Method for creating lodging resistant plant
By increasing trehalose-6-phosphate levels in plants through enhanced expression of trehalose-6-phosphate synthase, the challenges of lodging resistance in current plant breeding methods are addressed, achieving effective lodging resistance without adverse effects on other traits.
Patent Information
- Application Number
- JP2025042168
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-03-17
- Publication Date
- 2025-06-24
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Current methods for enhancing lodging resistance in plants, such as the semi-dwarf gene sd-1 and the gene SCM2, have limitations including reduced nitrogen absorption, pleiotropic effects, and lack of markers for breeding.
Increasing trehalose-6-phosphate levels in plants by enhancing the expression of trehalose-6-phosphate synthase, either through the use of strong promoters or by introducing specific SNPs in the promoter region, to improve lodging resistance.
The increased trehalose-6-phosphate levels confer lodging resistance to plants without negatively impacting other agricultural traits, enabling effective selection and breeding of resistant varieties.
Smart Images

Figure 2025094048000006 
Figure 2025094048000007 
Figure 2025094048000008
Abstract
Description
Technical Field
[0001] The present invention relates to substances and genes involved in the lodging resistance of plants, particularly rice, a method for producing plants having lodging resistance, and lodging-resistant plants. The present invention also relates to methods and means for determining or selecting lodging-resistant plants.
Background Art
[0002] Lodging is the most important obstacle in plant cultivation, leading to a decrease in productivity and quality directly related to the reduction of income for cultivating farmers. For example, it can reduce the yield, production quality, and mechanical harvesting efficiency of wheat (Triticum aestivum), barley (Hordeum vulgare), oats (Avena sativa), corn (Zea mays), sorghum (Sorghum bicolor), soybeans (Glycine max), tomatoes (Lycopersicon esculentum), tobacco (Nicotiana tabacum), etc. To reduce the damage caused by plant lodging, there are mainly the following three countermeasures. The first is a lodging reducer, and various reducers containing gibberellin inhibitors are on the market. The lodging reducer has problems such as the application time being limited to the middle growth stage because it inhibits gibberellin and suppresses the elongation of the upper part of the plant body, having no quick effect, and causing an increase in labor time and cost. The second is a combine for dealing with lodging, which can cut while raising the fallen plants (for example, rice). The combine for dealing with lodging has a high introduction cost. Also, it is effective for lodging immediately before harvesting, but it cannot cope with lodging that lasts for a long period from occurrence to harvesting.
[0003] The third is the creation of resistant lines, which has the lowest risk and is excellent in terms of cost. Targets for enhancing lodging resistance include shortening the culm, strengthening the culm, and enhancing the plant's supporting strength. In the breeding of resistant varieties, the semi-dwarf gene sd-1 related to culm shortening is utilized, and many varieties at home and abroad have sd-1. While the semi-dwarf gene sd-1 enabled the "Green Revolution," sd-1 has the drawback of reducing nitrogen absorption, and high input of nitrogen fertilizer is required during cultivation (Non-Patent Document 1). High input of fertilizer leads to a decrease in soil fertility and a burden on the environment due to residual nitrogen. In order to achieve the Sustainable Development Goals (SDGs) and comply with the "Green Food System Strategy," the development of improved lodging resistance technologies to replace sd-1 is required.
[0004] In addition, in the creation of resistant lines targeting culm strengthening, the introduction of the gene SCM2 improves lodging resistance by increasing the physical strength of the culm. However, due to its pleiotropic effects, the number of stems is reduced, so the lines into which it can be introduced are limited (Non-Patent Document 2). The creation of resistant lines targeting enhanced supporting strength has been shown to be effective since ancient times, but there is no information such as markers that can be used in breeding, and there are no reports of its utilization in breeding.
Prior Art Documents
Patent Documents
[0005]
Patent Document 1
Patent Document 2
Non-Patent Documents
[0006]
Non-Patent Document 1
Non-Patent Document 2
Summary of the Invention
[0007] Therefore, means and methods for acquiring lodging resistance in plant cultivation have been desired.
[0008] On the other hand, it has been described that the development and contents of cells and tissues are modified by artificially varying the amount of trehalose-6-phosphate in cells (Patent Documents 1 and 2), and it has been described that in order to increase the amount of trehalose-6-phosphate, the trehalose-6-phosphate synthase gene is expressed under the control of a highly expressing promoter (35S CaMV promoter). However, there is no description about improving the expression level of the trehalose-6-phosphate synthase gene by using SNPs in the promoter region of the trehalose-6-phosphate synthase gene. Also, it has not been known that trehalose-6-phosphate synthase is related to the lodging resistance of plants. [Means for Solving the Problems]
[0009] The present inventor conducted studies to solve the above problems, and as a result, obtained the knowledge that the amount of trehalose-6-phosphate is related to the lodging resistance of rice, and that by increasing this amount, for example, by increasing the expression of trehalose-6-phosphate synthase, lodging resistance can be imparted to plants. The present inventor also obtained the knowledge that there are SNPs related to the increased expression of the gene in the promoter sequence of trehalose-6-phosphate synthase. The present invention has been completed based on the above knowledge.
[0010] The present invention includes, for example, the following embodiments. [1] A method for producing a lodging-resistant plant, comprising increasing trehalose-6-phosphate in at least a part of the plant. [2] A method for removing weed plants in plant cultivation, comprising cultivating a plant in which trehalose-6-phosphate has increased in at least a part of the plant. [3]A method for cultivating rice with a high ratio of high-quality rice, which includes cultivating rice in which trehalose-6-phosphate has increased in at least a part of the rice. [4]The method according to any one of [1] to [3], wherein the increase in trehalose-6-phosphate is carried out by an increase in trehalose-6-phosphate synthase. [5]The method according to [4], wherein the increase in trehalose-6-phosphate synthase is carried out by the expression of the trehalose-6-phosphate synthase gene using a strong promoter sequence or a promoter sequence having the sequence shown in SEQ ID NO: 2, or by the introduction of the trehalose-6-phosphate synthase gene. [6]The method according to [5], wherein the trehalose-6-phosphate synthase gene contains at least one gene selected from the group consisting of OsTPS6, OsTPS1, OsTPS2, OsTPS3, OsTPS4, and OsTPS5. [7]The method according to any one of [1] to [3], wherein the increase in trehalose-6-phosphate is carried out by the application of a signal transduction precursor of trehalose-6-phosphate. [8]The method according to any one of [1] to [3], wherein the increase in trehalose-6-phosphate is carried out by the decrease or inhibition of trehalose-6-phosphate phosphatase. [9]The method according to any one of [1], [2], and [4] to [8], wherein the plant includes at least one selected from the group consisting of Gramineae plants, Leguminosae plants, Brassicaceae plants, and Solanaceae plants.
[10] The method according to any one of [1], [2], and [4] to [9], wherein the plant is rice.
[11] The method according to any one of [1] to
[10] , wherein at least a part of the plant or rice includes at least one selected from the group consisting of stems, roots, and leaves.
[0011]
[12] The plant or its plant part is characterized in that the promoter sequence of the trehalose-6-phosphate synthase gene comprises a promoter sequence having the sequence shown in SEQ ID NO: 2, or a promoter sequence having at least 90% sequence identity to the sequence shown in SEQ ID NO: 2 and having promoter activity, or a sequence in which the base G at position 883 of the sequence shown in SEQ ID NO: 1 is mutated to another base or a sequence in which the base motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1 is disrupted.
[13] The plant or its plant part according to
[12] , wherein the plant part is at least one selected from the group consisting of a plant seedling, a root, and a seed.
[14] The plant or its plant part according to
[12] or
[13] , wherein the plant comprises at least one selected from the group consisting of a gramineous plant, a leguminous plant, a cruciferous plant, and a solanaceous plant.
[15] The plant or its plant part according to any one of
[12] to
[14] , wherein the plant is rice.
[16] The plant or its plant part according to any one of
[12] to
[15] , wherein the plant has lodging resistance or the plant part has lodging resistance when it becomes a plant individual.
[0012]
[17] A method for determining or selecting a lodging-resistant plant, the method comprising the step of detecting whether the promoter sequence of the trehalose-6-phosphate synthase gene in the target plant comprises a promoter sequence having the sequence shown in SEQ ID NO: 2, or a promoter sequence having at least 90% sequence identity to the sequence shown in SEQ ID NO: 2 and having promoter activity, or a mutation of the base G at position 883 of the promoter sequence shown in SEQ ID NO: 1 to another base or a disruption of the base motif GCGG at positions 883 to 886 of the promoter sequence shown in SEQ ID NO: 1.
[18] The method according to
[17] , wherein the detection of the mutation is performed using polymerase chain reaction (PCR), hybridization, or a sequencing method.
Advantages of the Invention
[0013] According to the present invention, it becomes possible to produce a plant having lodging resistance and a plant part thereof. In particular, since the locus prl5 containing the gene involved in lodging resistance does not have a negative impact on other agricultural traits, it is a locus with high practicality for improving lodging resistance. Further, according to the present invention, it becomes possible to determine and select whether a certain plant has lodging resistance. Therefore, the present invention is useful in fields such as agriculture, plant improvement, and food production.
Brief Description of the Drawings
[0014]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Modes for Carrying Out the Invention
[0015] Hereinafter, the present invention will be described in detail. The present invention is based on the finding that trehalose-6-phosphate is involved in the lodging resistance of plants. Trehalose-6-phosphate is produced from glucose-6-phosphate by trehalose-6-phosphate synthase (TPS), and trehalose is produced from trehalose-6-phosphate by trehalose-6-phosphate phosphatase (TPP). Glucose-6-phosphate → Trehalose-6-phosphate → Trehalose TPS TPP
[0016] Accordingly, the present invention relates to a lodging-resistant plant focusing on trehalose-6-phosphate, a method for producing the same, and a method and means for determining or selecting a lodging-resistant plant.
[0017] Here, "lodging resistance" or "lodging-resistant trait", "lodging resistance" means that a plant individual has a property of being difficult to lodge, specifically, it means that the lodging property is improved as compared with the case where the present invention is not applied. Lodging resistance can be confirmed by a method known in the art, for example, by measuring the knockdown resistance value (Kashiwagi and Ishimaru, Plant Physiol vol.134, pp.676-683, 2004), etc., the lodging resistance can be measured.
[0018] 1. Method for producing a lodging-resistant plant In one aspect, the present invention relates to a method for producing a lodging-resistant plant, which includes increasing trehalose-6-phosphate in at least a part of the plant. The increase in trehalose-6-phosphate may be achieved, for example, by an increase in trehalose-6-phosphate synthase that catalyzes the production of trehalose-6-phosphate from glucose-6-phosphate, and / or by application of a signal transduction precursor of trehalose-6-phosphate, and / or by a decrease or inhibition of trehalose-6-phosphate phosphatase that catalyzes the production of trehalose from trehalose-6-phosphate.
[0019] An increase in trehalose-6-phosphate may occur in at least a part of the plant. Preferably, trehalose-6-phosphate is increased in at least one selected from the group consisting of parts where imparting lodging resistance is desired, such as stems, roots, and leaves.
[0020] In the present specification, the plant or a part thereof is intended to be the whole plant, a plant organ (e.g., leaves, petals, stems, roots, seeds, etc.), a plant tissue (e.g., epidermis, phloem, parenchyma, xylem, vascular bundle, palisade tissue, spongy tissue, etc.) or a plant cultured cell, or various forms of plant cells (e.g., suspension-cultured cells), protoplasts, leaf sections, callus, etc.
[0021] In one embodiment, the increase in trehalose-6-phosphate is achieved by an increase in trehalose-6-phosphate synthase. Trehalose-6-phosphate synthase (TPS) is known in the art, and its genes and proteins have been isolated in various plants. As trehalose-6-phosphate synthase genes, for example, OsTPS6, OsTPS1, OsTPS2, OsTPS3, OsTPS4, OsTPS5, etc. are known, and at least one gene can be utilized. In this specification, as the trehalose-6-phosphate synthase (TPS) gene, mainly the TPS6 protein (GenBank accession number AK072066.1) or TPS6 gene (SEQ ID NO: 20, GenBank accession number BAF17964.1 (genomic sequence)) derived from the Koshihikari variety is described as a reference. However, it is known in the art that homologous TPS proteins and TPS genes derived from other rice varieties and other plants (e.g., Poaceae cereals) exist. For example, wheat, Arabidopsis, soybean, sorghum, etc. (e.g., Xie et al., Journal of Genetics, Vol. 94, No. 1, pp. 55-65, Hu et al, Agronomy 10(7), 969, 2020) are known, and sequence information can be obtained from databases such as literature, GenBank, and UniProt. Such homologous proteins and homologous genes can also be used equivalently. Homologous proteins and homologous genes and their regulatory sequences (such as promoter sequences) have sequence homology with the reference protein and gene and their regulatory sequences. The "corresponding position" described in this specification refers to the position of the homologous protein or gene or regulatory sequence (promoter sequence) corresponding to a certain position of the reference protein or gene or regulatory sequence (promoter sequence), and can be easily determined according to methods known in the art.
[0022] The increase in trehalose-6-phosphate synthase can be carried out by methods known in the art and is not particularly limited. In one embodiment, it can be carried out by highly expressing the trehalose-6-phosphate synthase gene in plants. The high expression of the trehalose-6-phosphate synthase gene can be achieved, for example, by introducing the trehalose-6-phosphate synthase gene into the target plant, or by the expression of the trehalose-6-phosphate synthase gene using a strong promoter sequence or a promoter sequence having the sequence shown in SEQ ID NO: 2.
[0023] The method of introducing a gene of interest or a specific promoter into a plant can be carried out using genetic recombination methods known in the art. For example, by constructing a recombinant vector and introducing the recombinant vector into the plant, a gene of interest or a specific promoter can be introduced into the plant. Such a recombinant vector can be constructed by inserting the gene of interest or a specific promoter into an appropriate vector. As vectors for introducing the gene of interest or a specific promoter into plant cells and expressing them, pBI-based vectors, pUC-based vectors, and pTRA-based vectors are preferably used. pBI-based and pTRA-based vectors can introduce a gene of interest or a specific promoter into plants via Agrobacterium. pBI-based binary vectors or intermediate vector systems are preferably used, and examples include pBI121, pBI101, pBI101.2, pBI101.3, etc. pUC-based vectors can directly introduce a gene or a promoter into plants, and examples include pUC18, pUC19, pUC9, etc.
[0024] To insert a gene of interest or a specific promoter into a vector, methods such as first cleaving the purified DNA with an appropriate restriction enzyme and inserting it into a restriction enzyme site or multiple cloning site of an appropriate vector DNA and ligating it to the vector are employed. The gene of interest or the specific promoter needs to be incorporated into the vector so that the function of the gene is exerted. Therefore, in addition to a promoter, an enhancer, a splicing signal, a polyA addition signal, a 5'-UTR sequence, a selectable marker gene, etc. can be ligated to the vector as desired.
[0025] As the "promoter", as long as it is a DNA that can function in plant cells and direct expression in a specific tissue of the plant (especially a tissue where it is desired to impart lodging resistance, for example, the stem) or at a specific developmental stage, it may be of plant origin or not of plant origin.
[0026] In the present invention, a promoter capable of enhancing the expression of the trehalose-6-phosphate synthase gene is used. In one embodiment, a strong promoter sequence, for example, the cauliflower mosaic virus 35S promoter, the promoter derived from the Agrobacterium T-DNA opine synthase gene, the nopaline synthase (nos) promoter, the octopine synthase (ocs) promoter, the mannopine synthase (mas) promoter, the tomato ubiquitin promoter, etc. can be used to enhance the gene expression. In another embodiment, a promoter sequence having a mutation that enhances the expression of the trehalose-6-phosphate synthase gene can be used. For example, a promoter sequence having the sequence shown in SEQ ID NO: 2, or a promoter sequence having at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the sequence shown in SEQ ID NO: 2 and having promoter activity can be used. Here, the identity of the nucleotide sequence can be easily determined by a method known in the art, for example, using a known sequence program (such as BLAST provided by NIBI).Alternatively, a promoter sequence having at least one selected from the group consisting of a mutation from the base T corresponding to position 48 of SEQ ID NO: 1 (the promoter sequence of the Koshihikari or Nipponbare variety) to another base (e.g., A, C, or G, preferably C), a deletion of the bases T corresponding to positions 68 and 69 (e.g., 1, 2, or 3, preferably 2 TT), a mutation from the base G corresponding to position 86 to another base (e.g., A, T, or C, preferably A), a mutation from the base C corresponding to position 210 to another base (e.g., G, T, or A, preferably A), a mutation from the base T corresponding to position 305 to another base (e.g., G, A, or C, preferably A), a mutation from the base A corresponding to position 517 to another base (e.g., G, T, or C, preferably G), a mutation from the base C corresponding to position 696 to another base (e.g., G, T, or A, preferably A), a mutation from the base G corresponding to position 825 to another base (e.g., A, T, or C, preferably A), a mutation from the base G corresponding to position 883 to another base (e.g., A, T, or C, preferably A), and a deletion of the bases corresponding to positions 1113 and 1115 (e.g., the base GAG) can be used. The sequence comparison result between SEQ ID NO: 1 (the promoter sequence of the Koshihikari or Nipponbare variety) and SEQ ID NO: 2 (the promoter sequence of the Kasalath variety) is shown in FIG. 1. In a preferred embodiment, it is preferable to use a promoter sequence having at least a mutation from the base G corresponding to position 883 of SEQ ID NO: 1 to another base (e.g., A, T, or C, preferably A), or a promoter sequence in which the base motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1 is disrupted. In addition, as long as the promoter sequence has promoter activity, it may include a sequence in which 1 to 30, preferably 1 to 20, more preferably 1 to 10, for example, 1 to 3 bases are deleted, substituted, or added in the base sequence of SEQ ID NO: 1 or 2. Promoter activity means having the ability and function to produce the gene product of the target gene in or outside the host when the target gene is ligated in an expressible state downstream of the promoter and introduced into the host.Such DNA means that promoter activity that can be used in substantially the same manner is maintained under the same conditions as those under which a promoter consisting of a full-length base sequence having no mutation (deletion, substitution, or addition) functions. For example, it is DNA that maintains an activity about 0.01 to 100 times, preferably about 0.5 to 20 times, more preferably about 0.5 to 2 times the promoter activity of the full-length sequence.
[0027] The "terminator" may be any sequence that can terminate the transcription of a gene transcribed by the promoter. The "enhancer" is used to enhance the expression efficiency of the target gene. The "selection marker" is used to facilitate the selection of transformants, and examples include the hygromycin resistance gene, the neomycin resistance gene, and the like.
[0028] The constructed recombinant vector is introduced into a plant so that the target gene can be expressed or so that the gene can be expressed under a specific promoter. The plants targeted in the present invention can be applied to all plants such as various monocotyledonous plants, dicotyledonous plants, cereal plants, and trees. For example, monocotyledonous plants include Poaceae plants (rice, wheat, barley, oat, corn, sorghum, rye, adzuki bean, sugarcane, etc.), Orchidaceae plants including Cattleya plants, and Juncaceae plants. Note that cereal plants refer to plants mainly having starchy seeds (especially edible seeds), and include plants such as Poaceae and Fabaceae.
[0029] Moreover, examples of dicotyledonous plants include Convolvulaceae plants including Ipomoea plants (Ipomoea nil, sweet potato); Caryophyllaceae plants including Dianthus plants (carnation, etc.); Zingiberaceae plants, Actinidiaceae plants, Brassicaceae plants (Arabidopsis thaliana, cabbage, radish, wasabi, Japanese pepper, broccoli, etc.), Fabaceae plants (soybean, etc.), Cannabaceae plants, Portulacaceae plants, Apiaceae plants, Solanaceae plants (tomato, tobacco, etc.), Asteraceae plants (chrysanthemum, lettuce, burdock, butterbur, etc.).
[0030] In a preferred embodiment, the plant is a gramineous plant, particularly rice. The rice varieties (e.g., japonica rice varieties) are not limited either, and examples include Koshihikari, Hitomebore, Hinohikari, Akitakomachi, Nanatsuboshi, Haenuki, Masshigura, Kinuhikari, Asahinoyume, Yumepirika, Kinumusume, Koshibuki, Tsuyahime, Yumetsukushi, Fusakogane, Tsugaru Roman, Aichinokari, Irodokagayaki, Amanotsubu, Kirara 397, etc.
[0031] The target plant means the whole plant body, plant organs (e.g., leaves, roots, seeds, etc.), plant tissues (e.g., epidermis, sieve part, parenchyma, xylem, vascular bundle, etc.) or plant cultured cells. When targeting plant cultured cells, in order to regenerate a transformant from the obtained transformed cells, organs or individuals may be regenerated by known tissue culture methods.
[0032] Examples of methods for introducing a target gene, a specific promoter or a recombinant vector into a plant include the Agrobacterium method, the PEG-calcium phosphate method, the electroporation method, the liposome method, the particle gun method, the microinjection method, etc. For example, when using the Agrobacterium method, there are cases of using protoplasts and cases of using tissue pieces. When using protoplasts, methods include co-culturing with Agrobacterium having a Ti plasmid, fusing with spheroplasted Agrobacterium (spheroplast method). When using tissue pieces, it can be carried out by infecting sterile cultured leaf pieces of the target plant with leaf disks (leaf disk method) or infecting callus (undifferentiated cultured cells), etc.
[0033] Alternatively, random mutagenesis can be induced in plants to introduce mutations into the promoter sequence of the trehalose-6-phosphate synthase gene. Such random mutagenesis includes treatment with known mutagens (e.g., ultraviolet rays, radiation, heavy ion beams, chemical mutagens, etc.). Alternatively, genome editing can be performed in plants to introduce mutations into the promoter sequence of the trehalose-6-phosphate synthase gene. Preferably, by introducing a mutation from the base G corresponding to position 883 of SEQ ID NO: 1 to at least one other base (e.g., A, T, or C, preferably A) into the promoter sequence, or by disrupting the base motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1, it is also possible to enhance the expression of the trehalose-6-phosphate synthase gene.
[0034] Confirmation of whether the target gene or a specific promoter has been incorporated into a plant, or whether a mutation has been introduced at a specific position of the promoter, or whether the GCGG motif has been disrupted, can be carried out by methods such as the PCR method, Southern hybridization method, Northern hybridization method, etc. For example, DNA is prepared from the transformed plant, DNA-specific primers are designed, and PCR is performed. After PCR, agarose gel electrophoresis, polyacrylamide gel electrophoresis, capillary electrophoresis, etc. are carried out on the amplification product, stained with ethidium bromide, SYBR Green solution, etc., and the amplification product is detected as a single band to confirm transformation. Also, PCR can be performed using primers labeled in advance with a fluorescent dye, etc., and the amplification product can be detected. Furthermore, a method in which the amplification product is bound to a solid phase such as a microplate, and the amplification product is confirmed by fluorescence or an enzyme reaction, etc. may also be used.
[0035] Subsequently, it is confirmed whether the obtained plant has lodging resistance traits. That is, the lodging resistance of the obtained plant is measured. The measurement of lodging resistance can be carried out by methods conventional in the art. As such a method, for example, the lodging resistance can be measured by the push-down resistance value (Kashiwagi and Ishimaru, Plant Physiol vol.134, pp.676-683, 2004).
[0036] In another embodiment, the increase in trehalose-6-phosphate is effected by the application of a signal transduction precursor of trehalose-6-phosphate. As a signal transduction precursor of trehalose-6-phosphate, synthetic small molecules permeable to plants have been reported to be readily taken up by plants and induce the photoactivated release of T6P (Griffiths et al., Nature 540: 574-578, 2016). For example, 6-O-bis-(2-nitrobenzyloxyphosphoryl)-D-trehalose, 6-O-bis-(4,5-dimethoxy-2-nitrobenzyloxyphosphoryl)-D-trehalose, 6-O-bis-[1-(2-nitrophenyl)-ethoxyphosphoryl]-D-trehalose, 6-O-(4,5-dimethoxy-2-nitrobenzyloxyphosphoryl)-D-trehalose, etc. can be used to increase trehalose-6-phosphate in plants.
[0037] In yet another embodiment, the increase in trehalose-6-phosphate is effected by the decrease or inhibition of trehalose-6-phosphate phosphatase. Trehalose-6-phosphate phosphatase (TPP) is also known in the art, and its genes and proteins have been isolated in various plants. For example, rice (accession number GenBank AP008208) etc. are known. The decrease or inhibition of trehalose-6-phosphate phosphatase can be carried out by methods known in the art, such as the antisense method, RNAi technology, antibodies, etc.
[0038] The plant obtained as described above acquires the lodging resistance trait. That is, by increasing trehalose-6-phosphate in the plant, the lodging resistance trait can be imparted to the plant. Therefore, according to the present invention, it is possible to impart the lodging resistance trait to plants that were conventionally prone to lodging, such as the rice variety Koshihikari.
[0039] 2. Method for removing weed plants As described above, since a plant with increased trehalose-6-phosphate has the lodging resistance trait, weed plants can be visually distinguished from non-lodged plants (target plants), and the weed plants can be removed simply and quickly (for example, in Example 4). When plants lodge during cultivation, it becomes difficult to distinguish other varieties or weed plants that have mixed in (Figure 5), so the present invention is also useful for removing weed plants.
[0040] Therefore, in one aspect, the present invention relates to a method for removing weed plants in the cultivation of plants, which includes cultivating a plant in which trehalose-6-phosphate has increased in at least a part of the plant. A plant in which trehalose-6-phosphate has increased in at least a part of the plant can be produced as described in other parts of this specification.
[0041] Weed plants refer to plants other than the plants for the purpose of cultivation (that is, plants in which trehalose-6-phosphate has increased according to the present invention). In the present invention, since the cultivated plants are not easily lodged, the weed plants are visually distinguished and removed. As for the removal method, those skilled in the art can adopt an appropriate removal method according to the type of the target plant and the type of the plant to be removed.
[0042] 3. Method for cultivating rice with a high proportion of superior grains Rice with increased trehalose-6-phosphate produces seeds with a high proportion of top-quality rice (e.g., Example 4). Top-quality rice refers to the rice selected by a sieve with a mesh size of 2.00 mm among the sieves used for sorting brown rice (generally, the mesh size is 1.7 mm to 2.00 mm). The top-quality rice ratio refers to the ratio (weight ratio %) of the selected rice among the rice subjected to a sieve with a mesh size of 2.00 mm. A high top-quality rice ratio means that the top-quality rice ratio is at least 25%, for example, at least 28%, preferably at least 30%, more preferably at least 40% or more.
[0043] Therefore, in another aspect, the present invention relates to a method for cultivating rice with a high top-quality rice ratio, which includes cultivating rice in which trehalose-6-phosphate is increased in at least a part of the rice. The rice in which trehalose-6-phosphate is increased in at least a part of the rice can be produced as described elsewhere in this specification.
[0044] 4. Plants having a mutation in the promoter of the trehalose-6-phosphate synthase gene In one aspect, the present invention relates to a plant or a plant part thereof, characterized in that the promoter sequence of the trehalose-6-phosphate synthase gene comprises a promoter sequence having the sequence shown in SEQ ID NO: 2, or a promoter sequence having at least 90%, at least 95%, at least 98% or at least 99% sequence identity to the sequence shown in SEQ ID NO: 2 and having promoter activity. The present invention also relates to a plant or a plant part thereof comprising a promoter sequence having at least one selected from the group consisting of a mutation of the base T corresponding to position 48 of SEQ ID NO: 1 (the promoter sequence of the Koshihikari or Nipponbare variety) to another base (for example, A, C or G, preferably C), a deletion of the bases T corresponding to positions 68 and 69 (for example, 1, 2 or 3, preferably 2 TT), a mutation of the base G corresponding to position 86 to another base (for example, A, T or C, preferably A), a mutation of the base C corresponding to position 210 to another base (for example, G, T or A, preferably A), a mutation of the base T corresponding to position 305 to another base (for example, G, A or C, preferably A), a mutation of the base A corresponding to position 517 to another base (for example, G, T or C, preferably G), a mutation of the base C corresponding to position 696 to another base (for example, G, T or A, preferably A), a mutation of the base G corresponding to position 825 to another base (for example, A, T or C, preferably A), a mutation of the base G corresponding to position 883 to another base (for example, A, T or C, preferably A), and a deletion of the bases corresponding to positions 1113 and 1115 (for example, the base GAG). In a preferred embodiment, the plant or the plant part thereof comprises a promoter sequence having at least a mutation of the base G corresponding to position 883 of SEQ ID NO: 1 to another base (for example, A, T or C, preferably A), or a promoter sequence in which the base motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1 is disrupted.
[0045] As described above, since the amount of trehalose-6-phosphate increases in a plant or a plant part having a mutation in the promoter sequence of the trehalose-6-phosphate synthase gene, it has lodging resistance when it becomes an individual plant. Here, the plant is not particularly limited as long as it is a plant in which acquisition of the lodging resistance trait is desired, and examples include the plants described above. Further, the plant part is not particularly limited as long as it is a part of a plant, and examples include seedlings, plant organs (e.g., leaves, roots, seeds, etc.), plant cultured cells, and the like.
[0046] A plant or a plant part having a mutation in the promoter sequence of the trehalose-6-phosphate synthase gene can be produced as described above.
[0047] 5. Determination or selection of lodging-resistant plants Since it is considered that the amount of trehalose-6-phosphate increases in the plant having a mutation in the promoter sequence of the trehalose-6-phosphate synthase gene described above, by detecting this mutation, a lodging-resistant plant can be determined or selected.
[0048] The plants to be determined or selected in the present invention are not particularly limited, and can be applied to various plants such as monocotyledonous plants, dicotyledonous plants, and trees. For example, as monocotyledonous plants, gramineous plants (rice, wheat, barley, oat, corn, sorghum, rye, adzuki bean, sugarcane, etc.), orchid plants including Cattleya genus plants, and juncaceae plants can be exemplified.
[0049] Examples of dicotyledonous plants include Convolvulaceae plants containing sweet potato plants (Ipomoea batatas, sweet potato), Caryophyllaceae plants containing Dianthus plants (carnation, etc.), Zingiberaceae plants, Actinidiaceae plants, Brassicaceae plants (Arabidopsis thaliana, cabbage, radish, wasabi, Japanese pepper, broccoli, etc.), Fabaceae plants (soybean, etc.), Cannabaceae plants, Portulacaceae plants, Apiaceae plants, Solanaceae plants (tomato, tobacco, etc.), Asteraceae plants (chrysanthemum, lettuce, burdock, butterbur, etc.). The plants targeted by the present invention may be not only wild types of the plants exemplified above, but also mutants, transformants, genetically modified plants, and genome-edited plants.
[0050] In one aspect, the present invention relates to a method for determining or selecting a lodging-resistant plant, the method comprising detecting whether the promoter sequence of the trehalose-6-phosphate synthase gene in a target plant contains a promoter sequence having the sequence shown in SEQ ID NO: 2, or a promoter sequence having at least 90% sequence identity to the sequence shown in SEQ ID NO: 2 and having promoter activity. The present invention also relates to a method for determining or selecting a lodging-resistant plant, the method comprising detecting whether the promoter sequence of the trehalose-6-phosphate synthase gene in a target plant contains a promoter sequence having at least one selected from the group consisting of a mutation from the base T corresponding to position 48 of SEQ ID NO: 1 (promoter sequence of Koshihikari or Nipponbare variety) to another base (e.g., A, C, or G, preferably C), a deletion of the bases T corresponding to positions 68 and 69 (e.g., 1, 2, or 3, preferably 2 TT), a mutation from the base G corresponding to position 86 to another base (e.g., A, T, or C, preferably A), a mutation from the base C corresponding to position 210 to another base (e.g., G, T, or A, preferably A), a mutation from the base T corresponding to position 305 to another base (e.g., G, A, or C, preferably A), a mutation from the base A corresponding to position 517 to another base (e.g., G, T, or C, preferably G), a mutation from the base C corresponding to position 696 to another base (e.g., G, T, or A, preferably A), a mutation from the base G corresponding to position 825 to another base (e.g., A, T, or C, preferably A), a mutation from the base G corresponding to position 883 to another base (e.g., A, T, or C, preferably A), and a deletion of the bases corresponding to positions 1113 and 1115 (e.g., the base GAG). In a preferred embodiment, it is detected whether the promoter sequence of the trehalose-6-phosphate synthase gene in a target plant contains a promoter sequence having at least a mutation from the base G corresponding to position 883 of SEQ ID NO: 1 to another base (e.g., A, T, or C, preferably A), or a promoter sequence in which the base motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1 is disrupted.
[0051] In one embodiment, genomic DNA is prepared from a plant to be determined or selected. The genomic DNA can be prepared by a known method, such as the phenol / chloroform method. Further, if necessary, genomic DNA may be prepared from positive control and / or negative control plants. The source for preparing the DNA is not particularly limited, and it can be extracted from any tissue of the plant body. For example, in the case of rice, it can also be extracted from panicles, leaves, roots, seeds, polished rice, brown rice, etc.
[0052] The detection of mutations in genomic DNA can be performed by any method known in the art, and examples include, but are not limited to, methods using an amplification reaction, such as a polymerase chain reaction (PCR), hybridization methods, direct sequencing methods, and methods using restriction fragment length polymorphism (RFLP). All of these methods are well known to those skilled in the art. The outlines of representative methods are described below.
[0053] (1) Method using an amplification reaction (PCR method) In the present invention, for example, the polymerase chain reaction (PCR) can be used to simply and highly accurately detect a target mutation.
[0054] First, based on the comparison between the nucleotide sequence of the promoter of trehalose-6-phosphate synthase without mutation (for example, SEQ ID NO: 1) and the nucleotide sequence of the mutant promoter (for example, SEQ ID NO: 2) using the Koshihikari or Nipponbare variety as a reference, primers that can distinguish and amplify the two, or primers that can amplify to include the mutated part, are designed. Specifically, a primer set is designed so that a region containing a mutation in the promoter sequence (especially, the mutation of the base G corresponding to position 883 of SEQ ID NO: 1 to another base or the disruption of the base motif GCGG at positions 883 - 886 of the sequence shown in SEQ ID NO: 1) is amplified. The primer set can be designed based on the genomic sequences of trehalose-6-phosphate synthase and the mutant promoter (SEQ ID NO: 2), or based on the genomic sequences of trehalose-6-phosphate synthase and the promoter without mutation using the Koshihikari or Nipponbare variety as a reference (SEQ ID NO: 1). SEQ ID NOs: 1 and 2 show the genomic sequences of the peripheral region containing the promoter of the trehalose-6-phosphate synthase gene.
[0055] The method for designing primers is well-known in the art, and the primers that can be used in the present invention are designed to satisfy the conditions for specific annealing, for example, having a length and base composition (melting temperature) that allow specific annealing. For example, as the length having the function as a primer, 10 bases or more are preferable, more preferably 15 - 50 bases, and even more preferably 15 - 30 bases. Also, when designing, it is preferable to confirm the GC content of the primer and the melting temperature (Tm) of the primer. Tm means the temperature at which 50% of any nucleic acid strand forms a hybrid with its complementary strand. In order for the DNA serving as a template and the primer to form a double strand and anneal, it is necessary to optimize the annealing temperature. On the other hand, if this temperature is lowered too much, a non-specific reaction will occur, so it is desirable that the temperature be as high as possible. For the confirmation of Tm, known primer design software can be used. The designed primers can be chemically synthesized by known oligonucleotide synthesis methods, but usually, they are synthesized using a commercially available chemical synthesis apparatus.
[0056] In a specific embodiment, examples of primer sets that can be used in the present invention include, but are not limited to, a primer set containing a primer having the nucleotide sequence of CTGGGCAGAAGCTACTTTACTC (SEQ ID NO: 3) and a primer having the nucleotide sequence of CAGCGCCTCGAAGTTCCC (SEQ ID NO: 4). These primer sets can amplify the region containing the target mutation.
[0057] When the thus-designed primer set is used, the nucleotide sequences of the amplification product obtained using the DNA containing the mutation as a template and the amplification product obtained using other DNA as a template are different. Therefore, from the difference in the sequences of the amplification products obtained by the amplification reaction using the primer set, it is possible to determine whether the target plant has a mutation involved in lodging resistance in the promoter sequence of the trehalose-6-phosphate synthase gene.
[0058] The amplification reaction is not particularly limited, and examples thereof include known methods utilizing the principle of the polymerase chain reaction (PCR) method. Amplification is carried out until the amplification product reaches a detectable level. Those skilled in the art can easily determine the optimal conditions for PCR.
[0059] As described above, a nucleic acid fragment containing the target mutation can be specifically amplified using the genomic DNA derived from the target plant as a template.
[0060] To detect whether a specific amplification reaction has occurred after the above amplification reaction, known means capable of specifically recognizing the amplification product obtained by the amplification reaction can be used. For example, by using agarose gel electrophoresis or the like to confirm whether an amplification fragment of a specific size has been amplified, a specific amplification reaction can be detected. The size of the amplification product can be estimated based on the nucleotide sequence between the designed primers. Alternatively, by determining the nucleotide sequence of the obtained amplification fragment, it is possible to determine whether the sequence containing the target mutation has been amplified.
[0061] Alternatively, the presence or absence of amplification of the nucleic acid fragment is detected based on a label labeled on a primer or a substrate. For example, a label such as a radioisotope, a fluorescent substance, or a luminescent substance is allowed to act on dNTP incorporated during the amplification reaction, and this label can be detected. As the radioisotope, 32 P, 125 I, 35 S, etc. can be used. As the fluorescent substance, for example, fluorescein (FITC), sulforhodamine (TR), tetramethylrhodamine (TRITC), etc. can be used. As the luminescent substance, luciferin, etc. can be used. There are no particular restrictions on the type of these labels and the method of introducing the labels, and various conventionally known means can be used. For example, as a method of introducing a label, a random primer method using a radioisotope can be mentioned.
[0062] As a method of observing the amplification product incorporating the labeled dNTP, any method may be used as long as it is a method known in the art for detecting the above-described label. For example, when a radioisotope is used as the label, the radioactivity can be measured by, for example, a liquid scintillation counter, a γ-counter, etc. When fluorescence is used as the label, the fluorescence can be detected using a fluorescence microscope, a fluorescence plate reader, etc.
[0063] Thereby, it is possible to determine and select whether the target plant has a mutation in the promoter sequence of the trehalose-6-phosphate synthase gene (particularly, a mutation from the base G corresponding to position 883 of SEQ ID NO: 1 to another base, or the disruption of the base motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1), that is, whether the plant has lodging resistance.
[0064] (2) Hybridization method The target mutation can also be detected using a hybridization method. The hybridization method is a method for determining whether a target plant-derived genomic DNA has a mutation based on the ability of the genomic DNA to hybridize with a complementary DNA molecule (e.g., an oligonucleotide probe). This hybridization method can be performed using various techniques for hybridization and detection.
[0065] First, based on the comparison between the nucleotide sequence of the promoter of trehalose-6-phosphate synthase without mutation and the nucleotide sequence of the mutant promoter using Koshihikari or Nipponbare varieties as a reference, a probe that can distinguish between the two and hybridize can be designed. For example, the probe can be designed to span the target mutated region. For example, the probe can be designed to hybridize to the promoter sequence without mutation but not to the promoter sequence containing the mutation. By the presence or absence of hybridization using such a probe, it can be detected whether the genomic DNA of the target plant contains the target mutation.
[0066] The method for designing the probe is well-known in the art, and the probe usable in the present invention is designed to satisfy the conditions for specific hybridization, for example, having a length and nucleotide composition (melting temperature) that allow specific hybridization. The length of the probe is preferably 10 nucleotides or more, more preferably 20 - 50 nucleotides, and even more preferably 20 - 30 nucleotides.
[0067] In this method, a hybridization reaction with the genomic DNA derived from the target plant is performed using the probe, and the presence of the target mutation is detected by detecting the specific binding (hybrid). The hybridization reaction needs to be performed under stringent conditions. Such stringent conditions are well-known in the art and are not particularly limited.
[0068] When performing hybridization in this method, appropriate labels such as fluorescent labels (e.g., fluorescein, rhodamine), radioactive labels ( 32 P, etc.), enzyme labels (e.g., alkaline phosphatase, horseradish peroxidase), biotin labels, etc. can be added to the probe.
[0069] Detection using the labeled probe involves contacting the genomic DNA derived from the target plant with the probe so that they can hybridize. Specifically, for example, the genomic DNA derived from the target plant is digested with a restriction enzyme as appropriate if necessary, immobilized on a suitable carrier such as a slide glass, membrane, microtiter plate, etc., and the labeled probe is added to contact the probe with the genomic DNA to perform a hybridization reaction. After removing the unhybridized probe, the label of the probe hybridized with the genomic DNA is detected. If the label is detected, it means that the target plant has the target mutation.
[0070] Alternatively, hybridization can also be detected using a DNA chip. In this method, the probe is attached to a solid support. The genomic DNA derived from the target plant is contacted with the DNA chip, and hybridization is detected.
[0071] (3) Direct sequencing method Mutations in the promoter sequence of the trehalose-6-phosphate synthase gene can be detected by direct sequencing using genomic DNA. In direct sequencing, first, genomic DNA is prepared from the target plant, the region containing the mutation to be detected is cloned into a vector, and amplified in a host cell (e.g., bacteria). Alternatively, it is also possible to amplify the DNA within the region containing the mutation to be detected by PCR. After amplification, the DNA within the detection target region is sequenced. Examples of sequencing methods include, but are not limited to, manual sequencing or automated sequencing. Examples of automated sequencing methods include methods using a dideoxy terminator, next-generation sequencing (NGS), etc. Based on the sequencing results, it is determined whether the target plant has the target mutation.
[0072] By the above method, it becomes possible to detect whether the target plant has a mutation in the promoter sequence of the trehalose-6-phosphate synthase gene, and from the results, determine and select whether the target plant has a lodging-resistant trait. Since the method of the present invention utilizes genetic techniques, it is possible to simply and highly accurately determine and select lodging-resistant plants.
[0073] 6. Kit The method for determining or selecting the lodging-resistant plants described above can be carried out more simply by using a kit. This kit includes means capable of detecting mutations in the promoter region of the trehalose-6-phosphate synthase gene as described above, specifically, at least primers or probes.
[0074] In one embodiment, the present invention relates to a kit for determining or selecting lodging-resistant plants, characterized by including a primer set including a primer having the nucleotide sequence shown in SEQ ID NO: 3 and a primer having the nucleotide sequence shown in SEQ ID NO: 4.
[0075] In addition, when the kit contains primers, it may further contain a buffer, a dNTP mixture, enzymes (such as reverse transcriptase, RNaseH), a calibration standard sample, etc. that constitute the reaction solution. Also, when the kit contains probes, it may further contain a hybridization buffer, a washing buffer, a microplate, a nylon membrane, etc.
Example
[0076] Hereinafter, the present invention will be described more specifically based on examples, but the present invention is not limited to these examples.
[0077] [Example 1] Isolation of the Causal Gene OsTPS6 That Enhances the Support Force of Plants In a previous report (Kashiwagi and Ishimaru, Plant Physiol vol.134, pp.676-683, 2004), a QTL (prl5) that enhances the support force of plants was identified. Also, a method for evaluating the phenotype (the support force of the lower part of the plant body) based on the knockdown resistance value of the lower part was reported by removing the plant body above 40 cm from the ground pole. In this example, an attempt was made to isolate the causal gene involved in the support force of plants based on the genotype and phenotype.
[0078] A chromosome segment substitution line group (CSSL) in which a part of the chromosome of the Japanese rice cultivar Koshihikari was replaced with that of the Indian rice cultivar Kasalath was used to further analyze the region (pr15) of the identified QTL. Specifically, Koshihikari was crossed with CSSL to produce BC1F1.
[0079] Subsequently, DNA markers were set at both ends of the region where the causal gene was considered to exist, and individuals in which recombination occurred within the region were selected from 2,000 individuals of the self-progeny BC1F2 of BC1F1. Specifically, the first leaf under the flag leaf of the cultivated rice was sampled at 10:30 am, cooled with liquid nitrogen, stored in an -80°C freezer, and then 100 mg of the leaf was ground in a mortar using liquid nitrogen, and DNA was extracted using the Qiagen DNeasy Plant Mini Kit. Subsequently, positional cloning was performed using the primers shown in Table 1. For SSR1896, PCR was performed for 30 cycles at 95°C for 1 minute, 60°C for 1 minute, and 72°C for 1 minute using TAKARA EX TAQ (Takara Bio Inc.), and for PRL1441, PCR was performed for 30 cycles at 95°C for 1 minute, 68°C for 1 minute, and 72°C for 1 minute using TAKARA EX TAQ (Takara Bio Inc.).
[0080]
Table 1
[0081] Next, six lines of BC1F2 in which recombination occurred within the region were self-propagated to produce their progeny BC1F3. From among these BC1F3, individuals homozygous for the region derived from Kasalath were selected for each line and self-propagated to obtain seeds of the progeny.
[0082] BC1F4 (20 individuals per line) was cultivated in the field of the Institute of Agricultural Environment Technology (currently, the Department of Agricultural Environment Research, NARO, Kannon-dai, Tsukuba City, hereinafter also referred to as "IAET"). The region where the causal gene exists was narrowed down to 137 kb based on its genotyping and phenotype (upper part of Figure 2). The phenotype was measured according to the previously reported evaluation method (Kashiwagi and Ishimaru, Plant Physiol vol.134, pp.676-683, 2004), and the region where the prl5 causal gene exists was narrowed down from the measured values and the genotyping results using DNA markers.
[0083] The analysis was repeated using a similar method, and the region was narrowed down to 12.1 kb. Candidate genes were narrowed down to Os05g0517200 (OsTPS6) from the annotation data of the rice genome.
[0084] Next, genomic DNA was extracted from the leaf tissue of BC1F4 at the second week after transplantation in the same manner as above, the sequence of OsTPS6 was determined, and the nucleotide sequences of the ORFs of Koshihikari and Kasalath were compared. The primers used for sequencing were the forward primer Os05g0517200_Fw (CTGGGCAGAAGCTACTTTACTC: SEQ ID NO: 3) and the reverse primer Os05g0517200_Rv (CAGCGCCTCGAAGTTCCC: SEQ ID NO: 4), which produced an amplification product of 1160 bp.
[0085] As a result, as shown in Table 2, there were 5 SNPs in Kasalath, but there were no amino acid substitutions.
[0086]
Table 2
[0087] Near-isogenic lines NILs with the genetic background of Koshihikari into which the TPS6 locus derived from Kasalath was introduced were selected by the above method. The second leaf counted from the flag leaf of Koshihikari and NILs cultivated in the paddy field of NARO was sampled using liquid nitrogen after heading and stored in a freezer set at -80°C. The methods of RNA extraction and real-time PCR were carried out according to the previous report (Ishimaru et al., Nature Genet vol.45, pp.707-713, 2013). Specifically, leaves (100 mg) were collected from Koshihikari and NILprl5, and total RNA was extracted using the Plant RNeasy kit of Qiagen according to its protocol. Next, using the total RNA as a template, cDNA was obtained by a reaction using AMV reverse transcriptase of Wako. Using the obtained cDNA as a template, the expression levels of genes such as OsTPS6 were compared by real-time PCR using the primers shown in the following table. Plants at 60 days after transplantation were used for both.
[0088]
Table 3
[0089] The results are shown in Figure 3. From the results in Figure 3, it was found that OsTPS6 among the RNAs in the TPS6 locus was significantly highly expressed in NIL, and the expression level was about 3.8 times higher in NILprl5 than in Koshihikari.
[0090] [Example 2] Demonstration experiment with OsTPS6 recombinant In this example, a recombinant that highly expresses OsTPS6, which was considered as the causative gene in Example 1, under the control of a strong 35S promoter was created.
[0091] Specifically, the cDNA of Nipponbare OsTPS6 (accession number AK072066) was inserted between the promoter of cauliflower 35S protein and the nos terminator into pSTAH301G (containing the hygromycin resistance gene) using XgaI and SacI to construct a vector.
[0092] The constructed vector was introduced into Nipponbare by the Agrobacterium method, and recombinants (T0) were selected using hygromycin. In addition, for the recombinants (T0), the introduction of OsTPS6 was confirmed using OsTPS6 cDNA-specific primers (SEQ ID NOs: 3 and 4).
[0093] Subsequently, self-propagated progeny (T1) were selected, and PCR confirmation was performed for 10 individuals of each line of the recombinants (T3). Three lines that could be discriminated as homozygous for the OsTPS6 gene and a line in which the introduced gene could not be confirmed (null; control) were selected.
[0094] Six individuals each of Nipponbare, null, and three lines of recombinants were cultivated in an isolated greenhouse and used for analysis. After measuring the samples (-2 leaves) at the second week after heading using a chlorophyll meter (SPAD: KONIKA-MINOLTA 501), the samples were sampled, and the expression level of OsTPS6 was measured by the method described in Example 1. In addition, the lodging resistance value was measured according to a previously reported method (Kashiwagi and Ishimaru, Plant Physiol vol.134, pp.676-683, 2004) at the fourth week after heading.
[0095] The results are shown in Figure 4. A in Figure 4 shows the OsTPS6 expression level in each individual, B shows the SPAD (-2 leaves, chlorophyll in the lower leaves), and C shows the lodging resistance value. 1 is Nipponbare, 2 is null, and 3-5 are recombinants, all of which are the averages of three units (n = 3). As a result of highly expressing OsTPS6 cDNA under the 35S promoter, except for the lodging resistance value of individual 4, the recombinants had significantly higher OsTPS6 expression levels, SPAD of -2 leaves, and lodging resistance values compared to Koshihikari (p < 0.01). Therefore, it was suggested that the increase in the expression of OsTPS6 suppressed the senescence of the lower leaves and increased the supporting force of the plants.
[0096] [Example 3] Examination of the promoter sequence of OsTPS6 In this example, the promoter region of the OsTPS6 gene was identified. Specifically, a 1 kb sequence upstream of the start codon was sequenced and compared with the sequence between Kasalath and Koshihikari. Nine SNPs were found between Kasalath and Koshihikari.
[0097] Among them, due to the -188 (G / A) SNP, the GCGG motif was disrupted in the Kasalath type. It has been reported (Non-Patent Document 1) that under sd1, an excessive amount of DELLA protein (a gibberellin signal promoter) binds to the GCGG motif (-148 bp), thereby reducing the expression level of OsTPS6.
[0098] To examine the relationship between the GCGG motif and the expression level of the OsTPS6 gene, the expression levels of OsTPS6 in multiple NIL individuals were investigated. First, NILprl5 (with the GCGG motif disrupted) and NILsd1 (accumulating excessive DELLA protein) were crossed to produce the self-progeny F2 of the obtained F1. From the genotyping results of 200 individuals of this F2, lines with the prl5 and sd1 loci of the Kasalath type or the Dwarf Wulong type were selected to obtain seeds of the progeny. The seedlings obtained by sowing the progeny seeds were sampled 1 month after transplantation, and the OsTPS6 expression level was measured in the same manner as in Example 1. The results are shown in Table 4.
[0099]
Table 4
[0100] NILprl5 (GCGG motif disrupted) and NILprl5sd1 (GCGG motif disrupted and overexpression of DELLA protein) had increased expression levels of OsTPS6 compared to NILsd1 (overaccumulation of DELLA protein). From these results, it was identified that -188 (G / A) of the promoter sequence of OsTPS6 is the FNP. That is, under sd1, excessive DELLA protein binds to the GCGG motif, thereby decreasing the expression level of OsTPS6 (Non-Patent Document 1). In contrast, under the promoter sequence with FNP, DELLA protein cannot bind to the GCGG motif, and it was suggested that the expression level of OsTPS6 increases because the decrease in the expression level of OsTPS6 does not occur. Therefore, when based on the promoter sequence without mutation (SEQ ID NO: 1), a mutation from the base G at position 883 (the base corresponding to 883) to another base (for example, base A), and disruption of the motif GCGG at positions 883 to 886 may contribute to the increase in the expression level of OsTPS6.
[0101] [Example 4] Examination of the characteristics of individuals (NILprl5) with increased OsTPS6 expression In this example, the characteristics of individuals (NILprl5) with increased OsTPS6 expression were examined.
[0102] (1) Lodging resistance Regarding individuals (NILprl5) with increased OsTPS6 expression and the control Koshihikari, a photograph taken on the day after Typhoon No. 9 hit on August 23, 2016 (maximum wind speed 26.9 m / s) is shown in Fig. 5. It can be seen that NILprl5 (the back of the photograph in Fig. 5) has lodging resistance and does not fall even when hit by the typhoon, unlike Koshihikari (in the foreground).
[0103] (2) Yield characteristics and ratio of high-quality rice The control Koshihikari and NIL were cultivated under the methods and schedules of neighboring farmers (row spacing 30 cm, plant spacing 18 cm, machine planting). After harvesting the rice, the ratio of high-quality rice was determined using a sieve for brown rice. The results are shown in Table 5.
[0104]
Table 5
[0105] From Table 5, it can be seen that the yield characteristics of NIL are equivalent to those of Koshihikari. Also, it can be seen that the ratio of superior grains at a brown rice sieve size of 2.0 or more is higher than that of Koshihikari. As a recent trend, there is a tendency to select rice with good grain uniformity (large grains). Therefore, NIL has the advantage of having excellent characteristics with a high ratio of superior grains.
[0106] (3) Possibility of identifying and removing weedy rice In recent years, the problem of rice growing wild in the field being mixed with cultivated varieties and the damage caused by its colored seeds (red rice) being mixed into the harvested brown rice has become a major issue. This wild-growing and mixed-in rice is called "weedy rice" and is proliferating in various regions around the world, causing significant damage to rice cultivation. In normal rice cultivation, herbicides are used for weed control. However, since herbicides are very safe for rice, it is extremely difficult to control weedy rice, which is of the same plant species as rice, with rice herbicides.
[0107] Figure 6 shows the results of a cultivation test conducted at the farm of the University of Miyazaki in Miyazaki Prefecture for individuals with increased OsTPS6 expression level (NILprl5) and the control Koshihikari. The left side of the photo in Figure 6 is Koshihikari, and the right side is NILprl5. The Koshihikari on the left side of Figure 6 has lodged, and it is not clear if there is any mixing of weedy rice. However, since the NILprl5 on the right side does not lodge, it was found that weedy rice can be identified and removed as indicated by the arrow.
[0108] [Sequence Listing] SEQUENCE LISTING <110> National Agriculture and Food Research Organization <120> Method of producing lodging resistant plants <130> P25-0062 <160> 20 <170> PatentIn version 3.5 <210> 1 <211> 1071 <212> DNA <213> Oryza sativa var. Koshihikari <400> 1 ttctttcttc cacttttcca acttctactc cattatttgt cgaactgtta aacgatgtgt 60 ttttttttta caaaaatctt ctatagaaaa gttgctttta aaatcatatt acttttaagt 120 ttttattaat taataatact taattgatca catattaatg ggcaacgctg ttttccatgc 180 ccggagagag gttctcgaac acaacctaac tagggcttaa atccatacca cttaataata 240 ttctgcgata attttttgct tgtgttaata cttgaaattc gaaccaattc atcgcattcc 300 aaaatttcga atcgcaatgg atacgcttaa caacatatga cgtggcaccc accgctaccg 360 gacacgtgtt tcacgccctg caaaagcgcc cctcgttttg ctgctgttgt ttggcgttcg 420 ttcgttcacc cgggggaaga aagaagaaaa ggacgaccca gacctctcat aaaccgccgg 480 gcaattcaat tcaaagcctc tcgtgaggaa tttcccaaaa tacccctccc cccactgtag 540 gtatggatgg gttgctcggt ccacctcgtc cgtccatcgc gtgggcccca ccccgaccga 600 acgctatccc gtacgtccat ccggtgggcc ccgcggtgtc aggtggcagc gtgacgccag 660 ctggcaccgg ggtgtggggg cgccccccct cccccctccc cactacctta tcctcttttc 720 ccgatgcagc atcacctccc taggcccggt ccacggtgga cccagcggct caccggcatg 780 cggggccccg cactgtcggt gggtctacgg ggggaggcgc cgtggaccgg gtccacccgc 840 cccgagggag aggaatatac cgcgtgtgtg cgcgtgtgtt gtgcgggctc gtcttcctcg 900 ccgctcgctc gctcgcctcc tccatttttt ttttcttctc ttcttcttac gaactcgaaa 960 cgcgaaaaag ggagtagatc agatcaaaga cgcggaggag gaggaggagg aggagagcta 1020 gggtttggat cgggagagag ggctagggtt tcagccatga tgtcgaggtc g 1071 <210> 2 <211> 1066 <212> DNA <213> Oryza sativa var. Kasalath <400> 2 ttctttcttc cacttttcca acttctactc cattatttgt cgaactgcta aacgatgtgt 60 tttttttaca aaaatcttct ataaaaaagt tgcttttaaa atcatattac ttttaagttt 120 ttattaatta ataatactta attgatcaca tattaatggg caacgctgtt ttccatgccc 180 ggagagaggt tctcgaacac aacctaaata gggcttaaat ccataccact taataatatt 240 ctgcgataat tttttgcttg tgttaatact tgaaattcga accaattcat cgcattccaa 300 aaattcgaat cgcaatggat acgcttaaca acatatgacg tggcacccac cgctaccgga 360 cacgtgtttc acgccctgca aaagcgcccc tcgttttgct gctgttgttt ggcgttcgtt 420 cgttcacccg ggggaagaaa gaagaaaagg acgacccaga cctctcataa accgccgggc 480 aattcaattc aaagcctctc gtgaggaatt tcccgaaata cccctccccc cactgtaggt 540 atggatgggt tgctcggtcc acctcgtccg tccatcgcgt gggccccacc ccgaccgaac 600 gctatcccgt acgtccatcc ggtgggcccc gcggtgtcag gtggcagcgt gacgccagct 660 ggcaccgggg tgtgggggcg ccccccctcc cccatcccca ctaccttatc ctcttttccc 720 gatgcagcat cacctcccta ggcccggtcc acggtggacc cagcggctca ccggcatgcg 780 gggccccgca ctgtcggtgg gtctacgggg ggaggcgccg tgaaccgggt ccacccgccc 840 cgagggagag gaatataccg cgtgtgtgcg cgtgtgttgt acgggctcgt cttcctcgcc 900 gctcgctcgc tcgcctcctc catttttttt ttcttctctt cttcttacga actcgaaacg 960 cgaaaaaggg agtagatcag atcaaagacg cggaggagga ggaggaggag agctagggtt 1020 tggatcggga gagagggcta gggtttcagc catgatgtcg aggtcg 1066 <210> 3 <211> 22 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 3 ctgggcagaa gctactttac tc 22 <210> 4 <211> 18 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 4 cagcgcctcg aagttccc 18 <210> 5 <211> 27 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 5 cattgattta gaatctcctt ttccgct 27 <210> 6 <211> 27 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 6 cattgattta gaatctcctt ttccgcg 27 <210> 7 <211> 20 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 7 acgtggggta tcttcgttca 20 <210> 8 <211> 20 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 8 gaggtcacgg tcgccgccga 20 <210> 9 <211> 20 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 9 cttcttgtcg tctccccaag 20 <210> 10 <211> 28 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 10 aaggatgact tgagcaaaaa gcttatct 28 <210> 11 <211> 23 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 11 tacaaaatct gccagttgcc cct 23 <210> 12 <211> 24 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 12 ggaagccgat cagttgaagt tcgg 24 <210> 13 <211> 23 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 13 acgatcaatt gcagcaccct ttg 23 <210> 14 <211> 22 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 14 tctcttccaa cctgcacacg ac 22 <210> 15 <211> 23 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 15 tgcaagaggg acttggtaac ctc 23 <210> 16 <211> 22 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 16 attgccttcc tcgcttcgca tc 22 <210> 17 <211> 22 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 17 gtcacaacca acacccaatg cc 22 <210> 18 <211> 22 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 18 gtctgcgata atggaactgg ta 22 <210> 19 <211> 19 <212> DNA <213> Artificial <220> <223> synthetic primer <400> 19 cagggcgatg taggaaagc 19 <210> 20 <211> 4806 <212> DNA <213> Oryza sativa <400> 20 gggctcgtct tcctcgccgc tcgctcgctc gcctcctcca tttttttttt cttctcttct 60 tcttacgaac tcgaaacgcg aaaaagggag tagatcagat caaagacgcg gaggaggagg 120 aggaggagga gagctagggt ttggatcggg agagagggct agggtttcag ccatgatgtc 180 gaggtcgtac acgaacctgc tggacctcgc ggcggggaac ttcgaggcgc tggggccggc 240 ggggggaggg aggaggaggt cgttcggggc gaagcggatg acgcgggtga tgacggtgcc 300 cgggacgctg tcggagctgg acgacgagga cgacgagccg gcggcgacga gcagcgtcgc 360 ctccgacgtg ccctcgtcgg cggcgtgcga gcgcctcatc gtcgtggcga accagctccc 420 cgtggtggcg cggcggaggc cgggcgccgc ggcggggggg tgggcgttct cgtgggacga 480 cgactcgctc ctcctccgcc tccgcgacgg cgtccccgac gagatggagg tgctcttcat 540 cggcacgctc cgcgccgacg tgcccgcctg cgagcaggac gaggtgtcgc agagcctcat 600 cgatggattc ggatgcgcac ccgtgttcct ccccgcgggg ctctacgacc gattctacca 660 gcacttctgc aagggttacc tatggccgct gttccactac atgctcccct tcgcctccgc 720 cttgccggcg gccgcatccg gcgatggccg gtttgaccgc ggcgcgtggg aggcctacgt 780 gctcgccaac aaatacttct tcgagaaggt ggtcgaggtc atcaacccgg aggacgacta 840 cgtttgggtc cacgattacc acctcatggc gctgcccacc ttcctccgcc gccgcttcaa 900 tcgcctccgc atcgggttct tcctccacag cccctttccc tcatcggaga tctaccgctc 960 gctgcccgtc cgagaggaga tcctaagaac gctgcttaat tgcgatctca ttggattcca 1020 cacattcgat tatgcgaggc acttcctatc ttgctgtagt aggatgctgg ggatagagta 1080 ccagtcaaag cgtggataca ttggattgga ttactttggc cgcactgttg gaatcaagat 1140 catgccagtg ggaatccata tgggtcaatt gcaatcagtg ttgcgattgt ccgagaaaga 1200 aaagaaggtt gctgagctgc ggcagcaatt cgagggcaag tccgtgttac ttggtgtgga 1260 tgatatggat atcttcaagg gaatcaactt aaaacttctt gcgtttgaga atatgctgag 1320 gacgcatccc aagtggaagg gaagagctgt gttggtgcag attgcaaacc cagcacgagg 1380 gaagggaaag gatctggagg ctgtccaggc tgagattcgg gagagttgtg atagaattaa 1440 caaggagttt ggccagtcag gttacagtcc agtgattttc attgaccaga gcgtgccaag 1500 tgcggtgagg cttgcatatt atacggttgc tgagtgtgtt gtggtgacgg ctgtgaggga 1560 tgggatgaat ttgaccccat atgaatacat tgtctgccgg gaggggatac ctggctctga 1620 gtgtgcacca gaggtgagtg gaccaaagaa gagcatgttg gttgtgtcgg agtttattgg 1680 ttgctcacct tcactgagtg gagccattcg tgttaacccg tggaatatcg aggcaactgc 1740 agaggcactg aatgaggcca tctcaatgtc agagcgtgaa aagcagctga ggcacgaaaa 1800 acattaccgt tatgtcagca cccatgatgt tgcatattgg tctaagagct ttgtacagga 1860 cctggagagg gcttgcaagg atcactttag gaaaccatgc tggggcattg gattgggatt 1920 tggcttcagg gtggtagccc tagacccaca tttcacaaag cttaatttcg attcaattat 1980 aatgtcctat gagagatcaa agagtagggc tatatttctc gactatgatg gcacattggt 2040 gccacaggct tcgctcaaca agaatccaag tgaagaatta ctgaggatca ttaataccct 2100 atgcgcagat agaaataaca ccgtgttcat tgtcagcggg agaagcaagg atgacttgag 2160 caaaaagctt atctcatgtc caaagctagg cattgccgca gagcatggct acttcttaag 2220 gtacaattcc ttaaccgtag tcagctttct tttcattgcc agtacaatct gcactttttt 2280 cctaaaatag aatctgcact ttaccatata tactagaaag tcttgcatta tgcactagca 2340 taaagcgtgc cacatgcacc ttttcaaaat acgattctga gctaataaca atttatgtta 2400 tcagaatgga gggcatttta tctttagaac ttgcgtagca gatcctgatc ttacttttat 2460 gtaaaagtcc atggcatcag caaatattta taggtgcttc ttaactgtta atttgggctt 2520 gtgtttttat tactccctct gtcccaaaat atagcaacct agtactccct ctgtcccaaa 2580 atataacaac ttttaactct caggatttgt cctgaaatat aacaacttct acaccaacat 2640 tctcttccta accaatcaca accctccacc attcactttt cccacctacc tccattactc 2700 atccaatcac aaccctccat cattcacttc tacctacttt cttaataacc gtgtccaact 2760 ctaaaacttc ttatattctg ggatggaggg agtactagat tagacacaac ctagtagagt 2820 ttagattcct actataggtt gtgtttaatt tagtacttgg ttgctaaatt ttgggacagg 2880 gagtagccaa ggacattgat gataagtgaa gtcccatctg attccctctt gaaattacga 2940 aaaaaacgga tgatggaatg atttctttca atatgtaggt ggactagaga tgaagaatgg 3000 caaaccactg cacagacctc agattttgga tggatgcaaa tggcgaagcc agtgatggat 3060 ctttatactg aatcaactga cggatccacc attgagacta aagaaactgc actggtgtgg 3120 caccatcagg atgctgacca aggttttggc tcttcccagg caaaggaaat gcttgatcac 3180 ttggaaagtg tattagcaaa tgaaccagtc tcagtcaaga gtggccaatt cattgttgaa 3240 gtcaaacctc aggtacatta tcttgatctc ttacattcct ttcacaagta cattgttatt 3300 ctgatcatga aaccacatat ttttgtgcct tttgtggaga acagtttctg taccaaataa 3360 cctgactatt taattctcat ttatatgatg ctcctcgaga tccagctaat tcttttgcat 3420 caatcgtaca aaccgttttt tttttccatt acggtataga gctacagggt gatcatgatg 3480 gatgcagata tgttggcttc acattttctt taccctgttg ttatgccttt tcaatttcag 3540 ttcaccttgc attctggtgt agacttattg ttggacaaaa tgcaagatat ctgatatcat 3600 aactaaaaca atgctgtttt atattgtctc catgtttaaa acagaatttg tgaattgcaa 3660 tggaacactt cctatgttgg cctttatggt ttaatgctat acatgtcact taacagttta 3720 acttcacctg ctccaggctt ttcatttgta atatatgcat tggtgtgcat tcctcattta 3780 ttccttcaaa ctcctttgtg ctgcagggtg ttaccaaagg gctcatagct gagaaagtac 3840 tcacatcaat gaaggagaag gggcaactgg cagattttgt attatgcatt ggtgatgaca 3900 ggtcagatga ggatatgttt gaaaatattg ccgatgtcat gaaaaggagc attgttgcac 3960 caaaaactcc actgtttgca tgtactgtgg gccagaagcc aagcaaagct aggttttacc 4020 tggatgatac atttgaagtc gtcaccatgt tgagttcact ggcggatgct tcagaaccag 4080 accttatggc agacttggaa gatgacttgg ccacatcagt ctcatcaata gaaataagtg 4140 acagagtggt atcttttagt aatttaagga cagaaggatc ttagtctggt gtttctgcgt 4200 tgcttttctc gccgaaaaag ttctgttgga actgagtgag ggagtgttaa gcaagatgaa 4260 acactgcaag attaaagatg ctacagggca aggaagtcga attcttgggt tcatgattca 4320 ttttggtgaa gatgagggta agggattaaa acatgtagct gcaaatattc tgaagtccgg 4380 aaagagatta cagtttgagt agctcccaaa tagcctcatt atgcgttttg ttacggcggc 4440 atttactacc agtcgctgct acgaagattc ttatgttcat agctgacctg ccatgttctt 4500 tccatttgaa tacttatccc aaggctaagt aggaagcatc ggcgtggcag aagtgcatcg 4560 gtgcaatatg ggggaatatg agggtaaatc ttgtgacagg ttaactgcag cttgtgattt 4620 cttgcttgtt aacctggtta acagaaatcg tctagtaggg aaaaaactag tgatgctttt 4680 cgtttacttg taatgttgtg gcaatgtgga ggatgacatt tgattcattg tttgacagca 4740 ttatctgtat catccttata tgtagctaat ttatattgag ttctttacaa ttaatcacca 4800 cttgct 4806
Sequence Listing Free-Text
[0109] SEQ ID NOs: 3 to 19: Artificial, synthetic primers
Claims
1. A genetically modified grass family plant or a plant part thereof, characterized in that a mutation has been introduced into the promoter sequence of the trehalose-6-phosphate synthase gene so as to include, in a homozygous form, a promoter sequence having the following: (i) a promoter sequence having the sequence shown in SEQ ID NO: 2; or (ii) a promoter sequence having at least 90% sequence identity to the sequence shown in SEQ ID NO: 2 and having promoter activity, wherein the promoter sequence has a sequence in which the base G at position 883 of the sequence shown in SEQ ID NO: 1 has been mutated to another base, or a sequence in which the base motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1 has been disrupted; or (iii) a promoter sequence having a sequence in which the base G at position 883 of the sequence shown in SEQ ID NO: 1 has been mutated to another base, or a sequence in which the base motif GCGG at positions 883 to 886 of the sequence shown in SEQ ID NO: 1 has been disrupted (however, the grass family plant is not a Kasalath variety).
2. 2. The genetically modified grass plant or plant part thereof according to claim 1, wherein the plant part is at least one selected from the group consisting of a plant seedling, a root, and a seed.
3. 3. The genetically modified grass family plant or plant part thereof according to claim 1 or 2, wherein the plant is rice.
4. The genetically modified grass family plant or its plant part according to any one of claims 1 to 3, wherein the grass family plant has lodging resistance, or the plant part has lodging resistance when it becomes a grass family plant individual.
Citation Information
Patent Citations
Regulation of metabolism by altering levels of trehalose-6-phosphate
JP2000510691A
Regulation of metabolism by altering levels of trehalose-6-phosphate by inhibiting endogenous trehalase levels
JP2001523110A