Therapeutic pharmaceutical composition for treatment of dry eyes

Abstract

To provide a therapeutic or preventive pharmaceutical drug for a disease selected from ocular dryness, vaginal dryness and oral burning syndrome.SOLUTION: According to the present invention, for example, the treatment of above disease is performed using a TRPM8 agonist selected from ethyl 3-(p-methane-3-carboxamide), (-)-isopulegol, (+)-cis and (-)-trans p-methane-3,8-diol, (-)-cubebol, icilin, 5-methyl-4-(1-pyrrolidinyl)-3-[2H]-furanone, 4,5-dimethyl-3-(1-pyrrolidinyl)-2 [5H]-furanone, 4-methyl-3-(1-pyrrolidinyl)-2[5H]-furanone, N-ethyl-p-methane-3-carboxamide, 2-isopropyl-5-methyl-cyclohexane carboxylic acid (2-hydroxy-1,1-dimethyl-ethyl acid)-amide, 2-isopropyl-5-methyl-cyclohexane carboxylic acid (4-methoxyphenyl) amide, etc.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a therapeutic composition for the treatment of dry eye, more specifically to a TRPM8 receptor antagonist. The present invention relates to compositions comprising agonist ligands. [Background technology]

[0002] Moisture on the ocular surface and other exposed mucous membranes is due to continuous aqueous secretions produced by exocrine glands. Disruption of this process is highly prevalent, especially among the elderly. and vaginal dryness syndrome (Moss, SE et al., 2008, Optom. Vi Sci. 85:668-674 (Non-Patent Document 1); Barker, K. E. and Sav age, NW, 2005, Aust.Dent.J.50:220-223 (non-specific Reference 2); Leiblum, SR et al., 2009, J.Sex Med 6:242 5-2433 (Non-Patent Document 3). In the eye, basal tear flow is measured according to environmental conditions and changes in blink rate. It is produced in the absence of emotional or exogenous stimulus ("basal" tear production). The tear flow is adjusted to changes in environmental conditions and blink rate (Dartt, DA Author, 2009, Prog. Retin. Eye Res. 28:155―177 (non-specific 4)) In addition, tearing significantly increases irritation on the ocular surface (Acosta, MC et al. Author, 2004, Invest Ophthalmol.Vis.Sci. 45:2333 -2336 (Non-Patent Document 5). Irritating stimuli include injurious mechanical forces, harmful heat, and irritating and polymodal nociceptors in trigeminal nerve endings sensitive to chemicals and pain (Belmonte, C. et al., 2004, Exp. Eye Re s. 78:513-525 (Non-Patent Document 6)) and induces irritant-induced tearing. However, the neural structures responsible for sensing ocular surface dryness and regulating basal tear flow remain unclear. It has not been caught.

[0003] Xerophthalmia, or dry eye syndrome, is characterized by persistent dryness of the conjunctiva and clouding of the cornea. It is a disease characterized by

[0004] Several causes, more common in older people, can lead to xerophthalmia. Among the diseases that are known to cause this are: Vitamin A deficiency, Sjögren's syndrome, Rheumatoid arthritis and other rheumatic diseases, chemical burns or thermal burns, atenolol, chlorpheniramine amine, hydrochlorothiazide, isotretinoin, ketorolac, ketotifen, levocaine Drugs like Vastin, Levofloxacin, Oxybutynin, Tolterodine.

[0005] Therapies used to treat dry eye syndrome may be useful in the early stages of the disease. corticosteroids, vitamin A supplements, and medications that increase tear production Among the preparations (artificial tears) used to improve dryness, pilocarpine is the most commonly used. However, these treatments have not been fully implemented. It has clear limitations in terms of efficacy and toxicity, and therefore may cause xerophthalmia, vaginal dryness, and oral burning. There is a need to provide new and improved treatments for the syndrome. [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Moss, SE et al., 2008, Optom.Vis.Sci. 85:668―674 [Non-patent document 2] Barker, KE and Savage, NW, 2005, Aust.Dent.J.50:220–223. [Non-patent document 3] Leiblum, SR et al., 2009, J.Sex Med 6:2425-2433 [Non-patent document 4] Dartt, DA, 2009, Prog. Retin. Eye Res. 28:155―177 [Non-patent document 5] Acosta, MC et al., 2004, Invest Ophthalmol.Vis.Sci.45:2333―2336 [Non-patent document 6] Belmonte, C. et al., 2004, Exp.Eye Res. 78:513-525 Summary of the Invention [Means for solving the problem]

[0007] In a first aspect, the present invention provides a method for treating a disease selected from xerophthalmia, vaginal dryness and burning mouth syndrome. TRPM8 agonists or combinations thereof for the manufacture of pharmaceuticals for the treatment or prevention of Regarding the use of

[0008] In a second aspect, the present invention provides a method for treating dry eye, vaginal dry eye, or other conditions comprising administering at least one TRPM8 agonist to a patient in need thereof. At least one useful for treating one or more diseases selected from dry mouth and burning mouth syndrome The present invention relates to a composition comprising a drug of the present invention and, optionally, a pharmaceutically acceptable vehicle.

[0009] In a third aspect, the present invention provides a method for the preparation of a medicament for the treatment of epiphora. Regarding the use of nisto.

[0010] In another aspect, the present invention provides a method for treating epiphora by administering at least one TRPM8 antagonist to a subject in need thereof. and optionally a pharmaceutically acceptable vehicle. The present invention relates to a composition comprising: [1] Drugs for the treatment or prevention of diseases selected from xerophthalmia, vaginal dryness, and burning mouth syndrome Use of a TRPM8 agonist or a combination thereof for the manufacture of a medical device. [2] The use of [1], wherein the disease is xerophthalmia. [3] The agonist increases the stimulation of tear secretion by cold-sensitive fibers through TRPM8 activation. Use of [2]. [4] [1] to [3], wherein the TRPM8 agonist is selected from the agonists listed in Table 1. Use either. [5] The TRPM8 agonist is WS-5 (ethyl 3-(p-menthane-3-carboxamide) Do)), CPS369, CPS368, CPS125, Frescolato MGA-2 isomer , Cooling Agent 10, (-)-Isopulegol (Cool Act P (registered trademark)), (+)-cis and (-)-trans p-menthane-3,8-diol (chlo- ALACT 38D (registered trademark), (-)-Kube Ball, Hasegawa cooling compound, IFF new GRAS cooling substance, icilin, 5-methyl-4-(1-pyrrolidinyl)-3-[2H]-fura Non, 4,5-dimethyl-3-(1-pyrrolidinyl)-2[5H]-furanone, 4-methyl- 3-(1-pyrrolidinyl)-2[5H]-furanone, N-ethyl-p-menthane-3-carbo oxamide, WS-11 (2-isopropyl-5-methyl-cyclohexanecarboxylic acid (2 -hydroxy-1,1-dimethyl-ethyl acid)-amide), WS-12 (2-isopropyl -5-methyl-cyclohexanecarboxylic acid (4-methoxyphenyl)-amide), WS-1 4(2-isopropyl-5-methyl-cyclohexanecarboxylic acid tert-butylamide ), WS-23 (2-isopropyl-N-2,3-trimethylbutyramide), WS-3 0(2-Isopropyl-5-methyl-cyclohexanecarboxylic acid ester 2,3-dihydr hydroxypropyl), WS-148 (1-(di-sec-butyl-phosphinoyl)-heptyl Tan), menthol, geraniol, linalool, eucalyptol, hydroxyl- Tronellal, PMD-38 (p-menthane-3,8-diol), TRPM8-specific [4] The use of a TRPM8 antagonist selected from agonist antibodies and constitutively active TRPM8 mutants. [6] At least one TRPM8 agonist and xerophthalmia, vaginal dryness, and burning mouth syndrome and optionally, at least one drug useful for treating one or more diseases selected from the group consisting of: and a pharmaceutically acceptable vehicle. [7] A drug for treating one or more diseases selected from xerophthalmia, dry vagina, and burning mouth syndrome. Use of the composition of [6] for producing a medicine. [8] [6] The TRPM8 agonist is selected from the TRPM8 agonists shown in Table 1; or [7] Composition or use. [9] The TRPM8 agonist is a TRPM8 agonist and / or menthol or its The composition of [6] or the use of [7] or [8], wherein the agonist is selected from non-derivative agonists.

[10] The TRPM8 agonist is WS-5 (ethyl 3-(p-menthane-3-carboxamide) Do)), CPS369, CPS368, CPS125, Frescolato MGA-2 isomer , Cooling Agent 10, (-)-Isopulegol (Cool Act P (registered trademark)), (+)-cis and (-)-trans p-menthane-3,8-diol (chlo- ALACT 38D (registered trademark), (-)-Kube Ball, Hasegawa cooling compound, IFF new GRAS cooling substance, icilin, 5-methyl-4-(1-pyrrolidinyl)-3-[2H]-fura Non, 4,5-dimethyl-3-(1-pyrrolidinyl)-2[5H]-furanone, 4-methyl- 3-(1-pyrrolidinyl)-2[5H]-furanone, N-ethyl-p-menthane-3-carbo oxamide, WS-11 (2-isopropyl-5-methyl-cyclohexanecarboxylic acid (2 -hydroxy-1,1-dimethyl-ethyl acid)-amide), WS-12 (2-isopropyl -5-methyl-cyclohexanecarboxylic acid (4-methoxyphenyl)-amide), WS-1 4(2-isopropyl-5-methyl-cyclohexanecarboxylic acid tert-butylamide ), WS-23 (2-isopropyl-N-2,3-trimethylbutyramide), WS-3 0(2-Isopropyl-5-methyl-cyclohexanecarboxylic acid ester 2,3-dihydr hydroxypropyl), WS-148 (1-(di-sec-butyl-phosphinoyl)-heptyl Tan), menthol, geraniol, linalool, eucalyptol, hydroxyl- Tronellal, PMD-38 (p-menthane-3,8-diol), specific for TRPM8 and a constitutively active TRPM8 mutant. is a composition.

[11] Use of a TRPM8 antagonist for the manufacture of a medicament for the treatment of epiphora.

[12] The epiphora is caused by Graves-Graves' disease, corneal tumor, Ackerman's syndrome, allergy, (animals, pollen, etc.), bacterial conjunctivitis, blepharitis, facial nerve paralysis, ectropion, or nasolacrimal duct or The use of

[11] is associated with diseases selected from disorders of the lacrimal sac.

[13] The antagonist stimulates tear secretion from cold-sensitive fibers by inactivating TRPM8 Use of

[11] or

[12] to reduce

[14] The TRPM8 antagonist is selected from the TRPM8 antagonists shown in Table 3. , or use of any of

[11] ~

[13] .

[15] The TRPM8 antagonist is an antagonist specific to the sequence of the gene encoding TRPM8. antisense oligonucleotides, DNA enzymes specific to the TRPM8 sequence, and A microRNA specific to the gene encoding TRPM8 A specific ribozyme, an interfering RNA specific to the sequence of the gene encoding TRPM8, A peptide capable of specifically binding to and inhibiting the activity of TRPM8. An antibody, BCTC(N-(4-tert-butyl 2-methylpropional), which has the ability to bind to and inhibit the activity of this channel t-butyl-phenyl)-4-(3-chloropyridin-2-yl)tetrahydropyrazine- 1(2H)-carboxamide), CTPC((2R)-4-(3-chloro-2-pyridinyl)- 2-Methyl-N-[4-(trifluoromethyl)phenyl]-1-piperazine-carboxamide thio-BCTC (N-(4-tert-butyl-phenyl)-4-(3-chloropyridinyl) (2H)-(thio)carboxamide), SB-45 2533 (N-(2-bromophenyl)-N'-(2-[ethyl(3-methylphenyl)amino] ]ethyl)urea), SKF96365 (1-[2-(4-methoxyphenyl)-2-[3-( 4-Methoxyphenyl)propoxy]ethyl-1H-imidazole), econazole (1- [2-[(4-chlorophenyl)methoxy]-2-(2,4-dichlorophenyl)ethyl]-1H -imidazole), clotrimazole (1-[(2-chlorophenyl)diphenylmethyl]- 1H-imidazole), ACA (N-(p-amylcinnamoyl)anthranilic acid), AM TB(N-(3-aminopropyl)-2-{[(3-methylphenyl)methyl]oxy}-N-( 2-thienylmethyl)-benzamide), capsazepine (N-[2-(4-chlorophenyl) Ethyl]-1,3,4,5-tetrahydro-7,8-dihydroxy-2H-2-benzazepi phenanthroline, MAD1d (N-[(1R,2S,5R) -2-isopropyl-5-methylcyclohexyl]biphenyl-4-carboxamide), MAD2e (4-tert-butylphenyl(1R,2S,5R)-2-isopropyl-5- methylcyclohexylcarbamate).

[16] At least one TRPM8 antagonist and at least one compound useful for treating epiphora and optionally a pharmaceutically acceptable vehicle.

[17] Use of the composition of

[16] for the manufacture of a medicament for the treatment of epiphora.

[18] The epiphora is caused by Graves-Graves' disease, corneal tumor, Ackerman's syndrome, allergy, (animals, pollen, etc.), bacterial conjunctivitis, blepharitis, facial nerve paralysis, ectropion, or nasolacrimal duct or The use of

[17] is associated with diseases selected from disorders of the lacrimal sac.

[19] The TRPM8 antagonist is selected from the TRPM8 antagonists shown in Table 3. , the composition of

[16] or the use of

[17] or

[18] .

[20] The TRPM8 antagonist is an antagonist specific to the sequence of the gene encoding TRPM8. antisense oligonucleotides, DNA enzymes specific to the TRPM8 sequence, and A microRNA specific to the gene encoding TRPM8 A specific ribozyme, an interfering RNA specific to the sequence of the gene encoding TRPM8, A peptide capable of specifically binding to and inhibiting the activity of TRPM8. An antibody, BCTC(N-(4-tert-butyl 2-methylpropional), which has the ability to bind to and inhibit the activity of this channel t-butyl-phenyl)-4-(3-chloropyridin-2-yl)tetrahydropyrazine- 1(2H)-carboxamide), CTPC((2R)-4-(3-chloro-2-pyridinyl)- 2-Methyl-N-[4-(trifluoromethyl)phenyl]-1-piperazine-carboxamide thio-BCTC (N-(4-tert-butyl-phenyl)-4-(3-chloropyridinyl) (2H)-(thio)carboxamide), SB-45 2533 (N-(2-bromophenyl)-N'-(2-[ethyl(3-methylphenyl)amino] ]ethyl)urea), SKF96365 (1-[2-(4-methoxyphenyl)-2-[3-( 4-Methoxyphenyl)propoxy]ethyl-1H-imidazole), econazole (1- [2-[(4-chlorophenyl)methoxy]-2-(2,4-dichlorophenyl)ethyl]-1H -imidazole), clotrimazole (1-[(2-chlorophenyl)diphenylmethyl]- 1H-imidazole), ACA (N-(p-amylcinnamoyl)anthranilic acid), AM TB(N-(3-aminopropyl)-2-{[(3-methylphenyl)methyl]oxy}-N-( 2-thienylmethyl)-benzamide), capsazepine (N-[2-(4-chlorophenyl) Ethyl]-1,3,4,5-tetrahydro-7,8-dihydroxy-2H-2-benzazepi phenanthroline, MAD1d (N-[(1R,2S,5R) -2-isopropyl-5-methylcyclohexyl]biphenyl-4-carboxamide), MAD2e (4-tert-butylphenyl(1R,2S,5R)-2-isopropyl-5- methylcyclohexylcarbamate). . [Brief explanation of the drawings]

[0011] [Figure 1-1] Figure 1 shows the characteristics of cold-sensitive nerve terminal responses in the mouse cornea. Figure 1A shows nerve terminal impulse (NTI) activity in cold-sensitive terminals in response to cold and heat pulses and menthol. From top to bottom, the graph shows the mean firing rate (mean frequency, impulses / s), instantaneous frequency (instantaneous frequency, Hz), direct recording of electrical activity (impulse amplitude, μV), and temperature of the perfusion solution (°C). [Figure 1-2]Figure 1 shows the characteristics of the response of cold-sensitive nerve terminals in the mouse cornea. Figure 1B: The average firing frequency (mean frequency, impulses / second) of 55 cold-sensitive terminals in response to a cooling gradient is shown. Data are means ± SEM. Figure 1C: The distribution of cold thresholds (expressed as -ΔT°C from basal body temperature) for 55 cold-sensitive nerve terminals is shown. Figure 1D: The change in firing frequency with temperature measured for the same 55 cold-sensitive terminals is shown. For each nerve terminal, the change in firing frequency (mean frequency, impulses / second) is shown between the threshold temperature and the temperature at which peak frequency is reached. The thick lines represent the average of each of the 55 gradients. [Figure 1-3] Figure 1 shows the characteristics of the response of cold-sensitive nerve terminals in the mouse cornea. Figure 1E shows nerve terminal impulse activity in cold-sensitive nerve terminals in response to cooling. Lines indicate the mean firing frequency (mean frequency, Hz), instantaneous frequency (instantaneous frequency, Hz), number of impulses per burst of action potentials (impulses / burst), and temperature of the perfusion solution (temperature, °C). [Figure 1-4] Figure 1 shows the response characteristics of cold-sensitive nerve terminals in the mouse cornea. Figure 1F shows the mean firing rate of 10 cold-sensitive terminals during the cooling process. A significant increase in mean firing rate, proportional to the temperature decrease, was observed during the early part of the cooling process (first 30 s, dynamic response, Pearson correlation coefficient = -0.98, p = 0.002) and during the last 30 s of the cooling process (static response, Pearson correlation coefficient = -0.96, p = 0.014). [Figure 2]Figure 2 shows whole-mount immunohistochemistry of corneal sensory nerve fibers in TRPM8-EYFP mice. Figures 2A, B, and C show examples of corneal stromal nerve bundles that enter the peripheral cornea and form the corneal stromal plexus. In Figure 2A, all sensory nerve fibers contained in the bundle were stained with an antibody against neuron-specific class III β-tubulin (Tuj-1), whereas in Figure 2B, only nerve fibers reactive with an antibody against green fluorescent protein (GFP) were stained. Figure 2C shows double immunofluorescence staining of corneal stromal nerves using Tuj-1 (top panel) and GFP antibodies (middle panel) and the corresponding merged image (bottom panel), demonstrating a reduction in the population of putative cold-sensitive fibers within the sensory nerve fiber population. Figures 2D, E, and F show the characteristic structure of nerve fibers traversing the basal epithelial layer of the cornea (subbasal plexus), which appear as straight, roughly parallel, beaded fibers (tethers) that run long distances from the periphery toward the center of the cornea. In Figure 2D, all subbasal sensory fibers were stained (Tuj-1 positive), whereas in Figure 2E, only those immunoreactive for GFP were shown. Figure 2F shows double immunofluorescence staining of Tuj-1-positive fibers (gray) and GFP-positive fibers (white), illustrating the absence of putative TRPM8-positive axons. Figures 2G and H show higher magnifications of the dashed areas in Figures 2D and E, respectively, demonstrating in more detail the morphology of beaded fibers and their branching, which ascends vertically from the basal layer to the outermost superficial layer of the corneal epithelium, occasionally resulting in terminal endings (arrows) at this stage. Figures 2I and J show the same areas shown in Figures 2G and H at a more superficial focal plane, demonstrating the appearance of all corneal sensory nerve fibers (I) and the superficial epithelial nerve terminals of putative cold-sensitive endings (J), which are GFP-positive. The variable morphology and reduced branching of putative TRPM8-positive endings are also shown in K using an upright fluorescent microscope. Figure 2I presents a z-stack image, showing the trajectory of axons running from the corneal stroma to the corneal surface, ultimately resulting in a brush-like GFP-positive area (dashed box, corresponding to the area shown in Figure 2K). The upper right corner shows a diagram of the mouse cornea, illustrating the location of the various nerve types shown in the various panels of the figure. ac corresponds to the anterior third of the corneal stroma, where stromal nerves are found. dh represents the nerve cord in the basal epithelial layer, and ik represents the corneal surface with nerve endings.Scale bars: A-C, 70 μm; D and E, 150 μm; F-L, 40 μm. [Figure 3] Figure 3 shows the response of corneal terminals from TRPM8(- / -), TRPM8(+ / -), TRPA1(- / -), and wild-type mice to a cooling gradient. Figure 3A shows the average firing rate (impulses / second) (upper panel) during a cooling gradient (lower panel) recorded from 143 nerve terminals from TRPM8(- / -) mice (thin lines), 11 nerve terminals from TRPM8(+ / -) mice (dotted lines), and 12 nerve terminals from wild-type littermates (solid lines) in control solution (left) and in the presence of 50 μM menthol (right). Figure 3B shows the average firing rate during a cooling gradient (lower panel) from 11 nerve terminals from TRPA1(- / -) mice (thin lines) and 13 nerve terminals from wild-type littermates (thick lines). Data are means ± SEM. [Figure 4A] Figure 4 shows the dependence of tear production on corneal temperature. Figure 4A shows basal tear production, expressed as the average length of a wet phenol red thread, measured over a 2-minute period in the eyes of anesthetized mice exposed to ambient temperatures of 24.8 ± 0.9 °C and 42.5 ± 0.4 °C, respectively, under ambient humidity of 63.7 ± 0.4% and 38.2 ± 1.4%, resulting in the indicated changes in corneal surface temperature. Solid and hatched columns represent tear production in animals at moderate (28.4 °C) or high (42.5 °C) temperatures, respectively. The number of measurements in consecutive columns represents 35, 11, 23, 9, and 6 observations. (**p<0.01, ***p<0.001, Mann-Whitney test) [Figure 4B]Figure 4 shows the dependence of tear production on corneal temperature. Figure 4B: Increases in tear production induced by application of filter paper soaked with 1 μM capsaicin (n = 12 and 15) or 500 μM allylisothiocyanate (AITC, n = 10 and 16) in wild-type (black columns) and TRPM8(- / -) (gray columns) animals are shown. The first column shows the response to application of vehicle (0.5% DMSO in saline) in wild-type animals (n = 6). Tear production measurements were performed 1 min after removal of the drug-containing filter paper. Statistically significant differences from baseline tear production were determined using the Wilcoxon test (*p < 0.05, ***p < 0.001). [Figure 4C] Figure 4 shows the dependence of tear production on corneal temperature. Figure 4C shows the mean tear production, expressed as wet length values ​​of a phenol red thread, measured in the eyes of 11 human volunteers at ambient temperatures of 18°C, 25°C, and 43°C, resulting in corneal surface temperatures of 32.4±0.4°C, 34.2±0.1°C, and 36.0±0.2°C, respectively. Repeated measures ANOVA showed significant differences (**p<0.01). DETAILED DESCRIPTION OF THE INVENTION

[0012] Surprisingly, the inventors of the present invention have discovered that the TRPM8 receptor is involved in the regulation of tearing, found that activation of the TRPM8 receptor using an agonist resulted in increased tearing. Specifically, the inventors of the present invention have demonstrated that cold receptors innervating the cornea in mammals maintain sustained firing activity at normal corneal temperatures and occur during the interval between blinking and exposure to a dry environment. They are highly sensitive to small thermal changes at the ocular surface, such as those caused by evaporation of the precorneal tear film. This remarkable cold sensitivity was observed in both spontaneous steady-state activity and in response to cold. This is the result of high expression of TRPM8 channels, which critically determine the increased firing rate of neurons. The present inventors have demonstrated that ablation of the TRPM8 channel using genetic techniques reduces tear secretion in mice. Partial silencing by corneal heating has also been shown to reduce secretion by half in humans. Reduces tear production.

[0013] Thus, TRPM8 is involved in the cold receptor nerve fibers that innervate the exposed ocular surface of terrestrial animals. This is a candidate molecule for detecting moisture in the blood. TEPM8 regulates the spontaneous tear production and tear activity in thermosensitive corneal nerve endings. Therefore, stimulation of TRPM8 is important for the development of both the ATP-induced and cold-induced activity. increases stimulation of tear secretion by cold-sensitive fibers through activation of TRPM8.

[0014] Thus, the present invention provides a method for treating xerophthalmia, vaginal dryness, and burning mouth syndrome through the use of various therapeutic agents. Furthermore, the results obtained by the inventors of the present invention relate to the treatment of TRPM8 receptors. This paves the way for the treatment of excessive tearing (epiphora) through the use of various drugs that inhibit it.

[0015] [Therapeutic Use of TRPM8 Agonists] Thus, the present invention provides a method for treating a disease selected from xerophthalmia, vaginal dryness, and burning mouth syndrome. TRPM8 agonists or combinations thereof for the manufacture of therapeutic or prophylactic medicaments Regarding the use of.

[0016] The TRPM8 receptor, also known as cold and menthol receptor 1 or CMR1, Transient receptor potential cation channel subfamily M member 8 is a member of the human TROM It is a protein encoded by eight genes (Clapham DE et al., 2005 Pharmacological Reviews 57 (4):427-50).

[0017] After activation, TRPM8 reacts with sodium ions (Na + ) and calcium ions ( Ca 2+ ) into the cell, causing depolarization of the cell and membrane It is an ion channel that causes changes in electrical potential.

[0018] The TRPM8 protein is expressed in sensory neurons and is activated at low temperatures (below approximately 26°C). TRPM8 is activated by chemicals such as menthol and by electrical potentials. It is also expressed in the prostate, lung, and bladder; its function in these organs is unknown.

[0019] The human TRPM8 gene is located on chromosome 2 in the 2p37.1 region; it contains 1104 amino acids. The code for the protein (NP_076985.4, SEQ ID NO: 1) is nucleotide NM_02 The TRPM8 gene is encoded by the sequence 4080.4 (SEQ ID NO: 2). It has six transmembrane segments with the N-terminus on the cytoplasmic side. The ATP-dependent ATPases then combine to form active channels.

[0020] As used herein, the term "TRPM9" refers exclusively to the human gene and protein. This is not related to dogs (XP_543296.2), mice (NP_599013. 1), and also orthologues in other species such as rat (NP_599198.2).

[0021] The words "treating" or "treatment" , the goal of which is to prevent undesirable physiological changes or disorders such as dryness of the eyes, vagina, or mouth. or stopping (alleviating) the symptoms of the disease, both therapeutic and preventative measures. For purposes of this invention, beneficial or desirable clinical outcomes include, but are not limited to, Symptom relief, reduction in the extent of disease, stable disease, both detectable and undetectable (specifically (no worsening), slowing or halting the progression of the disease, improvement or palliation of the condition, and remission (partial and A subject in need of treatment may already have the disease or Subjects who are suffering from an injury, as well as subjects who are suspected of suffering from said disease or injury, or Also included are subjects in whom disease or injury is to be prevented.

[0022] A "method of treatment" refers to administering a TRPM8 agonist of the present invention to a subject in need of such treatment. It is defined as the administration of a pharmaceutical composition containing a

[0023] "Xerophthalmia or dry eye syndrome" in the present invention refers to persistent dryness of the conjunctiva and It is defined as a disease characterized by corneal opacity. Numerous causes can cause xerophthalmia. This condition is common among older people. Diseases that cause this include: Vitamin A deficiency, Sjogren's syndrome, rheumatoid arthritis, and others. Rheumatic diseases, chemical burns or thermal burns, atenolol, chlorpheniramine, hydrochloride Lothiazide, isotretinoin, ketorolac, ketotifen, levocabastine, levofloxacin Drugs such as loxacin, oxybutynin, and tolterodine.

[0024] Thus, in certain embodiments, xerophthalmia is caused by vitamin A deficiency, Sjogren's syndrome, Rheumatoid arthritis and other rheumatoid diseases, chemical burns or thermal burns, atenolol, chlorophen Ramin, hydrochlorothiazide, isotretinoin, ketorolac, ketotifen, levo Associated with drugs such as cabastine, levofloxacin, oxybutynin, and tolterodine .

[0025] "Vaginal dryness" is defined as a decrease in the amount of fluid produced by the vagina. This dryness can occur during sexual intercourse. It causes discomfort such as itching, irritation and burning in the genital area, as well as pain during This lack of lubrication can be due to organic or psychological causes. Among the organic causes: The most common is a lack of estrogen levels, for example during menopause, which can lead to vaginal dryness. Other causes are vaginitis, an infection of the vaginal tissue, or diabetes, which can decrease vaginal lubrication. In women with urinary problems, especially those with poor blood sugar control, this lack of lubrication can lead to a combination of Symptoms: A condition that can decrease response to sexual stimulation; and restrict blood flow in the vaginal walls, reducing the amount of lubrication. This may be related to vascular damage that reduces

[0026] Another possible factor is stress, which leads to increased release of cortisol in the blood. Smoking also interferes with the function of estrogen, This can decrease vaginal lubrication. Similar effects can be caused by alcohol and cannabis. Some drugs, such as birth control pills or drugs used to treat breast, ovarian, or uterine cancer, may be Some hormonal medications can cause vaginal dryness. Tricyclic antidepressants, some antiulcer drugs, or Some antihypertensive drugs can have the side effect of reducing vaginal secretions. Other drugs that may be used are antihistamines.

[0027] Thus, in a preferred embodiment, vaginal dryness is caused by factors such as low estrogen levels, diabetes, stress, or in connection with alcohol consumption and used to treat cannabis or breast, ovarian or uterine cancer. Medications such as tricyclic antidepressants, antiulcer drugs, antihypertensives or antihistamines can cause vaginal dryness. The same is true for histamines.

[0028] In the present invention, "burning mouth syndrome" refers to a disease called oral pain. , due to several causes: inadequate intake of certain vegetables or meats that provide iron, folic acid or vitamin B12 Inadequate intake of iron may contribute to the iron deficiency anemia that results in this burning mouth syndrome. Some endocrine disorders, such as hypogonadism or diabetes, or gastroesophageal reflux Intestinal disease also contributes to burning mouth syndrome.

[0029] Another issue that influences the development of this disease is the use of drugs such as beta-blockers, antihypertensives and antidiabetics. Chronic use of some drugs.

[0030] In certain preferred embodiments, the disease is xerophthalmia.

[0031] In the present invention, a "TRPM8 receptor agonist" is an agonist that specifically binds to the TRPM8 receptor. Upon binding, this can cause an increase in TRPM8 channel activity, i.e., cell deactivation. Any increase in sodium and calcium flux through the channel causes polarization. These agonists are defined as molecules that stimulate tear secretion by cold-sensitive fibers. Whole-cell patch clamp electrophysiological studies (implemented) described in the examples of the present invention See Example 1), calcium microscopy (Bodding et al., 2007, Cell Calcium, 42,618-628) and a fluorometric imaging plate reader -assay (Behrendt et al., 2004, J. Pharmacol. 141, 7 It can be used to detect the activity of TRPM8 receptor agonists, such as 37-745. There is a wide variety of research.

[0032] Examples of TRPM8 receptor agonists suitable for use in the present invention include, but are not limited to, those listed in Table Examples of such molecules include those described in 1.

[0033] [Table 1-1]

[0034] [Table 1-2]

[0035] [Table 1-3]

[0036] [Table 1-4]

[0037] [Table 1-5]

[0038] [Table 1-6]

[0039] [Table 1-7]

[0040] [Table 1-8]

[0041] [Table 1-9]

[0042] [Table 2]

[0043] In a particular embodiment, the agonist for the first use of the present invention is WS-5 (ethyl 3 -(p-menthane-3-carboxamide)), CPS369, CPS368, CPS125 , Frescolato MGA-2 Isomer, Cooling Agent 10, (-)-Isoprego (Coolact P®), (+)-cis and (-)-trans p in a ratio of approximately 62:38 -menthane-3,8-diol (Coolact 38D (registered trademark)), (-)-cubebol, Hasegawa cooling compound, IFF new GRAS cooling substance, Icilin, 5-methyl-4-(1 -pyrrolidinyl)-3-[2H]-furanone, 4,5-dimethyl-3-(1-pyrrolidinyl)- 2[5H]-furanone, 4-methyl-3-(1-pyrrolidinyl)-2[5H]-furanone, N- Ethyl-p-menthane-3-carboxamide, WS-11 (2-isopropyl-5-methyl cyclohexanecarboxylic acid (2-hydroxy-1,1-dimethyl-ethyl acid) amide ), WS-12 (2-isopropyl-5-methyl-cyclohexanecarboxylic acid (4-methyl hydroxyphenyl)-amide), WS-14 (2-isopropyl-5-methyl-cyclohexyl carboxylic acid tert-butylamide), WS-23 (2-isopropyl-N-2,3- trimethylbutyramide), WS-30 (2-isopropyl-5-methyl-cyclohexyl 2,3-dihydroxypropyl hydroxybenzoate, WS-148 (1-(di-se c-butyl-phosphinoyl)-heptane), menthol, geraniol, linalool, Eucalyptol, hydroxyl-citronellal, PMD-38 (p-menthane-3, 8-diol), TRPM8-specific agonist antibodies, and constitutively active TRPM8 mutations The agonist is selected from the group consisting of:

[0044] In a preferred embodiment, the agonist for the first use of the present invention is menthol or its Thus, in a preferred embodiment, the TRPM8 agonist is a different agonist from the derivative. The compounds are icilin, AG3-5, WS-23, WS-148, and hydroxyl-citronellol. 5-methyl-4-(1-pyrrolidinyl)-3-[2H]-furanone, 4,5-dimethyl- 3-(1-pyrrolidinyl)-2[5H]-furanone and 4-methyl-3-(1-pyrrolidinyl) -2[5H]-furanones.

[0045] In a more preferred embodiment, the agonist for the first use of the present invention is Compound 1 of Table 1. ~4 (WS-5, CPS369, CPS368, CPS125), Compound 19 (WS-1 2, Becka, B., 2007, CellCalcium 41(3):285―2 94) and a specific TRPM8 agonist selected from TRPM8 agonist antibodies. .

[0046] In another preferred embodiment, the agonist is a cooling agent 10, fresh Corato MGA, Frescolato ML, CPS-369, CPS-113, WS-23, 7 such as WS-11, WS-30, WS-148, WS-3, WS-12 and Icilin Lower EC 50(See Table 2).

[0047] In the present invention, a "specific agonist" refers to an agonist that activates other channels of the same family. Activates TRPM8 without the need for other channels in the same family. Agonists that activate TRPM8 with 50x, 100x, 1000x, and 2000x potency is defined as:

[0048] A method that can be used to measure the specificity of TRPM8 agonists is electrophysiology. The agonist activity of the compounds can be measured by the methods described above, such as immunoassay, calcium microscopy, etc. This is the same as the method described above.

[0049] [TRPM8 receptor agonist antibody] The TRPM8 agonist used in the present invention is a TRPM8 agonist antibody or a TRPM8 It specifically binds to the extracellular domain of the receptor, more specifically the TRPM8 receptor, and inhibits its activity. The agonist antibody may be a fragment of a TRPM8 agonist antibody capable of inducing TRPM8 activation. The antibody is specific for the human TRPM8 receptor or a homologous TRPM8 receptor orthologue. It can bind and activate.

[0050] Thus, in certain embodiments, the TRPM8 receptor agonist is selected from IgG, IgM, Ig TRPs that can be of any class or subclass, such as IgA, IgD, and IgE In certain embodiments, these TRPM8 anti-receptor antibodies are TRPM8 anti-receptor agonist antibodies. At least one of the agonist antibodies is an IgG-2A type immunoglobulin.

[0051] In the present invention, the term "antibody" must be interpreted broadly and includes antibodies that recognize the relevant antigen. and specifically binds to the TRPM8 receptor or the extracellular domain of this receptor. Polyclonal, monoclonal, and multispecific antibodies may be used, provided that they are capable of detecting the antibody. It includes antibodies and their fragments (F(ab')2, Fab). Examples of antibodies that can be used include, but are not limited to, polyclonal antibodies, monoclonal antibodies, and the like. , recombinant antibodies, chimeric antibodies, humanized antibodies, fully human antibodies, etc.

[0052] In the present invention, a "TRPM8 receptor agonist antibody" is defined as an antibody that binds to the TRPM8 receptor or its receptor. It specifically binds to the extracellular domain of the body and regulates sodium and calcium flux through the channel. is defined as an antibody that can induce channel activation resulting in an increase in Suitable methods for detecting agonist antibodies include those that activate TRPM8 as described in detail above. Based on these capabilities, it is within the scope of therapeutic use of the agonists according to the present invention.

[0053] Polyclonal antibodies are originally derived from different antibody molecules produced in the serum of animals immunized with the antibody. These are, for example, colorimetric assays using peptides of a single epitope of a related antigen. Monospecific polyclonal antibodies obtained from the heterogeneous mixture by column chromatography Also includes antibodies.

[0054] Monoclonal antibodies are a homogeneous population of antibodies specific to a single epitope. These monoclonal antibodies are described, for example, in the article by Koehler and Milstein [Na ture, 1975, 256:495-397] or Harlow and Lane [“Using Antibodies. A Laboratory Manual” fr omE. Harlowand D. Lane, Editor: Cold Spring Harbor Laboratory Press, ColdSpring Harbor, New York; 1998 (ISBN 978-0879695439)] These can be prepared by conventional techniques.

[0055] Chimeric antibodies are antibodies constructed by cloning or recombining antibodies from different animal species. In a typical, but non-limiting configuration of the present invention, a chimeric antibody is is the portion of a monoclonal antibody that contains the site that recognizes and binds to an antigen, generally the variable region ( Fv) and other portions corresponding to human antibodies, generally including constant regions and constant region adjacent regions. It includes a part that includes

[0056] Fully human antibodies can be produced in transgenic animals with a human immune system or by the production of antibodies from human immune cells. By ex vivo immunization (with or without adjuvant, pure antigen or pure This includes both genetic and traditional immunization with non-specific antigens; or antigen exposure to the immune system. or natural / synthetic libraries generated from human immune cells. These antibodies are derived from human immunoglobulin genes. The gene was cloned and transfected with the target antigen (in this case, the TRPM8 receptor). These antibodies can be obtained and selected from transgenic animals (e.g., mice). Single-chain (scFv) or antigen-binding (Fab) variable antibody generated by phage display by the selection of a target region and subsequent cloning and grafting in a human antibody, or by methods known to those skilled in the art. Cloning of the variable regions of both chains and subsequent generation of an antibody library, using any of the known Generation of libraries formed by combining / mutating the variable regions of both chains for and can be obtained by display methods.

[0057] Humanized antibodies are made by cloning the complementarity-determining hypervariable regions (CDRs) of a mouse monoclonal antibody. constructed by grafting into its own CDR hypervariable region in a human antibody It is a monoclonal antibody.

[0058] Thus, in certain embodiments of the compositions of the present invention, at least one TRPM8 anti-receptor The antibody is a humanized antibody.

[0059] An example of an agonist antibody specific for the TRPM8 receptor is described in Mahieu, F. et al. (2007) J Biol Chem 282(5):3325-36) and Obata, K. et al. (20 2005, J Clin Invest. 115(9):2393-2401) It is being done.

[0060] Additionally, in the context of the present invention, the term "antibody" refers to the antibody In addition to mutants with weakened glycosylation patterns as disclosed in Glycated or non-glycosylated antibody fragments obtained from or by recombinant techniques, comprising (i) a binding peptide; (ii) variable regions of antibodies bound together by peptides (scFv); The heavy chain (Fd) is linked to the light chain by a disulfide bond with a peptide. (iii) the heavy chain alone, such as the variable region together with the CH1 constant region (scFab); , new variants, or (iv) to make them more similar or less immunogenic. Or, the antibody fragment is used to make it more stable in body fluids, and activates the TRPM8 receptor. These include mutant forms that have the ability to cause

[0061] The TRPM8 receptor agonist antibody disclosed in the present invention can be produced by conventional genetic engineering or recombinant methods. By recombinant engineering techniques, by conventional antibody production techniques, from normal body fluids or biological tissues or by extraction and purification techniques well known to those skilled in the art for obtaining proteins and antibodies. The TRPM8 receptor agonist may be an antibody or other conventional technique. In this case, the following may be used in particular for their preparation, without any limitation: No: Transgenic animals for human immunoglobulin genes, hybridomas Production of monoclonal antibodies against natural, synthetic, or related antigens in immunized organisms. The antibody libraries that can be derived from the antibody libraries are available using very different display methods (phage display, (i) Ribosome display, etc.) followed by genetic engineering techniques that can be redesigned and expressed in vectors designed for the production of recombinant antibodies of different sizes, compositions, and structures. Immunization techniques in animals, including production from antibody libraries prepared by the method of An overview of the main methods for this can be found, for example, in: - S. Duebel, Handbook of Therapeutic Antibodies apeutic Antibodies), Publisher: Wiley-VCH, 2007 , Vol:IaIII (ISBN978―3527314539); - G. Subramanian, ed., Antibodies: Volume 1: Production and Purification : Volume 1: Production and Purification)”, Publisher: Springer, 1st edition, 2004 (ISBN 978―03064824 58); - G. Subramanian, ed., "Antibodies: Volume 2: Novel Technologies and Therapeutic Uses" bodies:Volume 2:Novel Technologies and T herapeutic use), Publisher: Springer, 1st edition, 2004 ( ISBN978―0306483158); - J. Sambrook and D.W. Russel (eds.), Molecular Cloning: A Laboratory Manual Al(Molecular Cloning: a Laboratory manual )”, Publisher: Cold Spring Harbor Laboratory Pre ss, 3rd edition, 2001 (ISBN978-0879695774).

[0062] More specifically, to produce and obtain antibodies that specifically bind to the TRPM8 receptor , International Publication No. 98 / 16249, International Publication No. 2004 / 010947, U.S. Patent Application Publication No. 2004 / 0109847 and U.S. Patent Application Publication No. 2005 / 00 Any of the methods disclosed in the publication No. 13811 can be used, the contents of which are incorporated herein by reference. is incorporated in its entirety.

[0063] [Constitutively active mutant of TRPM8] In the present invention, the TRPM8 agonist is a constitutively active mutant of the TRPM8 receptor. or functionally equivalent variants thereof.

[0064] The "constitutively active mutant of the TRPM8 receptor" is a mutant of the natural TRPM8 receptor that, when expressed in cells, subunit of PM8 and this constitutively active mutation results in a continuously activated channel The TRPM8 sequence-derived subunits give rise to mixed TRPM8 channels formed from The function of a constitutively active mutant of the TRPM8 receptor is defined as a peptide sequence of interest. "Equivalent variants" as used herein refer to variants whose sequences are identical to the constitutively active variants of the TRPM8 receptor. The variant can be obtained by the insertion, substitution or deletion of one or more amino acids in the sequence of the variant. as peptides that retain at least some of their ability to form genetically activated channels. To prove whether a channel is constitutively active, electrophoresis as described above is performed. Physiological techniques can be used. Preferably, the variant of the natural ligand of 4-1BB is , at least 50%, at least 60%, at least 70%, at least At least 80%, at least 90%, at least 91%, at least 92%, at least 93% , at least 94%, at least 95%, at least 96%, at least 97%, at least The sequence identity between the variant and the natural ligand is 98% or at least 99%. The degree of identity can be determined using methods and computer algorithms well known to those skilled in the art. Preferably, the identity between two amino acid sequences is determined using the BLASTP algorithm (BL AST Manual, Altschul, S. et al., NCBI NLM NIH Bethe sda, Md. 20894; Altschul, S. et al., J. MoI. Biol., 21 5:403-410 (1990)).

[0065] TRPs resulting in conservative substitutions of amino acids at positions not critical for protein functionality Nucleotide sequences of functionally equivalent variants of a constitutively active mutant of the M8 receptor. The mutation is an evolutionarily neutral mutation that does not affect its overall structure or its functionality. Those skilled in the art will understand that.

[0066] [First composition of the present invention] As will be appreciated by those skilled in the art, TRPM8 agonists can be used to treat conditions such as dry eye, vaginal dryness, and oral dryness. It can be used in combination with other drugs useful in the treatment of burning cavity syndrome. In an embodiment, the present invention provides a method for treating dry eye, vaginal dryness, and other conditions by administering at least one TRPM8 agonist to a patient in need thereof. and at least one drug useful for treating one or more diseases selected from the group consisting of fluticasone, fluticasone-containing compounds, and fluticasone-containing compounds. and optionally a pharmaceutically acceptable vehicle.

[0067] TRPM8 agonists and pharmaceutically acceptable vehicles suitable for use in the compositions of the present invention Kuru has been reported previously.

[0068] Drugs useful in treating dry eye include, among others, corticoids, vitamin A, pilocarpine, Hypromecellulose solution, carbomer gel, cyclosporine, glycerol, hydroxypropyl Hydroxypropylmethylcellulose, Hydroxymethylcellulose, Carboxymethylcellulose Rose, polyethylene glycol, polyvinyl alcohol, hyaluronic acid, castor oil or It is a moisturizing eye drop containing mineral oil.

[0069] Medications useful in treating vaginal dryness include water-based lubricants, vitamin E, and estrogen, among others. Estrogens such as estrogens, aglycone-type isoflavones, hyaluronic acid, and raloxifene and selective modulators of receptors.

[0070] Drugs useful in treating burning mouth syndrome include, among others, capsaicin, nystatin ( Icostatin) or fluconazole (Diflucan), gabapentin (Neurontin) anticonvulsants such as benzodiazepines, and analgesics such as clonazepam (Klonopin) Drugs, amitriptyline, mexiletine, lamotrigine, phenytoin, N-phenylethyl Amitriptyline, desipramine, gabapentin or nortriptyline (Pamelor, Amitriptyline) Antidepressants, antiepileptics and anticonvulsants such as Benzyl.

[0071] As used herein, a "pharmaceutically acceptable vehicle" includes preservatives, excipients, carriers, agents that may be present in the compositions of the present invention, such as fillers, wetting agents, binders, disintegrants, buffers, etc. These additives include, for example, magnesium carbonate, calcium carbonate, calcium carbonate, carboxymethylcellulose, starches, sugars, gums, magnesium stearate or The additive may be calcium stearate, a coloring material, or a flavoring agent. There are a wide variety of excipients that are pharmaceutically acceptable, and the selection of appropriate excipients is crucial for the classification of pharmaceutical formulations. This is common knowledge for those skilled in the art.

[0072] In another embodiment, the present invention provides a method for treating a disease characterized by a condition selected from the group consisting of xerophthalmia, dry vagina, and burning mouth syndrome. Use of the first composition of the present invention for the manufacture of a medicament for the treatment of one or more diseases. .

[0073] In another embodiment, the present invention provides a method for treating a disease characterized by a condition selected from the group consisting of xerophthalmia, dry vagina, and burning mouth syndrome. The first composition of the invention is for the treatment of one or more diseases.

[0074] In another embodiment, the present invention provides a method for treating a cancer, comprising administering to a subject a first composition of the present invention. One or more of the following diseases are selected from the group consisting of xerophthalmia, dry vagina, and burning mouth syndrome in patients with Regarding treatment methods.

[0075] The compositions of the present invention can be administered, for example, intravenously, intraperitoneally, subcutaneously, intramuscularly, topically, intradermally, or intravenously. It can be administered by various routes, such as intranasal or intrabronchial, and can be administered locally or intravenously to the target site. The active substance can be administered systemically or directly. An overview of excipients and manufacturing methods is available in the a, C. Faulli´i Trillo, Luza´n 5, SA deEdicio nes, 1993 and Remington's Pharmaceutical Sciences ences (edited by A.R. Gennaro), 20th edition, Williams & Wilkins PA, USA (2000).

[0076] Dosage regimens will be determined by the physician and depend on clinical factors. Thus, the dose depends on the patient's physical characteristics (age, size, sex), the route of administration used, and the severity of the disease. The dosage will depend on numerous factors, including the dosage, the particular compound used, and the pharmacokinetic properties of the subject.

[0077] The compositions of the present invention are administered in amounts that may vary within broad, but always therapeutically effective, ranges. It may contain a TRPM8 agonist drug.

[0078] In the present invention, a "therapeutically effective amount" is defined as an amount that increases lacrimation, vaginal discharge, or salivation in a patient. is defined as a sufficient amount of a TRPM8 receptor agonist to cause

[0079] Therefore, the composition of the present invention is administered in an amount of 0.1 to 2,000 mg, preferably 0.5 to 500 mg. mg, and even more preferably in the range of 1 to 200 mg of a TRPM8 receptor agonist The appropriate dose of the composition is 0.01 to 10 per kg of body weight. 0 mg per kg of body weight, preferably 0.1 to 50 mg per kg of body weight, more preferably The composition may be administered at variable times per day, particularly 1 to 4 times per day. It can be administered in a single dose.

[0080] As will be appreciated by those skilled in the art, TRPM8 agonists and the associated symptoms of xerophthalmia, vaginal dryness, and burning mouth may be Both the drug and the drug useful for treating one or more diseases selected from the syndrome are pharmaceutically acceptable. The compound may be present in a vehicle.

[0081] Preferred excipients or vehicles for use in the present invention include sugars, starches, cellulose, In certain embodiments, the pharmaceutical compositions of the present invention include cereals, dairy products, and dairy products. is available in solid form (e.g., tablets, capsules, lozenges, granules, suppositories, or reconstituted into a liquid form) and the like), liquids (e.g., solutions, Suspensions, emulsions, elixirs, lotions, ointments, etc.) or semi-solids (gels, softeners, etc.) The pharmaceutical compositions of the present invention may be formulated into pharmaceutical dosage forms such as plasters, creams, and the like. The substances may be administered by, but are not limited to, oral, intravenous, intramuscular, intra-arterial, intraspinal, intrathecal, intraventricular, transdermal, It may be administered by any of the following routes: subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal. An overview of the various routes of administration of active substances, the excipients used and the manufacturing techniques can be found in Tratadode Farmacia Gale´nica, C. Faulli´ i T rillo, Luza´n5, SA deEdiciones, 1993 and Rem ington's Pharmaceutical Sciences (AR Genna ro), 20th edition, Williams & Wilkins PA, USA (2000) can be found.

[0082] As will be appreciated by those skilled in the art, the present invention, which includes at least one TRPM8 receptor agonist, The compositions will be formulated according to the route of administration to be used. In the present invention, the composition of the present invention containing at least one TRPM8 receptor agonist is administered intraocularly. The dosage will be appropriately formulated for administration.

[0083] In another particular embodiment, the present invention provides a method for the treatment of a disease comprising at least one TRPM8 receptor agonist. The composition will be suitably formulated for vaginal administration.

[0084] In another particular embodiment, the present invention provides a method for the treatment of a disease comprising at least one TRPM8 receptor agonist. The compositions will be suitably formulated for buccal administration.

[0085] In a specific embodiment, the agonist used in the first use of the present invention is CoolAct 3 8D®, (-)-Kube Ball, Hasegawa Cooling Compound, IFF New GRAS Cooling Compound Substance, Icilin, 5-methyl-4-(1-pyrrolidinyl)-3-[2H]-furanone, 4,5- Dimethyl-3-(1-pyrrolidinyl)-2[5H]-furanone, 4-methyl-3-(1-pyrrolidinyl)-2[5H]-furanone Lysinyl)-2[5H]-furanone, N-ethyl-p-menthane-3-carboxamide, W S-11 (2-isopropyl-5-methyl-cyclohexanecarboxylic acid (2-hydroxy -1,1-dimethyl-ethyl acid)-amide), WS-12 (2-isopropyl-5-methyl -cyclohexanecarboxylic acid (4-methoxyphenyl)-amide), WS-14 (2-isopropyl Propyl-5-methyl-cyclohexanecarboxylic acid tert-butylamide), WS-2 3 (2-isopropyl-N-2,3-trimethylbutyramide), WS-30 (2-isopropyl Propyl-5-methyl-cyclohexanecarboxylic acid ester 2,3-dihydroxy-propyl WS-148 (1-(di-sec-butyl-phosphinoyl)-heptane), Toll, Geraniol, Linalool, Eucalyptol, Hydroxy-Citronellal , PMD-38 (p-menthane-3,8-diol), TRPM8-specific agonist antibody , and constitutively active TRPM8 mutants, or combinations thereof.

[0086] In a preferred embodiment, the agonist used in the first use of the present invention is menthol or Therefore, in a preferred embodiment, the TRPM8 agonist is icilin, but not a derivative thereof. , AG3-5, WS-23, WS-148, Hydroxyl-citronellal, 5-methyl -4-(1-pyrrolidinyl)-3[2H]-furanone;4,5-dimethyl-3-(1-pyrrolidinyl)-3[2H]-furanone; 4-Methyl-3-(1-pyrrolidinyl)-2-[5H]-furanone and 4-methyl-3-(1-pyrrolidinyl)-2-[5H]- In a more preferred embodiment, the furanones used in the first use of the present invention are selected from the group consisting of furanones, The agonist was selected from compounds 1 to 4 in Table 1 (WS-5, CPS369, CPS368, CPS1 25), Compound 20 (WS-12, Becka, B., 2007, Cell Calc ium 41(3):285-294), specific antibodies selected from TRPM8 agonist antibodies It is a selective TRPM8 agonist.

[0087] In another preferred embodiment, the agonist is a cooling agent 10, fresh Corato MGA, Frescolato ML, CPS-369, CPS-113, WS-23, Such as WS-11, WS-30, WS-148, WS-3, WS-12 and Icilin, EC lower than 7 50 (see Table 2).

[0088] As will be appreciated by those skilled in the art, TRPM8 agonists may be antibodies or constructs of TRPM8. Another method of practicing the invention is to use these TRPM8 receptor antagonists, where the antagonists are functionally active variants. The administration of a vector containing a nucleotide sequence encoding an agonist.

[0089] The nucleotide sequences encoding these agonists are cloned and the control sequences for expression are inserted. As used herein, "may" refers to a molecule that can be preceded by, or operably linked to, a nucleic acid. "Operably linked" means that the nucleotide sequence is capable of expression under the control of these regulatory sequences. This means that the sequence is in the appropriate reading frame for the gene.

[0090] Regulatory sequences of value for the present invention include nuclear promoter sequences, or enhancer sequences. The promoter sequence may be a promoter sequence and / or other regulatory sequence that increases the expression of the nucleic acid of the heterologous sequence. The promoter can be constitutively expressing or inducible. In this case, a constitutive promoter is used. Examples include the immediate early promoter of cytomegalovirus (CMV) and the promoter of Rous sarcoma. Many other examples of constitutive promoters can be found in the art. and can be used in the practice of the present invention. If required, then an inducible promoter must be used. So, an inducible promoter is "silent." "Silent" means that the inducible promoter In the absence of the enzyme, low or no expression of the nucleic acid of the heterologous sequence is detected; In the presence of an inducer, expression of the nucleic acid heterologous sequence occurs. The level can often be controlled by adjusting the concentration of the inducer. Regulating expression can be induced, for example, to stimulate an inducible promoter more strongly or less strongly. By adjusting the concentration of the inducer, the concentration of the transcription product of the nucleic acid heterologous sequence can be affected. If the sequence encodes a gene, the amount of protein synthesized can be controlled. Thus, the concentration of the therapeutic agent can be regulated. Examples of well-known inducible promoters include estradiol, estradiol, and estradiol. a promoter of a prodrug or androgen, a promoter of a metallothionein, or an enzyme Numerous other examples are known in the art and are incorporated herein by reference. Constitutive and inducible promoters (often In addition to the promoters that function in various cell or tissue types, tissue-specific promoters can be used to Tissue-specific expression of the heterologous sequence of nucleic acid can be achieved. Well-known examples include the promoter of skeletal muscle α-actin and the promoter of cardiac actin. tar, skeletal muscle troponin C promoter, slow contraction cardiac troponin C promoter and various muscle-specific promoters such as the promoter / enhancer of creatine kinase. There are many muscle-specific promoters known in the art, and the (For a review of muscle-specific promoters, see Miller et al. (See, for example, W. (1993) Bioessays 15:191-196).

[0091] In certain embodiments, the TRPM8 agonist antibody is an IgG-2A type immunoglobulin. be.

[0092] In another specific embodiment, the TRPM8 agonist antibody is a humanized antibody.

[0093] Furthermore, the vector contains a polynucleotide encoding a constitutively active mutant of the TRPM8 receptor. Therefore, if the vector is expressed in a biological receptor, it may The therapeutic effects discussed above for the treatment of conditions such as xerostomia, vaginal dryness, and burning mouth syndrome The resulting proteins may then produce related proteins that can cause side effects.

[0094] Within the scope of the present invention, it is preferred that the vector used is suitable for use in gene therapy. viral or non-viral vectors; examples include, but are not limited to, The vector can be a viral vector based on a retrovirus, adenovirus, etc. In the case of non-viral vectors, DNA-liposomes, DNA-polymers, DNA -Polymer-liposome and other complexes can be used. rs for Gene Therapy”, by Huang, Hung and Wagner, Academic Press (1999). These viral and non-viral vectors containing the encoding sequence can be prepared by conventional methods. Alternatively, these vectors can be used to directly administer the vectors to the human or animal body. and transforming, transfecting or infecting cells, e.g., mammalian cells, e.g., human cells, in vitro. These cells can then be implanted into the human or animal body to achieve the intended therapeutic effect. For administration to a subject, these cells must be in a suitable container that does not adversely affect their viability. The compound will be formulated in an appropriate vehicle.

[0095] [Second therapeutic use of the present invention] In another aspect, the present invention provides a method for treating or preventing epiphora using a TRPM compound. 8 antagonists or combinations thereof.

[0096] In another aspect, the present invention provides a TRPM8 antagonist or It concerns the combination of them.

[0097] In another aspect, the present invention provides a method for treating a subject with a TRPM8 antagonist or a combination thereof. The present invention relates to a method for treating epiphora in a subject, comprising administering to

[0098] The words "TRPM8", "treatment" and "prevention" are used in connection with the first use of the present invention. It has already been explained.

[0099] In the present invention, "epiphora" is defined as the presence of continuous and excessive tearing. Excessive tear production can be caused by, for example, cold, exposure to polluted environments or chemicals, a foreign body in the cornea, or It can be caused by external stimuli, such as ulcers, which act as irritants. It can also be caused by conditions that cause inflammation of the ocular surface, such as acute conjunctivitis.

[0100] Sometimes the cause is an abnormal position of the eyelid (ectropion) or a disorder in the nasolacrimal duct or lacrimal sac. If present from birth, it is a defect in the tear drainage system due to a disorder of the lacrimal system. The damage may be congenital, most commonly due to an imperforate nasolacrimal membrane. When it occurs in adults, it may be due to an infection of the lacrimal sac or dacryocystitis. Sometimes, the cause of epiphora is an infection of the eyelid. Another cause of epiphora is facial nerve paralysis, which causes weakness of the orbicularis muscle. Symptoms include: eczema, Ackerman's syndrome, allergies to animals, pollen, etc., bacterial conjunctivitis, and eyelid allergies. It's fire.

[0101] Thus, in certain embodiments, the epiphora is caused by Graves'-Graves' disease, corneal tumors, Achilles' heel, or other conditions. Hayman's syndrome, allergies (animals, pollen, etc.), bacterial conjunctivitis, blepharitis, facial nerve paralysis, external ocular Associated with inversion or disorders of the nasolacrimal duct or lacrimal sac.

[0102] In certain embodiments, the medicament inhibits cold-sensitive fibers by inactivating TRPM8. Reduces the stimulation of tear secretion caused by contact lenses.

[0103] In the present invention, a "TRPM8 receptor antagonist" refers to a compound that specifically binds to the TRPM8 receptor. It is defined as a molecule that specifically binds to TRPM8, and when it binds, it reduces the activity of the TRPM8 channel. This causes the release of sodium and calcium through channels that cause cell repolarization. Reduces um.

[0104] A suitable method for determining whether a given compound is a TRPM8 antagonist is to To detect the activity of the TRPM8 receptor agonist described in connection with the first use of the present invention, This is consistent with the method described for

[0105] Table 3 shows exemplary, non-limiting examples of TRPM8 antagonists that can be used in the present invention. In addition, the method described in the international patent application WO 2010 / 021882 is The compounds can be used.

[0106] [Table 3-1]

[0107] [Table 3-2]

[0108] [Table 3-3]

[0109] [Table 3-4]

[0110] [Table 3-5]

[0111] [Table 3-6]

[0112] [Table 4]

[0113] [Antisense oligonucleotides] In certain embodiments, for example, TRPM8 is inhibited (to inhibit its activity). inhibition of the gene encoding TRPM8, such as inhibition of transcription and / or translation of the nucleic acid encoding it. Antisense oligonucleotides specific for inhibiting expression are used. Nucleotides can bind by conventional base complementarity or, for example, when binding to double-stranded DNA. binds to its potential targets through specific interactions in the major groove of the double helix For use in the present invention, constructs containing antisense oligonucleotides can be prepared, e.g., For example, when transcribed in cells, a small portion of the cellular mRNA encoding TRPM8 It can be distributed as an expression plasmid that produces RNA that is at least complementary to the target gene. Alternatively, antisense constructs may be generated in vitro and, when placed in cells, may be capable of targeting the target nucleus. Inhibition of gene expression by hybridizing with mRNA and / or genomic sequences These oligonucleotide probes The enzyme preferably inhibits endogenous nucleases, e.g., exonucleases and / or endonucleases. Modified oligonucleotides that are resistant to nucleases and therefore stable in vivo Exemplary nucleic acid molecules for antisense oligonucleotides include phosphoramidates. , phosphothionate, and methylphosphonate DNA analogs (see, e.g., US Patent No. 5176966, U.S. Patent No. 5264564 and U.S. Patent No. 5256775 In addition, general methods for constructing oligomers useful in antisense therapy are available. For an overview of the techniques, see, for example, Van der Krol et al., BioTechniq ues 6:958-976, 1988 and Stein et al., CancerRes 4 8:2659-2668, 1988.

[0114] For example, antisense oligonucleotides are used to target genes from -10 to +10. The oligodeoxyribonucleotide region derived from the translation initiation site is preferred. The chisense approach involves the insertion of an oligonucleotide complementary to the mRNA encoding the target polypeptide. Antisense oligonucleotides involve the design of a molecule (either DNA or RNA). It may bind to NA transcripts and prevent translation.

[0115] In addition, in antisense techniques, a gene can be synthesized by using a gene encoding a non-coding 5' or 3' region complementary to the gene. Oligonucleotides could be used to inhibit translation of the mRNA. The oligonucleotide complementary to the 5' region should include the complement of the AUG start codon. Oligonucleotides complementary to mRNA coding regions are weak inhibitors of translation. However, they can also be used in accordance with the present invention. When designed to hybridize with a base region, the antisense nucleic acid should be at least 6 nucleotides in length, preferably less than about 100 nucleotides in length, More preferably, it has a length of less than about 50, 25, 17 or 10 nucleotides.

[0116] Preferably, in vitro studies are performed to determine whether antisense oligonucleotides inhibit gene expression. Advantageously, these studies should measure the ability of oligonucleotides to inhibit expression. A control was used to distinguish between antisense gene inhibition and nonspecific biological effects of oxidases. These studies may also be useful for controlling the levels of target RNA or protein in vivo. It is also preferable to compare the levels of RNA or protein in the target gene with those in the target gene. The results obtained with the oligonucleotide were significantly different from those obtained with the control oligonucleotide. The control oligonucleotide can be used to compare the results with the test oligonucleotide. and the oligonucleotide sequence is a specific hybrid to the target sequence. Preferably, the sequence differs from the antisense sequence by as much as necessary to prevent degradation. stomach.

[0117] Antisense oligonucleotides may be single-stranded or double-stranded DNA or RNA or chimeric The oligonucleotide may be a mixture of bases, or a derivative or modified version thereof. The sugar or phosphate backbone may be modified to affect, for example, the stability of the molecule, its hybridization ability, The oligonucleotides can enhance the activity of peptides (e.g., to target cell receptors) or drugs that help cross the cell membrane (Letsinger et al. , Proc. Natl. Acad. Sci. USA 86: 6553-6556, 1 989; Lemaitre et al., Proc. Natl. Acad. Sci. 84: 6 48-652, 1987; WO88 / 09810) or drugs that help cross the blood-brain barrier agents (WO 89 / 10134) or intercalating agents (Zon, Pharm. Res. 1999 88, 5: 539-549). Therefore, the oligonucleotide can be attached to another molecule, e.g., a peptide, a carrier substance, a hybridization agent, or The protein can be conjugated to a cleavage agent induced by cleavage of the protein.

[0118] In some cases, the antisense oligonucleotide is sufficient to inhibit translation of endogenous mRNA. It can be difficult to achieve intracellular concentrations of nucleotides. Therefore, a preferred approach is to , antisense oligonucleotides targeting strong promoters of pol III or pol II A recombinant DNA construct is used that is placed under the control of a gene encoding a nucleotide sequence.

[0119] Alternatively, the gene regulatory region (i.e., promoter and / or enhancer) may be involved. Targeting complementary deoxyribonucleotide sequences and transcribing genes in target cells in the body It forms a triple helix structure that prevents rug Des. 6(6):569-84, 1991), which reduces the expression of target genes It is possible.

[0120] In some embodiments, the antisense oligonucleotide is an antisense morpholine is.

[0121] [DNA enzyme] In another specific embodiment, the gene encoding TRPM8 is isolated using a specific DNA enzyme. DNA enzymes inhibit the expression of the enzymes. It contains some of the characteristics of both mechanisms. Like leutidine, it targets a specific nucleic acid sequence (in this case, the sequence encoding TRPM8). However, like ribozymes, DNA enzymes are designed to recognize specific sequences. It is a catalytic agent that specifically cleaves target nucleic acids.

[0122] [Ribozyme] In another specific embodiment, the target mRNA transcript is catalytically cleaved to inhibit its activity. designed to prevent translation of mRNA encoding TRPM8, Ribozymes are used to specifically cleave RNA [for review, see Ros See si, 1994, Current Biology 4:469-471. and ribozyme molecules capable of catalyzing the reaction. The sequence of the ribozyme molecule is preferably The mRNA cleavage site comprises one or more sequences complementary to the target mRNA and a known sequence involved in mRNA cleavage. or a functionally equivalent sequence (see, e.g., U.S. Pat. No. 5,093,246). include.

[0123] The ribozyme used in the present invention includes hammerhead ribozymes, endoribonuclease ribozymes, and the like. Examples include oase RNA [Zaug et al., 1984, Science 224: 574-578].

[0124] Ribozymes can be composed of modified oligonucleotides (e.g., for stability, orientation, etc.). In order to enhance the activity of the target gene, it should be distributed to cells that express the target gene in vivo. A new method of delivery involves inserting a DNA construct "encoding" the ribozyme into pol III or pol II under the control of a strong constitutive promoter, Producing sufficient amounts of ribozyme to destroy endogenous target messengers, thereby inhibiting translation In contrast to other antisense molecules, ribozymes are catalytic and therefore more It is necessary to be effective at low intracellular concentrations.

[0125] [microRNA] In another specific embodiment, a microRNA specific to the sequence encoding TRPM8 is used. As is known, microRNAs (miRNAs) are 21-25 nucleotide long molecules. It is a single-stranded RNA of length 1000 kJ / s, which is synthesized by multiple processes using the RNA interference pathway to encode other genes. It has the ability to regulate expression.

[0126] [iRNA] In another specific embodiment, a sequence encoding TRPM8 intended to inhibit activity is An interfering RNA (iRNA), such as a small interfering RNA (siRNA), specific for the sequence is used.

[0127] Small interfering RNAs, or siRNAs, inhibit the expression of target genes through RNA interference siRNA can be chemically synthesized or Alternatively, it can be obtained by in vitro transcription or synthesized in vivo in target cells. siRNAs are typically double-stranded oligonucleotides 15 to 40 nucleotides in length. It consists of RNA and may contain 3' and / or 5' overhanging regions of 1 to 6 nucleotides. The length of the region is independent of the total length of the siRNA molecule. They act by degradation or post-transcriptional silencing of the target protein.

[0128] siRNA can be called shRNA (short hairpin RNA), and siRN A is characterized in that the antiparallel strands forming A are connected by loop or hairpin regions. shRNAs target promoters such as the U6 promoter for RNA polymerase III. Encoded under control by a plasmid or virus, particularly a retrovirus can be done.

[0129] In a specific embodiment, the siRNA that can be used in the present invention encodes TRPM8. It is substantially homologous to the gene or mRNA of the genomic sequence encoding this protein. "Substantially homologous" means that the siRNP has a sequence that is sufficiently complementary or similar to the target mRNA, A is defined as a gene that can induce degradation of target mRNA by RNA interference. Suitable siRNAs for causing this interference include siRNAs formed by RNA. In addition to RNA, it also includes siRNAs containing various chemical modifications, such as: - The internucleotide linkages are naturally occurring, such as phosphorothioate linkages and different siRNAs; - conjugation of RNA strands with functional reagents, such as fluorophores; - modification of the 2'-hydroxyl with different functional groups to form the ends of the RNA strands; modifications, especially at the 3' end; - at the 2'-position, such as 2'-O-methylribose or 2'-O-fluororibose nucleotides with modified sugars, such as O-alkylated residues in - halogen bases (e.g., 5-bromouracil and 5-iodouracil), alkyl Nucleotides with modified bases, such as 7-methylguanosine .

[0130] The siRNA and shRNA that can be used in the present invention can be synthesized using several techniques known to those skilled in the art. The TRPM8 coding region, which serves as the basis for designing siRNA, can be obtained using the technique. The region of the nucleotide sequence to be read is not limited, and may include the region of the coding sequence (start codon and stop codon). Alternatively, it may contain 5' or 3' untranslated regions, preferably long A sequence of 25 to 50 nucleotides in length at any position in the 3' sense region from the start codon The method for designing siRNA can include those in which N binds to TRPM8. Identification of the motif AA(N19)TT, which can be any nucleotide in the loading sequence; Selection of those with a high G / C content is involved. If this motif is not found, N The motif NA(N21) can be identified, which can be any nucleotide.

[0131] In certain embodiments, the TRPM8 inhibitor is a compound selected from the group consisting of compounds listed in Table 3(5) [SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5]. 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9] iRNAs specific for TRPM8, such as specific iRNAs selected from the group formed by It is NA.

[0132] [Inhibitory peptides] In another specific embodiment, a TRPM8 inhibitor peptide is used to detect the presence of this protein. Serves any function, especially channeling the passage of sodium and calcium ions hinders.

[0133] The term "inhibitory peptide," as used herein, refers to a peptide that binds to TRPM8 and inhibits its activity. The activity can be inhibited as described above, i.e., sodium ions and calcium Refers to a peptide that can inhibit the passage of ions through the TRPM8 channel.

[0134] [Inhibitory antibody] In another specific embodiment, a TRPM8 inhibitor antibody is used to detect the presence of this protein in any of its These functions are mainly related to the passage of sodium and calcium ions through the endothelial cells. Thus, a TRPM8 "inhibitor" antibody, as used herein, is an antibody specific for TRPM8. It can bind specifically to inhibit the passage of sodium ions and calcium ions through the channel. The antibody can be prepared by any method known to those skilled in the art. Identifying antibodies capable of binding to TRPM8 can be used as an assay for identifying inhibitors. Using this method, antibodies capable of inhibiting the activity of this protein could be selected. [See, for example, Metz S et al., 2008, J. Biol. Chem. 283:5985- See 5995].

[0135] [Compound] In another specific embodiment, the activity of TRPM8 is decreased when contacted with this protein. Examples of compounds that can be used include, but are not limited to, BCTC and CTPC. , Thio-BCTC, SB-452533, SKF96365, Econazole, Clotrimazole Zol, ACA, AMTB, capsazepine, phenanthroline, MAD1d and MAD2 Examples of the compounds include those shown in Table 3 (compounds 8 to 20), such as compounds 1 and 2.

[0136] In a particular embodiment, the TRPM8 antagonist for the second use of the present invention is TRPM, an antisense oligonucleotide specific to the sequence of the gene encoding PM8 8. A microRNA specific for the gene encoding the sequence-specific DNA enzyme, TRPM8 , a ribozyme specific to the sequence of the gene encoding TRPM8, Interfering RNA specific to the gene sequence specifically binds to TRPM8 and inhibits its activity A peptide with the ability to specifically bind to TRPM8 and inhibit the activity of this channel Antibodies with anti-cancer properties, such as BCTC (N-(4-tert-butyl-phenyl)-4-(3-chloro- pyridin-2-yl)tetrahydropyrazine-1(2H)-carboxamide), CTPC (( 2R)-4-(3-chloro-2-pyridinyl)-2-methyl-N-[4-(trifluoromethyl) phenyl]-1-piperazine-carboxamide), thio-BCTC(N-(4-tert -butyl-phenyl)-4-(3-chloropyridin-2-yl)tetrahydropyrazine-1( 2H)-(thio)carboxamide), SB-452533 (N-(2-bromophenyl)-N '-(2-[ethyl(3-methylphenyl)amino]ethyl)urea), SKF96365(1 -[2-(4-methoxyphenyl)-2-[3-(4-methoxyphenyl)propoxy]ethyl -1H-imidazole), econazole (1-[2-[(4-chlorophenyl)methoxy]- 2-(2,4-dichlorophenyl)ethyl]-1H-imidazole), clotrimazole (1 -[(2-chlorophenyl)diphenylmethyl]-1H-imidazole), ACA(N-(p -amylcinnamoyl)anthranilic acid), AMTB (N-(3-aminopropyl)-2-{ [(3-methylphenyl)methyl]oxy}-N-(2-thienylmethyl)-benzamide), Capsazepine (N-[2-(4-chlorophenyl)ethyl]-1,3,4,5-tetrahydro- 7,8-dihydroxy-2H-2-benzazepine-2-carbothioamide), phenane Troline, MAD1d (N-[(1R,2S,5R)-2-isopropyl-5-methylcyclohexane hexyl]biphenyl-4-carboxamide), MAD2e (4-tert-butylphenyl Nyl(1R,2S,5R)-2-isopropyl-5-methylcyclohexylcarbamate The antagonist is selected from the group consisting of:

[0137] In another specific embodiment, the TRPM8 antagonist is a TRPM8-specific antagonist. He is a scientist.

[0138] [Second composition of the present invention] In another aspect, the present invention provides a method for treating epiphora using at least one TRPM8 antagonist. and optionally a pharmaceutically acceptable vehicle. This relates to a composition containing the compound (hereinafter referred to as the second composition of the present invention).

[0139] The term "TRPM8 antagonist" has already been explained, and the second composition of the present invention It is used in the same way in relation to.

[0140] The term "pharmaceutically acceptable vehicle" and the route of administration of the composition are used in the first aspect of the present invention. It has already been described in relation to the composition.

[0141] The term "lacrimation" has been explained in detail above and will be used in connection with the present compositions as well. , thus, Graves-Graves disease, corneal tumors, Ackerman syndrome, allergies (animal , pollen, etc.), bacterial conjunctivitis, blepharitis, facial nerve paralysis, ectropion, or nasolacrimal duct or lacrimal sac inflammation This refers to lacrimation that occurs as a symptom in various disorders such as eyelid irritation.

[0142] In certain embodiments, the TRPM8 antagonist used in the second composition of the present invention is TRPM, an antisense oligonucleotide specific to the sequence of the gene encoding PM8 8. A microRNA specific for the gene encoding the sequence-specific DNA enzyme, TRPM8 , a ribozyme specific to the sequence of the gene encoding TRPM8, Interfering RNA specific to the gene sequence specifically binds to TRPM8 and inhibits its activity A peptide with the ability to specifically bind to TRPM8 and inhibit the activity of this channel Antibodies with anti-cancer properties, such as BCTC (N-(4-tert-butyl-phenyl)-4-(3-chloro- pyridin-2-yl)tetrahydropyrazine-1(2H)-carboxamide), CTPC (( 2R)-4-(3-chloro-2-pyridinyl)-2-methyl-N-[4-(trifluoromethyl) phenyl]-1-piperazine-carboxamide), thio-BCTC(N-(4-tert -butyl-phenyl)-4-(3-chloropyridin-2-yl)tetrahydropyrazine-1( 2H)-(thio)carboxamide), SB-452533 (N-(2-bromophenyl)-N '-(2-[ethyl(3-methylphenyl)amino]ethyl)urea), SKF96365(1 -[2-(4-methoxyphenyl)-2-[3-(4-methoxyphenyl)propoxy]ethyl -1H-imidazole), econazole (1-[2-[(4-chlorophenyl)methoxy]- 2-(2,4-dichlorophenyl)ethyl]-1H-imidazole), clotrimazole (1 -[(2-chlorophenyl)diphenylmethyl]-1H-imidazole), ACA(N-(p -amylcinnamoyl)anthranilic acid), AMTB (N-(3-aminopropyl)-2-{ [(3-methylphenyl)methyl]oxy}-N-(2-thienylmethyl)-benzamide), Capsazepine (N-[2-(4-chlorophenyl)ethyl]-1,3,4,5-tetrahydro- 7,8-dihydroxy-2H-2-benzazepine-2-carbothioamide), phenane Troline, MAD1d (N-[(1R,2S,5R)-2-isopropyl-5-methylcyclohexane hexyl]biphenyl-4-carboxamide), MAD2e (4-tert-butylphenyl Nyl(1R,2S,5R)-2-isopropyl-5-methylcyclohexylcarbamate The antagonist is selected from the group consisting of:

[0143] Not only antibiotics but also the Chinese Patent Application Publication No. 101612199 and the International Patent Publication No. 08 / 066644, Russian Patent No. 2305517, Chinese Patent Application Publication No. 1775261 No. 1775263, No. 15655 No. 01, Chinese Patent Application Publication No. 1199617 and Japanese Patent Application Laid-Open No. 57-17912 Drugs useful for treating epiphora, such as the composition described in Patent Publication No. 1, are known to those skilled in the art. are.

[0144] In another aspect, the present invention relates to a method for the preparation of a medicament for the treatment of epiphora. In another aspect, the present invention relates to the use of the second composition of the present invention for the treatment of epiphora. In a third aspect, the present invention relates to a method for treating a rheumatoid arthritis, comprising administering to a subject a second composition of the present invention. , relates to a method for treating epiphora in a subject.

[0145] The following examples illustrate the present invention and should not be construed as limiting the scope of the invention. . [Example]

[0146] To functionally define the temperature sensitivity and coding capacity of intact cold-sensitive nerve endings, wild-type Nerve terminal impulse (NTI) activity in the cornea of ​​mouse eyes was recorded in vitro (Br ock, JA et al., 1998, J.Physiol512:211-217). low Thermoreceptor terminals were identified by spontaneous nerve impulses at 34°C, which increased in frequency with cooling. In addition to responding to menthol application, the rats were calmed by rewarming (Fig. 1A) (Schafer , K. et al., 1986, J.Gen.Physiol 88:757-776). 72% Cold-sensitive endings in the brain also respond to heat pulses (paradoxical response) (Long, RR , 1977, J. Neurophysiol. 40:489-502), 100 nM They also responded to psaicin (65%).

[0147] At basal body temperature (34°C), the spontaneous firing rate of cold-sensitive nerve endings was 4.0±0.4 impulses. The cold-sensitive nerve endings were occasionally observed in very regularly spaced intervals of 2 or more seconds (n=55). in response to any of a number of unique potentials, such as those seen in the burst of action potentials in The cooling pulse from 34°C to 20°C gradually increased with the temperature decrease. , impulse discharges that reach a peak frequency and are suppressed or subsided after reaching a lower temperature. During the cooling ramp, all 55 cold-sensitive terminals were recorded. The recorded average firing frequency and the temperature decrease over time are shown in Figure 1B. The temperature threshold for eliciting this was less than 2°C (mean value -1.5 ± 0.2°C, Fig. 1C). When the temperature drops below 1°C, about 30% of the temperature-sensitive units have already significantly decreased their firing frequency. The mean peak frequency during the cooling ramp was 37.6 ± 1.8 impulses / sec. (n=55).

[0148] The temperature sensitivity of the corneal cryoreceptors is expressed as the number of degrees Celsius of temperature decrease during a continuous cooling gradient. Expressed as a change in fire frequency, it varied between recording units. The average gradient was 6.3 ±1.0 impulses / sec / °C (n=55) (red line in Figure 1D). A cooling step of -2.5°C was also administered to assess the ability of cold-sensitive endings to encode sustained temperature. The initial temperature drop resulted in a temporary decrease in firing rate, which allowed the firing rate to adapt to a new steady-state level (Fig. 1E). Corneal cryoreceptors encode static temperature over a wide temperature range. The response to cold was characterized by an increase in firing frequency; In many cases, significant changes in the potential waveform occurred suddenly (Fig. 1E, Table 1). Deformation was displayed (Brock, JA et al., 1998, J. Physiol. 512 :211-217). Figure 1F shows the static and dynamic changes in firing rate for 10 cold receptors. The dynamic changes in the corneal receptors were summarized, demonstrating the remarkable thermosensitivity of the corneal receptors to small changes in temperature. vinegar.

[0149] Menthol (50 μM), a well-known activator of cold-sensitive afferent nerves (Schafe r, K. et al., 1986, J. Gen. Physiol. 88:757-776) Increased spontaneous activity in 98% of the terminals tested (Fig. 1A) (3.4 ± 0.3 impulses). impulses / sec ~ 18.4 ± 1.4 impulses / sec; p < 0.001, n = 44, paired t-test) The proportion of terminals with a spontaneous firing pattern at 34 °C was significantly increased during perfusion with menthol ( 44%), which was almost 10 times higher than before treatment (5%). In the presence of menthol, the cooling gradient induced an increase in firing frequency, resulting in a higher At high temperatures (control: 26.7±0.5°C; menthol: 28.6±0.5°C, n=44 ; p < 0.001, paired t test) reached peak frequency at higher temperatures (control: 23. 8±0.4°C; menthol: 25.2±0.4°C; p<0.05, paired t-test) BCTC is a potent and reversible blocker of the TRPM8 ion channel in vitro. (Madrid, R. et al., 2006, J. Neurosci. 26:12512 -12525;Jordt, SE et al., 2004, Nature 427:260- 265). The effect of a saturating concentration of BCTC (10 μM) on sensitive terminals was studied. The spontaneous activity and increased firing rate of menthol-evoked discharges gradually decreased, and the increase continued for 90 min. These effects of BCTC were almost completely abolished after perfusion of BCTC in TRPA1(- / -) mice. The decrease in activity was partially reversed with respect to BCTC removal, and was observed in the absence of drug. This suggests that the activity of thermosensitive nerve terminals is mainly mediated by the TRPM8 channel. In contrast to the stimulating effect of menthol, the cold-sensitive Allyl-isothiocyanate (A), a specific TRPA1 agonist tested at nerve terminals ITC, 100 μM) (Bandell, M. et al., 2004, Neuron 41:8 49-857) failed to modify spontaneous or cold-induced activity in 24 of them. Only four nerve endings showed a significant increase in firing frequency when perfused with AITC at basal body temperature. This was due to the fact that the majority of cold-sensitive corneal endings showed a significant increase in TRP levels (data not shown). This suggests that the expression of A1 channels is absent or low. The results confirm the previously reported limited overlap of TRPM8 and TRPA1 expression (Story, This is also consistent with GM et al., 2003, Cell 112:819-829).

[0150] IKD acts as an excitatory brake on temperature-induced activation of sensory neurons It is a shaker-like voltage-dependent potassium current that determines the thermal threshold in thermoreceptors. (Madrid, R. et al., 2009, J. Neurosci. 29:3 120-3131). 4-aminopyridine (4-AP, 100μL), a current IKD blocker, M) to investigate whether this current affects the temperature sensitivity of the cold nerve endings in the cornea. In three of the nine units tested, spontaneous activity increased significantly after 4-AP perfusion. Although the cold thresholds were increased, no parallel changes were observed in these terminal cold thresholds. In all 4-AP-treated terminals, the mean peak frequency of the cold response was compared with the control value. 39±6% (p<0.001, n=9). The thermal threshold of the cold receptor nerve endings in the cornea was at least significantly increased by the shaker-like Kv1 channel. These terminals belong to low-threshold cold receptor neurons. (Belmonte, C. et al., 2009, Exp Brain Res. 196:1 3-30).

[0151] Subsequently, the enhanced yellow fluorescent protein (EYFP) was expressed under the control of the TRPM8 regulatory sequence. We used genetically engineered mice (TRPM8-EYFP mice, Figure 2) to measure cold sensitivity. The presence, morphology, and density of nerve fibers predicted to express the TRPM8 channel were analyzed. We analyzed the mouse cornea. Putative TRPM8-positive nerve fibers were found throughout the entire cornea. The stromal nerve bundles penetrated the outer third of the corneal stroma (Fig. 2 A–C). Approximately 1 in 9 keratinocyte axons was TRPM8-positive (Fig. 2C). Branches from the stromal plexus penetrate into Bowman's layer, which is located between the corneal stroma and the corneal epithelium. Under the basal epithelial cells, several subbasal cells running parallel to each other towards the center of the cornea are They branch into nerve fibers (fiber tufts) (Fig. 2D-H). Some TRPM8-positive subbasal fibers Within this subbasal plexus, one terminal nerve had already arisen (Figure 2H, arrow). Most of them form side branches that ascend to the surface epithelial layer and terminate in asymmetric radial tufts. Unlike non-fluorescent sensory fibers, they probably have polymodal and The mechano-nociceptive fibers, TRPM8-positive terminal axons, branch sparsely within the epithelium and In all cases, the sarcoids terminated in a small number of brush-like endings in the superficial epithelial cell layer (Fig. 2J-K). The subbasal epithelial fibrous structures and intraepithelial terminal endings exhibited a beaded morphology (Fig. 2H-K). Using double immunofluorescence staining for fluorescent protein (GFP) and neurofilaments The putative cold receptor fibers account for approximately 12% of the total number of subbasal nerve fibers and 12% of the total number of superficial intraepithelial nerve fibers. We determined that it accounts for approximately 10% of the terminal end of the thorax (see also Methods section; Fig. 2C, F, K, L).

[0152] Next, cold-induced nerve impulse discharge in TRPM8(- / -)-EGFPki mice Investigating electrical activity (Dhaka, A. et al., 2007, Neuron 54:371-378 ), we determined the contribution of TRPM8 channels to cold sensitivity. -) We attempted to record sensory end responses in the cornea. However, the entire corneal surface was not recorded. Of the hundreds of trials repeatedly investigated in PET (Fig. 3A, dotted lines), 14 nerve terminals In these cases, spontaneous activity was detected at a low frequency (0.6± 0.2 impulses / s, n = 14), cooling only in one TRPM8(- / -) terminal Firing frequency increased during the cooling gradient, reaching a threshold temperature of 28.4°C and a 3-in. Menthol was a potent activator of TRPM8 channels, with a peak frequency of 100 pulses per second. (McKemy, DD et al., 2002, Nature 416:52-58 ) Perfusion of 50 μM menthol increased firing frequency at basal body temperature of 34°C or during a cooling gradient. This result suggests that TRPM8 expression did not increase the serotonin level (n = 6) (Fig. 3A, dotted line). This is consistent with the existence of a dependency of spontaneous and cold-induced activity in cold-sensitive terminals on the cold-sensing potential. Psaicin (100 nM) inhibited the six active units detected in TRPM8(- / -) corneas. Tested with a knitted fabric, two terminals were subjected to a small impulse (5 impulses and In some cases, it elicited a short (8 impulse) discharge, while in others it elicited a powerful discharge lasting more than 30 seconds.

[0153] In contrast to the profound inhibition of spontaneous and cold-induced activity observed in TRPM8(- / -) mice Specifically, the corneal nerve endings of TRPA1(- / -) mice (Kwan, KY et al., 2006) , Neuron. 50:277-289) showed firing rates and cold responses similar to those of wild-type animals. In summary, these results suggest that TRPA1 channels mediate the corneal These results confirm that cold-sensitive endings are not important molecular determinants of cold sensitivity. These results are consistent with our previous findings in cultured trigeminal sensory neurons (JN eurosci., 2009, 29:3120-3131). TRPM8(- / -) horn To exclude the possibility that the cold-sensing nerve endings in the membrane were absent or morphologically altered, These corneas were then stained with antibodies against GFP to express truncated TRPM8 channels. The morphology of nerve fibers was visualized (Dhaka, A. et al., 2008, J. Neurosc i. 28:566-57). The distribution of stained nerve fibers in various regions of the corneal periphery was However, there was a large variation among TRPM8(- / -) animals. The general morphology of tufted intraepithelial nerve endings was TRPM8-EYFP positive in all cases. Furthermore, there was no significant difference in the overall density of terminals. Therefore, the lack of activity and cold response observed in the electrophysiological tests was due to the lack of access to the recording pipette. The possibility that it was due to an untimely end has been ruled out.

[0154] In addition, low expression of the TRPM8.30 channel is predicted to reduce the response to cold. We investigated cold-induced activity in TRPM8(+ / -) mice. The nerve endings in the sham nerve were spontaneously active, with the exception of the cold-insensitive units that showed spontaneous activity. In contrast to wild-type animals (7%), they lacked cold and menthol sensitivity. During the end of menstruation, mean spontaneous activity at 34°C was significantly lower than in TRPM8(+ / +) animals. (2.2±0.4 impulses / sec vs. 4.4±0.9 impulses / sec, n=11; p=0. 025, Mann-Whitney test) while during the cooling gradient, it was found that The threshold temperature required for the treatment was lower than that of wild-type mice (30.6 ± 0.5°C vs. 32.7±0.4°C, p=0.004, Mann-Whitney test), mean peak during cooling The frequency of corneal ulcers was significantly lower in TRPM8(+ / -) corneas than in wild-type mice (19.4±3 0.4 impulses / sec vs. 33.8 ± 3.5 impulses / sec, p = 0.008, t-test) This was confirmed (Figure 3A, solid line). Menthol (50 μM) increased the activity of TRPM8(+ / -) mice. The firing frequency at basal body temperature was significantly lower in TRPM8(+ / +) animals than in TRPM8(+ / +) animals. , increased the cold sensation threshold and peak frequency (Fig. 3A, solid line).

[0155] Next, if tear production is related to neural activity of cold receptor fibers, T We reasoned that basal tear flow would be reduced in RPM8(- / -) mice. Figure 4A shows this. This shows that tear volume is actually a fact. Red threads are expressed as the length stained and collected for 2 min. Tear volume measured in mice (1.5 ± 0.2 mm, n = 23) was significantly higher than that in wild-type animals (3.7 ±0.4 mm, n=35, p<0.001). The basal tear volume of PA1(- / -) mice was not significantly different from that of wild-type animals (Fig. 4A, black On the other hand, TRPV1 and TRPA1 channels in polymodal nociceptors Topical administration of two well-known irritants, capsaicin (1 μM) and AITC (500 μM), Application significantly increased tear flow in the eyes of TRPM8(- / -) and wild-type mice. The vehicle did not increase the expression of β-glucan (Figure 4B).

[0156] Next, we investigated whether the relationship between corneal temperature and basal tear flow also exists in human subjects. In separate sessions, the temperature was measured at 18°C, 25°C, and a constant humidity of 32%. and 11 young human (28.9±1.8 years) subjects exposed to an ambient temperature of 43°C for 10 minutes. The amount of tear flow was measured. These environmental temperature exposures increased the corneal temperature by 32°C, respectively. These values ​​were 34.2±0.1°C, 36.0±0.2°C, and 36.4±0.4°C. There was a significant difference (p<0.001, repeated measures ANOVA). In contrast, only in the 43°C environment , tear flow was significantly reduced: 17.1 ± 1.4 mm vs. 22.8 ± 1.2 mm at 25°C or At 18°C, it was 23.2 ± 2.3 mm (repeated measures ANOVA, p = 0.006) (Figure 4C). Repeated exposure to 3°C (corneal temperature 36±0.1°C) at an environmental humidity level of 62.5% resulted in a 3 The decrease in tear flow rate was no different from that in the 2% humidity environment (17.6±2.4 mm). Experiments were performed on anesthetized wild-type mice by placing them under the same environmental conditions used in human experiments. This was replicated in TRPM8(- / -) and TRPM8(- / -) mice, i.e., these mice were kept under constant humidity conditions. The mean corneal temperature of wild-type mice was 36.4±0. When the temperature was raised to 2°C (n = 11), the tearing decreased to 1.8 ± 0.4 mm (Figure 4 A), whereas in a moderate temperature environment, the mean corneal temperature was 27.2 ± 0.1°C (n = 6 ), and the tear flow value was 4.6±0.8mm (p=0.017, Mann-Whitney test). In contrast, TRPM8(- / -) mice exposed to similar conditions showed no change in corneal surface temperature. When the LAMB smear was performed, tear flow rate did not differ significantly (Fig. 4A).

[0157] Sequence information SEQUENCE LISTING <110> UNIVERSIDAD MIGUEL HERNANDEZ DE ELCHE CONSEJO SUPERIOR DE INVESTIGACIONES CIENTIFICAS <120> PHARMACEUTICAL COMPOSITION FOR THE TREATMENT OF DRY EYE <150> ES P201031341 <151> 2010-09-08 <160> 9 <170> PatentIn version 3.5 <210> 1 <211> 1104 <212> PRT <213> Homo sapiens <400> 1 Met Ser Phe ArgAla Ala Arg Leu Ser Met Arg Asn Arg Arg Asn Asp 1 5 10 15 Thr Leu Asp SerThr Arg Thr Leu Tyr Ser Ser Ala Ser Arg Ser Thr 20 25 30 Asp Leu Ser TyrSer Glu Ser Asp Leu Val Asn Phe Ile Gln Ala Asn 35 40 45 Phe Lys ArgGlu Cys Val Phe Thr Lys Asp Ser Lys Ala Thr 50 55 60 Glu Asn Valves Cys Gly Tyr Ala Gln Ser Gln His Met Glu Gly 65 70 75 80 Thr Gln With AsnGln Ser Glu Lys Trp Asn Tyr Lys His Thr Lys 85 90 95 Glu Phe Pro ThrAsp Ala Phe Gly Asp Ile Gln Phe Glu Thr Leu Gly 100 105 110 Lys Gly LysTyr Ile Arg Leu Ser Cys Asp Thr Asp Ala Glu Ile 115 120 125 Leu Tyr Glu LeuLeu Thr Gln His Trp His Leu Lys Thr Pro Asn Leu 130 135 140 Val Ile Ser ValThr Gly Gly Ala Lys Asn Phe Ala Leu Lys Pro Arg 145 150 155 160 Met Arg Lys IlePhe Ser Arg Leu Ile Tyr Ile Ala Gln Ser Lys Gly 165 170 175 Ala Trp Ile LeuThr Gly Gly Thr His Tyr Gly Leu Met Lys Tyr Ile 180 185 190 Gly Glu Val ValArg Asp Asn Thr Ile Ser Arg Ser Ser Glu Glu Asn 195 200 205 Ile Val Ala IleGly Ile Ala Ala Trp Gly Met Val Ser Asn Arg Asp 210 215 220 Thr Leu Ile ArgAsn Cys Asp Ala Glu Gly Tyr Phe Leu Ala Gln Tyr 225 230 235 240 Leu Met Asp AspPhe Thr Arg Asp Pro Leu Tyr Ile Leu Asp Asn Asn 245 250 255 His Thr His LeuLeu Leu Val Asp Asn Gly Cys His Gly His Pro Thr 260 265 270 Val Glu Ala LysLeu Arg Asn Gln Leu Glu Lys Tyr Ile Ser Glu Arg 275 280 285 Thr Ile Gln AspSer Asn Tyr Gly Gly Lys Ile Pro Ile Val Cys Phe 290,295,300 Only Gln Gly GlyGly Lys Glu Thr Leu Lys Only Asn Thr Ser Ile 305 310 315 320 Lys Asn Lys IlePro Cys Val Val Val Glu Gly Ser Gly Gln Ile Ala 325 330 335 Asp Val Ile AlaSer Leu Val Glu Val Glu Asp Ala Leu Thr Ser Ser 340 345 350 Ala Val Lys GluLys Leu Val Arg Phe Leu Pro Arg Thr Val Ser Arg 355 360 365 Leu Pro Glu GluGlu Thr Glu Ser Trp Ile Lys Trp Leu Lys Glu Ile 370 375 380 Leu Glu Cys SerHis Leu Leu Leu Thr Val Ile Lys Met Glu Glu Ala Gly 385 390 395 400 Asp Glu Contains ValSer Asn Containing Tyr Containing Tyr Containing Leu Tyr Lys Containing Phe 405 410 415 Ser Thr Ser GluGln Asp Lys Asp Asn Trp Asn Gly Gln Leu Lys Leu 420 425 430 Leu Leu Glu TrpAsn Gln Leu Asp Leu Ala Asp Glu Ile Phe Thr 435 440 445 Asn Asp Arg ArgTrp Glu Ser Ala Asp Leu Gln Glu Val Met Phe Thr 450 455 460 Ala Leu Ile LysAsp Arg Pro Lys Phe Val Arg Leu Phe Leu Glu Asn 465 470 475 480 Gly Leu Asn LeuArg Lys Phe Leu Thr His Asp Val Leu Thr Glu Leu 485 490 495 Phe Ser Asn HisPhe Ser Thr Leu Val Tyr Arg Asn Leu Gln Ile Ala 500 505 510 Lys Asn Ser TyrAsn Asp Ala Leu Leu Thr Phe Val Trp Lys Leu Val 515 520 525 Ala Asn Phe ArgArg Gly Phe Arg Lys Glu Asp Arg Asn Gly Arg Asp 530 535 540 Glu Met Asp IleGlu Leu His Asp Val Ser Pro Ile Thr Arg His Pro 545 550 555 560 Leu Gln Ala LeuPhe Ile Trp Ala Ile Leu Gln Asn Lys Lys Glu Leu 565 570 575 Ser Lys Val IleTrp Glu Gln Thr Arg Gly Cys Thr Leu Ala Ala Leu 580 585 590 Gly Ala Ser LysLeu Leu Lys Thr Leu Ala Lys Val Lys Asn Asp Ile 595 600 605 Asn Ala GlyGlu Ser Glu Glu Leu Ala Asn Glu Tyr Glu Thr Arg 610 615 620 Ala Val Glu LeuPhe Thr Glu Cys Tyr Ser Ser Asp Glu Asp Leu Ala 625 630 635 640 Glu Gln LeuVal Tyr Cys Ser Glu Ala Trp Gly Gly Ser Asn Cys 645,650,655 Leu Glu Leu AlaVal Glu Ala Thr Asp Gln His Phe Ile Ala Gln Pro 660,665,670 Gly Val Gln AsnPhe Leads to Lys Gln Trp Tyr Gly Glu With Ser Arg 675,680,685 Asp Thr Lys AsnTrp Lys Ile and Cys Leu Phe Ile Ile Pro Leu 690,695,700 Val Gly Cys GlyPhe Val Ser Phe Arg Lys Pro Val Asp Lys His 705 710 715 720 Lys Lys LeuTrp Tyr Tyr Val Ala Phe Phe Thr Ser Pro Phe Val 725 730 735 Val Phe Ser TrpAsn Val Phe Tyr Ile Ala Phe Leu Leu Leu Phe 740,745,750 Ala Tyr Val LeuLeu Met Asp Phe His Ser Val Pro His Pro Pro Glu 755,760,765 Leu Val Leu TyrSer Leu Val Phe Val Leu Phe Cys Asp Glu Val Arg 770 775 780 Gln Trp Tyr ValAsn Gly Val Asn Tyr Phe Thr Asp Leu Trp Asn Val 785 790 795 800 Met Asp Thr LeuGly Leu Phe Tyr Phe Ile Ala Gly Ile Val Phe Arg 805 810 815 Leu His Ser SerAsn Lys Ser Ser Leu Tyr Ser Gly Arg Val Ile Phe 820 825 830 Cys Leu Asp TyrIle Ile Phe Thr Leu Arg Leu Ile His Ile Phe Thr 835 840 845 Val Ser Arg AsnLeu Gly Pro Lys Ile Ile Met Leu Gln Arg Met Leu 850 855 860 Ile Asp Val PhePhe Phe Leu Phe Leu Phe Ala Val Trp Met Val Ala 865 870 875 880 Phe Gly Val AlaArg Gln Gly Ile Leu Arg Gln Asn Glu Gln Arg Trp 885 890 895 Arg Trp Ile PheArg Ser Val Ile Tyr Glu Pro Tyr Leu Ala Met Phe 900 905 910 Gly Gln Val ProSer Asp Val Asp Gly Thr Thr Tyr Asp Phe Ala His 915 920 925 Cys Thr Phe ThrGly Asn Glu Ser Lys Pro Leu Cys Val Glu Leu Asp 930 935 940 Glu His Asn LeuPro Arg Phe Pro Glu Trp Ile Thr Ile Pro Leu Val 945 950 955 960 Cys Ile Tyr MetLeu Ser Thr Asn Ile Leu Leu Val Asn Leu Leu Val 965 970 975 Ala Met Phe GlyTyr Thr Val Gly Thr Val Gln Glu Asn Asn Asp Gln 980 985 990 Val Trp Lys PheGln Arg Tyr Phe Leu Val Gln Glu Tyr Cys Ser Arg 995 1000 1005 Leu Asn Ile Pro Phe Pro Phe Ile Val Phe Ala Tyr Phe Tyr Met 1010 1015 1020 Val Val Lys Lys Cys Phe Lys Cys Cys Cys Lys Glu Lys Asn Met 1025 1030 1035 Glu Ser Ser Val Cys Cys Phe Lys Asn Glu Asp Asn Glu Thr Leu 1040 1045 1050 Ala Trp Glu Gly Val Met Lys Glu Asn Tyr Leu Val Lys Ile Asn 1055 1060 1065 Thr Lys Ala Asn Asp Thr Ser Glu Glu Met Arg His Arg Phe Arg 1070 1075 1080 Gln Leu Asp Thr Lys Leu Asn Asp Leu Lys Gly Leu Leu Lys Glu 1085 1090 1095 Ile Ala Asn Lys Ile Lys 1100 <210> 2 <211> 5621 <212> DNA <213> Homo sapiens <400> 2 aagaaaatcctgcttgacaa aaaccgtcac ttaggaaaag atgtccttcgggcagccag 60 gctcagcatg aggaacagaaggaatgacac tctggacagc acccggaccc tgtactccag 120 cgcgtctcggagcacagact tgtcttacag tgaaagcgac ttggtgaattttattcaagc 180 aaatttaagaaacgagaat gtgtcttctt taccaaagat tccaaggccacggagaatgt 240 gtgcaagtgtggctatgcc agagccagca catggaaggc acccagatcaaccaaagtga 300 gaaatggaactacaagaaac acaccaagga atttcctacc gacgccttttggggatattca 360 gttgagacactggggaaga aagggaagta tatacgtctg tcctgcgacacggacgcgga 420 aatccttacgagctgctga cccagcactg gcacctgaaa acacccaacctggtcatttc 480 tgtgaccgggggcgccaaga acttcgccct gaagccgcgc atgcgcaaga tcttcagccg 540 gctcatctacatcgcgcagt ccaaaggtgc ttggattctc acgggaggcacccattatgg 600 cctgatgaagtacatcgggg aggtggtgag agataacacc atcagcaggagttcagagga 660 gaatattgtggccattggca tagcagcttg gggcatggtc tccaaccgggacaccctcat 720 caggaattgcgatgctgagg gctatttttt agcccagtac cttatggatgacttcacaag 780 agatccactgtatatcctgg acaacaacca cacacatttg ctgctcgtggacaatggctg 840 tcatggacatcccactgtcg aagcaaagct ccggaatcag ctagagaagt atatctctga 900 gcgcactattcaagattcca actatggtgg caagatcccc attgtgtgttttgcccaagg 960 aggtggaaaagagactttga aagccatcaa tacctccatc aaaaataaaa ttccttgtgt 1020 ggtggtggaaggctcgggcc agatcgctga tgtgatcgct agcctggtgg aggtggagga 1080 tgccctgacatcttctgccg tcaaggagaa gctggtgcgc tttttacccc gcacggtgtc 1140 ccggctgcctgaggaggaga ctgagagttg gatcaaatgg ctcaaagaaa ttctcgaatg 1200 ttctcacctattaacagtta ttaaaatgga agaagctggg gatgaaattg tgagcaatgc 1260 catctcctacgctctataca aagccttcag caccagtgag caagacaagg ataactggaa 1320 tgggcagctgaagcttctgc tggagtggaa ccagctggac ttagccaatg atgagatttt 1380 caccaatgaccgccgatggg agtctgctga ccttcaagaa gtcatgttta cggctctcat 1440 aaaggacagacccaagtttg tccgcctctt tctggagaat ggcttgaacc tacggaagtt 1500 tctcacccatgatgtcctca ctgaactctt ctccaaccac ttcagcacgc ttgtgtaccg 1560 gaatctgcagatcgccaaga attcctataa tgatgccctc ctcacgtttg tctggaaact 1620 ggttgcgaacttccgaagag gcttccggaa ggaagacaga aatggccggg acgagatgga 1680 catagaactc cacgacgtgtctcctattac tcggcacccc ctgcaagctc tcttcatctg 1740 ggccattcttcagaataaga aggaactctc caaagtcatt tgggagcaga ccaggggctg 1800 cactctggcagccctgggag ccagcaagct tctgaagact ctggccaaag tgaagaacga 1860 catcaatgctgctggggagt ccgaggagct ggctaatgag tacgagaccc gggctgttga 1920 gctgttcactgagtgttaca gcagcgatga agacttggca gaacagctgc tggtctattc 1980 ctgtgaagcttggggtggaa gcaactgtct ggagctggcg gtggaggcca cagaccagca 2040 tttcatcgcccagcctgggg tccagaattt tctttctaag caatggtatg gagagatttc 2100 ccgagacaccaagaactgga agattatcct gtgtctgttt attataccct tggtgggctg 2160 tggctttgtatcatttagga agaaacctgt cgacaagcac aagaagctgc tttggtacta 2220 tgtggcgttcttcacctccc cttcgtggt cttctcctgg aatgtggtct tctacatcgc 2280 cttcctcctgctttgcct acgtgctgct catggatttc cattcggtgc cacacccccc 2340 cgagctggtcctgtactcgc tggtctttgt cctcttctgt gatgaagtga gacagtggta 2400 cgtaaatggggtgaattatt ttactgacct gtggaatgtg atggacacgc tggggcttt 2460 ttacttcatagcaggaattg tatttcggct ccactcttct aataaaagct cttgtattc 2520 tggacgagtcatttctgtc tggactacat tattttcact ctaagattga tccacatttt 2580 tactgtaagcagaaacttag gacccaagat tataatgctg cagaggatgc tgatcgatgt 2640 gttcttcttctgttcctct ttgcggtgtg gatggtggcc tttggcgtgg ccaggcaagg 2700 gatccttagg cagaatgagcagcgctggag gtggatattc cgttcggtca tctacgagcc 2760 ctacctggccatgttcggcc aggtgcccag tgacgtggat ggtaccacgt atgactttgc 2820 ccactgcaccttcactggga atgagtccaa gccactgtgt gtggagctgg atgagcacaa cctgccccggttccccgagt ggatcaccat ccccctggtg tgcatctaca tgttatccac 2940 caacatcctgctggtcaacc tgctggtcgc catgtttggc tacacggtgg gcaccgtcca ggagaacaatgaccaggtct ggaagttcca gaggtacttc ctggtgcagg agtactgcag ccgcctcaatatccccttcc ccttcatcgt cttcgcttac ttctacatgg tggtgaaga 3120 3180. gtgcttcaagtgttgctgca aggagaaaaa catggagtct tctgtctgct gtttcaaaaa tgaagacaatgagactctgg catgggaggg tgtcatgaag gaaaactacc ttgtcaagat 3300. cctcagagga aatgaggcat cgatttagac aactggatac aaagcttaatgatctcaagg gtcttctgaa agagattgct aataaatca aataaactg 3420. 3420. 3420. 3420. 3420. 3420. 3420. 3420. 3420 acaatttgctatcgactac taaatgagag atttcagac ccctgggtac atggtggatg 3480 attttaaatc accctagtgtgctgagacct tgagaataaa gtgtgtgatt ggtttcatac 3540 ttgaagacggatataaagga agaatatttc ctttatgtgt ttctccagaa tggtgcctgt 3600 ttctctctgtgtctcaatgc ctgggactgg aggttgatag tttaagtgtg ttcttaccgc 3660 ctccttttcctttaatctt atttttgatg aacacatata taggagaaca tctatcctat 3720 gaataagaacctggtcatgc tttactcctg tattgttatt ttgttcattt caattgatt 3780 ctctacttttccctttttg tattatgtga ctaattagtt ggcatattgt taaaagtctc 3840 tcaaattaggccagattcta aaacatgctg cagcaagagg accccgctct cttcaggaaa 3900 agtgtttcatttctcagga tgcttcttac ctgtcagagg aggtgacaag gcagtctctt 3960 gctctcttggactcaccagg ctcctattga aggaaccacc cccattccta aatatgtgaa 4020 aagtcgcccaaaatgcaacc ttgaaaggca ctactgactt tgttcttatt ggatactcct 4080 cttattattttccattaaa aataatagct ggctattata gaaaatttag accatacaga 4140 gatgtagaaagaacataat tgtccccatt accttaaggt atcactgct aacaatttct 4200 ggatggtttttcaagtctat tttttcta tgtagtctc aattcttt caaaatttta 4260 cagaatgttatcatactaca tatatacttt ttatgtaagc ttttcactt agtattttat 4320 caatatgttttatat tcatagcctt cttaaacatt atatcaataa ttgcataata 4380 ggcaacctctagcgattacc atattttgc tcattgaagg ctatctccag ttgatcattg 4440 ggatgagcatctttgtgcat gatcctatt gctgtatttg ggaaaatttt ccaaggttag 4500 attccaaataatctattt attattaaat attaaatat ctattatta ttaaaaccat 4560 ttaaggcttttcataaa tgtatagca taggaatta ttaacttgag cataagatat 4620 gagatacatgaacctgaact atttaaata atattatat tttaaccctta gtttagaag 4680 aagtcaatgcttatttaa atattatgga tggtgggcag atcacttgag gtcaggagtt 4740 cgagaccagcctggccaaca tgcaaaacc acatctc taaaaataa aaaattagct 4800 gggtgtggtggtgcactcct gtaatcccag ctactcagaa ggctgaggta caagaattgc 4860 tggaacctggggaggcggagg ttgcagtgaa ccaagattgc accactgcac tccagccggg gtgacagagtgagactccga ctgaaata father father father 4980 attatggatggtgaaggga tggtatagaa ttggagagat tatcttactg aacacctgta gtcccagctttctctggaag tggtcgtatt tgagcaggat gtgcacaagg caattgaaat gcccataatt agtttctcagctttgaatc actataaact cactggctga aggaggaat tttagaaggaagctactaa agatctaatt tgaaaaacta caaaagcatt aactaaaaaa gtttattttccttttgtctg ggcagtagtg aaaataacta ctcacaacat tcactatgtt tgcaaggattacacaaat aaaagatgcc tttttactta aacaccaaga cagaaactt gcccaatactgagaagcaac ttgcattaga gaggaactg ttaaatgttt tcaacccagt tcatctggtggatgtttttg caggttactc tgagaatttt gcttatgaaa aatcattatt tttagtgtagttcacaataa tgtattgac atacttctaa tcaaaggtgc tatgtccttg tgtatggtactaaatgtgtc ctgtgtactt ttgcacaact gagaatcctg cagcttggtt 5580 taatgagtgtgttcatgaaa taaataatgg aggaattgtca 5621 <210> 3 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Interference RNA <400> 3 agaaauucucgaauguucuuu 21 <210> 4 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> Interference RNA <400> 4 uuucuuuaagagcuuacaaga 21 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Interference RNA <400> 5 gaaaacacccaacctggtcatttc 24 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Interference RNA <400> 6 caccgtgcggggtaaaaagcg 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Interference RNA <220> <221> misc_feature <222> (21)..(22) <223> Deoxythymidine <400> 7 ucucugagcg cacuauucatt 21 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Interference RNA <220> <221> misc_feature <222> (18)..(19) <223> deoxythymidine <400> 8 uauccgucggucaucuatt 19 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Interference RNA <220> <221> misc_feature <222> (20)..(21) <223> Deoxythymidine <400> 9 tctctgagcgcactattcatt 21

Claims

1. A therapeutically effective amount of WS-12, a TRPM8 agonist, for use in treating or alleviating persistent dryness of the conjunctiva in a subject suffering from xerophthalmia. 【Chemistry 1】 1. An ophthalmic pharmaceutical composition comprising:

2. A therapeutically effective amount of WS-12, a TRPM8 agonist, for use in treating or alleviating dry eye syndrome in a subject in need thereof. 【Chemistry 2】 1. An ophthalmic pharmaceutical composition comprising:

3. An ophthalmic pharmaceutical composition comprising a TRPM8 agonist or a combination thereof for use in treating or alleviating dry eye syndrome in a subject in need thereof, wherein the TRPM8 agonist is: 【Transformation 3】 An ophthalmic pharmaceutical composition comprising:

4. An ophthalmic pharmaceutical composition described in any one of claims 1 to 3, characterized in that the ophthalmic pharmaceutical composition is administered at variable times per day.

5. An ophthalmic pharmaceutical composition described in any one of claims 1 to 3, characterized in that the ophthalmic pharmaceutical composition is administered 1 to 4 times a day.

6. An ophthalmic pharmaceutical composition described in any one of claims 1 to 3, wherein the subject is suffering from vitamin A deficiency, Sjogren's syndrome, a rheumatic disease, a chemical burn or thermal injury, or the subject is receiving treatment with atenolol, chlorpheniramine, hydrochlorothiazide, isotretinoin, ketorolac, ketotifen, levocabastine, levofloxacin, oxybutynin, or tolterodine.

7. An ophthalmic pharmaceutical composition described in any one of claims 1 to 3, which contains at least one additional TRPM8 agonist.

8. An ophthalmic pharmaceutical composition described in any one of claims 1 to 3, which contains at least one additional drug useful for treating dry eye syndrome.

9. The ophthalmic pharmaceutical composition described in any one of claims 1 to 3, further comprising at least one additional compound selected from the group consisting of corticoids, vitamin A, pilocarpine, carbomer, cyclosporine, glycerol, hydroxypropylmethylcellulose, hydroxymethylcellulose, carboxymethylcellulose, polyethylene glycol, polyvinyl alcohol, hyaluronic acid, castor oil, and mineral oil.

10. An ophthalmic pharmaceutical composition described in any one of claims 1 to 3, which comprises a pharmaceutically acceptable vehicle.

11. A therapeutically effective amount of WS-12, a TRPM8 agonist, in the manufacture of a medicament for treating or alleviating persistent dryness of the conjunctiva in a subject suffering from xerophthalmia. 【Chemistry 4】 Use of.

12. A therapeutically effective amount of WS-12, a TRPM8 agonist, in the manufacture of a medicament for treating or alleviating dry eye syndrome in a subject in need thereof. 【Transformation 5】 Use of.

13. Use of a TRPM8 agonist or a combination thereof for the manufacture of a medicament for the treatment or alleviation of dry eye syndrome, wherein the TRPM8 agonist is: 【Transformation 6】 That is, use.

14. The use according to any one of claims 11 to 13, characterized in that the pharmaceutical is administered at variable times per day.

15. The use according to any one of claims 11 to 13, characterized in that the pharmaceutical is administered 1 to 4 times a day.

16. The use of any one of claims 11 to 13, wherein the subject is suffering from vitamin A deficiency, Sjogren's syndrome, a rheumatic disease, a chemical burn or thermal injury, or the subject is receiving treatment with atenolol, chlorpheniramine, hydrochlorothiazide, isotretinoin, ketorolac, ketotifen, levocabastine, levofloxacin, oxybutynin, or tolterodine.

17. The use described in any one of claims 11 to 13, wherein the pharmaceutical agent comprises at least one additional TRPM8 agonist.

18. The use described in any one of claims 11 to 13, wherein the pharmaceutical product comprises at least one additional drug useful for treating dry eye syndrome.

19. The use of any one of claims 11 to 13, wherein the pharmaceutical comprises at least one additional compound selected from the group consisting of corticoids, vitamin A, pilocarpine, carbomer, cyclosporine, glycerol, hydroxypropylmethylcellulose, hydroxymethylcellulose, carboxymethylcellulose, polyethylene glycol, polyvinyl alcohol, hyaluronic acid, castor oil, and mineral oil.

20. The use of any one of claims 11 to 13, wherein the pharmaceutical comprises a pharmaceutically acceptable vehicle.

Images