC AGGTTAGCGGTGGCCGAAAAACGGGCGGAAACCCTTGCAAATGCTGGATT TTCTGCCTGTGGACAGCCCCTCAAATGTCAATAGGTGCGCCCCTCATCTGT CAGCACTCTGCCCCTCAAGTGTCAAGGATCGCGCCCCTCATCTGTCAGTAG TCGCGCCCCTCAAGTGTCAATACCGCAGGGCACTTATCCCCAGGCTTGTCC ACATCATCTGTGGGAAACTCGCGTAAAATCAGGCGTTTTCGCCGATTTGCG AGGCTGGCCAGCTCCACGTCGCCGGCCGAAATCGAGCCTGCCCCTCATCT GTCAACGCCGCGCCGGGTGAGTCGGCCCCTCAAGTGTCAACGTCCGCCCC TCATCTGTCAGTGAGGGCCAAGTTTTCCGCGAGGTATCCACAACGCCGGC liliLCC 1ACA i uuC i C i (jC 1U1 Alj i CjACj i 1 1 UCUC i CCCjCjCACjCLjLj 1C CTGATCCCCCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCT ACGGCGCGCCCAG SEQIDNO: 9 (pSClOl RepA,s origin of replication, temperature-sensitive) ACUUU1111 CjC 1UCCCUC A A ACCjUCjC 1U1 1 Cl UU1 Cj 1 1UC1 AU 1 1 1 Cj 1 1A1 CAGAATCGCAGATCCGGCTTCAGGTTTGCCGGCTGAAAGCGCTATTTCTTC CAGAATTGCCATGATTTTTTCCCCACGGGAGGCGTCACTGGCTCCCGTGTT GTCGGCAGCTTTGATTCGATAAGCAGCATCGCCTGTTTCAGGCTGTCTATG TGTGACTGTTGAGCTGTAACAAGTTGTCTCAGGTGTTCAATTTCATGTTCT AGTTGCTTTGTTTTACTGGTTTCACCTGTTCTATTAGGTGTTACATGCTGTT CATCTGTTACATTGTCGATCTGTTCATGGTGAACAGCTTTGAATGCACCAA AAACTCGTAAAAGCTCTGATGTATCTATCTTTTTTACACCGTTTTCATCTGT GCATATGGACAGTTTTCCCTTTGATATGTAACGGTGAACAGTTGTTCTACT TTTGTTTGTTAGTCTTGATGCTTCACTGATAGATACAAGAGCCATAAGAAC CTCAGATCCTTCCGTATTTAGCCAGTATGTTCTCTAGTGTGGTTCGTTGTTT TTGCGTGAGCCATGAGAACGAACCATTGAGATCATACTTACTTTGCATGTC ACTCAAAAATTTTGCCTCAAAACTGGTGAGCTGAATTTTTGCAGTTAAAGC ATCGTGTAGTGTTTTTCTTAGTCCGTTATGTAGGTAGGAATCTGATGTAAT GGTTGTTGGTATTTTGTCACCATTCATTTTTATCTGGTTGTTCTCAAGTTCG GTTACGAGATCCATTTGTCTATCTAGTTCAACTTGGAAAATCAACGTATCA GTCGGGCGGCCTCGCTTATCAACCACCAATTTCATATTGCTGTAAGTGTTT AAATCTTTACTTATTGGTTTCAAAACCCATTGGTTAAGCCTTTTAAACTCA TGGTAGTTATTTTCAAGCATTAACATGAACTTAAATTCATCAAGGCTAATC TCTATATTTGCCTTGTGAGTTTTCTTTTGTGTTAGTTCTTTTAATAACCACT CATAAATCCTCATAGAGTATTTGTTTTCAAAAGACTTAACATGTTCCAGAT TATATTTTATGAATTTTTTTAACTGGAAAAGATAAGGCAATATCTCTTCAC TAAAAACTAATTCTAATTTTTCGCTTGAGAACTTGGCATAGTTTGTCCACT GGAAAATCTCAAAGCCTTTAACCAAAGGATTCCTGATTTCCACAGTTCTCG TCATCAGCTCTCTGGTTGCTTTAGCTAATACACCATAAGCATTTTCCCTACT GATGTTCATCATCTGAGCGTATTGGTTATAAGTGAACGATACCGTCCGTTC TTTCCTTGTAGGGTTTTCAATCGTGGGGTTGAGTAGTGCCACACAGCATAA AATTAGCTTGGTTTCATGCTCCGTTAAGTCATAGCGACTAATCGCTAGTTC ATTTGCTTTGAAAACAACTAATTCAGACATACATCTCAATTGGTCTAGGTG ATTTTAATCACTATACCAATTGAGATGGGCTAGTCAATGATAATTACTAGT CCTTTTCCTTTGAGTTGTGGGTATCTGTAAATTCTGCTAGACCTTTGCTGGA AAACTTGTAAATTCTGCTAGACCCTCTGTAAATTCCGCTAGACCTTTGTGT GTTTTTTTTGTTTATATTCAAGTGGTTATAATTTATAGAATAAAGAAAGAA TAAAAAAAGATAAAAAGAATAGATCCCAGCCCTGTGTATAACTCACTACT TTAGTCAGTTCCGCAGTATTACAAAAGGATGTCGCAAACGCTGTTTGCTCC TCTACAAAACAGACCTTAAAACCCTAAAGGCTTAAGTAGCACCCTCGCAA UC i CUUCrC AAA i LUC i U A A1A11CC iiiiUiCl CCU ACC A i CACiCiCACC 1 Ci AGTCGCTGTCTTTTTCGTGACATTCAGTTCGCTGCGCTCACGGCTCTGGCA GTGAATGGGGGTAAATGGCACTACAGGCGCCTTTTATGGATTCATGCAAG GAAACTACCCATAATACAAGAAAAGCCCGTCACGGGCTTCTCAGGGCGTT TTATGGCGGGTCTGCTATGTGGTGCTATCTGACTTTTTGCTGTTCAGCAGTT CCTGCCCTCTGATTTTCCAGTCTGACCACTTCGGATTATCCCGTGACAGGT CATTCAGACTGGCTAATGCACCCAGTAAGGCAGCGGTATCATCAACAGGC TTACCCGTCTTACTGTC SEQ ID NO: 10 (dapA DNA sequence from Escherichia coli KI 2 with synthetic ribosome binding site underlined) ATTAAAGAGGAGAAAGGTACATGTTCACGGGAAGTATTGTCGCGATTGTT ACTCCGATGGATGAAAAAGGTAATGTCTGTCGGGCTAGCTTGAAAAAACT GATTGATTATCATGTCGCCAGCGGTACTTCGGCGATCGTTTCTGTTGGCAC CACTGGCGAGTCCGCTACCTTAAATCATGACGAACATGCTGATGTGGTGA i UA1 CjACCjC i CjCjA i C i CiCiC 1 CjA1 CjCjCjCCjCA 1 1 CCCjCj i AA i i CiCCCjCjCjACC GGCGCTA AGGCTACTGCGGA AGrCATTAGCrTGArGCAGCGCTTCA ATGA vJ kJ 1 x X x kJ v_-- 1 jL kv-* X vJv-'VJxJi Xx iKJIvzV'Z V. A X X xJ / iV-'vJ X X Z XZ X X XJ £ \ CAGTGGTATCGTCGGCTGCCTGACGGTAACCCCTTACTACAATCGTCCGTC GCAAGAAGGTTTGTATCAGCATTTCAAAGCCATCGCTGAGCATACTGACC i CiCCCjC A A A1 ICICjIAI AA 1 u 1 UCCCi i CCCCj i AC 1 CjCjC i CjCCjA IC 1 CjC 1CC CGGAAACGGTGGGCCGTCTGGCGAAAGTAAAAAATATTATCGGAATCAA AGAGGCAACAGGGAACTTAACGCGTGTAAACCAGATCAAAGAGCTGGTTT CAGATGATTTTGTTCTGCTGAGCGGCGATGATGCGAGCGCGCTGGACTTC A i UCAA1 1 CjCjUCUU i CA i UUCiCj 1 i A i i i CCU1 1 ACCjCiC i AACU i LUCACjC GCGTGATATGGCCCAGATGTGCAAACTGGCAGCAGAAGGGCATTTTGCCG 5 AGGCACGCGTTATTAATCAGCGTCTGATGCCATTACACAACAAACTATTTG TCGAACCCAATCCAATCCCGGTGAAATGGGCATGTAAGGAACTGGGTCTT GTGGGG AGGGATa CGGTGGGGGTGGG A ATGACAGG A ATG AGGG AG AGTGG TCGTGAGACGGTCAGAGCGGCGCTTAAGCATGCCGGTTTGCTGTAA

Claims

1. A parent cell comprising at least one nucleoprotein complex comprising at least one DNA-binding scaffold tethered to at least one control plasmid; and wherein the at least one nucleoprotein complex is configured so that upon cell division of the parent cell, a copy of the parent cell that retains the at least one nucleoprotein complex is formed and a daughter cell that is devoid of the at least one nucleoprotein complex is formed.

2. A parent cell as claimed in claim 1, wherein the DNA-binding scaffold comprisesthe scaffold protein Caulobacter crescentus pole-organising protein (PopZ).

3. A parent cell as claimed in claim 1 or 2, wherein the DNA-binding scaffold comprises a tetracycline repressor, TetR and wherein the control plasmid comprises a tetracycline operator sequence, tetO.

4. A parent cell as claimed in any one of claims 1 to 3, wherein the parent cell comprises a gene regulatory control sequence comprising at least one transcriptional repressor and / or transcriptional activator gene located on the control plasmid, and each parent and / or daughter cell comprises at least one operator sequence which is repressed or activated by at least one transcriptional repressor or transcriptional activator expressed by the transcriptional repressor and / or transcriptional activator gene of the gene regulatory sequence, wherein the operator sequence is coupled to at least one nucleic acid sequence encoding a pay load or output moiety.

5. A parent cell as claimed in claim 4, wherein upon cell division of the parent cell, each daughter cell formed contains a finite amount of transcriptional repressor and / or transcriptional activator.

6. A parent cell as claimed in claim 4 or 5, wherein the payload or output moiety is selected from the group consisting of: a bacteriophage biologically active peptide, a protein, an enzyme, a virus like particle (VLP), a toxin, or any combination thereof.

7. A parent cell as claimed in any one of claims 4 to 6, wherein the parent cellfurther comprises a payload or output release mechanism.

8. A parent cell as claimed in claim 7, wherein the pay load or output release mechanism further comprises a fail-safe mechanism that ensures daughter cell death, and wherein the fail-safe mechanism comprises a deletion of or in an essential gene encoding an essential protein from the parent cell genome and an insertion of the essential gene onto the control plasmid.

9. A method of manufacturing a parent cell of any one of claims 1 to 8, the methodcomprising:(i) genetically engineering a host cell by including at least one gene or DNA sequence that expresses the at least one DNA-binding scaffold, or parts thereof;(ii) inducing expression of the at least one DNA-binding scaffold; and(iii) tethering and / or immobilising the at least one control plasmid to the plasmid DNA-binding moiety of the at least one DNA-binding scaffold.

10. A method of asymmetric plasmid partitioning (APP) comprising the steps of:(i) providing a parent cell comprising at least one nucleoprotein complex comprising at least one DNA-binding scaffold tethered and / or immobilised to at least one control plasmid and wherein the at least one nucleoprotein complex is configured so that upon cell division of the parent cell, a copy of the parent cell that retains the at least one nucleoprotein complex is formed and a daughter cell that is devoid of the at least one nucleoprotein complex is formed; and(ii) effecting cell division to form a daughter cell which is devoid of the at least one nucleoprotein complex and a copy of the parent cell which comprises the at least one nucleoprotein complex.

11. A method of APP as claimed in claim 10, wherein the DNA-binding scaffold comprises a scaffold protein comprising the Caulobacter crescentus poleorganising protein (PopZ).

12. A method of APP as claimed in claim 10 or 11, wherein the DNA-binding scaffold comprises a tetracycline repressor, TetR and wherein the control plasmid comprises a tetracycline operator sequence, tetO.

13. A method of APP as claimed in any one of claims 10 to 12, wherein the parent cell comprises a gene regulatory control sequence, comprising at least one transcriptional repressor and / or transcriptional activator gene located on the control plasmid, and each of the parent or daughter cells comprise at least one operator sequence which is repressed or activated by at least one transcriptional repressor or transcriptional activator expressed by the transcriptional repressor ortranscriptional activator gene of the gene regulatory control sequence, and wherein the operator sequence is coupled to at least one nucleic acid sequence encoding a pay load or output moiety.

14. A method as claimed in claim 13 wherein the method further comprises:(iii) further dividing the daughter cell and the parent cell to form more daughter cells; and wherein upon cell division a finite amount of the transcriptional repressor and / or transcriptional activator is contained within each daughter cell and wherein upon each round of cell division the amount of transcriptional repressor and / or transcriptional activator contained within each subsequent daughter cells is reduced or diluted; and wherein the operator sequence effects expression of the payload or output moiety when a daughter cell contains a minimum threshold amount of transcriptional repressor.

15. A method of APP as claimed in claim 13 or 14, wherein each cell further comprises a payload or output release mechanism; and wherein the method further comprises the release of the payload or output moiety from at least one daughter cell when a threshold of payload or output moiety is reached within the daughter cell.

16. A method as claimed in claim 15, wherein the payload or output release mechanism is cell lysis, or secretion.

17. A method as claimed in claim 15 or 16, wherein the payload or output release mechanism further comprises a fail-safe mechanism that ensures daughter cell death, and wherein the fail-safe mechanism comprises a deletion of or in anessential gene encoding an essential protein from the parent cell genome and an insertion of the essential gene onto the control plasmid.

18. A method as claimed in any one of claims 13 to 17, wherein the pay load or output moiety is selected from the group consisting of: a bacteriophage, a biologically active peptide, a protein, an enzyme, a virus like particle (VLP), a toxin, or any combination thereof.

19. A method as claimed in any one of claims 13 to 18, wherein the gene regulatory control sequence comprises the repressor gene, Laci, and a LaqI gene promoter coupled to a DNA sequence encoding the pay load or output moiety.

20. A cell comprising one or more gene sequences for the formation of at least one nucleoprotein complex, comprising at least one sequence encoding at least one DNA-binding scaffold; and at least one control plasmid; and wherein the at least one DNA-binding scaffold sequence comprises sequences encoding a Caulobacter crescentus pole-organising protein (PopZ) and a tetracycline repressor, TetR, and the at least one control plasmid comprises a sequence encoding a tetracycline resistance operator sequence, tetO.

21. A cell as claimed in claim 20, wherein the control plasmid further comprises at least one gene sequence for a transcriptional repressor and / or transcriptional activator.

22. A cell as claimed in claim 21, wherein the repressor is Laci.

23. An asymmetric plasmid partitioning system comprising at least one nucleoprotein complex comprising, (a) at least one DNA-binding scaffold comprising scaffold protein and at least one plasmid DNA-binding moiety, wherein the scaffoldprotein is the Caulobacter crescentus pole-organising protein (PopZ), and (b) at least one control plasmid.

24. An asymmetric plasmid partitioning system as claimed in claim 23, where the DNA-binding scaffold (a) is bound to the plasmid (b).

25. An asymmetric plasmid partitioning system as claimed in claim 23 or 24, whereinthe DNA-binding scaffold (a) further comprises a tetracycline repressor, TetR, and the control plasmid (b) comprises a tetracycline resistance operator sequence, tetO.

26. An asymmetric plasmid partitioning system as claimed any one of claims 23 to 25, wherein the control plasmid (b) further comprises at least one moiety selected from the group consisting of; an ampicillin resistance gene (bla), a parS site, one or more genes encoding a fluorescent protein, or any combination of the aforementioned.

27. An asymmetric plasmid partitioning system as claimed in any one of claims 23 to26, wherein the DNA-binding scaffold further comprises at least one moiety selected from the group consisting of: a fluorescent protein, a DNA tether, a tethering moiety, or any combination of the aforementioned.

28. An asymmetric plasmid partitioning system as claimed in any one of claims 23 to27, wherein the control plasmid comprises a gene regulatory control sequence comprising at least one transcriptional repressor and / or transcriptional activator gene, preferably a Laci gene repressor, and wherein the asymmetric plasmid partitioning system further comprises at least one operator sequence which is repressed and / or activated by the at least one transcriptional repressor ortranscriptional activator expressed by the transcriptional repressor and / or transcriptional activator gene of the gene regulatory control sequence, wherein the operator sequence is coupled to at least one nucleic acid sequence encoding a pay load or output moiety.5 29. An asymmetric plasmid partitioning system as claimed in claim 28, wherein theat least one operator sequence is located on a separate plasmid contained within the parent or daughter cell that is not bound into the nucleoprotein complex.

30. A cell comprising the asymmetric plasmid partitioning system of any one of claims 23 to 30.

Images