Single waveform continuous square wave voltammetry for optimal calibration-free sensing

Abstract

A method for measuring a sensor response for a sample is disclosed. The sample is exposed to an electrochemical aptamer-based (EAB) sensor, which includes an electrode and one or more aptamers with redox tags. An interrogation is then performed by applying a sudden voltage pulse to the electrode. Two or more data samples are collected at different time values, each data sample being a redox tag current value. The data samples are then used to determine at least one measurement of the sample.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to and the benefit of the filing dates of U.S. Provisional Patent Application No. 63 / 311,704, filed February 18, 2022, and U.S. Provisional Patent Application No. 63 / 353,172, filed June 17, 2022, the disclosures of which are incorporated by reference in their entireties herein.

[0002]

[0002] The present invention relates generally to square wave voltammetry. [Background technology]

[0003]

[0003] This section is intended to introduce the reader to various aspects of art that may be related to various aspects of the present invention that are described and / or claimed later. This discussion is believed to be helpful in providing the reader with background information to aid in better understanding the various aspects of the present invention. Accordingly, it should be understood that these statements are to be read in this light, and not as admissions of prior art.

[0004] Square wave voltammetry (SWV) has several unique properties that have enabled the technique to become a central pillar in measuring surface bound redox systems. These properties stem from a pulsed potential waveform and regulated current measurements that exclude interference from non-faradaic processes. Typically, the technique utilizes a square wave potential pulse waveform superimposed on a staircase step to generate a voltammetric linear sweep. The SWV current sampling technique typically considers the current response during the second half of the potential pulse, thereby minimizing any non-faradaic contribution to the resulting current response. The current-voltage curve is presented as the difference between the forward current sample (obtained with a forward pulse) and the reverse current sample (obtained with a reverse pulse), thereby further reducing any remaining charging current and amplifying the peak current to provide square wave voltammetry data with high sensitivity.

[0005]

[0005] SWV is useful for measuring surface binding processes. SWV helps monitor the current response as a function of frequency, allowing the charge transfer rate in these systems to be characterized. It has been demonstrated that SWV peak current can be used to determine the rate constant of a standard by finding the critical frequency that is the maximum of the relationship between normalized peak current and inverse frequency. The normalized peak current is calculated by dividing the peak current (i p) and frequency (f). The normalized current maximum occurs at the same resonance frequency as in spectroscopy (where the current is maximized at the perturbation frequency), and therefore the characteristic time scale of the voltammetric experiment is similar to that of the charge transfer rate. Previous studies have utilized SWV to determine kinetic parameters defined as standard rate constants and frequency ratios. This type of critical frequency analysis has been similarly applied to folding-based sensors that utilize functional nucleic acids and even target-induced conformational changes to construct sensors. The critical frequency and therefore the charge transfer rate change upon target addition, which results in a conformational change of the surface-bound nucleic acid.

[0006] As described above, the power of the SWV is determined by the forward potential pulse and the reverse potential pulse (forward current i f and reverse current i r The current sampling delay depends on its ability to sample the current at the end of the forward and reverse pulses (defined as ΔP, ΔP; Fig. 1A). The delay in current sampling allows non-faradaic processes to decay before sampling the current contribution from the faradaic processes occurring at the electrode surface. Schematically, the current is sampled at the end of the forward and reverse pulses, but commercially available instruments sample multiple current points along the potential pulse and average these data for a better signal-to-noise voltammogram. The exact region of the pulse that is collected and utilized for data analysis can vary from one instrument manufacture to another, but the end result is an averaged current for a better signal, with the current at the beginning of the pulse discarded. While this works well for many applications, as has been demonstrated in the field of electrochemical aptamer-based sensors, this method leaves out data. Thus, a more efficient method of collecting data for square wave voltammetry remains in demand.

[0007]

[0007] SWV and chronoamperometry, as well as other basic approaches to measuring EAB sensors, essentially contain additional information that can enable sensor calibration. Each technique uniquely exploits the fundamental electron transfer rate in the EAB sensor. These calibration techniques have drawbacks, including the complexity of the measurement waveform and limitations on the amount of information that can be collected for analysis and for improving the calibration. Thus, there remains a need for better ways to collect data for sensor calibration, and ideally to do so in a manner that also allows for more information to be collected for improving the calibration. Summary of the Invention [Means for solving the problem]

[0008]

[0008] Certain exemplary embodiments of the present invention are described below. It should be understood that these embodiments are intended to provide the reader with a general overview of certain forms the present invention may take, and that these embodiments are not intended to limit the scope of the present invention. Indeed, the present invention may encompass a variety of embodiments that may not be explicitly described below.

[0009]

[0009] Many of the above-mentioned shortcomings and limitations can be overcome by creating novel and progressive interactions of chemicals, materials, sensors, electronics, microfluidics, algorithms, computing, software, systems, and other features or designs in a manner that makes sensing technology accessible to biofluids and analytes inexpensively, effectively, conveniently, intelligently, or reliably. In one aspect of the present invention, a method of measuring a sensor response for a sample is disclosed. The method involves exposing the sample to an electrochemical aptamer-based (EAB) sensor, the sensor comprising an electrode and one or more aptamers having a redox tag. Then, performing a first interrogation includes applying an abrupt voltage pulse to the electrode, the abrupt voltage pulse causing a redox electron transfer between the redox tag on the aptamer and the electrode. Then, two or more data samples are collected at different time values, each data sample being a redox tag current value. Finally, the data sample is used to determine at least one measurement of the sample.

[0010] In one embodiment, square wave voltammetry is used to interrogate the sensor. In another embodiment, amperometry is used to interrogate the sensor. In one embodiment, electron transfer rate data is collected after a time period selected from the group consisting of 10 μs, 100 μs, and 1 mS. In another embodiment, electron transfer rate data is collected after at least one time period selected from the group consisting of 10 μs, 100 μs, and 1 mS. In one embodiment, sampling is performed at a frequency selected from the group consisting of at least 10 Hz, 100 Hz, 1 kHz, 10 kHz, and 100 kHz.

[0011] In another embodiment, the probing is performed without calibration of the sensor. In one embodiment, the sensor is calibrated. In another embodiment, calibration is performed during manufacture of the sensor. In one embodiment, calibration of the sensor is performed before use of the sensor. In another embodiment, calibration of the sensor is performed during use of the sensor. In one embodiment, the probing is performed twice, one probing with a target and another probing without a target.

[0012] In another embodiment, the two or more samples include a minimally responsive sample, where the redox tag current is minimally responsive to changes in concentration of the target, and a responsive sample that is responsive to changes in concentration of the target. Current measurements of the two or more samples are used to calibrate the sensor. In one embodiment, the calibration of the sensor is calculated, at least in part, by comparing current measurements of the minimally responsive sample and the responsive sample at the response time of the saturation level through a polynomial fit.

[0013] In another embodiment, the calibration provides a concentration value,

[0014]

number

[0015] It is calculated according to: where [T] is the concentration of the target and K D is the dissociation constant of the target, i is a constant that contains the peak current, α is a constant that contains the ratio of the output signal at the minimum frequency to the target-free output signal, and i NR is the output current and γ is a constant comprising the ratio of the target saturation output signal to the target free output signal.

[0016] In one embodiment, the two or more samples include a first sample and a second sample, the first sample having a redox tag current that increases with increasing concentration of the target and the second sample having a redox tag current that decreases with increasing concentration of the target, and the difference in the current change between these two samples is recorded as a differential current value. In another embodiment, the two or more samples are average samples that are averaged from two or more adjacent samples. In one embodiment, the two or more samples are composite samples obtained from two or more adjacent samples.

[0017] In another embodiment, at least one sample is taken at a time point equal to when the change in redox tag current has a maximum increase for a given increase in the target concentration. In one embodiment, at least one sample is taken at a time point equal to when the change in redox tag current has a maximum decrease for a given increase in the target concentration. In another embodiment, at least one sample is taken at a time point equal to when the change in redox tag current has a minimum change for a given increase in the target concentration. In one embodiment, the method is continuous square wave voltammetry scans, and the sensor is measured over time using at least one continuous square wave voltammetry scan for calibration and multiple non-continuous square wave voltammetry scans for measurement. In another embodiment, the sensor is calibrated during in vivo use at a known point when the concentration of the target analyte is less than a percentage selected from the group consisting of 2%, 5%, 10%, and 20%. In one embodiment, the data samples are used to determine the critical frequency.

[0018]

[0017] In another embodiment, the applied sudden voltage is at or within the voltage of the redox peak current of + / -0.1 mV, and the data collected from the amperometric scan includes data selected from the group consisting of average samples and composite samples. In another embodiment, the invention involves a method for determining a concentration of an analyte. The method involves exposing an electrochemical sensor having a medical electrode to an analyte; and then scanning the medical electrode using scanning voltammetry, the scanning voltammetry including a square wave voltammetric waveform at a first frequency while continuously probing the current as a function of time. A set of readings is then generated from the scanning voltammetry. Finally, the set of readings is used to determine one or more changes in the concentration of the analyte. In another embodiment, the scanning voltammetry is performed without calibration. In one embodiment, the electrochemical sensor is calibrated.

[0019] In one aspect of the invention, a method of probing and challenging an electrochemical aptamer-based (EAB) sensor is disclosed. The method includes applying a square wave voltammetric waveform at a first frequency to the EAB sensor while continuously probing the current as a function of time and collecting the resulting data. In one embodiment, the first frequency is 100 kHz. In another embodiment, a single voltammetric sweep is used for simultaneous signal optimization and calibration. In one embodiment, the resulting data is used to determine a critical frequency.

[0020] In another aspect of the present invention, a method for obtaining the overall frequency response of an electrochemical aptamer-based (EAB) sensor is disclosed, which involves performing a square wave voltammetric sweep at a first frequency on the EAB sensor while continuously monitoring the current as a function of time in the absence of target, and then performing a square wave voltammetric sweep at the first frequency on the EAB sensor while continuously monitoring the current as a function of time in saturated target conditions.

[0021] In another aspect of the invention, a method for determining an analyte concentration is disclosed. The method involves first exposing an electrochemical sensor having a medical electrode to an analyte. The medical electrode is then scanned using scanning voltammetry. The scanning voltammetry involves a square wave voltammetric waveform at a first frequency while continuously probing the current as a function of time. A set of readings is generated from the scanning voltammetry. One or more peaks are identified in the set of readings. The analyte concentration is determined by applying a predetermined correlation to the voltage difference between the identified peaks. In one embodiment, the first frequency is 100 kHz. In another embodiment, a single voltammetric sweep is used for simultaneous signal optimization and calibration. In one embodiment, the resulting data is used to determine a critical frequency.

[0022]

[0021] Objects and advantages of the disclosed invention will be further appreciated in light of the following detailed description and drawings. [Brief description of the drawings]

[0023] [Figure 1A] FIG. 1 is a graph showing potential and current vs. time for conventional SWV using a commercially available instrument. [Figure 1B] FIG. 1 is a graph showing current vs. potential of nSWV at 100 Hz. [Figure 1C]

[0024] 1 is a graph showing potential and current vs. time for continuous SWV of the present invention. [Figure 1D]

[0025] Graph showing current vs. potential of ncSWV at 100 Hz. [Figure 2A]

[0026] 1 is a graph showing SWV current vs. potential showing forward, reverse, and differential curves. [Figure 2B]

[0027] 1 is a graph showing cSWV current vs. potential, showing the forward curve, reverse curve, and difference curve. [Figure 3A]

[0028] FIG. 13 is a graph showing peak current vs. frequency using SWV for ferrocene and K3[Fe(CN)6]. [Figure 3B]

[0029] FIG. 13 is a graph showing peak current vs. frequency for ferrocene and K3[Fe(CN)6] using cSWV. [Figure 3C]

[0030] FIG. 13 is a graph showing peak current vs. frequency for ferrocene and K3[Fe(CN)6] using cSWV. [Figure 4A]

[0031] Graph showing current vs. voltage using SWV for ATP with and without target. [Figure 4B]

[0032] Graph showing current vs. voltage using cSWV for ATP with and without target. [Figure 4C]

[0033] 13 is a graph showing current vs. potential using SWV for tobramycin with and without target. [Figure 4D]

[0034] 13 is a graph showing current vs. potential using cSWV for tobramycin with and without target. [Figure 5A]

[0035] Figure 13 is a graph showing % signal change vs. frequency using cSWV for ATP. The inset is a zoomed in percentage signal change at low frequencies up to 2000 Hz. [Figure 5B]

[0036] FIG. 13 is a graph showing % signal change vs. frequency using cSWV for tobramycin. The inset is a zoomed in percentage signal change at low frequencies up to 2000 Hz. [Figure 5C]

[0037] FIG. 13 is a graph showing % signal change vs frequency showing SWV results vscSWV for ATP. [Figure 5D]

[0038] FIG. 13 is a graph showing % signal change vs frequency showing SWV results vscSWV for tobramycin. [Figure 6A]

[0039] FIG. 13 is a graph showing normalized current vs1 / frequency using cSWV for ATP with and without target. [Figure 6B]

[0040] FIG. 13 is a graph showing normalized current vs. frequency using cSWV for tobramycin with and without target. [Figure 6C]

[0041] 13 is a graph showing normalized current vs. 1 / frequency using SWV for tobramycin with and without target. [Figure 6D]

[0042] FIG. 13 is a graph showing normalized current vs1 / frequency using cSWV for ATP with and without target. [Figure 7A]

[0043] 1 is a graph showing peak current vs. frequency for K3[Fe(CN)6]. [Figure 7B]

[0044] 1 is a graph showing peak current vs. frequency for ferrocene. [Figure 8A]

[0045] 1 is a graph showing signal change vs. frequency for tobramycin. [Figure 8B]

[0046] 1 is a graph showing current vs. potential for tobramycin. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0024] definition

[0047] The term "about," as used herein, when referring to a value or magnitude of mass, weight, time, volume, pH, size, concentration, or percentage, is intended to encompass, in some embodiments, a variation of ±20%, in some embodiments, a variation of ±10%, in some embodiments, a variation of ±5%, in some embodiments, a variation of ±1%, in some embodiments, a variation of ±0.5%, and in some embodiments, a variation of ±0.1% from the specified amount, as these variations are reasonable for performing the disclosed methods.

[0025]

[0048] The term "electrode" as used herein means any material that is electrically conductive, such as gold, platinum, nickel, silicon, conductive liquid infused materials such as ionic liquids, PEDOT:PSS, conductive oxides, carbon, boron doped diamond, nanotube or nanowire mesh, or other suitable conductive materials.

[0026]

[0049] The term "aptamer" as used herein means a molecule that undergoes a structural or binding change when an analyte binds to the molecule, and meets the general operating principle of the sensing method as described herein. Such molecules are, for example, natural or modified DNA, natural or modified RNA, or natural or modified XNA oligonucleotide sequences, spiegelmers, peptide aptamers, and affimers. Modifications can include replacing natural bases in the aptamer sequence with non-natural bases, exchanging natural sequences with non-natural sequences, or other suitable modifications that improve sensor function but behave similarly to conventional aptamers. Two or more aptamers bound together (i.e., do not separate in solution) can also be referred to as aptamers. Aptamers can have a molecular weight of at least 1 kDa, 10 kDa, or 100 kDa.

[0027]

[0050] The term "polynomial fit" as used herein means that the relationship between two variables is a functional polynomial relationship.

[0051] The present invention involves the application of a sudden voltage pulse to an electrode on an EAB sensor and the collection of multiple current vs. time data points to determine the concentration of an analyte. The method applies a sudden voltage pulse to the electrode, which causes redox electron transfer between the redox tag on the aptamer and the electrode. After application of the pulse, two or more samples of redox current vs. time are collected and the samples are used to calculate the sensor response or target concentration. In one embodiment, amperometry is used to interrogate the sensor. In another embodiment, square wave voltammetry is used to interrogate the sensor.

[0028]

[0052] In one embodiment, the present invention involves the development of a single waveform (e.g., a single voltammetric sweep) that allows simultaneous signal optimization and calibration for folding-based electrochemical sensors. In one embodiment, the present invention involves the use of this new waveform, referred to as continuous square wave voltammetry, to probe and stimulate electrochemical aptamer-based sensors. By continuously collecting current for the entire voltammetric sweep (data sampling frequency of 100 kHz), information equivalent to multiple running voltammograms at various frequencies ranging from 50 kHz to the nominal square wave frequency used in the potential waveform can be extracted.

[0029]

[0053] The present invention utilizes the complete current-time response gained during application of a square wave voltammetric waveform to collect continuous square wave voltammograms (cSWV) of both soluble and surface-bound redox markers with the goal of maximizing the information content that can be obtained from a single voltammetric sweep. In conventional square wave voltammetry (SWV), the frequency (f) of the square wave potential pulses is 1 / (2t p ), where t p is the pulse width (Figure 1A). Typically, the current is sampled at the end of the forward and reverse pulses, and the difference (i f -i r =i diff ) is plotted against the potential. In fact, many of the commercially available instruments used here use i f and i r The currents from the second half of each pulse are averaged to determine , thereby providing an average current over this time period. This provides an increased signal-to-noise ratio in the resulting voltammogram. In either case, most of the current data obtained during voltammetry is discarded.

[0030]

[0054] Square wave voltammetry that collects all current-time data is defined herein as "continuous square wave voltammetry" (cSWV). To perform cSWV, a native frequency equivalent to the conventional square wave frequency (f) is selected. This native square wave frequency dictates the length of each potential pulse. However, during a single native frequency voltammetric sweep, the current is collected at a sampling frequency of 100 kHz. Because of this collection frequency, individual voltammograms can be extracted at effective frequencies as defined below. A number of variables have been defined to better describe cSWV. First, δt(s) is defined as the time after application of the individual forward and reverse pulses. Then, the cSWV frequency is calculated as 1 / 2δt(Hz), and the native frequency is calculated as 1 / (2δt max ) or the overall pulse length t as described above p Because the data is collected at 100 kHz, a voltammogram taken at a natural frequency of 50 Hz can generate 1000 different voltammograms corresponding to 1000 frequencies (number of voltammograms = t p × sampling frequency). The experiment was performed using custom LabVIEW code, run simultaneously with the amperometric traces on CH instruments to collect the entire current-time data. The current values ​​corresponding to each voltammogram are plotted against the potential window used to monitor the reaction (Figure 2A).

[0031]

[0055] Voltammetric investigations apply a standard square wave voltammetric waveform at a given frequency while continuously investigating the current as a function of time (and thus also as a function of potential by converting the scan rate to potential). Continuous current sampling allows one to choose a particular δt or time after application of the pulses (forward and reverse pulses) and measures the difference current (i f -i r) can be plotted. Plotting such differential current vs. time or potential at a given δt gives a sampled current voltammogram at a square wave frequency of 1 / δt. By continuously collecting data, the voltammogram can be plotted at a square wave frequency of 1 / δt. min →∞ and 1 / δt max →0 can be obtained in a single voltammetric sweep. Because the performance (i.e., sensitivity) of folding-based sensors is a function of square wave frequency or 1 / δt, the optimal frequency for signal transmission from two voltammetric sweeps, one in the absence and one in the presence of the target analyte, can be quickly found.

[0032]

[0056] As a result of the finite number of redox probes on the surface at various electron transfer rates in the presence and absence of target, there is a time point (δt eq ) also exists. By using the continuous square wave voltammetry waveform of the present invention, dt eq Calibration can be accomplished using a single voltammetric sweep followed by analysis of the current at δt and any other δt. This provides a self-reference point for "on-the-fly" calibration. These measurements are achievable by having information about each potential frequency secured by continuously collecting current data while a single voltammetric sweep is in progress.

[0033]

[0057] The continuous square wave voltammetry technique of the present invention collects an entire set of current-time data associated with a single voltammetric sweep. Unlike square wave voltammetry, which provides a single averaged voltammetric response for the Faradaic reaction, cSWV essentially provides multiple voltammograms corresponding to frequencies ranging from 50 kHz to the intrinsic interrogation frequency while maintaining the benefits of SWV compared to other possible measurement techniques. A key advantage of using cSWV is the ability to perform these same types of measurements in a series of one or two sweeps rather than multiple sweeps. For example, optimization of a sensor to determine the optimal interrogation frequency often requires >20-30 voltammetric sweeps over a wide range of SW frequencies (10-5000 Hz). This can now be accomplished with two sweeps, one with the target and one without the target. Additionally, the dual frequency approach disclosed in the art is a calibration-free technique, where the target concentration is determined regardless of surface variability from sensor to sensor and without the need for recalibration against a reference sample. This is achieved by voltammetrically probing two different SWV frequencies corresponding to responsive and non-responsive signals (currents independent of target concentration). As another example, the frequency dependence of the employed EAB sensor has been described by the same group, and an improved calibration system for probing EAB sensors has been shown by adjusting the square wave frequency with the aim of obtaining the maximum peak current response given by the same sensor in signal-on and signal-off examples, and thereby determining the value of the "Kinetic Differential Measurement" (KDM). The present application allows the determination of target concentrations with clinical accuracy. The cSWV approach of the present invention can be effectively incorporated into many such applications. Some important advantages of each of these two examples are that improved time resolution can be achieved by negating the need to perform multiple scans.A single sweep can provide information at two or more different SWVs for calibration purposes, thereby improving the rate at which quantitative target concentration data can be collected. First, the soluble redox markers ferrocene and K. 3 [Fe(CN) 6 Continuous square wave voltammetry was tested using a soluble redox marker and then investigated using EAB sensors made with ATP and tobramycin aptamers. Similar trends in the change in peak current with frequency were observed for both the soluble redox marker and EAB sensors. Furthermore, this technique allows the critical frequencies to be determined, thereby providing information related to the kinetics and sensor behavior.

[0034]

[0058] Referring to Figures 1A-1D, continuous square wave voltammetry (cSWV) employs the same applied potential waveform as used in commercially available instruments (here, CH instruments) that employ square wave voltammetry. Figures 1A and 1B show that in conventional square wave voltammetry, the frequency (f) of the square wave potential pulses is 1 / (2t p ), where t p is the pulse width. Typically, the current is sampled at the end of the forward and reverse pulses and the difference (i f -i r =i diff ) is plotted against the potential. The commercial instrument used here has an f and i r The current from the second half of each pulse is averaged to determine . Figures 1C and 1D show that cSWV continuously collects current data throughout the applied potential waveform at a characteristic SWV frequency of nf=50 with a data collection rate of 100 kHz. Selecting the current at a given time (δt) after application of the pulse allows for the extraction of a voltammogram at frequency = 1 / 2δt. At nf=50 Hz and a data collection frequency of 100 kHz, it is possible to extract 1000 voltammograms from a single voltammetric sweep.

[0035]

[0059] 2A and 2B, continuous square wave voltammetry (cSWV) provides a diffusion-limited current-voltage response for soluble redox markers similar to that observed using conventional square wave voltammetry. 3 [Fe(CN) 6

[0036] Conventional SWV for

[0036] typically obtains forward, reverse, and differential voltammograms acquired at 100 Hz with 1 mV increments and a step size of 25 mV. Figure 2B shows that a δt (1 / 2δ t = 100 Hz) to obtain an equivalent voltammogram at 100 Hz.

[0036]

[0060] 3A-3C show the soluble redox marker K 3 [Fe(CN) 6 ] and ferrocene were examined using both techniques. Figure 3A shows that the dependence of peak current on frequency for 5 mM K in 0.1 mM KCl. 3 [Fe(CN) 6 ] and 5 mM ferrocene in 0.1 mM tetrabutylammonium hexafluorophosphate, showing peak currents at various frequencies similar to those obtained using conventional SWV. 3 [Fe(CN) 6 SW voltammograms were obtained by scanning the potential window from 0.5 V to -0.1 V for ZnO and from 0.8 V to 0.1 V for ferrocene. Figure 3B shows the peak current response extracted from the voltammogram obtained at frequencies from cSWV equivalent to SWV performed at a characteristic frequency of 10 Hz. Figure 3C shows all peak current values ​​plotted against the full range of frequencies given by cSWV. The solution conditions and parameters used are the same as for conventional SWV.

[0037]

[0061] Referring to Figures 4A-4D, a display of the voltammetric response from the two techniques in the bound and unbound states is shown. Figures 4A and 4B show the voltammograms obtained from the ATP sensor probed with SWV at 400 Hz for the bound and unbound phases, and the equivalent voltammogram at 400 Hz (δt=1.25 ms) obtained with cSWV at a natural frequency of 50 Hz under conditions equivalent to SWV. Figures 4C and 4D show the voltammetric response of the aminoglycoside tobramycin sensor at 500 Hz upon addition of 1 mM target using both techniques. The equivalent voltammetric at 500 Hz when using cSWV is obtained at δt=1 ms.

[0038]

[0062] Referring to Figures 5A and 5B, the calculated signal change percentage response for the ATP sensor and the tobramycin EAB sensor from SWV and cSWV is shown. All signal change percentage values ​​given by cSWV in the full range of frequencies from 50Hz to 50kHz were obtained using the ATP sensor and the tobramycin sensor, respectively. The inset shows a close-up of the signal change percentage at lower frequencies up to 2000Hz. The signal change percentage response for the ATP sensor and the tobramycin sensor was calculated in the frequency range from 50Hz to 500Hz using SWV. Its comparison with the equivalent frequency obtained from cSWV with a natural frequency of 50Hz is shown.

[0039]

[0063] 6A-6D, square wave voltammetry allows for the determination of electron transfer kinetics between an electrode and a redox probe, which can be incorporated into the new technique cSWV. FIGS. 6A and 6B show the normalized current (i pPlots of 1 / frequency (1 / f) vs 1 / frequency (1 / f), which can provide the apparent electron transfer rate from the maximum of the plot, are displayed for the ATP and tobramycin sensors, respectively. To compare the electron kinetic information obtained from cSWV, Figures 6C and 6D show conventional SWV performed on the same EAB sensor over a selected frequency range. Similar trends were observed using the two approaches in the "targeted" and "label-free" conditions. cSWV response from soluble redox markers

[0064] Soluble Redox Marker K 3 [Fe(CN) 6 The cSWV voltammogram of ] is similar to that collected via SWV when using a characteristic frequency of 100 Hz. For example, 3 [Fe(CN) 6 The voltammetric responses of the forward, reverse, and differential voltammograms of ] followed the typical response of soluble redox markers. Both conventional SWV and cSWV voltammograms were performed at a characteristic frequency of 100 Hz, and for cSWV, the voltammograms displayed were δt max =t p = 5 ms (Figures 2A and 2B).

[0040]

[0065] The frequency response and therefore the scan rate response of the soluble redox markers are equal for both conventional SWV and cSWV (Figures 3A-3C). 3 [Fe(CN) 6 When studying [ , the peak current increases monotonically up to ∼625 Hz, after which there is a continuing downward trend in peak current as would be expected since the reaction behaves quasi-reversibly at these higher frequencies due to finite electron transfer kinetics. 6The response of ferrocene with 0.1 mM KCl, on the other hand, plateaus at a comparable frequency, indicating that this reaction behaves reversibly even at the highest frequency tested (2500 Hz). Using the same set of electrodes, a similar peak current response can be seen up to 2500 Hz with cSWV, but the cSWV can also probe at significantly higher frequencies. Additionally, the response of ferrocene with 0.1 mM KCl, on the other hand, plateaus at a comparable frequency, indicating that this reaction behaves reversibly even at the highest frequency tested (2500 Hz). 3 [Fe(CN) 6 ] and 0.1 mM TBAPF 6 For each of the ferrocenes in the study, it was found that the peak currents began to roll over or plateaued at ~625 Hz, similar to SWV (Figure 3B). For better visualization, a comparison of the peak current responses obtained from conventional SWV to the equivalent frequency of cSWV performed at a natural frequency of 10 Hz is shown in Figures 7A and 7B. More specifically, when analyzing all frequencies from cSWV, a K 3 [Fe(CN) 6 ] and 0.1 mM TBAPF 6 Maximum current responses were observed at 957 ± 32 Hz and 1721 ± 162 Hz for ferrocene in and out, respectively (Figure 3C). cSWV for investigating electrochemical aptamer-based (E-AB) sensors

[0066] Square wave voltammetry is a common electrochemical technique used to investigate electrochemical aptamer-based (i.e., E-AB) sensors. E-AB sensors are utilized as analytical detection tools for a wide variety of target molecules ranging from small molecules to proteins. E-AB sensors can also be employed for continuous therapeutic monitoring in vivo. Briefly, E-AB sensors employ nucleic acid aptamers (oligonucleotide strands of single-stranded DNA or single-stranded RNA that bind to a target of interest) that are thiol modified at the 5' end to attach to an electrode surface (e.g., gold). In contrast, redox markers such as methylene blue are modified at the 3' end. In the presence of target, the aptamer undergoes a conformational change, thereby bringing the redox tag closer to the electrode surface, thereby facilitating the electron transfer process. SWV is particularly well suited to monitor this class of sensors due to its ability to reduce background current (non-faradaic charging current) while maximizing the signaling difference between the target-free and target-bound states. Previous studies have reported optimizing electrochemical signaling through changes in interrogation frequency and even measuring apparent charge transfer rates with these types of folding-based sensors. More recently, this approach has been expanded to use variable frequency interrogation to perform on-the-fly calibration of the sensor and to eliminate sensor drift when employed in vivo. Therefore, measuring the frequency-dependent response of E-AB sensors is of great importance with regard to the functionality and application of this effective class of sensors.

[0041]

[0067] To demonstrate the applicability of cSWV for EAB sensors, we tested the method using two representative sensors fabricated to detect adenosine triphosphate (АTP) and an aminoglycoside antibiotic (tobramycin). E-AB sensors were qualitatively and quantitatively interrogated via SWV and cSWV, which were performed similarly to allow for comparison. For example, a sensor fabricated to use a destabilized ATP aptamer exhibits a signal change of 154 ± 10% when interrogated at a SWV frequency of 400 Hz. Similarly, a percent signal change of 90 ± 5% is shown at an equivalent SWV frequency of 400 Hz (δt = 1.25 ms) extracted from the intrinsic cSWV frequency of 50 Hz upon target addition of 1 mM ATP (Figures 4A and 4B). Sensors made with aminoglycoside-binding aptamers behaved similarly, exhibiting a 31±1% signal change in SWV at 500 Hz and a 17±1% signal change in cSWV at δt=1 upon addition of 1 mM tobramycin target (Figures 4C and 4D).

[0042]

[0068] One advantage of using cSWV is that the entire frequency response of the E-AB sensor can be obtained from two simple voltammetric sweeps, one without target and the other with saturated target conditions. Typically, frequency sweeps are obtained by running voltammograms over a range of frequencies in buffer and target saturated buffer. Thus, typical frequency sweeps for ATP and tobramycin sensors performed with SWV exhibit the expected frequency-dependent signal change (Figures 5A and 5B). To quantify the sensor response collected by these two techniques, the equation (i WT -i NT / i NT The percent signal change was calculated using the formula: i ) × 100, where i WT is the peak current response in the presence of a target, and i NTis the peak current response without target. Note that these data require 12 voltammograms for six frequencies (with and without target). Conversely, two voltammetric sweeps of cSWV performed at a characteristic frequency of 50 Hz, with and without target, yield 1000 voltammograms between 50 Hz and 50 kHz (Figures 5A and 5B). By isolating the six equal frequencies from the characteristic 50 Hz sweep, it can be seen that the signal change upon target addition matches that observed in SWV (Figures 5C and 5D). By plotting the signal change over all selected δt and therefore frequencies, a high-resolution representation of the frequency response of each E-AB sensor is obtained. The most notable percent signal change for the ATP sensor is observed at approximately 175%, given at 25000 Hz, with higher percent signal change (>100%) observed overall at higher frequencies (>500 Hz). Similarly, the tobramycin sensor showed the highest percent signal change at about 50%, and both signal-on and signal-off responses were observed from the tobramycin sensor as expected. Furthermore, they both exhibit a frequency of no response. The key difference here is that only a single voltammetric sweep can be used to capture data (peak current or signal change) at the desired frequency (maximum signal change and frequency of no response). Alternatively, only two voltammetric sweeps can be used, but a full frequency sweep can be performed to find the optimal signaling. There is a slight difference in the percent signal change obtained for the ATP sensor and the tobramycin EAB sensor. However, these two techniques are comparable to each other in calibration performance and follow a consistent trend. The difference in values ​​between these two techniques may be due to the difference in the sampling procedures followed by these two techniques. Averaging of data in nSWV may result in larger values ​​compared to cSWV, which may cause the difference in percent signal change to be observed.For the tobramycin EAB sensor, larger error bars were observed using the cSWV technique compared to nSWV, especially at 50 Hz, which results in a small deviation from the nSWV response, which may be an artifact of sensor-to-sensor variability and may contribute to the overall signal gain from individual sensors.

[0043]

[0069] Another advantage of using cSWV is the rapid, high-resolution, and accurate assessment of the charge transfer rate of linked redox molecules. CSWV allows the determination of the critical frequency, as shown in Figures 6A and 6B. The critical frequency is i p / fvs1 / f, where i p is the peak current and f is the frequency. The charge transfer rates of the bound and unbound probes for the fabricated sensor of tobramycin were 480 ± 14 s, respectively, using the cSWV technique. -1 and 251±37s -1 Similar observations were made using SWV, with the charge transfer rates for the bound and unbound states being 400±150 s -1 and 250±150s -1 However, when using cSWV, the frequency resolution is significantly higher compared to that when using nSWV (a sampling rate of 100 kHz produces a voltammogram every 1 / 20 μs), which is based on the number of sweeps the experimenter performs. For example, in the determination of nSWV here for tobramycin, the charge transfer rate is 400 s -1It was found that. This determination is based on the maximum current value observed at 400 Hz surrounded by measurements at 500 Hz and 250 Hz, therefore, when using such intervals in nSWV, the charge transfer rate can only be known within a range of + / - 150 Hz. It can be asserted that both approaches provide comparable charge transfer rates in the case of tobramycin sensors, so that the cSWV approach can have many advantages for the field of EAB sensors. Similar to the observations with the tobramycin sensor, a similar trend is observed in the plot in the case of ATP sensors, which further confirms the capabilities of the present approach. According to the trend given in the plot in the case of ATP, the maximum value cannot be determined, since the plot represents an increasing trend in the case of 1 / f. Therefore, the critical frequency values ​​for the target and non-target conditions are not determined.

[0044]

[0070] Another advantage of cSWV is that it can also preserve the forward and reverse sample averaging advantages of nSWV. For example, whereas in FIG. 1C samples δt and δt' are represented as single data point captures, any capture point δt with cSWV can also be an average of adjacent capture points, satisfying the principles of the present invention, provided that: (1) more than one sample δt and δt' (and possibly δt'', etc.) is captured from a single cSWV; (2) more than one sample is used in connection with providing a sensor response or calibrating a sensor. For example, if the sampling is 50 kHz, then the sample δt or δt' can be 100 μs within the sampling width, each including five current data points each taken at 20 μs intervals. These samples can be averaged, which can be the mean (or other statistical method, such as the median), or can be a composite value of δt or δt', so that the composite value is more accurate or precise in the measurement. This averaging can introduce errors due to nonlinearities in electron transfer kinetics, based on the time scale of the electron transfer kinetics and the width of the sample of δt or δt'. Thus, δt or δt' cannot be centered, so that, for example, if data is collected at 1.26 ms, 1.28 ms, 1.30 ms, 1.32 ms, and 1.34 ms, the average will be used to represent the 1.32 ms sample, even though 1.30 ms is the median, due to undue influence on the averaging of the 1.26 ms sample. Thus, one embodiment of the present invention involves a sample that is an average of two or more adjacent samples or a composite of two or more adjacent samples.

[0045]

[0071] Another advantage of cSWV is that when using a single scan of the sensor with both a signal ON frequency (add analyte and the redox current increases) and a signal OFF frequency (add analyte and the redox current decreases), there is a zero gain frequency where the sensor becomes unresponsive to the analyte. In this case, cCSV can capture data at two or more points, which is the signal ON sample δt where the redox tag current increases with increasing target concentration. ON and the non-reactive sample δt NR and the signal OFF sample δt where the redox tag current decreases with increasing target concentration. OFF and two or all of these together can improve the accuracy of the calibration. In this case, the invention can also capture multiple samples, which are at redox current minima or redox current maxima or other responses to the analyte. There can be more than three samples, since there are multiple samples inherent in cSWV data.

[0046]

[0072] Another advantage of cSWV is that it does not need to be used continuously and can be used interchangeably with nSWV to maximize the accuracy and precision of the sensor over time. For example, a 48-hour sensor can be factory calibrated (calibrated during manufacture) and nSWV can be used for multiple measurements. In addition, at 12-hour, 24-hour, and 36-hour operations, cSWV is performed and used to calibrate the nSWV measurements, for example, using post-processing of data or software. Thus, the present invention can include at least one cSWV scan and multiple nSWV scans.

[0047]

[0073] Another advantage of cSWV is that it can be calibrated in vivo in some cases. For example, the binding affinity of the sensor can be adjusted so that the sensor primarily captures the medium and high concentrations of a drug, such as an anticoagulant such as rivaroxaban, which is all the information needed to prevent strokes (ensuring the patient is in the medium concentration range) and to stop bleeding (ensuring the patient is not in the high concentration range). The drug metabolizes so that the drug concentration measured by the sensor between doses is close to zero (e.g., rivaroxaban 1-2 hours before a once-daily dose). This can therefore be assumed to be the zero concentration calibration point, even if the drug concentration in the body is not zero. This assumes, for example, that less than 2%, less than 5%, less than 10%, or less than 20% of the aptamer binds to the drug. In one embodiment, the invention includes a method in which a sensor is calibrated at a known point during in vivo use, where the concentration of the target analyte is less than 2%, less than 5%, less than 10%, or less than 20%, in various embodiments. A similar situation may exist, for example, in dialysis patients or renal biomarkers. In one embodiment, the sensor is a two-week wearable sensor, where the patient undergoes dialysis three times a week, and the sensor is calibrated within a two-hour window following dialysis.

[0048]

[0074] In another embodiment of the present invention, the cSWV technique can be applied to "continuous chronoamperometry or continuous amperometry" or cA technique. A voltage can be applied to the sensor suddenly, and an amperometric scan is collected, which is typically analyzed for redox current decay time or for a single exponential fit to the redox current decay curve, and the time or fit is used as a method to measure the concentration of the target analyte. In the present invention, an amperometric scan can be captured, for example, a voltage of -0.35V is applied suddenly, and data is selected from the group consisting of δt samples, δt' samples, δt'' samples, average samples, and composite samples, collected as taught herein.

[0049]

[0075] Numerous approaches for calibration-free operation have been reported. All these "calibration-free" methods exploit fundamental aspects of the electron transfer rate of EAB sensors, and are simply unique ways to do so with their own advantages and disadvantages (e.g., dual-frequency calibration-free chronoamperometry measuring redox peak shifts, etc.). Information on these fundamental behaviors of aptamer sensors (e.g., White and Plaxco, Anal.Chem. 2010, 82, 1, pp. 73-76) for calibration against a reference sensor that does not bind to the target or against a sensor at zero concentration (which is essentially the reference sensor as well), as well as for its full exploitation to improve sensor accuracy, has been known for a long time. The present invention can also fully exploit these fundamental aspects of the electron transfer rate, and several non-limiting examples are presented here.

[0050]

[0076] In one embodiment, the present invention can use a calibration-free method to calculate concentration. Here, cSWV takes full advantage of recording the output of the E-AB sensor at a "responsive" square wave frequency and a "non-responsive" square wave frequency, and multiple scans are not required since cSWV captures all frequencies in a single scan. The non-responsive square wave frequency is the frequency at which the E-AB sensor signaling is zero or negligible at all possible target concentrations. The resulting non-responsive signal can then be used to calibrate the EAB sensor, considering that it is invariant. Furthermore, a calibration-free constant α obtained by performing a "calibration" set can be used to calculate the square wave voltammogram peak current at the responsive square wave frequency (i) and at the non-responsive square wave frequency (i). NR The peak current measured in this calibration set is the calibration parameter K D , γ, and α. With these parameters at hand, the concentration of the target can be determined directly via Eq.

[0051]

number

[0052]

[0077] where [T] is the concentration of the target and K D is the dissociation constant of the target, i is a constant that contains the peak current, α is a constant that contains the ratio of the output signal at the minimum frequency to the target-free output signal, and i NR is the output current, and γ is a constant that contains the ratio of the target saturation output signal to the target free output signal.

[0053]

[0078] In one embodiment, the samples collected include a first sample and a second sample, the first sample having a redox tag current that is minimally responsive to changes in the concentration of the target, and the second sample having a redox tag current that is responsive to changes in the concentration of the target, and the currents of these two samples are used to calculate the concentration of the target.

[0054]

[0079] Figure 8A shows an example of a calibration-free analysis using data from a single sweep of tobramycin. The sweep shows an unresponsive frequency at 350 Hz and a responsive frequency at 2000 Hz. Figure 8B shows that the lower grey peaks for 1 mM tobramycin and 0 concentration tobramycin are very similar to 350 Hz, but the peak at 2000 Hz is significantly different. Kinetic differential measurement (KDM)

[0080] In another embodiment, the present invention can use the difference between the signal ON and signal OFF curves to calibrate the E-AB sensor. This approach is called kinetic differential measurement (KDM) and can be expressed in the form of the following equation:

[0055]

number

[0056] where i min,ON and i ON represents the peak current measured at each signal ON frequency in the presence and absence of the target, and i min,OFF and i OFF represents the equivalent measurement performed at the signal OFF frequency; (4) performs a nonlinear regression analysis of the iKDM calibration curve against the binding isotherm; here, for example, the Langmuir-Hill isotherm is used.

[0057]

number

[0058] where n is the Hill coefficient (i.e., the number of binding sites on the aptamer). Equation 3 expresses the dissociation constant (K D ) and the signal gain (g). Finally, these parameters and i min With this information, the target concentration can be obtained from the measurement of iKDM of the E-AB sensor using the following formula:

[0059]

number

[0060] In one embodiment of the present invention, the samples collected include at least a first sample and a second sample. The first sample has a redox tag current that increases with increasing concentration of the target. The second sample has a redox tag current that decreases with increasing concentration of the target. The difference in the change in current between these two samples is recorded as a differential current value. EXAMPLES

[0061] Chemicals and Solutions

[0081] Potassium ferricyanide (K 3 [Fe(CN) 6 ]), ferrocene (Fe(C 5 H 5 ) 2 )), tris-2-carboxyethyl-phosphine (TCEP), 6-mercapto-1-hexanol, tris(tris) base (2-amino-2-hydroxymethyl-1,3-propanethiol), adenosine triphosphate (ATP), magnesium chloride (MgCl 2 ), tobramycin, 10X Tris-EDTA, tetrabutylammonium hexafluorophosphate (TBAPF 6 ) were purchased from Sigma-Aldrich (St. Louis, MO, USA) and used as received. Potassium chloride (KCl), sodium hydroxide (NaOH), hydrochloric acid (HCl), sodium chloride (NaCl), sulfuric acid (H 2 SO 4 ), acetonitrile (C 2 H 3N) were purchased from Thermo-Fisher Scientific (Ward Hill, MA, USA) and used as received. Solutions were prepared with ultrapure water (18.0 MΩcm at 25°C) using a Biopak Polisher Millipore ultrapurification system (Millipore, Billerica, MA, USA). The parent tobramycin sequence: 5'-HS-C6-SEQ ID NO:1-MB-3' destabilized the ATP sequence: 5'-HS-C6-SEQ ID NO:2-MB-3'. DNA aptamer sequences were dual HPLC purified (Thermo-Fisher) and used as received. SEQ ID NO:1 GGGACTTGGTTTAGGTAATGAGTCCC SEQ ID NO:2 CTGGGGGAGTATTGCGGAGGAAA EXAMPLES

[0062] Electrode preparation for soluble redox marker experiments

[0082] A 2 mm diameter polycrystalline gold electrode (CH Instruments, Austin, TX, USA) was hand polished for 2 min using a 1 μm diamond suspension on a microcloth (Buehler) following a figure-of-eight motion. Similarly, the electrode was then polished in ultrapure water (Milli-Q Ultrapure Water Purification, Millipore, Billerica, MA, USA) in a similar manner. The hand polished electrode was sonicated for 5 min with ultrapure water and electrochemically cleaned in solutions of sodium hydroxide and sulfuric acid with different concentrations as discussed. The electrode was cycled in a 0.5 M NaOH solution, which reductively desorbed any attached sulfur molecules from the gold surface. The redox reaction was then performed in 0.5 M H 2 SO 4 The gold surface was then washed with 0.1 M H2 SO 4 The electrodes were then electrochemically cleaned and etched using 0.01M KCl. These bare electrodes were then investigated using SWV and cSWV. A solution of soluble redox marker was prepared as follows: 5 mM K in 0.1 mM KCl in DI water. 3 [Fe(CN) 6 ], and 0.1 mM TBAPF in acetonitrile 6 5 mM ferrocene in EXAMPLES

[0063] Fabrication of E-AB sensor

[0083] First, 1 μl of the aptamer solution was incubated with 2 μl of 100 mM TCEP for 1 hour, thereby reducing the disulfide bonds in the aptamer sequence. The electrode was then incubated with 200 mM Trizma base, 100 mM NaCl, and 5 mM MgCl. 2 The electrodes were incubated for 1 hour at room temperature in 200 nM probe solution prepared using 100 mM NaCl, pH 7.40. The electrodes were then thoroughly washed with ultrapure water to remove any excess aptamer, and then incubated in 30 mM 6-mercapto-1-hexanol prepared in ultrapure water for passivation. Finally, the thoroughly rinsed electrodes were incubated in Tris buffer for 1 hour equilibration. EXAMPLES

[0064] Electrochemical measurements

[0084] All electrochemical measurements were performed using CH instruments 660E and 1040C workstations (CH Instruments, Austin, TX, USA). All electrochemical measurements were collected using a three-electrode cell system consisting of a platinum counter electrode, a Ag / AgCl (3M NaCl) reference electrode, and a 2 mm polycrystalline gold electrode as the working electrode. Voltammetric parameters are as follows: amplitude and increment are 25 mV and 1 mV unless otherwise stated. A potential window between 0 V and (-0.5 V) and frequencies ranging from 50 Hz to 625 Hz were used for the investigation of the E-AB sensor. The soluble redox markers ferrocene and K 3 (Fe[CN] 6 ) were investigated in the potential windows between 0.8 V and 0.1 V and between 0.5 V and (-0.1 V), respectively. These were tested in the frequencies ranging from 10 Hz to 2500 Hz using SWV. The same parameters were used with continuous square wave measurements, and the characteristic frequencies of 10 Hz and 50 Hz were chosen for the measurements of soluble redox markers and the measurements of E-AB sensors, respectively, unless otherwise stated. All experiments were performed with at least three or more electrodes and their standard deviations are represented as error bars. EXAMPLES

[0065] Continuous Square Wave Voltammetry

[0085] Continuous square wave voltammetry was accomplished by utilizing the constant potential field capabilities of a CH Instruments (Model 660E) and the potential drive and measure capabilities of LabVIEW. Briefly, in-house written LabVIEW code (see cSWV.vi in ​​Supporting Information) was developed to generate a square wave voltammetric waveform and to apply the voltage waveform through the serial voltage input port on the CH instrument. The serial port on the back of the CH Instruments potentiostat (Model 660E) has the following assignments: 9-pin D connection; pin 1-current 1 output; pin 2-current 2 (bipotentiostat); pin 3-reverse potential output; pin 4-external potential input; pin 5-external signal input; pins 6-9-ground. Note that pin 4 is intentionally disabled by default to avoid instrument noise, since it must be enabled to accept input via a jumper to connect to the appropriate pin (communicating with CH Instruments). At the same time, the output voltage from the serial port on the CH Instrument (corresponding to the measured current) was acquired via LabVIEW at 100 kHz through the data acquisition board of the NI USB-6251, all by triggering via an external voltage trigger, and saved as a TDMS file. To properly interface the NI USB-6251 to the CH Instruments, the instrument was run in chronoamperometric mode to turn on the electrochemical cell. Finally, all software filters were disabled before the measurement. EXAMPLES

[0066] Data analysis

[0086] Data analysis for the collected cSWV data was performed using MATLAB® R2021b as described. First, the collected data was sorted into relevant time increments (δt, described later in the text) corresponding to each voltammogram. The original acquired data was smoothed by performing a moving mean averaging technique, thereby reducing noise and facilitating integration of the voltammograms in obtaining peak current values. The voltammograms obtained for ATP had more noise compared to the other voltammograms collected via cSWV. Therefore, an additional step of boxcar averaging was performed to obtain smoother data that would facilitate peak integration.

[0067]

[0087] Other steps not described in detail herein but which are readily understood from or incorporated with the disclosed embodiments are also intended to be included as part of the present invention. The embodiments described herein provide specific examples to illustrate the contours of the elements of the present invention, but do not necessarily encompass all possible embodiments commonly known to those of ordinary skill in the art.

Claims

1. 1. A method for measuring a sensor response for a sample, comprising: a. exposing the sample to an electrochemical aptamer-based (EAB) sensor, the sensor comprising an electrode and one or more aptamers having a redox tag; b. performing a first investigation, the first investigation comprising applying a sudden voltage pulse to the electrode, the sudden voltage pulse causing a redox electron transfer between the redox tag on the aptamer and the electrode; c. collecting two or more data samples at different time values, each data sample being a redox tag current value; d. using said data sample to determine at least one measurement of said sample; A method comprising:

2. The method of claim 1 , wherein square wave voltammetry is used to interrogate the sensor.

3. The method of claim 1 , wherein amperometry is used to interrogate the sensor.

4. 2. The method of claim 1, wherein the electron transfer rate data is collected after at least one time period selected from the group consisting of 10 μs, 100 μs, and 1 mS.

5. 2. The method of claim 1, wherein the sampling is performed at a frequency selected from the group consisting of at least 10 Hz, 100 Hz, 1 kHz, 10 kHz, and 100 kHz.

6. The method of claim 1 , wherein the step of investigating is performed without calibration of the sensor.

7. The method of claim 1 , wherein the sensor is calibrated.

8. The method of claim 7 , wherein calibration is performed during manufacture of the sensor.

9. The method of claim 7 , wherein calibration of the sensor is performed prior to use of the sensor.

10. The method of claim 1 , wherein the step of probing is performed twice, one probing with the target and another probing without the target.

11. The two or more samples a. a minimally responsive sample, the redox tag current being minimally responsive to changes in concentration of the target; b. a reactive sample that is reactive to changes in the concentration of said target; Including, the current measurements of the two or more samples are used to calibrate the sensor; The method of claim 1.

12. 12. The method of claim 11, wherein the calibration of the sensor is calculated, at least in part, by comparing current measurements of the least responsive sample and the responsive sample at response times of saturation levels through a polynomial fit.

13. The calibration provides a concentration value, the concentration value being: [0010] is calculated according to where [T] is the concentration of the target and K Ｄ is the dissociation constant of the target, i is a constant comprising the peak current, α is a constant comprising the ratio of the minimum frequency output signal to the target-free output signal, and i ＮＲ is the output current, and γ is a constant comprising the ratio of the target saturation output signal to the target free output signal. The method of claim 11.

14. 2. The method of claim 1, wherein the two or more samples include a first sample and a second sample, the first sample having a redox tag current that increases with increasing concentration of a target and the second sample having a redox tag current that decreases with increasing concentration of a target, and a difference in the current change between the two samples is recorded as a differential current value.

15. The method of claim 1 , wherein the two or more samples are average samples that are averaged from two or more adjacent samples.

16. The method of claim 1 , wherein the two or more samples are composite samples obtained from two or more adjacent samples.

17. 2. The method of claim 1, wherein at least one sample is taken at a time point equal to when the change in redox tag current has a maximum increase for a given increase in target concentration.

18. 2. The method of claim 1, wherein at least one sample is taken at a time point equal to when the change in redox tag current has a maximum decrease for a given increase in target concentration.

19. 2. The method of claim 1, wherein the at least one sample is taken at an equal time point when the change in redox tag current has a minimal change for a given increase in target concentration.

20. 2. The method of claim 1, wherein the method is continuous square wave voltammetry scans and the sensor is measured over time using at least one continuous square wave voltammetry scan for calibration and multiple non-continuous square wave voltammetry scans for measurement.

21. 10. The method of claim 1, wherein the sensor is calibrated during in vivo use at a known point when the concentration of the target analyte is less than a percentage selected from the group consisting of 2%, 5%, 10%, and 20%.

22. The method of claim 1 , wherein the data samples are used to determine a critical frequency.

23. 2. The method of claim 1, wherein the applied sudden voltage is at or within a range of + / - 0.1 mV of the voltage of the redox peak current, and the data collected from the amperometric scan comprises data selected from the group consisting of an average sample and a composite sample.

24. 1. A method for determining a concentration of an analyte, comprising: a. exposing an electrochemical sensor having a medical electrode to the analyte; b. scanning the medical electrode using scanning voltammetry, the scanning voltammetry comprising a square wave voltammetric waveform at a first frequency while continuously interrogating current as a function of time; c. generating a set of readings from said scanning voltammetry; d. using said set of readings to identify one or more changes in said analyte concentration; A method comprising:

25. 25. The method of claim 24, wherein the scanning voltammetry is performed without calibration.

26. The method of claim 24 , wherein the electrochemical sensor is calibrated.

Images