Inducible promoters for viral vector production

Inducible promoters in stable cell lines address the toxicity issues of Rep and capsid proteins, enabling efficient and scalable production of recombinant viral vectors by controlling protein expression, thus improving yield and stability.

JP2026015429APending Publication Date: 2026-01-29ASKLEPIOS BIOPHARMACEUTICAL INC +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025189111
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-02-12
Filing Date
2025-11-10
Publication Date
2026-01-29

Smart Images

  • Figure 2026015429000115
    Figure 2026015429000115
  • Figure 2026015429000116
    Figure 2026015429000116
  • Figure 2026015429000117
    Figure 2026015429000117
Patent Text Reader

Abstract

To provide an inducible promoter for viral vector production.SOLUTION: Aspects described herein relate to a stable cell line for recombinant viral vector (e.g., recombinant adeno-associated viral vector) production comprising at least one inducible promoter operably linked to a heterologous gene encoding a toxic protein. Further provided herein are methods for generating stable cell lines and methods for viral vector production. The present invention relates to cell lines for the rapid and scalable production of viral vectors, such as adeno-associated virus (AAV).SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This international application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 63 / 000,155, filed March 26, 2020; No. 63 / 010,330, filed April 15, 2020; and U.S. Patent Application Publication No. 63 / 148,905, filed February 12, 2021, the entire contents of which are incorporated herein by reference.

[0002] FIELD OF THE INVENTION The present invention relates to cell lines for the rapid and scalable production of viral vectors, such as adeno-associated viruses (AAV). [Background technology]

[0003] Background of the Invention Recombinant viral vectors, such as recombinant adeno-associated viral vectors, lentiviral vectors and adeno-vectors, all carry heterologous DNA (transgenes) and are used to deliver genes to cells, and the genes can be expressed to allow, for example, the production of recombinant proteins in vitro or in vivo, vaccination, or the treatment of disease states or genetic defects.Disease states or genetic defects can be treated, for example, by replicating viral genes, for example, providing effective levels of normal gene products, correcting dysfunctional genes by increasing the level of gene products, or by blocking the endogenous production of genes whose expression is harmful to cells or organisms.

[0004] Methods for delivering exogenous genes into mammalian cells include the use of mammalian viral vectors, such as those derived from retroviruses (e.g., lentiviruses), adenoviruses, herpes viruses, vaccinia viruses, polioviruses, adeno-associated viruses, hybrid viruses, etc. A limiting factor in the field of gene therapy is identifying efficient and scalable methods for producing such viral vectors in large quantities.

[0005] The adeno-associated virus (AAV) system has many advantages for transgene delivery and is therefore an ideal viral vector for gene therapy. Regarding AAV production, it has long been known that the viral protein, replication (rep), is required for replication and excision of the AAV genome, but the extent to which Rep protein is required for effective rAAV production is unclear. Rep protein has been shown to be toxic to cell lines, resulting in the difficulty of generating stable cell lines expressing Rep. It has further been suggested that attenuation of Rep78 / 68 production during viral propagation results in higher levels of rAAV production. In contrast, other techniques have clearly demonstrated that high expression of Rep protein (resulting from replacing the native rep p5 promoter with a stronger promoter) results in high levels of rAAV expression. Considering the state of the art, it appears that varying levels of Rep may be required depending on the specific virus-producing cells used for rAAV vector production. Similarly, capsid protein may be toxic to cells. Therefore, to optimize viral vector production, it is important to obtain precise temporal and / or spatial control of Rep, and / or other virulence genes required for virus production. Summary of the Invention [Means for solving the problem]

[0006] Summary of the Invention One aspect of the invention described herein provides a stable cell line for the production of a recombinant viral vector comprising at least one inducible promoter operably linked to a heterologous gene encoding a toxic protein.

[0007] In one embodiment of any aspect provided herein, the regulatable promoter is an inducible or repressible promoter. In one embodiment of any aspect provided herein, the regulatable promoter is an inducible promoter.

[0008] In one embodiment of any aspect provided herein, the toxic protein is a viral protein. Exemplary viral proteins include replication (rep), capsid (cap), envelope (env), and polymerase (pol).

[0009] In one embodiment of any aspect provided herein, the toxic protein is associated with nucleic acid transcription.

[0010] In one embodiment of any aspect provided herein, the toxic protein is associated with capsid or envelope production.

[0011] In one embodiment of any aspect provided herein, the inducible promoter is selected from the group selected from a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0012] In one embodiment of any aspect provided herein, the cell comprises at least two inducible promoters, wherein the at least two inducible promoters are induced by different compositions, and wherein the at least two inducible promoters are operably linked to different heterologous genes encoding different toxic proteins.

[0013] In one embodiment of any aspect provided herein, the cell comprises a first inducible promoter operably linked to a repressible element capable of silencing protein expression.

[0014] In one embodiment of any aspect provided herein, the first inducible promoter further encodes a protein that represses expression of the first inducible promoter.

[0015] In one embodiment of any aspect provided herein, the cell comprises a first inducible promoter that further encodes a protein that induces expression of a second inducible promoter.

[0016] In one embodiment of any aspect provided herein, the cell is a eukaryotic cell or a prokaryotic cell.

[0017] In one embodiment of any aspect provided herein, the cell is selected from a cell type listed in Table 2. In one embodiment of any aspect provided herein, the cell is derived from a cell type selected from a cell type listed in Table 2.

[0018] In one embodiment of any aspect provided herein, contacting the cell with the inducer results in expression of at least one toxic protein.

[0019] In one embodiment of any aspect provided herein, the cell is for use in producing a viral particle selected from the group consisting of an adenoviral vector, a lentiviral vector, a retroviral vector, a herpesvirus vector, an alphavirus vector, a poxvirus vector, a baculovirus vector, and a chimeric virus vector.

[0020] One aspect of the invention described herein is a stable cell line for recombinant AAV vector production comprising at least one inducible promoter, the inducible promoter being operably linked to a heterologous rep gene encoding a rep protein.

[0021] In one embodiment of any aspect provided herein, the inducible promoter is further operably linked to a heterologous cap gene encoding a cap protein.

[0022] In one embodiment of any aspect provided herein, the stable cell further comprises a second inducible promoter operably linked to a heterologous cap gene encoding a cap protein, wherein the second inducible promoter is induced by a different compound than the first inducible promoter.

[0023] One aspect of the invention described herein is a stable cell line for recombinant AAV vector production, comprising at least one inducible promoter, the inducible promoter operably linked to a heterologous cap gene encoding a cap protein.

[0024] One aspect of the invention described herein is a method of producing any of the stable cell lines provided herein, the method comprising: (a) transforming a population of cells with at least one nucleic acid cassette comprising an inducible promoter operably linked to a heterologous gene encoding a toxic protein; (b) culturing the population of cells of (a) for a time and under conditions sufficient to allow expression of the nucleic acid cassette; (c) selecting cells that stably express the nucleic acid cassette; and (d) growing the cells of (c) to produce a cell line.

[0025] One aspect of the invention described herein is a method for producing adeno-associated virus (AAV) particles, the method comprising the steps of: (a) providing any of the stable cell lines for rAAV production in an AAV expression system; (b) culturing the cells under conditions in which at least one toxic protein is expressed; (c) culturing the cells under conditions in which AAV particles are produced; and (d) optionally isolating the AAV particles.

[0026] In one embodiment of any aspect provided herein, the cells are cultured in suspension.

[0027] In one embodiment of any aspect provided herein, the cells are cultured in animal component-free conditions.

[0028] In one embodiment of any aspect provided herein, step (c) comprises isolating the AAV particles from the cells.

[0029] In one embodiment of any aspect provided herein, step (c) comprises isolating the AAV particles from the medium in which the cells are cultured.

[0030] In one embodiment of any aspect provided herein, the cells are cultured in shake flasks.

[0031] In one embodiment of any aspect provided herein, the cells are cultured in a bioreactor.

[0032] In one embodiment of any aspect provided herein, step (c) is performed after the toxic protein is expressed.

[0033] In one embodiment of any aspect provided herein, when the stable cell comprises at least two inducible promoters, the at least two inducible promoters are induced substantially simultaneously.

[0034] In one embodiment of any aspect provided herein, when the stable cell comprises at least two inducible promoters, the at least two inducible promoters are induced at different times and / or for different durations.

[0035] In one embodiment of any aspect provided herein, the method is capable of producing all serotypes, chimeras, and hybrids of AAV. Exemplary AAVs include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and AAV13, or chimeric AAVs composed of AAV1-13 2.5, 218, 9.45, and other chimeric or hybrid capsids.

[0036] In one embodiment of any aspect provided herein, the AAV particles comprise rational haploid capsids.

[0037] In one embodiment of any aspect provided herein, the AAV expression system comprises at least one of a recombinant AAV plasmid, a plasmid expressing Rep, a plasmid expressing Cap, and an adenovirus helper plasmid.

[0038] In one embodiment of any aspect provided herein, the recombinant AAV plasmid encodes a transgene. In one embodiment of any aspect provided herein, the transgene is a therapeutic transgene.

[0039]

[0023] In one embodiment of any aspect provided herein, the method comprises producing at least about 4x10 cells per cell prior to purification. 4 In one embodiment of any aspect provided herein, the method provides at least about 1 x 10 vector genome-containing particles per cell prior to purification. 5 In one embodiment of any aspect provided herein, the method provides at least about 1 x 10 vector genome-containing particles per liter of cell culture. 12 In one embodiment of any aspect provided herein, the method provides at least about 1 x 10 purified vector genome-containing particles per liter of cell culture. 13 A number of purified vector genome-containing particles are provided.

[0040] One aspect of the invention described herein is a method for producing viral particles, the method comprising the steps of: (a) providing a stable cell line described herein in a viral expression system; (b) culturing the cells under conditions in which at least one toxic protein is expressed (the at least one toxic protein is operably linked to at least one inducible promoter); (c) culturing the cells under conditions in which viral particles are produced; and (d) optionally isolating the viral particles.

[0041] In one embodiment of any aspect provided herein, the viral particle is selected from the group consisting of an adenoviral vector, a lentiviral vector, a retroviral vector, a herpesvirus vector, an alphavirus vector, a poxvirus vector, a baculovirus vector, and a chimeric virus vector.

[0042] One aspect of the invention described herein provides a cell line for recombinant viral vector production comprising the transient expression of at least one inducible promoter, the inducible promoter operably linked to a heterologous gene encoding a toxic protein.

[0043] One aspect of the invention described herein provides a stable cell line for producing a recombinant viral vector comprising at least one inducible promoter operably linked to a heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, an RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0044] One aspect of the invention described herein provides a stable cell line for the production of recombinant viral vectors comprising at least one forskolin-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein.

[0045] One aspect of the invention described herein provides a stable cell line for recombinant viral vector production comprising at least one hypoxia-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein.

[0046] One aspect of the invention described herein provides a stable cell line for recombinant viral vector production, comprising at least one forskolin-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0047] One aspect of the invention described herein provides a stable cell line for recombinant viral vector production, the cell line comprising at least one hypoxia-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0048] One aspect of the invention described herein provides a stable cell line for recombinant viral vector production comprising at least one forskolin-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, and at least one hypoxia-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein.

[0049] One aspect of the invention described herein provides a stable cell line for recombinant viral vector production comprising at least one inducible promoter having the sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operably linked to at least one heterologous gene encoding a toxic protein. Variants of these and other promoters suitable for use in the invention are described below.

[0050] One aspect of the invention described herein provides a stable cell line for recombinant viral vector production comprising at least one inducible promoter having the sequence of any one of SEQ ID NOs: 6 to 9 operably linked to at least one heterologous gene encoding a toxic protein. Variants of these and other promoters suitable for use in the invention are described below.

[0051] One aspect of the invention described herein provides a stable cell line for recombinant viral vector production, comprising at least one inducible promoter having the sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0052] One aspect of the present invention described herein provides a stable cell line for producing a recombinant viral vector, the cell line comprising at least one inducible promoter having any one of the sequences of SEQ ID NO: 6 to SEQ ID NO: 9 operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0053] One aspect of the present invention described herein provides a stable cell line for producing a recombinant viral vector, comprising at least one inducible promoter having the sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter having the sequence of any one of SEQ ID NOs: 6 to 9 operably linked to at least one heterologous gene encoding a toxic protein.

[0054] One aspect of the invention described herein provides a stable cell line for rAAV production comprising at least one inducible promoter operably linked to a heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0055] One aspect of the invention described herein provides a stable cell line for rAAV production comprising at least one forskolin-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein.

[0056] One aspect of the invention described herein provides a stable cell line for rAAV production comprising at least one hypoxia-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein.

[0057] One aspect of the invention described herein provides a stable cell line for rAAV production, the cell line comprising at least one forskolin-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0058] One aspect of the invention described herein provides a stable cell line for rAAV production, the cell line comprising at least one hypoxia-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0059] One aspect of the invention described herein provides a stable cell line for rAAV production comprising at least one forskolin-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, and at least one hypoxia-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein.

[0060] One aspect of the invention described herein provides a stable cell line for rAAV production comprising at least one inducible promoter having the sequence of SEQ ID NO:1 or SEQ ID NO:3 operably linked to at least one heterologous gene encoding a toxic protein.

[0061] One aspect of the invention described herein provides a stable cell line for rAAV production comprising at least one inducible promoter having the sequence of any one of SEQ ID NO:6 to SEQ ID NO:9 operably linked to at least one heterologous gene encoding a toxic protein.

[0062] One aspect of the invention described herein provides a stable cell line for rAAV production, the cell line comprising at least one inducible promoter having the sequence of SEQ ID NO:1 or SEQ ID NO:3 operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0063] One aspect of the invention described herein provides a stable cell line for rAAV production, the cell line comprising at least one inducible promoter having a sequence of any one of SEQ ID NOs: 6 to 9 operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0064] One aspect of the invention described herein provides a stable cell line for rAAV production, comprising at least one inducible promoter having the sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter having the sequence of any one of SEQ ID NOs: 6 to 9 operably linked to at least one heterologous gene encoding a toxic protein.

[0065] In one embodiment of any aspect provided herein, the stable cell line further comprises at least one inhibitory element operably linked to the at least one heterologous gene encoding a toxic protein.

[0066] In one embodiment of any aspect provided herein, the stable cell line has at least two inducible promoters, and wherein the at least two inducible promoters are the same.

[0067] In one embodiment of any aspect provided herein, the stable cell line has at least two inducible promoters, wherein the at least two inducible promoters are different.

[0068] Certain aspects of the technology described herein generally relate to nucleic acid constructs, methods, and systems for sequential and / or temporal regulation of gene expression of one or more viral proteins. Such nucleic acid constructs described herein are suitable for viral vector expression systems, such as AAV expression systems, and for generating stable cell lines for viral and AAV vector expression systems.

[0069] One aspect described herein provides a nucleic acid construct comprising a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding a viral (e.g., E4) protein, a nucleic acid sequence encoding a second viral (e.g., E2A) protein, and a nucleic acid sequence encoding a viral RNA (e.g., VA RNA), wherein each nucleic acid sequence encoding any one of E4, E2A, and VA is operably linked to a first regulatable promoter; and a nucleic acid sequence encoding a Rep protein, wherein the nucleic acid encoding the Rep protein is under the control of a second regulatable promoter or regulatable transcription activator, wherein the first and second regulatable promoters are different types of regulatable promoters. In one embodiment, the regulatable promoter is an inducible promoter, such as a hypoxia- and / or forskolin-inducible promoter.

[0070] Exemplary transcriptional activators include homeodomain transcriptional activators, zinc finger transcriptional activators, winged-helix (forkhead) transcriptional activators, leucine zipper transcriptional activators, and helix-loop-helix transcriptional activators. In one embodiment, the transcriptional activator is a zinc finger transcriptional activator (ZF-TA).

[0071] In one embodiment, the first and second Rep proteins are encoded by a nucleic acid sequence or by one or more nucleic acid sequences. In one embodiment, the first Rep protein is a large Rep, e.g., Rep78, and the second Rep protein is a small Rep, e.g., Rep52. In one embodiment, the nucleic acids encoding the first and second Rep proteins are under the control of a second regulatable promoter or regulatable transcriptional activator. In one embodiment, each nucleic acid encoding the first and second Rep proteins is under the control of a regulatable transcriptional activator. In one embodiment, each nucleic acid encoding the first and second Rep proteins is under the control of the same regulatable transcriptional activator. In one embodiment, the transcriptional activator is a zinc finger transcriptional activator (ZF-TA).

[0072] In one embodiment, the nucleic acid sequence encoding the Rep protein comprises a modified start codon. In one embodiment, the nucleic acid sequence encoding the Rep78 protein comprises a modified start codon. In one embodiment, the nucleic acid sequence encoding the Rep78 protein comprises a modified start codon selected from ACC, AUC, CUG, and AGG. In such an embodiment, the nucleic acid sequence encoding the Rep52 protein comprises a typical start codon. In such an embodiment, the nucleic acid sequence encoding the Rep52 protein comprises an ATG start codon.

[0073] In one embodiment of any aspect, the Rep protein is a modified Rep protein. In one embodiment of any aspect, the Rep78 protein is a modified Rep protein.

[0074] In one embodiment of any aspect, the modified Rep protein has a lysine to arginine mutation at amino acid 84. In one embodiment of any aspect, the modified Rep78 protein has a lysine to arginine mutation at amino acid 84.

[0075] In one embodiment of any aspect, the nucleic acid encoding the Rep protein further comprises a nucleic acid encoding a ribozyme at its 3' end.

[0076] In one embodiment of any aspect, the second regulatable promoter operably linked to the nucleic acid encoding a Rep protein is an inducible promoter or comprises a binding site for a regulatable transcription activator. In one embodiment of any aspect, the first regulatable promoter operably linked to the nucleic acid encoding any one of E4, E2A, and VA is an inducible promoter.

[0077] In one embodiment of any aspect, the inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter. In one embodiment, the inducible promoter is a forskolin-inducible promoter or a hypoxia-inducible promoter.

[0078] In one embodiment of any aspect, the inducible promoter lacks a minimal promoter.

[0079] In one embodiment of any aspect, the inducible promoter further comprises a TATA box sequence or a p5 duplication sequence, or both a TATA box sequence and a p5 duplication sequence. In one embodiment of any aspect, the inducible promoter comprises a TATA box sequence or a p5 duplication sequence, or both a TATA box sequence and a p5 duplication sequence, instead of a minimal promoter. In such an embodiment, the inducible promoter can be a second regulatable promoter.

[0080] Another aspect described herein provides a nucleic acid construct comprising a promoter, a TATA box and / or a nucleic acid encoding p5, wherein the promoter does not comprise a minimal promoter.

[0081] Another aspect described herein provides a nucleic acid construct comprising a nucleic acid sequence encoding a regulatable transcriptional activator operably linked to an inducible promoter, wherein the inducible promoter is an E4-responsive promoter, or an E2-responsive promoter or other helper gene-responsive promoter. In one embodiment, the helper gene-responsive promoter comprises a sequence bound by the transcriptional activator, and expression or activity of the transcriptional activator is inducible by expression of one or more helper genes. In some embodiments, the regulatable transcriptional activator is a zinc finger transcriptional activator.

[0082] Another aspect of the present invention provides a nucleic acid construct comprising a toxic protein operably linked to a promoter comprising a target site for binding of a regulatable transcriptional activator, e.g., a zinc finger transcriptional activator (ZF-TA). In one embodiment, the toxic protein is a Rep protein. In one embodiment, a helper gene-responsive promoter comprises a sequence bound by the transcriptional activator, and expression or activity of the transcriptional activator is inducible by expression of one or more helper genes.

[0083] Another aspect according to the invention provides a nucleic acid construct comprising a gene encoding a Rep protein operably linked to a promoter containing a target site for binding of a regulatable transcriptional activator, e.g., a zinc finger transcriptional activator (ZF-TA), and a promoter.

[0084] In one embodiment of any aspect, the regulatable transcriptional activator, e.g., a zinc finger transcriptional activator (ZF-TA), is expressed from a nucleic acid construct encoding the regulatable transcriptional activator, e.g., a zinc finger (ZF) transcriptional activator, operably linked to an inducible promoter, wherein the inducible promoter is a helper gene responsive promoter, e.g., an E4 responsive promoter, or an E2 responsive promoter or other helper gene responsive promoter.

[0085] In one embodiment of any aspect, the nucleic acid construct comprises a nucleic acid sequence encoding at least one helper protein, wherein each nucleic acid construct is operably linked to a regulatable promoter; a nucleic acid encoding a toxic protein under the control of a second regulatable promoter or a regulatable transcriptional activator; a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA RNA, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a regulatable promoter; or Further comprising at least one of the nucleic acids encoding a Rep protein under the control of a second regulatable promoter or a regulatable transcriptional activator, hi one embodiment, the regulatable transcriptional activator is a zinc finger transcriptional activator.

[0086] Another aspect described herein provides a nucleic acid construct comprising: a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operably linked to a promoter (e.g., a constitutive promoter); a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA RNA, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a regulatable promoter; and / or a nucleic acid sequence encoding a regulatable transcription activator operably linked to an inducible promoter, wherein the inducible promoter is an E4-responsive promoter or an E2-responsive promoter; and a nucleic acid construct comprising a Rep protein operably linked to a promoter comprising a target site for binding of the regulatable transcription activator. In one embodiment, the regulatable transcription activator is a zinc finger transcription activator.

[0087] Another embodiment described herein provides a nucleic acid construct comprising a nucleic acid sequence encoding a Cap protein and a recombinase recognition sequence (RRS) located 3' to the nucleic acid sequence encoding the Cap protein.Another embodiment described herein provides a nucleic acid construct comprising a nucleic acid sequence encoding a Cap protein and a recombinase recognition sequence (RRS) located 5' to the nucleic acid sequence encoding the Cap protein.

[0088] In one embodiment of any aspect, the nucleic acid sequence encoding the Cap protein is operably linked to a constitutive promoter.

[0089] In one embodiment of any aspect, the nucleic acid sequence encoding the Cap protein is operably linked to a regulatable promoter. In one embodiment of any aspect, the regulatable promoter is an inducible promoter.

[0090] In one embodiment of any aspect, the RRS is a Flippase-responsive RRS.

[0091] In one embodiment of any aspect, the nucleic acid construct further comprises a nucleic acid encoding a recombinase protein operably linked to an inducible promoter.

[0092] Another embodiment provided herein is a nucleic acid construct comprising: a first nucleic acid construct comprising a promoter, a stop nucleic acid sequence flanked by a first pair of recombinase recognition sequences (RRS), and a nucleic acid sequence encoding a Rep protein, wherein the promoter is operably linked to the nucleic acid encoding the Rep protein; and a second nucleic acid construct comprising, in a 5' to 3' direction, a promoter, a stop nucleic acid sequence flanked by a second pair of recombinase recognition sequences (RRS), and a nucleic acid sequence encoding one or more of E2A, E4, and VA RNA, wherein the promoter is operably linked to the nucleic acid encoding one or more of E2A, E4, and VA RNA.

[0093] Another embodiment provided herein is a nucleic acid construct comprising: a first nucleic acid construct comprising, in a 5' to 3' direction, a promoter, a stop nucleic acid sequence flanked by a first pair of recombinase recognition sequences (RRS), and a nucleic acid sequence encoding a Rep protein, wherein the promoter is operably linked to the nucleic acid encoding the Rep protein; and a second nucleic acid construct comprising, in a 5' to 3' direction, a promoter, a stop nucleic acid sequence flanked by a second pair of recombinase recognition sequences (RRS), and a nucleic acid sequence encoding one or more of E2A, E4, and VA RNA, wherein the promoter is operably linked to the nucleic acid encoding one or more of E2A, E4, and VA RNA.

[0094] In one embodiment of any aspect, the nucleic acid construct further includes one or more selectable markers flanked by a third pair of recombinase recognition sequences (RRS), wherein the pairs of RRSs are in the same orientation relative to each other, and wherein the nucleic acid encoding the one or more selectable markers is operably linked to one or more promoters described herein.

[0095] In one embodiment of any aspect, the first pair of RRSs and the second pair of RRSs are in the same orientation relative to each other.

[0096] In one embodiment of any aspect, the first pair of RRSs and the second pair of RRSs are in opposite orientations relative to each other.

[0097] In one embodiment of any aspect, the first pair of RRSs, the second pair of RRSs, and the third pair of RRSs are each responsive to a different tyrosine recombinase or serine integrase enzyme.

[0098] In one embodiment of any aspect, the first pair of RRSs and the second pair of RRSs are responsive to the same tyrosine recombinase or serine integrase enzyme.

[0099] In one embodiment of any aspect, the first pair of RRSs, or the second pair of RRSs, or both, are Cre-responsive RRSs.

[0100] In one embodiment of any aspect, the third pair of RRSs is a Flipase-responsive RRS.

[0101] In one embodiment of any aspect, the cell further comprises a construct comprising a nucleic acid encoding a recombinase protein operably linked to an inducible promoter. In one embodiment of any aspect, the cell further comprises a nucleic acid encoding a Flipase recombinase protein operably linked to an inducible promoter.

[0102] In one embodiment of any aspect, the cell further comprises a nucleic acid encoding a Cre recombinase protein operably linked to an inducible promoter.

[0103] Another aspect described herein provides a cell comprising any of the nucleic acid constructs described herein.

[0104] Another aspect described herein provides a cell comprising at least one of any of the nucleic acid constructs described herein. In one embodiment of any of the aspects, the cell comprises at least two of any of the nucleic acid constructs described herein. In one embodiment of any of the aspects, the cell comprises at least three of any of the nucleic acid constructs described herein.

[0105] In one embodiment of any aspect, the cell further comprises a construct comprising a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operably linked to a promoter (e.g., a constitutive promoter).

[0106] In one embodiment of any aspect, the cell further comprises a construct comprising nucleic acid sequences encoding marker proteins, hi one embodiment of any aspect, the nucleic acid sequences encoding the marker proteins are flanked by recombinase recognition sequences (RRS) that are oriented in the same direction relative to each other.

[0107] In embodiments of any aspect, the cell further comprises a synthetic gene regulatory system, the synthetic gene regulatory system comprising a target DNA binding protein or a nucleic acid sequence encoding the target DNA binding protein operably linked to a promoter; and a nucleic acid sequence encoding a gene of interest operably linked to a target promoter, wherein the target DNA binding protein is capable of binding to a target sequence, and the target sequence is located within the target promoter and / or the nucleic acid sequence encoding the gene of interest, thereby attenuating or preventing expression of the gene of interest.

[0108] In one embodiment of any aspect, expression of the construct is stable expression.

[0109] In one embodiment of any aspect, expression of the construct is transient expression.

[0110] In one embodiment of any aspect, the cell comprises at least two nucleic acid constructs, and the expression of the at least two nucleic acid constructs is stable expression.

[0111] In one embodiment of any aspect, the cell comprises at least two nucleic acid constructs, and expression of the at least two nucleic acid constructs is transient expression.

[0112] In one embodiment of any aspect, the cell comprises at least two nucleic acid constructs, and expression of at least one nucleic acid construct is stable expression.

[0113] Another aspect described herein provides a stable cell comprising stable expression of at least one nucleic acid construct described herein.

[0114] Another aspect described herein provides a cell comprising transient expression of at least one nucleic acid construct described herein.

[0115] Another aspect described herein provides a method for producing viral particles, comprising providing any cell line described herein, any stable cell line described herein, or any transient cell line described herein in a viral expression system; culturing the cells for a time and under conditions sufficient to express at least one nucleic acid under the control of a regulatable promoter; culturing the cells under conditions such that viral particles are produced; and, optionally, isolating the viral particles.

[0116] Another embodiment described herein provides a method for producing viral particles, the method comprising: (a) providing a cell line expressing a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a first regulatable promoter; and a nucleic acid sequence encoding a Rep protein, wherein the nucleic acid encoding the Rep protein is under the control of a second regulatable promoter, and the first and second regulatable promoters are different nucleic acid sequences; (b) culturing the cells for a time and under conditions sufficient to express at least the nucleic acid sequence encoding the E4 protein, the nucleic acid sequence encoding the E2A protein, or the nucleic acid sequence encoding the VA RNA first in a viral vector production protocol; (c) culturing the cells for a time and under conditions sufficient to express the nucleic acid sequence encoding the Rep protein second in a viral vector production protocol; (d) culturing the cells under conditions to produce viral particles; and (e) optionally, isolating the viral particles. In one embodiment, the nucleic acid sequence encoding the E4 protein, the nucleic acid sequence encoding the E2A protein, or the nucleic acid sequence encoding the VA RNA is expressed at hour 3-4 of the viral vector production protocol. In one embodiment, the nucleic acid sequence encoding the Rep protein is expressed at hour 6-8 of the viral vector production protocol.

[0117] In one embodiment of any aspect, the culturing in step (b) is with an inducer of the first regulatable promoter. In one embodiment of any aspect, the culturing in step (c) is with an inducer of the second regulatable promoter. In one embodiment of any aspect, the or each inducer may act directly or indirectly to induce expression of a given nucleic acid.

[0118] Another embodiment described herein is a method of producing viral particles, comprising: (a) a nucleic acid construct comprising a nucleic acid sequence encoding a regulatable transcriptional activator operably linked to an inducible promoter (the inducible promoter is a helper gene responsive promoter, e.g., an E4 responsive promoter, or an E2 responsive promoter or other helper gene responsive promoter); a nucleic acid construct comprising a toxic protein operably linked to a promoter comprising a target site for the binding of the regulatable transcriptional activator; a nucleic acid construct comprising a Rep protein operably linked to a promoter comprising a target site for the binding of the regulatable transcriptional activator; at least one helper protein nucleic acid sequence (each nucleic acid construct is operably linked to a regulatable promoter; the nucleic acid encoding the toxic protein is under the control of a second regulatable promoter or regulatable transcriptional activator); a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA RNA (E4, E2A, and VA The method includes the steps of: (a) providing a cell line expressing at least one of the following viral vectors: (a) each nucleic acid sequence encoding one of the E4, E2A, or VA proteins operably linked to a regulatable promoter; or (b) the nucleic acid encoding the Rep protein is under the control of a second regulatable promoter or regulatable transcription activator; (b) culturing the cells for a time and under conditions sufficient to express at least the nucleic acid sequence encoding the E4 protein, the nucleic acid sequence encoding the E2A protein, or the nucleic acid sequence encoding the VA protein first in the viral vector production protocol; (c) culturing the cells for a time and under conditions sufficient to express the nucleic acid sequence encoding the toxic protein or the Rep protein second in the viral vector production protocol; (d) culturing the cells under conditions to produce viral particles; and (e) optionally isolating the viral particles. In one embodiment, the nucleic acid sequence encoding the E4 protein, the nucleic acid sequence encoding the E2A protein, or the nucleic acid sequence encoding the VA RNA is expressed between the third and fourth hours of the viral vector production protocol.In one embodiment, the nucleic acid sequence encoding the Rep protein is expressed between hours 6 and 8 of the viral vector production protocol. In one embodiment, the regulatable transcriptional activator is a zinc finger transcriptional activator (ZF-TA). In one embodiment, the expression or activity of the transcriptional activator is inducible by expression of one or more helper genes.

[0119] In one embodiment of any aspect, the culturing in step (b) is with an inducer of a regulatable promoter operably linked to a nucleic acid encoding at least E4, E2A, or VA RNA. In one embodiment of any aspect, the culturing in step (c) is with an inducer of a transcriptional activator (e.g., ZF-TA) or a second regulatable promoter. In one embodiment of any aspect, expression of the transcriptional activator (e.g., ZA-TA) is induced by expression of E4, E2, or VA RNA. In one embodiment of any aspect, expression of the transcriptional activator (e.g., ZA-TA) is induced directly or indirectly by expression of E4, E2, or VA RNA.

[0120] Another embodiment described herein is a method for producing viral particles, comprising the steps of: (a) providing a cell line expressing a nucleic acid construct comprising: a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operably linked to a promoter (e.g., a constitutive promoter); a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA RNA, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a regulatable promoter; a nucleic acid sequence encoding a regulatable transcription activator operably linked to an inducible promoter, wherein the inducible promoter is an E4-responsive promoter, an E2-responsive promoter, or a VA RNA-responsive promoter; and a Rep protein operably linked to a promoter comprising a target site for binding of the regulatable transcription activator; (b) providing a cell line expressing a nucleic acid construct comprising: a nucleic acid sequence encoding at least an E4 protein, a nucleic acid sequence encoding an E2A protein, or a VA RNA-responsive promoter; (c) culturing the cells for a time and under conditions sufficient to express a nucleic acid sequence encoding a toxic protein or a Rep protein secondarily in the viral vector production protocol; (d) culturing the cells under conditions to produce viral particles; and (e) optionally isolating the viral particles. In one embodiment, the nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, or a nucleic acid sequence encoding a VA RNA is expressed 3-4 hours into the viral vector production protocol. In one embodiment, the nucleic acid sequence encoding a Rep protein is expressed 6-8 hours into the viral vector production protocol. In one embodiment, the regulatable transcriptional activator is a zinc finger transcriptional activator. In one embodiment, the expression or activity of the transcriptional activator is inducible by expression of one or more helper genes.

[0121] In one embodiment of any aspect, the culturing in step (b) is with an inducer of a regulatable promoter operably linked to at least E4, E2A, or VA RNA. In one embodiment of any aspect, the culturing in step (c) is with a transcriptional activator (e.g., ZF-TA). In one embodiment of any aspect, expression of the transcriptional activator (ZF-TA) is induced by expression of E4, E2, or VA RNA. In one embodiment of any aspect, expression of the zinc finger transcriptional activator (ZF-TA) is induced directly or indirectly by expression of E4, E2, or VA.

[0122] Another aspect described herein is a method for producing viral particles, comprising: The method includes the steps of: (a) providing a cell line expressing a nucleic acid construct comprising a nucleic acid sequence encoding a Cap protein and a recombinase recognition sequence (RRS) located 3' of the nucleic acid sequence encoding the Cap protein; (b) culturing the cells for a time and under conditions sufficient to cause at least the nucleic acid sequence encoding the Cap protein to be highly expressed for the first 24 hours of a viral vector production protocol and moderately expressed for the remaining 48 hours of the viral vector production protocol; (c) culturing the cells for a time and under conditions sufficient to cause viral particles to be produced; and (d) optionally isolating the viral particles.

[0123] In one embodiment of any aspect, the culturing in step (b) is culturing with an inducer of a regulatable promoter operably linked to a Cap protein.

[0124] Another embodiment described herein is a method of producing viral particles, comprising the steps of: (a) providing a cell that expresses a first nucleic acid construct comprising, in a 5' to 3' direction, a promoter, a terminating nucleic acid sequence flanked by a first pair of recombinase recognition sequences (RRS), and a nucleic acid sequence encoding a Rep protein, wherein the promoter is operably linked to the nucleic acid encoding the Rep protein; and a second nucleic acid construct comprising, in a 5' to 3' direction, a promoter, a terminating nucleic acid sequence flanked by a second pair of recombinase recognition sequences (RRS), and a nucleic acid sequence encoding one or more of E2A, E4, and VA RNA, wherein the promoter is operably linked to the nucleic acid encoding one or more of E2A, E4, and VA RNA; (b) providing a cell that expresses at least a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, or a nucleic acid sequence encoding a VA protein. (c) culturing the cells for a time and under conditions sufficient to express a nucleic acid sequence encoding a toxic protein or a Rep protein in a viral vector production protocol first (e.g., at hour 10 of production); (c) culturing the cells for a time and under conditions sufficient to express a nucleic acid sequence encoding a toxic protein or a Rep protein in a viral vector production protocol second (e.g., at hour 12 of production); (d) culturing the cells under conditions to produce viral particles; and (e) optionally isolating the viral particles. In one embodiment, the nucleic acid sequence encoding an E4 protein, an E2A protein, or a VA RNA is expressed at hour 3-4 of the viral vector production protocol. In one embodiment, the nucleic acid sequence encoding a Rep protein is expressed at hour 6-8 of the viral vector production protocol.

[0125] In one embodiment of any aspect, the culturing in step (b) is with a recombinase specific for a first pair of recombinase recognition sequences (RRS). In one embodiment of any aspect, the culturing in step (c) is with a recombinase specific for a second pair of recombinase recognition sequences (RRS).

[0126] Yet another embodiment described herein provides a method for producing stable cell lines for producing viral particles containing packaging sequences (sometimes referred to as the AAV genome). The present invention provides, for example, the following items. (Item 1) A nucleic acid construct comprising: a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA RNA, wherein each of the nucleic acid sequences encoding any one of the E4 protein, the E2A protein, and the VA RNA is operably linked to a first regulatable promoter; and a nucleic acid sequence encoding a Rep protein, wherein said nucleic acid encoding the Rep protein is under the control of a second regulatable promoter or a heterologous transcriptional activator; A nucleic acid construct wherein said first and said second regulatable promoters are different. (Item 2) 2. The nucleic acid construct of item 1, wherein the Rep protein is a modified Rep protein. (Item 3) 3. The nucleic acid construct of claim 2, wherein the modified Rep protein has a lysine to arginine mutation at amino acid 84. (Item 4) 4. The nucleic acid construct of item 2 or 3, wherein the nucleic acid encoding the Rep protein further comprises a nucleic acid encoding a ribozyme at its 3' end. (Item 5) 5. The nucleic acid construct according to any one of items 2 to 4, wherein the regulatable promoter operably linked to the nucleic acid encoding the Rep protein is an inducible promoter or contains a binding site for the heterologous transcriptional activator. (Item 6) 6. The nucleic acid construct of item 5, wherein the inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, an RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter. (Item 7) 7. The nucleic acid construct of item 5 or 6, wherein the inducible promoter lacks a minimal promoter. (Item 8) 8. The nucleic acid construct according to any one of items 5 to 7, wherein the inducible promoter further comprises a TATA box sequence or a p5 replication sequence, or both a TATA box sequence and a p5 replication sequence. (Item 9) A nucleic acid construct comprising a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operably linked to an inducible promoter, wherein the inducible promoter is an E4-responsive promoter, or an E2-responsive promoter or other helper gene-responsive promoter. (Item 10) A nucleic acid construct comprising a toxic protein operably linked to a promoter containing a target site for binding of a zinc finger transcriptional activator (ZF-TA). (Item 11) A nucleic acid construct comprising a Rep protein operably linked to a promoter containing a target site for binding of a zinc finger transcriptional activator (ZF-TA). (Item 12) 12. The nucleic acid construct of claim 10 or 11, wherein the zinc finger transcriptional activator (ZF-TA) is expressed from the nucleic acid construct of claim 9. (Item 13) 13. The nucleic acid construct according to any one of items 9 to 12, further comprising at least one of the following: a nucleic acid sequence encoding at least one helper protein, each nucleic acid construct being operably linked to a regulatable promoter; the nucleic acid encoding the toxic protein is under the control of a second regulatable promoter or a zinc finger transcriptional activator; a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA RNA, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a regulatable promoter; or the nucleic acid encoding the Rep protein is under the control of a second regulatable promoter or a zinc finger transcriptional activator; Nucleic acid constructs. (Item 14) A nucleic acid construct comprising: a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operably linked to a constitutive promoter; a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a regulatable promoter; and a nucleic acid construct comprising: a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operably linked to an inducible promoter, wherein the inducible promoter is an E4-responsive promoter or an E2-responsive promoter; and a nucleic acid construct comprising a Rep protein operably linked to a promoter containing a target site for binding of a zinc finger transcriptional activator (ZF-TA). (Item 15) A cell comprising the nucleic acid construct according to any one of items 1 to 8. (Item 16) A cell comprising the nucleic acid construct of item 9. (Item 17) A cell comprising the nucleic acid construct according to any one of items 10 and 12 to 13. (Item 18) A cell comprising the nucleic acid construct according to any one of items 11 to 13. (Item 19) A cell comprising the nucleic acid construct of item 14. (Item 20) A cell comprising at least one nucleic acid construct selected from the nucleic acid constructs according to any one of items 1 to 14. (Item 21) 21. The cell according to Item 20, comprising at least two nucleic acid constructs selected from the nucleic acid constructs according to any one of Items 1 to 14. (Item 22) 21. The cell according to Item 20, comprising at least three nucleic acid constructs selected from the nucleic acid constructs according to any one of Items 1 to 14. (Item 23) 23. The cell of any of items 15 to 22, further comprising a nucleic acid construct comprising a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operably linked to a constitutive promoter. (Item 24) 23. The cell according to any one of items 15 to 22, further comprising a nucleic acid construct comprising a nucleic acid sequence encoding a marker protein. (Item 25) 25. The cell of item 24, wherein the nucleic acid sequences encoding the marker proteins are flanked by recombinase recognition sequences (RRS) that are oriented in the same direction relative to each other. (Item 26) 23. The cell according to any one of items 15 to 22, wherein the expression of the nucleic acid construct is stable. (Item 27) 23. The cell according to any one of items 15 to 22, wherein the expression of the nucleic acid construct is transient. (Item 28) 28. The cell according to any one of items 15 to 27, wherein the cell comprises at least two nucleic acid constructs, and the expression of the at least two nucleic acid constructs is stable expression. (Item 29) 28. The cell according to any one of items 15 to 27, wherein the cell comprises at least two nucleic acid constructs, and the expression of the at least two nucleic acid constructs is transient expression. (Item 30) 28. The cell according to any of items 15 to 27, wherein the cell comprises at least two nucleic acid constructs and the expression of at least one nucleic acid construct is stable expression. (Item 31) 15. A stable cell comprising stable expression of at least one nucleic acid construct selected from the nucleic acid constructs according to any one of items 1 to 14. (Item 32) 15. A cell comprising transient expression of at least one nucleic acid construct selected from the nucleic acid constructs according to any one of items 1 to 14. (Item 33) A nucleic acid construct comprising a nucleic acid sequence encoding a Cap protein and a recombinase recognition sequence (RRS) 3' of said nucleic acid sequence encoding said Cap protein. (Item 34) The nucleic acid sequence encoding the Cap protein is operably linked to a constitutive promoter. 34. The nucleic acid construct according to Item 33, (Item 35) 34. The nucleic acid construct of item 33, wherein the nucleic acid sequence encoding a Cap protein is operably linked to a regulatable promoter. (Item 36) 36. The nucleic acid construct of item 35, wherein the regulatable promoter is in an inducible promoter. (Item 37) 37. The nucleic acid construct according to any one of items 33 to 36, wherein the RRS is a flippase-responsive RRS. (Item 38) 38. The nucleic acid construct according to any one of items 33 to 37, further comprising a nucleic acid encoding a recombinase protein operably linked to an inducible promoter. (Item 39) A cell comprising the nucleic acid construct according to any one of items 33 to 38. (Item 40) 40. The cell of item 39, further comprising a nucleic acid construct comprising a nucleic acid encoding a recombinase protein operably linked to an inducible promoter. (Item 41) a first nucleic acid construct comprising, in a 5' to 3' direction, a promoter, a termination nucleic acid sequence flanked by a first pair of recombinase recognition sequences (RRS), and a nucleic acid sequence encoding a Rep protein, wherein the promoter is operably linked to the nucleic acid encoding the Rep protein; and a second nucleic acid construct comprising, in a 5' to 3' direction, a promoter, a termination nucleic acid sequence flanked by a second pair of recombinase recognition sequences (RRS), and a nucleic acid sequence encoding one or more of E2A, E4, and VA RNA, wherein the promoter is operably linked to the nucleic acid encoding one or more of E2A, E4, and VA RNA. A nucleic acid construct comprising: (Item 42) 42. The nucleic acid construct of claim 41, further comprising a nucleic acid encoding one or more selectable markers flanked by a third pair of recombinase recognition sequences (RRS), wherein the pairs of RRS are in the same orientation relative to each other, and wherein the nucleic acid encoding the one or more selectable markers is operably linked to one or more promoters of claim 41. (Item 43) 42. The nucleic acid construct of item 41, wherein the first pair of RRSs and the second pair of RRSs are in the same orientation relative to each other. (Item 44) 42. The nucleic acid construct of claim 41, wherein the first pair of RRSs and the second pair of RRSs are in opposite orientation relative to each other. (Item 45) 44. The nucleic acid construct of any of items 41 to 43, wherein the first pair of RRSs, the second pair of RRSs, and the third pair of RRSs are each responsive to a different tyrosine recombinase or serine integrase enzyme. (Item 46) 44. The nucleic acid construct of any of items 41 to 43, wherein the first pair of RRSs and the second pair of RRSs are responsive to the same tyrosine recombinase or serine integrase enzyme. (Item 47) The first pair of RRSs or the second pair of RRSs, or both, are Cre-responsive RRSs. 46. ​​The nucleic acid construct according to any one of items 41 to 45, which is an RS. (Item 48) 44. The nucleic acid construct according to any one of items 41 to 43, wherein the third pair of RRSs is flipase-responsive RRSs. (Item 49) A cell comprising the nucleic acid construct of item 41. (Item 50) 42. A cell comprising the nucleic acid construct of item 41 and a nucleic acid encoding a Cre recombinase protein operably linked to an inducible promoter. (Item 51) A method for producing viral particles, comprising: providing any cell line according to any one of Items 15 to 30, 39, 49 or 50, any stable cell line according to Item 31, or any transient cell line according to Item 32 in a viral expression system; culturing said cells for a time and under conditions sufficient to express said at least one nucleic acid under the control of a regulatable promoter; culturing the cells under conditions in which viral particles are produced; and Optionally, the method further comprises isolating said viral particles. (Item 52) A method for producing viral particles, comprising: a. providing the cell line according to item 15; b. culturing the cells for a time and under conditions sufficient to express at least the nucleic acid sequence encoding an E4 protein, the nucleic acid sequence encoding an E2A protein, or the nucleic acid sequence encoding a VA protein for the first time in a viral vector production protocol; c. culturing the cells for a time and under conditions sufficient to express the nucleic acid sequence encoding a Rep protein second in the viral vector production protocol; d. culturing the cells under conditions such that viral particles are produced; and e. optionally isolating said virus particles. (Item 53) 53. The method according to item 52, wherein the culturing in step (b) is culturing with an inducer of the first regulatable promoter. (Item 54) 53. The method of item 52, wherein the culturing in step (c) is culturing with an inducer of the second regulatable promoter. (Item 55) A method for producing viral particles, comprising: a. providing a cell line according to item 17 or 18; b. culturing the cells for a time and under conditions sufficient to express at least the nucleic acid sequence encoding the E4 protein, the nucleic acid sequence encoding the E2A protein, or the nucleic acid sequence encoding the VA protein for the first time in a viral vector production protocol; c. culturing the cells for a time and under conditions sufficient to express the nucleic acid sequence encoding a toxic protein or a Rep protein second in the viral vector production protocol; d. culturing the cells under conditions such that viral particles are produced; and e. optionally isolating said virus particles. (Item 56) Item 55. The culturing in step (b) is culturing with an inducer of the regulatable promoter operably linked to at least E4, E2A, or VA protein. The method described below. (Item 57) 56. The method of item 55, wherein the culturing in step (c) is culturing with the ZF-TA. (Item 58) 58. The method of claim 57, wherein expression of the zinc finger transcriptional activator (ZF-TF) is induced by expression of E4 or E2. (Item 59) A method for producing viral particles, comprising: a. providing the cell line according to item 19; b. culturing the cells for a time and under conditions sufficient to express at least the nucleic acid sequence encoding the E4 protein, the nucleic acid sequence encoding the E2A protein, or the nucleic acid sequence encoding the VA protein for the first time in a viral vector production protocol; c. culturing the cells for a time and under conditions sufficient to express the nucleic acid sequence encoding a toxic protein or a Rep protein second in the viral vector production protocol; d. culturing the cells under conditions such that viral particles are produced; and e. optionally isolating said virus particles. (Item 60) 60. The method of claim 59, wherein the culturing in step (b) is culturing with an inducer of the regulatable promoter operably linked to at least an E4, E2A, or VA protein. (Item 61) 60. The method of item 59, wherein the culturing in step (c) is culturing with the ZF-TA. (Item 62) 62. The method of claim 61, wherein expression of the zinc finger transcriptional activator (ZA-TF) is induced by expression of E4 or E2. (Item 63) A method for producing viral particles, comprising: a. providing the cell line according to item 39; b. culturing the cells for a time and under conditions sufficient to cause the nucleic acid sequence encoding the Cap protein to be highly expressed for at least the first 24 hours of the viral vector production protocol and moderately expressed for the remaining 48 hours of the viral vector production protocol; c. culturing the cells for a time and under conditions sufficient to produce viral particles; and d. optionally isolating said virus particles. (Item 64) Item 64. The method of item 63, wherein the culturing in step (b) is culturing with an inducer of the regulatable promoter operably linked to the Cap protein. (Item 65) A method for producing viral particles, comprising: a. providing the cell line according to item 49; b. culturing the cells for a time and under conditions sufficient to express at least the nucleic acid sequence encoding the E4 protein, the nucleic acid sequence encoding the E2A protein, or the nucleic acid sequence encoding the VA RNA for the first time in a viral vector production protocol; c. culturing the cells for a time and under conditions sufficient to express the nucleic acid sequence encoding a toxic protein or a Rep protein second in the viral vector production protocol; d. culturing the cells under conditions such that viral particles are produced; and e. optionally isolating said virus particles. (Item 66) Item 66. The method according to Item 65, wherein the culturing in step (b) is culturing with a recombinase specific to the first pair of recombinase recognition sequences (RRS). (Item 67) Item 66. The method according to Item 65, wherein the culturing in step (c) is culturing with a recombinase specific to the second pair of recombinase recognition sequences (RRS). (Item 68) 2. The method of claim 1, wherein the transcriptional activator is a zinc finger transcriptional activator (ZF-TA). [Brief explanation of the drawings]

[0127] [Figure 1]Figure 1A shows a schematic diagram of hypoxia-induced gene expression. The transcription factor HIF1A (HIF1α) is degraded under normal oxygen conditions but is stabilized under hypoxic conditions. It dimerizes with HIF1B (HIF1β) to form HIF1, which then translocates to the nucleus. In the nucleus, the HIF1 complex can bind to hypoxia-responsive elements (HSEs) and initiate the expression of genes of interest. Figure 1B shows a schematic diagram of the structural organization of HIF1α and HIF1β. Both HIF1α and HIF1β possess bHLH domains for DNA binding. HIF1β possesses a central Per-ARNT-Sim (PAS) domain for heterodimerization, and the C-terminal domain (TAD N / TAD C) of HIF1α recruits transcriptional coregulatory proteins. Upon dimerization, HIF1α and HIF1β translocate to the nucleus and bind to hypoxia-responsive elements, thereby turning on the expression of hypoxia-regulated genes.

[0128] [Figure 2] Figure 2 shows a schematic diagram of the promoters RTV-015 and Synp-HYP-001. The RTV-015 promoter contains five HRE1s and one synthetic minimal promoter MP1. These elements are separated by spacers (not shown). Synp-HYP-001 contains four HRE2s and one CMV minimal promoter. The HRE2 elements are not spaced apart, but there is a spacer between the last HRE2 element and the CMV minimal promoter (not shown).

[0129] [Figure 3] Figure 3 shows the time course of luciferase expression from the RTV-015, SYNP-HYP-001, and CMV-IE constructs in transiently transduced HEK293-F cells under hypoxia. Cells were placed in hypoxia at time 0 and then luciferase activity was monitored. Luciferase expression from the CMV minimal promoter used as a control remains unchanged, while the remaining constructs show increasing luciferase activity over time.

[0130] [Figure 4]Figure 4 shows measurements of luciferase expression from the RTV-015 and CMV-IE constructs in transiently transduced HEK293-T cells under normoxic conditions and after 24 hours in hypoxia. Luciferase expression from the CMV-IE promoter is the same under normoxic and hypoxic conditions. The RTV-015 construct shows little luciferase activity under normoxic conditions but is induced after 24 hours in hypoxia.

[0131] [Figure 5] Figure 5 shows measurements of luciferase expression from RTV-015 and CMV-IE constructs in transiently transduced CHO_GS suspension cell lines under normoxic conditions and after 24 hours in hypoxic conditions. Luciferase expression from CMV-IE is similar under normoxic and hypoxic conditions. Similar to the results shown in Figure 4, RTV-015 showed little luciferase activity under normoxic conditions but was induced after 24 hours in hypoxic conditions.

[0132] [Figure 6] FIG. 6 is a diagram of the mechanism of action of forskolin and other adenylyl cyclase activators.

[0133] [Figure 7] Figure 7 shows the activity of the promoters after transient transfection into the suspension cell line HEK293-F. Cells were induced with 20 μM forskolin (at time 0), and luciferase expression was measured at 0, 3, 5, and 24 hours. All constructs showed increased activity (to varying degrees), whereas CMV-IE activity remained constant.

[0134] [Figure 8]Figures 8A-8C show bright-field micrographs of C2C12 cells at passage 11. Figure 8A shows cells before transfection (day 2). Figure 8B shows C2C12 cells 24 hours after transfection (day 3). Figure 8C shows differentiated C2C12 cells after 5.5 days in differentiation medium (day 7.5). Scale bars are 50 μm.

[0135] [Figure 9] Figure 9 shows exemplary data demonstrating the difference in E1A gene expression between Hek293 cells and Pro10. Results are the average of three experiments, and error bars represent standard deviation. Pro10 cells express E1A RNA at approximately half the level of parental Hek293 cells.

[0136] [Figure 10] FIG. 10 shows exemplary data showing viable cell densities at the time of transfection and harvest.

[0137] [Figure 11] FIG. 11 shows exemplary data showing viability at the time of transfection and harvest.

[0138] [Figure 12] FIG. 12 shows exemplary data showing E1A RNA levels at the time of harvest.

[0139] [Figure 13] FIG. 13 shows exemplary data showing vg / cell of rAAV produced from Pro10 at different concentrations of E1.

[0140] [Figure 14] FIG. 14 shows exemplary data showing viable cell density for each of the indicated conditions tested.

[0141] [Figure 15]Figure 15 shows exemplary data showing cell viability of cells for each of the indicated conditions tested. Mutant Rep does not significantly affect cell viability or proliferation during production.

[0142] [Figure 16] FIG. 16 shows exemplary data showing the final virus titers from virus production.

[0143] [Figure 17] Figure 17 shows exemplary data showing viral titers from wtAAV and rAAV production, with wtAAV producing up to 2 logs more vg / ml than rAAV.

[0144] [Figure 18] FIG. 18 shows exemplary data showing the levels of E2A gene expression during wt and rAAV production.

[0145] [Figure 19] FIG. 19 shows exemplary data showing the levels of E4 gene expression during wt and rAAV production.

[0146] [Figure 20] FIG. 20 shows exemplary data showing the levels of Rep78, 52 and Cap2 expression during wtAAV production.

[0147] [Figure 21] FIG. 21 shows exemplary data showing the levels of Rep78, 52 and Cap2 expression during rAAV production.

[0148] [Figure 22] FIG. 22 shows an exemplary schematic illustrating the mechanism of action of leaky scanning.

[0149] [Figure 23]Figure 23 shows exemplary data showing a comparison of vg / ml for wt vs. mut-Rep. Removal of nine potential ATGs from Rep78 that could be used as translation start sites did not affect the ability to generate rAAV.

[0150] [Figure 24] Figure 24 shows exemplary data showing Western blots of Rep78 and Rep52 protein expression from rAAV production runs using various start codons. Percentages are published translation initiation rates relative to ATG.

[0151] [Figure 25] Figure 25 shows exemplary data showing the vg / ml of rAAV produced using alternative start codons to control the Rep78 / 52 ratio. Only the ACG mutation results in a significant improvement in viral titer.

[0152] [Figure 26] FIG. 26 shows exemplary data demonstrating adenoviral helper gene-mediated induction of Cap2 gene expression.

[0153] [Figure 27] Figure 27 shows exemplary data showing virus titers from C7 and C8 cells induced with adenoviral helper functions + E1. The control is a standard triple transfection of the non-inducible cassette. P = passage number.

[0154] [Figure 28] FIG. 28 shows exemplary data demonstrating the effect of adenoviral helper function on the forskolin promoter controlling Cap2 expression in stable cell lines.

[0155] [Figure 29] FIG. 29 shows exemplary data showing the effect of forskolin on new promoter designs.

[0156] [Figure 30] FIG. 30 presents exemplary data showing the effect of adenovirus helper function on the activity of FORN-pJB42.

[0157] [Figure 31] FIG. 31 shows exemplary data showing the construction of Rep LoxP constructs.

[0158] [Figure 32] Figure 32 shows exemplary data illustrating the diagram of Rep constructs. Effect of Cre and / or NHK477 treatment on induction of Rep expression. For both promoters, there is no expression of any Rep protein in untreated samples.

[0159] [Figure 33] FIG. 33 shows exemplary data demonstrating AAV production using cre recombinase control of Rep expression.

[0160] [Figure 34] Figure 34 shows exemplary data illustrating the expected outcome and results of the experiment. Mean of n=3

[0161] [Figure 35] Figure 35 shows exemplary data illustrating the concept of cascade gene expression for rAAV production in Pro10 cells.

[0162] [Figure 36] FIG. 36 shows exemplary data illustrating exemplary ZF-TF designs.

[0163] [Figure 37] FIG. 37 shows exemplary data showing a comparison of standard Rep2-Cap8 transfection versus the novel plasmid construct. DETAILED DESCRIPTION OF THE INVENTION

[0164] Detailed Description of the Invention In general, the invention described herein provides stable cell lines for recombinant viral vector production that have expression of at least one toxic protein under the control of at least one regulatable promoter, e.g., an inducible promoter, a promoter linked to another sequence that provides regulatory control, such as a zinc finger, and a method for producing recombinant viral vectors using the same. The described stable cell lines provide temporal and / or spatial control of at least one (e.g., at least one, at least two, or at least three) toxic protein during viral vector production. For example, toxic proteins expressed from viral genes such as replication (rep), capsid (cap), helper gene product, polymerase (pol), reverse polymerase, or envelope (env) are harmful to cells when expressed. However, these viral genes are essential for recombinant viral vector production. Current methods for mitigating the adverse effects of toxic protein expression include using cells that transiently express the toxic protein during production, but these methods can adversely affect production yields. Our stable cells described herein provide stable cell lines that allow expression of toxic proteins primarily at the time they are needed, thus limiting the adverse effects of their expression. Our methods described herein utilizing these stable cell lines result in higher yields of recombinant viral vector production compared to current methods.

[0165] definition For convenience, the meanings of some terms and phrases used in the specification, examples, and appended claims are provided below. Unless otherwise indicated or understood from context, the following terms and phrases have the meanings provided below. While the definitions are provided to aid in the description of particular embodiments, they are not intended to limit the claimed technology, as the scope of the technology is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which this technology belongs. If there is an apparent discrepancy between the usage of a term in the art and the definition of a term provided herein, the definition provided herein shall prevail.

[0166] Definitions of common terms in immunology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 19th Edition, published by Merck Sharp & Dohme Corp., 2011 (ISBN 978-0-911910-19-3); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway’s Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), Taylor & Francis Limited, 2014 (ISBN 0815345305, 9780815345305); Lewin’s Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, A.D.A. M. Kruisbeek, David H. Margulies, Ethan M. Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the entire contents of which are all incorporated herein by reference.

[0167] As used herein, the terms "nucleotide sequence," "nucleic acid sequence," "RNA sequence," and "DNA sequence" are used interchangeably herein and refer to the sequence of a nucleic acid, e.g., a circular nucleic acid, that is introduced into a target cell and encodes a gene product or polypeptide. The nucleic acid sequence may include at least a sequence that encodes a toxic polypeptide (i.e., a protein). A heterologous nucleic acid sequence refers to a nucleic acid sequence that is not "naturally occurring," i.e., a sequence that is not normally expressed in a cell.

[0168] As used herein, the term "promoter" generally refers to a region of DNA located upstream of the nucleic acid sequence to be transcribed, which is required for transcription to occur. Promoters allow for the appropriate activation or repression of the transcription of the sequence under their control. Promoters typically contain specific sequences, such as enhancer sequences, that are recognized and bound by transcription factors. Transcription factors bind to the promoter DNA sequence, resulting in the recruitment of RNA polymerase, an enzyme that synthesizes RNA from the coding region of the gene. Numerous promoters are known in the art.

[0169] Regulatable promoters include both inducible and repressible promoters. As used herein, an "inducible promoter" refers to a promoter that initiates or enhances transcriptional activity when in the presence of, affected by, or contact with an inducer or inducing agent, or when appropriate inducing conditions (e.g., hypoxia) are applied. As defined herein, an "inducer" or "inducing agent" can be endogenous or, typically, an exogenous compound or protein that is administered to be active in inducing transcriptional activity from an inducible promoter. The term "inducer" as used herein can also refer to the application of appropriate conditions (e.g., hypoxia) to induce transcriptional activity from an inducible promoter. In some embodiments, the inducer or inducing agent, i.e., a chemical, compound, protein, or appropriate condition, can itself be the result of transcription or expression of a nucleic acid sequence (i.e., an inducer can be an inducer protein expressed by another component or module) and can itself be under the control of, for example, an inducible or repressible promoter. In some embodiments, an inducible promoter is induced in the absence of a specific agent (e.g., a repressor, etc.). Examples of inducible promoters include, but are not limited to, forskolin-inducible, hypoxia-inducible, temperature-inducible, tetracycline-inducible (Tet-ON), pH-inducible, osmolarity-inducible, metallothionine-inducible, hormone (e.g., ecdysone-) inducible, carbon source-inducible, alcohol (e.g., ethanol)-inducible, amino acid-inducible, mifepristone (RU-486)-inducible, cumate-inducible, 4-hydroxytamoxifen (OHT)-inducible, gas-inducible, riboswitch-, ribozyme- and aptazyme-inducible, rapamycin-inducible, chemical-induced proximity-inducible, Rheoswitch® promoter, CRISPR-inducible and inducible promoters derived from mammalian viruses (e.g., adenovirus late promoter; and mouse mammary tumor virus long terminal repeat (MMTV-LTR)), as well as other steroid-responsive promoters, rapamycin-responsive promoters, and the like.

[0170] An inducible promoter can be said to drive expression of the nucleic acid sequence it regulates, for example, a heterologous gene encoding a toxic protein. The phrases "operably linked," "operatively linked," and "controlled" indicate that the promoter is in the correct functional location and / or orientation with respect to the nucleic acid sequence it regulates so as to control transcription initiation and / or expression of that sequence.

[0171] As used herein, a "repressible promoter" refers to a promoter that is characterized by silencing or preventing transcriptional activity in the presence of a repressor or inhibitor, such that its activity is downregulated when affected by or contacted with a repressor or inhibitor. A "repressor" or "repressor," as defined herein, can be an endogenous or, typically, exogenous compound or protein that is administered to be active in silencing transcriptional activity from a repressible promoter. In some embodiments, the repressor or repressor, i.e., a chemical, compound, or protein, can itself be the result of transcription or expression of a nucleic acid sequence (i.e., a suppressor can be a suppressor protein expressed by another component or module) and can itself be under the control of, for example, an inducible or repressible promoter. In some embodiments, a repressible promoter is repressed in the absence of a particular agent (e.g., an inducer). Examples of repressible promoters include, but are not limited to, tetracycline-off (Tet-OFF), glucose, copper ion, L-methionine, hypophosphate, ADH1, Gal80, and MET25.

[0172] In some embodiments, a promoter can be both repressible and inducible, for example, by using different repressors or inducers (e.g., agonists and antagonists of related transcriptional regulators or transcriptional pathways) or by various conditions that repress or induce expression. Thus, for example, a promoter can be induced when an inducer is administered and repressed when a repressor is administered.

[0173] As used herein, "introducing" refers broadly to placing a synthetic nucleic acid, expression vector, or plasmid into a viral expression system (e.g., a cell or viral vector) such that it is present in the cell or viral vector expression system. Less broadly, introduction refers to any suitable means of placing a synthetic nucleic acid, expression vector, or plasmid into a viral expression system described herein. Introduction can be performed by any means that properly transports the synthetic nucleic acid, expression vector, or plasmid into the cell or viral expression system, such that it is produced by the host cell machinery. Such introduction can include, for example, transformation, transfection, electroporation, or lipofection.

[0174] The term "vector" as used herein refers to a nucleic acid construct designed for delivery into a host cell or transfer between different host cells. As used herein, a vector can be viral or non-viral. The term "vector" encompasses any genetic element that can replicate and transfer genetic sequences into cells when associated with appropriate control elements. Vectors can include, but are not limited to, cloning vectors, expression vectors, plasmids, phages, transposons, cosmids, artificial chromosomes, viruses, virions, etc.

[0175] As used herein, "expression vector" refers to a nucleic acid containing an open reading frame (ORF) and all of the nucleic acid components necessary to enable mRNA expression of the ORF when introduced into a cell. The "expression vector" of the present invention also contains elements necessary for the replication and propagation of the vector in a host cell. In particular, as used herein, "expression vector" refers to a vector that directs the expression of a heterologous nucleic acid described herein. The expressed sequence is often, but not necessarily, heterologous to the cell. An expression vector may contain additional elements; for example, an expression vector may have two replication systems, thus allowing it to be maintained in two organisms, for example, in human cells for expression and in prokaryotic hosts for cloning and amplification. The term "expression" refers to the cellular processes involved in the production of RNA and protein, and, if applicable, protein secretion, including, but not limited to, transcription, transcript processing, translation, and protein folding, modification, and processing, where applicable.

[0176] As used herein, the term "viral vector" refers to a nucleic acid vector construct that contains at least one element of viral origin and has the ability to be packaged into a viral vector particle. The viral vector can contain a nucleic acid encoding a polypeptide described herein in place of a non-essential viral gene. The vector and / or particle can be used to transfer the synthetic nucleic acid described herein into cells either in vitro or in vivo. Many forms of viral vectors are known in the art.

[0177] As used herein, the term "cap protein" refers to a capsid protein, suitably an AAV capsid protein, e.g., one or more VP capsid proteins of AAV. For example, an AAV viral particle typically contains capsid proteins VP1, VP2, and VP3. Capsid proteins can be naturally occurring or modified, as is well known in the art.

[0178] As used herein, the term "adeno-associated virus" (AAV) refers to an AAV Examples of AAV include, but are not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, caprine AAV, shrimp AAV, and any other AAV now known or later discovered. See, e.g., FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). Several relatively new AAV serotypes and clades have been identified (see, e.g., Gao et al., J. Virol. 78:6381 (2004); Morris et al., Virol. 33:375 (2004); and Table 1). A "rAAV vector genome" or "rAAV genome" is an AAV genome (i.e., vDNA) containing one or more heterologous nucleic acid sequences. rAAV vectors generally require only the 145-base ITRs in cis to generate virus. All other viral sequences are not essential and may be supplied in trans (Muzyczka, Curr. Topics Microbiol. Immunol. 158:97 (1992)). Typically, rAAV vector genomes retain only one or more ITR sequences to maximize the size of the transgene that can be efficiently packaged by the vector. Structural and nonstructural protein coding sequences may be provided in trans (e.g., from a vector such as a plasmid or by stably integrating sequences into packaging cells). In embodiments of the invention, the rAAV vector genome comprises at least one ITR sequence (e.g., an AAV ITR sequence), and optionally two ITRs (e.g., two AAV ITRs), typically at the 5' and 3' ends of the vector genome, adjacent to, but not necessarily adjacent to, the heterologous nucleic acid. The ITRs may be the same as or different from one another. [Table 1-1] Table 1-2 Table 1-3

[0179] The genome sequences of various serotypes of AAV, as well as the sequences of native ITR, Rep protein and capsid subunits are known in the art.Such sequences can be found in literature or public databases such as GenBank.For example, GenBank accession numbers NC_002077, NC_001401, NC_001729, NC_001863, NC_001829, NC_001862, NC_000883, NC_001701 ... See 001510, NC_006152, NC_006261, AF063497, U89790, AF043303, AF028705, AF028704, J02275, J01901, J02275, X01457, AF288061, AH009962, AY028226, AY028223, AY631966, AX753250, EU285562, NC_001358, NC_001540, AF513851, AF513852 and AY530579, the disclosures of which are incorporated by reference herein for their teaching of AAV nucleic acid and amino acid sequences.For example, Bantel-Schaal et al.,J Virol.73:939(1999);Chiorini et al.,J Virol.71:6823(1997);Chiorini et al.,J.Virol.73:1309(1999);Gao et al.,Proc.Nat.Acad.Sci.USA 99:11854(2002);Moris et al.,Virology,33:375(2004);Mori et al.,Virology,330:375(2004);Muramatsu et al.,Virology,221:208(1996);Ruffing et al. al.,J.Gen.Virol.75:3385(1994);Rutledge et al.,J Virol.72:309(1998);Schmidt et al. See also, Shade et al., Virol. 82:8911 (2008); Shade et al., J. Virol. 58:921 (1986); Srivastava et al., J. Virol. 45:555 (1983); Xiao et al., J. Virol. 73:3994 (1999); International Patent Publications WO 00 / 28061, WO 99 / 61601, WO 98 / 11244; and U.S. Patent No. 6,156,303, the disclosures of which are incorporated herein by reference for their teaching of AAV nucleic acid and amino acid sequences. See also Table 1. An early description of AAV1, AAV2, and AAV3 ITR sequences is provided by Xiao, X., (1996), "Characterization of Adeno-associated virus (AAV) DNA replication and integration," Ph.D. Dissertation, University of Pittsburgh, Pittsburgh, PA, which is incorporated herein by reference in its entirety.

[0180] As used herein, the term "expression" refers to the cellular processes involved in the production of RNA and proteins, including, but not limited to, transcription, transcript processing, translation and protein folding, post-translational modifications and other types of processing, where applicable.

[0181] The term "gene" refers to a nucleic acid sequence (DNA) that is transcribed into RNA in vitro or in vivo when operably linked to appropriate regulatory sequences. A gene may or may not include regions preceding and following the coding region, such as 5' untranslated (5'UTR) or "leader" sequences and 3'UTR or "trailer" sequences, as well as intervening sequences (introns) between individual coding segments (exons).

[0182] As used herein, the term "polypeptide" encompasses both peptides and proteins, unless otherwise indicated. A "polypeptide" or "protein" is a sequence of nucleotide bases, which may be RNA, DNA, or a DNA-RNA hybrid sequence (containing both naturally occurring and non-naturally occurring nucleotides), and which may be either a single-stranded or double-stranded DNA sequence.

[0183] As used herein, the term "cell culture" refers to a proliferative mass of cells that may be in either an undifferentiated or differentiated state.

[0184] A "viral vector expression system" is a system of one or more polynucleotides sufficient to support the production of a viral vector when introduced into a suitable host cell. A viral vector expression system typically includes polynucleotides encoding appropriate viral proteins, such as envelope and polymerase genes, for producing, for example, a lentivirus or adenovirus.

[0185] An "AAV expression system" is a system of one or more polynucleotides sufficient to support the production of recombinant AAV (rAAV) when introduced into a suitable host cell. AAV expression systems typically include polynucleotides encoding AAV rep and cap, helper genes, and the rAAV genome.

[0186] The AAV genome has palindromic sequences at both its 5' and 3' ends. The palindromic nature of the sequence results in the formation of a hairpin structure stabilized by the formation of hydrogen bonds between complementary base pairs. This hairpin structure is thought to take a "Y" or "T" shape. See, e.g., FIELDS et al., VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).

[0187] The term "terminal repeat" or "TR" includes any viral or synthetic terminal repeat sequence that forms a hairpin structure and functions as an inverted terminal repeat (i.e., mediates a desired function, such as replication, viral packaging, integration, and / or proviral rescue). The ITR can be an AAV or non-AAV ITR. For example, non-AAV ITR sequences, such as those of other parvoviruses (e.g., canine parvovirus, bovine parvovirus, mouse parvovirus, porcine parvovirus, human parvovirus B-19), or the SV40 hairpin that serves as the SV40 origin of replication, can be used as an ITR, which can be further modified by truncation, substitution, deletion, insertion, and / or addition. Furthermore, the ITR can be partially or completely synthetic, such as the "double D sequence" described in U.S. Patent No. 5,478,745 to Samulski et al.

[0188] "AAV inverted terminal repeats" or "AAV ITRs" can be derived from any AAV, including, but not limited to, serotypes 1, 2, 3a, 3b, 4, 5, 6, 7, 8, 9, 10, 11, or 13, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, caprine AAV, shrimp AAV, or any other AAV now known or later discovered (see, e.g., Table 1). AAV ITRs need not have native terminal repeat sequences (e.g., native AAV ITR sequences can be altered by insertions, deletions, truncations, and / or missense mutations), so long as the terminal repeats mediate the desired function, such as replication, viral packaging, integration, and / or proviral rescue.

[0189] As used herein, "a," "an," or "the" can be singular or plural, depending on the context of such use. For example, "a cell" can mean a single cell or multiple cells.

[0190] Also, as used herein, "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative ("or").

[0191] Additionally, the term "about" as used herein when referring to a measurable value, such as an amount, dose, time, temperature, etc., of a composition of the present invention is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, ±0.5%, or even ±0.1% of the specified amount.

[0192] As used herein, the terms "comprising" or "comprises" are used in reference to compositions, methods, and their respective component(s) that are essential to the method or composition, but are open to the inclusion of unspecified elements, whether essential or not.

[0193] As used herein, the term "consisting essentially of" refers to elements required for a given embodiment. The term allows for the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment. The term "consisting of" refers to compositions, methods, and their respective components described herein, excluding any element not recited in that description of the embodiment. nucleic acid construct

[0194] One aspect provided herein is a nucleic acid construct comprising at least one nucleic acid sequence encoding at least one helper protein, each nucleic acid construct operably linked to a regulatable promoter. For example, exemplary helper genes for AAV viral particles include, but are not limited to, E1, E2A, E4, and VA. Additional helper genes may include one or more of the following known elements in the Pro10 cell line: Helper genes used in the production of other viral particles, such as lentiviral or adenoviral particles, can also be used in the nucleic acid constructs described herein. In one embodiment, the nucleic acid construct encoding at least one helper protein comprises a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operably linked to a constitutive promoter. In one embodiment, the nucleic acid construct encoding at least one helper protein further comprises a nucleic acid sequence encoding a marker protein. In one embodiment, the nucleic acid construct encoding at least one helper protein comprises a nucleic acid sequence encoding a tetracycline-responsive transactivator protein and a nucleic acid sequence encoding a marker protein, both operably linked to constitutive promoters.

[0195] In one embodiment, the regulatable promoter is a repressible promoter, such as a tetracycline-repressible promoter. In one embodiment, the repressible promoter is repressed by a tetracycline-responsive transactivator, and the repression is reversed by contact with tetracycline or doxycycline.

[0196] In one embodiment, expression of at least one helper gene is responsive to an inducer of a regulatable promoter. In one embodiment, expression of at least one helper gene is responsive to an inducer of a repressible promoter. In one embodiment, expression of at least one helper gene is responsive to tetracycline or doxycycline.

[0197] Another aspect provided herein is a nucleic acid construct encoding a tetracycline-responsive transactivator protein operably linked to a constitutive promoter.

[0198] Another aspect provided herein is a nucleic acid sequence encoding a marker protein.

[0199] Another aspect provided herein is a nucleic acid construct comprising at least a nucleic acid sequence encoding a toxic protein, wherein the nucleic acid encoding the toxic protein is operably linked to a regulatable promoter. In one embodiment, the nucleic acid encoding the toxic protein further encodes a ribozyme enzyme, e.g., a small self-cleaving ribozyme enzyme, 3' to the nucleic acid encoding the toxic protein.

[0200] In one embodiment, the regulatable promoter is an inducible promoter or contains a binding site for a regulatable transcription activator. In one embodiment, the inducible promoter contains a TATA box sequence or a p5 duplication sequence, or both a TATA box sequence and a p5 duplication sequence. In one embodiment, the inducible promoter contains a TATA box sequence or a p5 duplication sequence, or both a TATA box sequence and a p5 duplication sequence, instead of a minimal promoter. In one embodiment, the regulatable promoter contains a binding site for a zinc finger transcription activator (ZF-TA).

[0201] Another embodiment provided herein is a nucleic acid construct comprising a nucleic acid sequence encoding at least one helper protein, wherein the at least one helper gene is operably linked to a first regulatable promoter, and a nucleic acid sequence encoding a toxic protein, wherein the nucleic acid encoding the toxic protein is under the control of a second regulatable promoter or transcriptional activator.

[0202] Another aspect provided herein is a nucleic acid construct comprising a nucleic acid sequence encoding a helper gene, such as a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA RNA, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a regulatable promoter. In certain embodiments, any helper protein for producing, for example, lentivirus particles or adenovirus particles can be used. For example, nucleic acids encoding Gag, Pol, etc.

[0203] Another embodiment provided herein is a nucleic acid construct encoding a Rep protein, wherein the nucleic acid encoding the Rep protein is under the control of a regulatable promoter or zinc finger transcriptional activator (ZF-TA).

[0204] Another aspect provided herein is a nucleic acid construct comprising: a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a first regulatable promoter; and a nucleic acid sequence encoding a Rep protein, wherein the nucleic acid encoding the Rep protein is under the control of a second regulatable promoter or transcriptional activator, wherein the first and second regulatable promoters are different types of regulatable promoters; for example, the first promoter can be a hypoxic promoter and the second promoter can be another type. In one embodiment, the regulatable promoter is an inducible promoter, or an inducible promoter comprising a TATA box sequence, a p5 replication sequence, or both a TATA box sequence and a p5 replication sequence. In one embodiment, the regulatable promoter is an inducible promoter lacking a minimal promoter but comprising a TATA box sequence and / or a p5 replication sequence.

[0205] Exemplary transcriptional activators include homeodomain transcriptional activators, zinc finger transcriptional activators, winged-helix (forkhead) transcriptional activators, leucine zipper transcriptional activators, and helix-loop-helix transcriptional activators. In one embodiment, the transcriptional activator is a zinc finger transcriptional activator (ZF-TA).

[0206] Another aspect provided herein is a nucleic acid construct comprising a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operably linked to an inducible promoter, where the inducible promoter is an E4-responsive promoter, or an E2-responsive promoter or other helper gene-responsive promoter. In various embodiments, this construct is used to induce expression of the zinc finger transcriptional activator (ZF-TA) of other nucleic acid constructs described herein.

[0207] Another aspect provided herein is a nucleic acid construct comprising a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operably linked to a constitutive promoter.

[0208] Another aspect provided herein is a nucleic acid construct comprising a toxic protein operably linked to a promoter containing a target site for binding of a zinc finger transcriptional activator (ZF-TA).

[0209] Another embodiment provided herein is a nucleic acid construct comprising a Rep protein operably linked to a promoter containing a target site for binding of a zinc finger transcriptional activator (ZF-TA).

[0210] In various embodiments, any nucleic acid construct described herein comprises at least one of the following: a nucleic acid sequence encoding at least one helper protein, wherein each nucleic acid construct is operably linked to a regulatable promoter; a nucleic acid sequence encoding a toxic protein is under the control of a second regulatable promoter or a zinc finger transcriptional activator; a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a regulatable promoter; or a nucleic acid encoding a Rep protein is under the control of a second regulatable promoter or a zinc finger transcriptional activator.

[0211] Another embodiment provided herein is a nucleic acid construct comprising: a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operably linked to a constitutive promoter; a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA, or any combination thereof, is operably linked to a regulatable promoter; and a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operably linked to an inducible promoter, wherein the inducible promoter is an E4-responsive promoter or an E2-responsive promoter; and a nucleic acid construct comprising a Rep protein operably linked to a promoter comprising a target site for binding of the zinc finger transcriptional activator (ZF-TA).

[0212] Another aspect provided herein is a nucleic acid construct comprising a nucleic acid sequence encoding a toxic protein and a recombinase recognition sequence (RRS) located 3' of the nucleic acid sequence encoding the toxic protein. By way of example only, the toxic protein or polypeptide, when expressed by a cell, results in reduced viability of the cell in which it is expressed, or reduced protein production or protein synthesis. Exemplary toxic proteins include, but are not limited to, proteins encoded by Cap, Rep, or helper genes. In one embodiment, the toxic protein is operably linked to a constitutive promoter. In another embodiment, the toxic protein is operably linked to a regulatable promoter, e.g., an inducible promoter. In one embodiment, the nucleic acid construct comprises a nucleic acid encoding a recombinase protein operably linked to an inducible promoter.

[0213] Another aspect provided herein is a nucleic acid construct comprising a nucleic acid sequence encoding a Cap protein and a recombinase recognition sequence (RRS) located 3' of the nucleic acid sequence encoding the Cap protein. In one embodiment, the Cap protein is operably linked to a constitutive promoter. In another embodiment, the Cap protein is operably linked to a regulatable promoter, e.g., an inducible promoter. In one embodiment, the nucleic acid construct comprises a nucleic acid encoding a recombinase protein operably linked to an inducible promoter.

[0214] In one embodiment, the RRS is a Flippase-responsive RRS.

[0215] Another aspect provided herein is a nucleic acid construct comprising a nucleic acid construct comprising a nucleic acid encoding a recombinase protein operably linked to an inducible promoter.

[0216] Another embodiment provided herein is a nucleic acid construct comprising: a first nucleic acid construct comprising, in a 5' to 3' direction, a promoter, a stop nucleic acid sequence flanked by a first pair of recombinase recognition sequences (RRS), and a nucleic acid sequence encoding a Rep protein, wherein the promoter is operably linked to the nucleic acid encoding the Rep protein; and a second nucleic acid construct comprising, in a 5' to 3' direction, a promoter, a stop nucleic acid sequence flanked by a second pair of recombinase recognition sequences (RRS), and a nucleic acid sequence encoding one or more of E2A, E4, and VA RNA, wherein the promoter is operably linked to the nucleic acid encoding one or more of E2A, E4, and VA RNA.

[0217] In one embodiment, the RRS adjacent to the nucleic acid encoding Rep and the RRS adjacent to the helper gene (e.g., E2A, E4, or VA) are the same and are controlled by the same inducer. In one embodiment, the RRS adjacent to the nucleic acid encoding Rep and the RRS adjacent to the helper gene (e.g., E2A, E4, or VA) are different. The different adjacent RRSs allow for temporal control of the Rep protein and the helper gene.

[0218] In one embodiment, the construct further comprises a nucleic acid encoding one or more selectable markers flanked by a third pair of recombinase recognition sequences (RRS), wherein the pairs of RRSs are in the same orientation relative to each other, and wherein the nucleic acid encoding the one or more selectable markers is operably linked to one or more promoters from another construct provided herein.

[0219] If a nucleic acid sequence (e.g., a target gene) is flanked by a pair of recombinase recognition sequences (RRSs) in the same orientation, the nucleic acid sequence can be excised upon recognition of the RRSs by the appropriate recombinase. Alternatively, if a nucleic acid sequence is flanked by a pair of recombinase recognition sequences (RRSs) in opposite orientations, the nucleic acid sequence can be inverted upon recognition of the RRSs by the appropriate recombinase. In some embodiments, the inversion and / or excision reaction positions the nucleic acid sequence (e.g., a target gene) in a new location and / or orientation relative to elements outside the RRS sites, operably linking the nucleic acid to a promoter, thereby driving expression of the gene encoded by the nucleic acid sequence.

[0220] Depending on the location of the recombinase recognition sequence, the recombinase-mediated excision reaction can result in either activation or inhibition of gene expression. For example, to activate gene expression, a transcription termination sequence flanked by recombination sites can be placed upstream of a target gene of interest. In the presence of a recombinase, the transcription termination sequence is removed or excised, thus allowing gene expression to occur. In contrast, to inhibit gene expression, recombination sites can be engineered adjacent to the gene of interest. In such embodiments, the gene is expressed without the recombinase. Upon induction of the recombinase, the gene is excised, thus completely and irreversibly inhibiting gene expression. The determinants governing the on / off state of the gene reside in the presence of the recombinase and the location of the RRS. Recombinase expression can be regulated by a signal-inducible promoter, thus restricting recombinase expression to a specific subset of cells receiving that particular signal. For example, by controlling Cre recombinase expression using a neuron-specific promoter, a gene can be turned on or off only in neurons, while leaving the same gene unperturbed in other tissues. These enzymes have been engineered to be highly active in a wide range of organisms, including bacteria, mammals, insects, plants and fish.

[0221] In one embodiment, the first pair of RRSs, the second pair of RRSs, and the third pair of RRSs are each responsive to different tyrosine recombinase or serine integrase enzymes. In one embodiment, the first pair of RRSs and the second pair of RRSs are responsive to the same tyrosine recombinase or serine integrase enzyme. In one embodiment, the first pair of RRSs, the second pair of RRSs, or both are Cre-responsive RRSs. In one embodiment, the third pair of RRSs is a Flipase-responsive RRS.

[0222] In various embodiments, any of the nucleic acid constructs described herein further comprises a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operably linked to a constitutive promoter.

[0223] In various embodiments, any nucleic acid construct described herein further comprises the nucleic acid sequence encoding marker protein.Exemplary marker protein includes fluorescent protein, such as green fluorescent protein (GFP), red fluorescent protein (RFP) or luciferase; molecular tag such as Myc tag, Flag tag or His tag; and molecular barcode.

[0224] In various embodiments, any of the nucleic acid constructs described herein further comprises a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operably linked to a constitutive promoter and a nucleic acid sequence encoding a marker protein.

[0225] In one embodiment, the nucleic acid sequence encoding the marker protein is removed from the construct, hi one embodiment, the nucleic acid sequence encoding the marker protein is flanked by recombinase recognition sequences (RRS) oriented in the same direction relative to one another, e.g., to facilitate its removal from the construct.

[0226] In certain embodiments, the transactivator is a CRISPR transactivator or a CAS transactivator. As used herein, "CRISPR transactivator" or "CAS transactivator" refers to a transcriptional activator protein domain or entire protein linked to, for example, dCas9 or sgRNA, which assists in recruiting auxiliary factors or RNA polymerase for transcription of the gene(s) targeted by the system. The transcriptional activator, for example, has at least a DNA binding domain and a domain for transcription activation. The activation domain can recruit general transcription factors or RNA polymerase to the gene sequence or function by promoting transcription by stalled RNA polymerase, and in eukaryotes, can act to move nucleosomes on DNA or modify histones to increase gene expression. These activators can be introduced into the system by attaching to dCas9 or sgRNA. CRISPR transactivators or CAS transactivators are known in the art and can be easily identified by those skilled in the art.

[0227] Recombinase recognition sequence (RRS)

[0228] As used herein, a "recombinase" is a site-specific enzyme that recognizes short DNA sequence(s), referred to herein as recombinase recognition sequences or RRSs, typically about 30 base pairs (bp) and 40 bp, and mediates recombination between these recombinase recognition sequences, resulting in the excision, integration, inversion, or exchange of the DNA fragment between the recombinase recognition sequences.

[0229] Exemplary recombinases include, but are not limited to, Cre, Flp, Dre, SCre, VCre, Vika, B2, B3, KD, ΦC31, Bxb1, λ, HK022, HP1, γδ, ParA, Tn3, Gin, R4, TP901-1, TG1, PhiRv1, PhiBT1, SprA, XisF, TnpX, R, A118, spoIVCA, PhiMR11, SCCmec, TndX, XerC, XerD, XisA, Hin, Cin, mrpA, beta, PhiFC1, Fre, Clp, sTre, FimE, and HbiF.

[0230] Exemplary recombinase recognition sequences (RRS) include, but are not limited to, loxP, loxN, lox511, lox5171, lox2272, M2, M3, M7, M11, lox71, lox66, FRT, rox, SloxM1, VloxP, vox, B3RT, KDRT, F3, F14, attB / P, F5, F13, Vlox2272, Slox2272, SloxP, RSRT, and B2RT.

[0231] Based on their distinct biochemical properties, recombinases can be classified into two distinct families: serine recombinases (e.g., resolvases and invertases) and tyrosine recombinases (e.g., integrases). Serine and tyrosine recombinases are further divided into bidirectional and unidirectional recombinases. Examples of bidirectional serine recombinases include, but are not limited to, β-6, CinH, ParA, and γδ. Examples of unidirectional serine recombinases include, but are not limited to, Bxbl, φC31 (phiC31), TP901, TGI, φBTI, R4, cpRVl, cpFCl, MRU, A118, U153, and gp29. Examples of bidirectional tyrosine recombinases include, but are not limited to, Cre, FLP, and R. Unidirectional tyrosine recombinases include, but are not limited to, lambda, HKlOl, HK022, and pSAM2. Serine and tyrosine recombinases are named after the conserved nucleophilic amino acid residues that the recombinase uses to attack DNA and become covalently bound to it during strand exchange. Recombinases have been used in many standard biological applications, including creating gene knockouts and solving selection problems.

[0232] In some embodiments, recombinases for use in the present invention are orthogonal recombinases. When a first recombinase is orthogonal to a second recombinase, it means that the second recombinase does not recognize the RRS specific to the first recombinase, and the first recombinase does not recognize the RRS specific to the second recombinase.

[0233] The outcome of recombination depends, in part, on the location and orientation of two short, repetitive DNA sequences (e.g., RRSs), typically less than 30 bp in length, to be recombined. Site-specific recombinases bind to these repetitive sequences specific for each recombinase, referred to herein as "recombinase recognition sequences" or "recombinase recognition sites." Thus, as used herein, a recombinase is "specific" for a recombinase recognition site if the recombinase can mediate inversion or excision between the repetitive DNA sequences. As used herein, a recombinase may also be said to recognize its "cognate recombinase recognition site" adjacent to an intervening genetic element (e.g., a promoter, terminator, or target gene). A genetic element is said to be "flanked" by recombinase recognition sites if the element is located between and immediately adjacent to two repetitive DNA sequences. In some embodiments, the recombinase recognition sites do not overlap with each other. However, in other embodiments, the recombinase recognition sites can overlap one another, as described herein below, greatly increasing the combinatorial complexity.

[0234] Inversion recombination occurs between two short inverted repeat DNA sequences. Without wishing to be bound by theory, DNA loop formation, assisted by DNA bending proteins, brings the two repeat sequences together, at which point DNA cleavage and ligation occur. This reaction is ATP-independent and requires supercoiled DNA. The end result of such an inversion recombination event is that the DNA located between the repeat sites is inverted (i.e., the DNA between the two RRSs is reversed in orientation), and what was the coding strand is now the non-coding strand, and vice versa. In such a reaction, DNA is preserved with no net gain or loss of DNA.

[0235] Conversely, excision (integration) recombination occurs between two short, repetitive DNA sequences oriented in the same direction. In this case, the intervening DNA is excised / removed. For example, an AND gate can be assembled by placing a terminator between each of two different sets of recombinase sites oriented for excision, flanking an output, such as a promoter and a GFP coding sequence. In this example, both terminators must be excised by the input-dependent action of the recombinase(s) to allow read-through from the promoter to the GFP coding sequence. Therefore, two inputs are required to excise both terminators to generate the output.

[0236] Recombinases can also be classified as irreversible or reversible. As used herein, "irreversible recombinase" refers to a recombinase that can catalyze recombination between two complementary recombination sites but cannot catalyze recombination between the hybrid sites formed by this recombination without the assistance of additional factors. Thus, an "irreversible recognition site" refers to a recombinase recognition site that can function as the first of two DNA recognition sequences for an irreversible recombinase and is modified into a hybrid recognition site after recombination at that site. A "complementary irreversible recognition site" refers to a recombinase recognition site that can function as the second of two DNA recognition sequences for an irreversible recombinase and is modified into a hybrid recombination site after homologous recombination at that site. For example, attB and attP, as described below, are irreversible recombination sites for Bxbl and phiC31 recombinases, and attB is the complementary irreversible recombination site for attP, and vice versa. Recently, it has been shown that attB / attP sites can be mutated to create orthogonal B / P pairs that only interact with each other and not with other mutants

[72] , allowing a single recombinase to control the excision or integration or inversion of multiple orthogonal B / P pairs.

[0237] The phiC31 (φC31) integrase, for example, catalyzes only the attB x attP reaction in the absence of additional factors not found in eukaryotic cells. Recombinases cannot mediate recombination between the attL and attR hybrid recombination sites formed during recombination between attB and attP. Because recombinases such as phiC31 integrase cannot catalyze the reverse reaction by themselves, the attB x attP recombination of phiC31 is stable.

[0238] Irreversible recombinases and nucleic acids encoding irreversible recombinases have been described in the art and can be obtained using routine methods. Examples of irreversible recombinases include, but are not limited to, phiC31 (φC31) recombinase, coliphage P4 recombinase, coliphage lambda integrase, Listeria A118 phage recombinase, and actinophage R4 Sre recombinase, HK101, HK022, pSAM2, Bxbl, TP901, TGI, φBTI, cpRVl, cpFCl, MRU, U153, and gp29. Conversely, a "reversible recombinase" refers to a recombinase that can catalyze recombination between two complementary recombinase recognition sites and, without the aid of additional factors, can catalyze recombination between sites formed by an initial recombination event, thereby reversing it. The resulting product site is itself a substrate for subsequent recombination. Examples of reversible recombinase systems include, but are not limited to, the Cre-lox and Flp-frt systems, R, β-6, CinH, ParA, and γδ.

[0239] The recombinases provided herein are not meant to be exclusive examples of recombinases that can be used in embodiments of the present invention. Other examples of recombinases useful in the invention described herein will be known to those of skill in the art, and it is anticipated that any new recombinases discovered or produced can be used in different embodiments of the present invention.

[0240] In some embodiments, the recombinase is a serine recombinase. Thus, in some embodiments, the recombinase is considered irreversible. Some serine recombinases can reverse the initial recombination event if a recombinase directionality factor (RDF) is present. RDFs are a diverse group of proteins involved in controlling the directionality of integrase-mediated site-specific recombination reactions. Typically, RDFs are small DNA-binding proteins that act as accessory factors that influence the selection of substrates recombined by their cognate recombinases. See Lewis and Hatfull, Nucleic Acids Res. 2001 Jun 1;29(11):2205-2216. For example, if the recombination sites attB and attP are arranged in an antiparallel orientation, the presence of the recombinase stably inverts the DNA sequence between the two sites, generating attL and attR sites (a "BP reaction"). This inversion remains stable unless an RDF is also expressed along with bxb1 or phiC, which inverts the sequence between attL and attR and regenerates the attB and attP sites (the "LR reaction"). Examples of RDFs include, but are not limited to, gp47 of bxb1, gp3 of phiC31, gp3 of PhiBT1, ORF7 of TP901-1, gp25 of TG1, and gp3 of PhiRv1.

[0241] In some embodiments, the recombinase is a tyrosine recombinase. Thus, in some embodiments, the recombinase is considered to be reversible.

[0242] In some embodiments, the recombinases for the AAV expression systems described herein can all be of the same type (e.g., serine or tyrosine). In some embodiments, tyrosine and serine recombinases can be used together in the same nucleic acid construct described herein.

[0243] In some embodiments, the recombinase comprises the sequence of Bxbl recombinase, and the corresponding recombinase recognition sequences are Bxbl attB and Bxbl attP.

[0244] In some embodiments, the recombinase comprises the sequence of phiC31 (φC31) recombinase, and the corresponding recombinase recognition sequences include phiC31 attB and phiC31 attP.

[0245] The recombinase can recognize multiple pairs of RRSs. In some embodiments, the recombinase comprises a Cre sequence and the corresponding recombinase recognition sequence comprises loxP. In some embodiments, the recombinase comprises a Cre sequence and the corresponding recombinase recognition sequence comprises lox2272. In some embodiments, the recombinase comprises a Cre sequence and the corresponding recombinase recognition sequence comprises loxN.

[0246] In some embodiments, the recombinase comprises a sequence of Dre and the corresponding recombinase recognition sequence comprises rox.

[0247] In some embodiments, the recombinase comprises a sequence of VCre, and the corresponding recombinase recognition sequence comprises VloxP.

[0248] In some embodiments, the recombinase comprises a sequence of VCre, and the corresponding recombinase recognition sequence comprises VloxP.

[0249] In some embodiments, the recombinase comprises a sequence of Flp, and the corresponding recombinase recognition sequence comprises FRT.

[0250] In some embodiments, the recombinase comprises a sequence of SCre, and the corresponding recombinase recognition sequence comprises SloxM1.

[0251] In some embodiments, the recombinase comprises a Vika sequence and the corresponding recombinase recognition sequence comprises vox.

[0252] In some embodiments, the recombinase comprises a sequence of B3, and the corresponding recombinase recognition sequence comprises B3RT.

[0253] In some embodiments, the recombinase comprises a sequence of KD, and the corresponding recombinase recognition sequence comprises KDRT.

[0254] The sequences of some recombinases are shown below:

[0255] hPGK (SEQ ID NO: 10): [ka] [ka]

[0256] EF1α (SEQ ID NO: 11): [ka]

[0257] SFFV (SEQ ID NO: 12): [ka]

[0258] CAG (SEQ ID NO: 13): [ka] [ka]

[0259] NLS-iCre (SEQ ID NO: 14): [ka] [ka]

[0260] NLS-FlpO (SEQ ID NO: 15): [ka]

[0261] NLS-DreO (SEQ ID NO: 16): [ka] [ka]

[0262] NLS-SCre (SEQ ID NO: 17): [ka]

[0263] NLS-VCre (SEQ ID NO: 18): [ka] [ka]

[0264] NLS-VikaO (SEQ ID NO: 19): [ka] [ka]

[0265] NLS-B3 (SEQ ID NO: 20): [ka]

[0266] NLS-KD (SEQ ID NO: 21): [ka]

[0267] NLS-B2 (SEQ ID NO: 22): [ka] [ka]

[0268] NLS-R (SEQ ID NO: 23): [ka] [ka]

[0269] NLS-PhiC31 (SEQ ID NO: 24): [ka]

[0270] NLS-bxb1 (SEQ ID NO: 25): [ka]

[0271] The sequences of some recombinase recognition sequences (RRS) are shown below: [ka] [ka] [ka]

[0272] cell line Provided herein is a stable cell line for the production of recombinant viral vectors that contains at least one inducible promoter operably linked to a heterologous gene encoding a toxic protein.

[0273] One aspect of the present application provides a stable cell line for recombinant viral vector production, e.g., AAV vector production, comprising at least one inducible promoter operably linked to a heterologous rep or pol gene encoding a rep protein or a polymerase protein, respectively. In one embodiment, the inducible promoter is further operably linked to a heterologous cap or env gene encoding a cap protein or an env protein, respectively. Alternatively, in one embodiment, the stable cell line further comprises a second inducible promoter operably linked to a heterologous cap or env gene encoding a cap protein or an env protein, respectively, wherein the second inducible promoter is induced by a different inducer than the first inducible promoter.

[0274] Another aspect of the present application provides a stable cell line for recombinant AAV vector production, comprising at least one inducible promoter, the inducible promoter being operably linked to a heterologous cap gene encoding a cap protein.

[0275] Another aspect of the present application provides a stable cell line for recombinant AAV vector production, which comprises at least one regulatable promoter, for example, an inducible promoter, and the inducible promoter is operably linked to a heterologous helper gene encoding a helper gene product.Helper genes are generally used in the production of AAV vectors.Exemplary helper genes that have traditionally been used in AAV production include E1 (E1A and E1B), E2A, E4 and VA RNA.

[0276] Another aspect of the present application provides a stable cell line for producing a recombinant viral vector comprising at least one inducible promoter operably linked to a heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, an RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0277] Another aspect of the present application provides a stable cell line for producing a recombinant viral vector comprising at least one forskolin-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein.

[0278] Another aspect of the present application provides a stable cell line for producing a recombinant viral vector comprising at least one hypoxia-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein.

[0279] Another aspect of the present application provides a stable cell line for producing a recombinant viral vector, the cell line comprising at least one forskolin-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0280] Another aspect of the present application provides a stable cell line for recombinant viral vector production, comprising at least one hypoxia-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0281] Another aspect of the present application provides a stable cell line for producing a recombinant viral vector, comprising at least one forskolin-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, and at least one hypoxia-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein.

[0282] Another aspect of the present application provides a stable cell line for producing a recombinant viral vector comprising at least one inducible promoter having the sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operably linked to at least one heterologous gene encoding a toxic protein.

[0283] Another aspect of the present application provides a stable cell line for producing a recombinant viral vector, comprising at least one inducible promoter having any one of the sequences of SEQ ID NO: 6 to SEQ ID NO: 9 operably linked to at least one heterologous gene encoding a toxic protein.

[0284] Another aspect of the present application provides a stable cell line for producing a recombinant viral vector, the cell line comprising at least one inducible promoter having the sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0285] Another aspect of the present application provides a stable cell line for producing a recombinant viral vector, comprising at least one inducible promoter having any one of the sequences of SEQ ID NO: 6 to SEQ ID NO: 9 operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0286] Another aspect of the present application provides a stable cell line for producing a recombinant viral vector, comprising at least one inducible promoter having the sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter having any one of the sequences of SEQ ID NO: 6 to SEQ ID NO: 9 operably linked to at least one heterologous gene encoding a toxic protein.

[0287] Another aspect of the present application provides a stable cell line for rAAV production comprising at least one inducible promoter operably linked to a heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0288] Another aspect of the present application provides a stable cell line for rAAV production comprising at least one forskolin-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein.

[0289] Another aspect of the present application provides a stable cell line for rAAV production comprising at least one hypoxia-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein.

[0290] Another aspect of the present application provides a stable cell line for rAAV production, the cell line comprising at least one forskolin-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0291] Another aspect of the present application provides a stable cell line for rAAV production, the cell line comprising at least one hypoxia-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0292] Another aspect of the present application provides a stable cell line for rAAV production, comprising at least one forskolin-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, and at least one hypoxia-inducible promoter operably linked to at least one heterologous gene encoding a toxic protein.

[0293] Another aspect of the present application provides a stable cell line for rAAV production comprising at least one inducible promoter having the sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operably linked to at least one heterologous gene encoding a toxic protein.

[0294] Another aspect of the present application provides a stable cell line for rAAV production comprising at least one inducible promoter having the sequence of any one of SEQ ID NOs: 6 to 9 operably linked to at least one heterologous gene encoding a toxic protein.

[0295] Another aspect of the present application provides a stable cell line for rAAV production, the cell line comprising at least one inducible promoter having the sequence of SEQ ID NO:1 or SEQ ID NO:3 operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0296] Another aspect of the present application provides a stable cell line for rAAV production, comprising at least one inducible promoter having any one of the sequences set forth in SEQ ID NO:6 to SEQ ID NO:9 operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter operably linked to at least one heterologous gene encoding a toxic protein, wherein the at least one inducible promoter is selected from the group consisting of a forskolin-inducible promoter, a hypoxia-inducible promoter, a tetracycline-inducible promoter, an alcohol-inducible promoter, a steroid-inducible promoter, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, a metallothionein-inducible promoter, a hormone-inducible promoter, and a metal-inducible promoter.

[0297] A stable cell line for rAAV production, comprising at least one inducible promoter having the sequence of SEQ ID NO: 1 or SEQ ID NO: 3 operably linked to at least one heterologous gene encoding a toxic protein, and at least one inducible promoter having the sequence of any one of SEQ ID NO: 6 to SEQ ID NO: 9 operably linked to at least one heterologous gene encoding a toxic protein.

[0298] In one embodiment, the stable cell further comprises at least one inhibitory element operably linked to at least one heterologous gene encoding a toxic protein.

[0299] In one embodiment, the stable cell line has at least two inducible promoters, where the at least two inducible promoters are the same, for example, the stable cell contains two forskolin promoters. In one embodiment, the stable cell line has at least two inducible promoters, where the at least two inducible promoters are different, for example, the stable cell contains a forskolin and a hypoxia promoter.

[0300] The stable cell lines described herein can include at least one, two, three, four, five, or more inducible promoters operably linked to different toxic genes. Alternatively, the inducible promoter can be operably linked to at least two, three, four, five, or more genes. For example, the inducible promoter can be operably linked to at least two different toxic genes, e.g., rep and cap, such that induction of expression (e.g., by contacting cells with an inducer for the inducible promoter) results in expression of at least two different toxic genes. The inducible promoter can be operably linked to at least two different helper genes, such that induction of expression (e.g., by contacting cells with an inducer for the inducible promoter) results in expression of at least two different helper genes. The inducible promoter can be operably linked to at least one toxic protein and at least one different helper gene, such that induction of expression (e.g., by contacting cells with an inducer for the inducible promoter) results in expression of at least one toxic protein and at least one different helper gene.

[0301] In one embodiment, the cell comprises at least two distinct inducible promoters, the at least two inducible promoters being induced by different inducers (e.g., hypoxia and forskolin), and the at least two inducible promoters being operably linked to different heterologous genes encoding different toxic proteins. For example, the cell comprises a first inducible promoter operably linked to a first toxic gene and a second inducible promoter operably linked to a second toxic gene.

[0302] In one embodiment, the cell comprises at least two inducible promoters, wherein the at least two inducible promoters are induced by different inducers, and the at least two inducible promoters are induced by the same inducer. For example, the cell comprises a first inducible promoter operably linked to a first toxic gene and a second inducible promoter operably linked to a second toxic gene.

[0303] In one embodiment, the cell comprises at least two inducible promoters, the at least two inducible promoters being induced by different inducers, and the at least two inducible promoters are each operably linked to at least one different heterologous gene encoding at least one different toxic protein. For example, the cell comprises a first inducible promoter operably linked to a first and a second toxic gene, and a second inducible promoter operably linked to a third toxic gene.

[0304] In one embodiment, the stable cell line comprises at least one inducible promoter operably linked to a heterologous gene encoding a toxic protein integrated into the genome, hi another embodiment, the stable cell line comprises at least one inducible promoter operably linked to a heterologous gene encoding the toxic protein in a stable episomal form (e.g., as a stable plasmid).

[0305] In one embodiment, a cell line for producing a recombinant viral vector, e.g., an AAV vector, containing at least one inducible promoter does not need to be a stable cell line. For example, a vector containing at least one inducible promoter can be transiently introduced (e.g., transiently transfected) into cells. One aspect of the present application provides a cell line for producing a recombinant viral vector containing at least one inducible promoter operably linked to a heterologous gene encoding a toxic protein. Another aspect of the present application provides a cell line for producing an rAAV vector containing at least one inducible promoter operably linked to a heterologous gene encoding a toxic protein (e.g., rep or cap) required for rAAV production. Transient expression can be achieved, for example, by introducing a synthetic nucleic acid, expression vector, or plasmid for expressing at least one inducible promoter into cells, where the inducible promoter is operably linked to a heterologous gene encoding a toxic protein. Such introduction can include, for example, transformation, transfection, electroporation, or lipofection. One skilled in the art can determine whether a cell has transiently introduced a synthetic nucleic acid, expression vector, or plasmid, for example, by using a PCR-based assay or Western blotting to assess mRNA or protein levels of the synthetic nucleic acid, expression vector, or plasmid, respectively.

[0306] Another aspect provided herein is a cell expressing a nucleic acid construct encoding a tetracycline-responsive transactivator protein operably linked to a constitutive promoter.

[0307] Another aspect provided herein is a cell that expresses a nucleic acid sequence encoding a marker protein.

[0308] Another aspect provided herein is a cell expressing a nucleic acid construct comprising at least a nucleic acid sequence encoding a toxic protein, wherein the nucleic acid encoding the toxic protein is operably linked to a regulatable promoter.

[0309] Another embodiment provided herein is a cell expressing a nucleic acid construct comprising a nucleic acid sequence encoding at least one helper protein, wherein the at least one helper gene is operably linked to a first regulatable promoter, and a nucleic acid sequence encoding a toxic protein, wherein the nucleic acid encoding the toxic protein is under the control of a second regulatable promoter or zinc finger transcriptional activator (ZF-TA).

[0310] Another aspect provided herein is a cell that expresses a nucleic acid construct comprising a nucleic acid sequence that includes at least one of a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a regulatable promoter.

[0311] Another aspect provided herein is a cell expressing a nucleic acid construct encoding a Rep protein, wherein the nucleic acid encoding the Rep protein is under the control of a regulatable promoter or zinc finger transcriptional activator (ZF-TA).

[0312] Another aspect provided herein is a cell expressing a nucleic acid construct comprising: a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a first regulatable promoter; and a nucleic acid sequence encoding a Rep protein, wherein the nucleic acid encoding the Rep protein is under the control of a second regulatable promoter or transcriptional activator, wherein the first and second regulatable promoters are different. In one embodiment, the transcriptional activator is a zinc finger transcriptional activator (ZF-TA).

[0313] Another aspect provided herein is a cell expressing a nucleic acid construct comprising a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operably linked to an inducible promoter, wherein the inducible promoter is an E4-responsive promoter, or an E2-responsive promoter or other helper gene-responsive promoter. In various embodiments, the zinc finger transcriptional activator (ZF-TA) is expressed from the construct.

[0314] Another aspect provided herein is a cell expressing a nucleic acid construct comprising a target site for binding of a zinc finger transcriptional activator (ZF-TA).

[0315] Another embodiment provided herein is a cell expressing a nucleic acid construct comprising a Rep protein operably linked to a promoter containing a target site for binding of a zinc finger transcriptional activator (ZF-TA).

[0316] Another embodiment provided herein is a cell expressing a nucleic acid construct comprising: a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operably linked to a constitutive promoter; a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a regulatable promoter; and a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operably linked to an inducible promoter, for example, wherein the inducible promoter is an E4-responsive promoter or an E2-responsive promoter; and a nucleic acid construct comprising a Rep protein operably linked to a promoter comprising a target site for binding of the zinc finger transcriptional activator (ZF-TA).

[0317] Another aspect provided herein is a cell that expresses a nucleic acid construct comprising a nucleic acid sequence encoding a toxic protein and a recombinase recognition sequence (RRS) located 3' to the nucleic acid sequence encoding the toxic protein.

[0318] Another embodiment provided herein is a cell expressing a nucleic acid construct comprising a nucleic acid sequence encoding a Cap protein and recombinase recognition sequences (RRSs) located 5' and 3' of the nucleic acid sequence encoding the Cap protein such that the RRSs flank the nucleic acid sequence encoding the Cap protein.

[0319] Another embodiment provided herein is a cell that expresses a nucleic acid construct comprising a first nucleic acid construct comprising, in a 5' to 3' direction, a promoter, a terminating nucleic acid sequence flanked by a first pair of recombinase recognition sequences (RRS), and a nucleic acid sequence encoding a Rep protein, wherein the promoter is operably linked to the nucleic acid encoding the Rep protein, and a second nucleic acid construct comprising, in a 5' to 3' direction, a promoter, a terminating nucleic acid sequence flanked by a second pair of recombinase recognition sequences (RRS), and a nucleic acid sequence encoding one or more of E2A, E4, and VA RNA, wherein the promoter is operably linked to the nucleic acid encoding one or more of E2A, E4, and VA RNA.

[0320] The expression of the construct can be stably expressed, i.e., can be integrated into the genome of the cell.One aspect of the present specification provides a stable cell that expresses at least one nucleic acid construct described herein.In one embodiment, the stable cell expresses at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, or at least nine of the nucleic acid constructs described herein.

[0321] One embodiment provided herein is a stable cell that expresses nucleic acid constructs comprising at least one nucleic acid sequence encoding at least one helper protein, each nucleic acid construct operably linked to a regulatable promoter.

[0322] Another aspect provided herein is a stable cell expressing a nucleic acid construct encoding a tetracycline-responsive transactivator protein operably linked to a constitutive promoter.

[0323] Another embodiment provided herein is a stable cell expressing a nucleic acid sequence encoding a marker protein.

[0324] Another aspect provided herein is a stable cell expressing a nucleic acid construct comprising at least a nucleic acid sequence encoding a toxic protein, wherein the nucleic acid encoding the toxic protein is operably linked to a regulatable promoter.

[0325] Another aspect provided herein is a stable cell expressing a nucleic acid construct comprising a nucleic acid sequence encoding at least one helper protein, wherein the at least one helper gene is operably linked to a first regulatable promoter, and a nucleic acid sequence encoding a toxic protein, wherein the nucleic acid encoding the toxic protein is under the control of a second regulatable promoter or zinc finger transcriptional activator (ZF-TA).

[0326] Another aspect provided herein is a stable cell that expresses a nucleic acid construct comprising a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a regulatable promoter.

[0327] Another aspect provided herein is a stable cell expressing a nucleic acid construct encoding a Rep protein, wherein the nucleic acid encoding the Rep protein is under the control of a regulatable promoter or zinc finger transcriptional activator (ZF-TA).

[0328] Another aspect provided herein is a stable cell expressing a nucleic acid construct comprising: a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a first regulatable promoter; and a nucleic acid sequence encoding a Rep protein, wherein the nucleic acid encoding the Rep protein is under the control of a second regulatable promoter or transcriptional activator, wherein the first and second regulatable promoters are different.

[0329] Another aspect provided herein is a stable cell expressing a nucleic acid construct comprising a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operably linked to an inducible promoter, wherein the inducible promoter is an E4-responsive promoter, or an E2-responsive promoter or other helper gene-responsive promoter. In various embodiments, the zinc finger transcriptional activator (ZF-TA) is expressed from the construct.

[0330] Another embodiment provided herein is a stable cell expressing a nucleic acid construct comprising a toxic protein operably linked to a promoter comprising a zinc finger transcriptional activator (ZF-TA).

[0331] Another embodiment provided herein is a stable cell expressing a nucleic acid construct comprising a Rep protein operably linked to a promoter containing a target site for binding of a transcriptional activator, e.g., a zinc finger transcriptional activator (ZF-TA).

[0332] Another embodiment provided herein is a stable cell expressing a nucleic acid construct comprising: a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operably linked to a constitutive promoter; a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a regulatable promoter; and a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operably linked to an inducible promoter, wherein the inducible promoter is an E4-responsive promoter or an E2-responsive promoter; and a nucleic acid construct comprising a Rep protein operably linked to a promoter comprising a target site for binding of the zinc finger transcriptional activator (ZF-TA).

[0333] Another aspect provided herein is a stable cell that expresses a nucleic acid construct comprising a nucleic acid sequence encoding a toxic protein and a recombinase recognition sequence (RRS) located 3' to the nucleic acid sequence encoding the toxic protein.

[0334] Another aspect provided herein is a stable cell expressing a nucleic acid construct comprising a nucleic acid sequence encoding a Cap protein and a recombinase recognition sequence (RRS) located 3' to the nucleic acid sequence encoding the Cap protein.

[0335] Another embodiment provided herein is a stable cell that expresses a nucleic acid construct comprising: a first nucleic acid construct comprising, in a 5' to 3' direction, a promoter, a terminating nucleic acid sequence flanked by a first pair of recombinase recognition sequences (RRS), and a nucleic acid sequence encoding a Rep protein, wherein the promoter is operably linked to the nucleic acid encoding the Rep protein; and a second nucleic acid construct comprising, in a 5' to 3' direction, a promoter, a terminating nucleic acid sequence flanked by a second pair of recombinase recognition sequences (RRS), and a nucleic acid sequence encoding one or more of E2A, E4, and VA RNA, wherein the promoter is operably linked to the nucleic acid encoding one or more of E2A, E4, and VA RNA.

[0336] The expression of the construct can be transiently expressed, i.e., not integrated into the genome of the cell. One aspect of the present specification provides a cell that has transient expression of at least one nucleic acid construct described herein. In one embodiment, the cell has transient expression of at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, or at least nine of the nucleic acid constructs described herein.

[0337] One embodiment provided herein is a cell having transient expression of nucleic acid constructs comprising at least one nucleic acid sequence encoding at least one helper protein, each nucleic acid construct operably linked to a regulatable promoter.

[0338] Another aspect provided herein is a cell having transient expression of a nucleic acid construct encoding a tetracycline-responsive transactivator protein operably linked to a constitutive promoter.

[0339] Another aspect provided herein is a cell having transient expression of a nucleic acid sequence encoding a marker protein.

[0340] Another aspect provided herein is a cell having transient expression of a nucleic acid construct comprising at least a nucleic acid sequence encoding a toxic protein, wherein the nucleic acid encoding the toxic protein is operably linked to a regulatable promoter.

[0341] Another embodiment provided herein is a cell having transient expression of a nucleic acid construct comprising a nucleic acid sequence encoding at least one helper protein, wherein the at least one helper gene is operably linked to a first regulatable promoter, and a nucleic acid sequence encoding a toxic protein, wherein the nucleic acid encoding the toxic protein is under the control of a second regulatable promoter or zinc finger transcriptional activator (ZF-TA).

[0342] Another aspect provided herein is a cell having transient expression of a nucleic acid construct comprising a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a regulatable promoter.

[0343] Another aspect provided herein is a cell having transient expression of a nucleic acid construct encoding a Rep protein, wherein the nucleic acid encoding the Rep protein is under the control of a regulatable promoter or zinc finger transcriptional activator (ZF-TA).

[0344] Another embodiment provided herein is a cell having transient expression of a nucleic acid construct comprising: a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a first regulatable promoter; and a nucleic acid sequence encoding a Rep protein, wherein the nucleic acid encoding the Rep protein is under the control of a second regulatable promoter or transcriptional activator, wherein the first and second regulatable promoters are different.

[0345] Another aspect provided herein is a cell having transient expression of a nucleic acid construct comprising a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operably linked to an inducible promoter, wherein the inducible promoter is an E4-responsive promoter, or an E2-responsive promoter or other helper gene-responsive promoter. In various embodiments, the zinc finger transcriptional activator (ZF-TA) is expressed from the construct.

[0346] Another embodiment provided herein is a cell with transient expression of a nucleic acid construct comprising a toxic protein operably linked to a promoter comprising a zinc finger transcriptional activator (ZF-TA).

[0347] Another embodiment provided herein is a cell having transient expression of a nucleic acid construct comprising a Rep protein operably linked to a promoter containing a target site for binding of a transcriptional activator, e.g., a zinc finger transcriptional activator (ZF-TA).

[0348] Another embodiment provided herein is a cell having transient expression of a nucleic acid construct comprising: a nucleic acid sequence encoding a tetracycline-responsive transactivator protein operably linked to a constitutive promoter; a nucleic acid sequence comprising at least one of a nucleic acid sequence encoding an E4 protein, a nucleic acid sequence encoding an E2A protein, and a nucleic acid sequence encoding a VA protein, wherein each nucleic acid sequence encoding any one of E4, E2A, and VA RNA is operably linked to a regulatable promoter; and a nucleic acid sequence encoding a zinc finger (ZF) transcriptional activator operably linked to an inducible promoter, wherein the inducible promoter is an E4-responsive promoter or an E2-responsive promoter; and a nucleic acid construct comprising a Rep protein operably linked to a promoter comprising a target site for binding of the zinc finger transcriptional activator (ZF-TA).

[0349] Another aspect provided herein is a cell having transient expression of a nucleic acid construct comprising a nucleic acid sequence encoding a toxic protein and a recombinase recognition sequence (RRS) located 3' to the nucleic acid sequence encoding the toxic protein.

[0350] Another aspect provided herein is a cell having transient expression of a nucleic acid construct comprising a nucleic acid sequence encoding a Cap protein and a recombinase recognition sequence (RRS) located 3' to the nucleic acid sequence encoding the Cap protein.

[0351] Another embodiment provided herein is a cell having transient expression of a nucleic acid construct comprising a first nucleic acid construct comprising, in a 5' to 3' direction, a promoter, a stop nucleic acid sequence flanked by a first pair of recombinase recognition sequences (RRS), and a nucleic acid sequence encoding a Rep protein, wherein the promoter is operably linked to the nucleic acid encoding the Rep protein, and a second nucleic acid construct comprising, in a 5' to 3' direction, a promoter, a stop nucleic acid sequence flanked by a second pair of recombinase recognition sequences (RRS), and a nucleic acid sequence encoding one or more of E2A, E4, and VA RNA, wherein the promoter is operably linked to the nucleic acid encoding one or more of E2A, E4, and VA RNA.

[0352] When a cell expresses at least two nucleic acid constructs, the type of expression, i.e., stable or transient, can be the same or different for each of the at least two nucleic acid constructs.For example, when a cell expresses at least two nucleic acid constructs, the expression of the at least two nucleic acid constructs can both be stable expression.When a cell expresses at least two nucleic acid constructs, the expression of the at least two nucleic acid constructs can both be transient expression.Alternatively, when a cell expresses at least two nucleic acid constructs, the expression of at least one of the two nucleic acid constructs is stable expression, for example, the cell can have both stable expression of a nucleic acid construct and transient expression of a different nucleic acid construct.

[0353] Cell culture systems used for viral vector propagation, such as viral vector-producing cells, including primary cells, semi-continuous cell lines, and continuous cell lines, can express any of the inducible promoters described herein to control gene products required for viral vector propagation. Primary cell lines are cell lines derived from animal tissues, such as human, mouse, dog, or monkey, and can be passaged once or twice to generate secondary cultures (i.e., subcultures of primary cultures), but they only proliferate for a limited period of time. Secondary cultures are similar to primary cultures in both morphology and viral susceptibility. Semi-continuous cell lines, such as human diploid cells, are derived from fetal tissue and can be subcultured for approximately 50 passages. Continuous cell lines are cancer or other immortalized cell lines that proliferate rapidly and can be cultured indefinitely. These cells can become aneuploid with continuous passage. Continuous cell lines typically have a narrower range of viral susceptibility than primary and semi-continuous cell lines, but are easier to adapt for viral propagation.

[0354] Cell lines for propagating viral vectors are known in the art and include, but are not limited to, the exemplary cell lines shown in Table 2. In one embodiment, the cell line for viral propagation is selected from Table 2. In one embodiment, the cell line for viral propagation is derived from a cell line selected from Table 2. [Table 2-1] [Table 2-2]

[0355] In one embodiment, the cell line is a HEK293 cell line that has been modified so that it is no longer an adherent cell line. In one embodiment, the cell line is a HEK293 cell line that grows in suspension. In one embodiment, the cell line is a Pro10 cell line. The Pro10 cell line is described, for example, in U.S. Patent No. 9,441,206, which is incorporated herein by reference.

[0356] Provided herein are methods for producing any of the stable cell lines described herein, comprising the steps of: (a) transforming a population of cells with at least one nucleic acid cassette comprising an inducible promoter operably linked to a heterologous gene encoding a toxic protein or a nucleic acid described herein; (b) culturing the population of cells of (a) for a time and under conditions sufficient to allow expression of the nucleic acid cassette or construct; (c) selecting for cells that stably express the nucleic acid cassette; and (d) growing the cells of (c) to produce the cell line.

[0357] Techniques and methods for generating stable cell lines are known in the art and can be easily identified by those skilled in the art. In one embodiment, parent cells are co-transfected with a vector containing a gene that confers antibiotic resistance to the cells. For example, the bsr, bls, or BSD gene confers resistance to blasticidin; the Sh ble gene confers resistance to Zeocin™; the pac gene confers resistance to puromycin; the neo gene confers resistance to G418 (geneticin); the hph gene confers resistance to hygromycin B; and the Sh ble gene confers resistance to phleomycin. For initial selection, cells expressing a gene that confers resistance to an antibiotic are cultured in the presence of the antibiotic. For example, cells expressing the neo gene are cultured in a geneticin-containing medium. After initial selection, surviving cells are isolated, cultured under conditions that allow expression of the nucleic acid cassette, recovered, and assayed to confirm expression of the nucleic acid cassette.

[0358] In one embodiment, the method further comprises culturing the cells under conditions and for a time sufficient to induce expression of at least one toxic protein, such as Rep, Cap, or a helper protein. Western blotting or other suitable assays can be used to assess the expression of the nucleic acid cassette or at least one toxic protein. Inducing suitable expression involves applying at least one inducer to the cells. The inducer is applied for a period of time suitable to induce expression from the inducible promoter. As discussed herein, the inducer can be an agent administered to the cells or a condition to which the cells are subjected. Suitable inducers are discussed herein.

[0359] Clones producing the nucleic acid cassettes are propagated to produce stable cell lines of the invention (the term "cell line" is intended to include progeny (subclones) of the original line). In one embodiment, stability is confirmed by the ability to produce at least one toxic protein for at least about 12 months and for more than about 50 passages. In one embodiment, the stability is for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or more months, and for at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, , 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more passages to produce at least one toxic protein. Regulatable transcriptional activators

[0360] The or each nucleic acid sequence encoding a Rep protein is under the control of a second regulatable promoter or regulatable transcriptional activator. In one embodiment of any aspect, the second regulatable promoter operably linked to the or each nucleic acid encoding a Rep protein or each Rep protein comprises a binding site for the regulatable transcriptional activator.

[0361] Exemplary transcriptional activators include homeodomain transcriptional activators, zinc finger transcriptional activators, winged-helix (forkhead) transcriptional activators, leucine zipper transcriptional activators, and helix-loop-helix transcriptional activators. In one embodiment, the regulatable transcriptional activator is a zinc finger transcriptional activator (ZF-TA). In one embodiment of any aspect, the second regulatable promoter comprises a binding site for a zinc finger transcriptional activator (ZF-TA).

[0362] In one embodiment of any aspect, the zinc finger transcriptional activator (ZF-TA) is expressed from a nucleic acid construct encoding the zinc finger (ZF) transcriptional activator operably linked to an inducible promoter, optionally an E4-responsive promoter, or an E2-responsive promoter or other helper gene-responsive promoter.

[0363] In one embodiment of any aspect, the second regulatable promoter operably linked to the or each nucleic acid encoding the or each Rep protein comprises a binding site for a zinc finger (ZF) transcriptional activator.

[0364] In one embodiment of any aspect, the zinc finger transcriptional activator (ZF-TA) is encoded by the following nucleic acid sequence: [ka] [ka]

[0365] In one embodiment, the inducible promoter is an E4-responsive promoter, or an E2- or other helper gene-responsive promoter.

[0366] In one embodiment, the binding site for a zinc finger transcriptional activator (ZF-TA) binding site comprises the following nucleic acid sequence: [ka]

[0367] In one embodiment, the second regulatable promoter comprising a ZF-TA binding site operably linked to the or each nucleic acid encoding a Rep protein or each Rep protein comprises the following nucleic acid sequence (ZF-TA binding sites are shown in bold): [ka] [ka]

[0368] Regulatable promoter At least one of the regulatable promoters is an inducible promoter. An inducible promoter can be a promoter that is induced by the presence of an inducer, the absence of a repressor, or any other suitable physical or chemical condition that induces transcription from an inducible promoter. Terms such as "inducer", "induction condition" and the like should be understood accordingly.

[0369] By way of non-limiting example, inducible promoters for use in embodiments of the present invention may be forskolin-inducible promoters, hypoxia-inducible promoters, small molecule-inducible promoters, tetracycline-regulated (e.g., inducible or repressible) promoters, alcohol-inducible promoters, steroid-inducible promoters, mifepristone (RU486)-inducible promoters, ecdysone-inducible promoters, rapamycin-inducible promoters, metallothionein-inducible promoters, hormone-inducible promoters, cumate-inducible promoters, temperature-inducible promoters, pH-inducible promoters, and metal-inducible promoters. In one embodiment, the inducible promoter for use in embodiments of the present invention is a forskolin-inducible promoter or a hypoxia-inducible promoter.

[0370] As will be further discussed below, various suitable inducible promoters have been described in the art, and others are discussed herein. Those skilled in the art will be able to select one or more suitable inducible promoters for use in various embodiments of the present invention. Furthermore, those skilled in the art will be able to induce expression from the promoters as needed based on the teachings of this specification or the teachings existing in the prior art.

[0371] Regulatable introns

[0372] In some embodiments, the present invention may utilize at least one regulatable intron. The at least one regulatable intron may be operable to control the expression of one or more proteins. The at least one regulatable intron may be used alone or in combination with one or more regulatable promoters described herein.

[0373] Suitably, the regulatable intron controls expression at the translational stage.By combining a regulatable promoter, such as an inducible promoter, with the regulatable intron of the present invention, it is possible to achieve dual-level expression, i.e., control at both the transcriptional and translational levels.This allows for very strict control of gene expression, and can, for example, avoid any expression "leakage", i.e., expression in unintended locations, such as tissues or organs.

[0374] In one embodiment, the regulatable intron is an intron that contains an excisable sequence that can be spliced ​​from the transcript produced from the nucleic acid sequence via the intracellular unfolded protein response (UPR) system, thereby resulting in a transcript encoding a functional protein. The unfolded protein response (UPR) to unfolded protein stress is a cellular coping mechanism that is highly conserved across all eukaryotes.

[0375] In one embodiment, a nucleic acid construct of the invention may comprise a sequence encoding a regulatable intron, suitably a nucleic acid sequence encoding a regulatable intron. In one embodiment, a nucleic acid sequence of the invention encoding a protein may comprise a sequence encoding a regulatable intron. In one embodiment, a nucleic acid construct of the invention may comprise a nucleic acid sequence encoding a protein, wherein the nucleic acid sequence encoding the protein comprises a sequence encoding a regulatable intron.

[0376] The nucleic acid sequence encoding a regulatable intron can be present in any nucleic acid sequence encoding any protein described herein.In one embodiment, the nucleic acid sequence encoding any of the E4 protein, E2A protein, Rep protein, and Cap protein can contain a sequence encoding a regulatable intron.In one embodiment, the nucleic acid sequence encoding a Rep protein can contain a sequence encoding a regulatable intron.In one embodiment, a nucleic acid sequence encoding a Rep protein is provided, and the nucleic acid sequence encoding the Rep protein contains a sequence encoding a regulatable intron.

[0377] In one embodiment, the cell of the present invention may comprise a nucleic acid sequence or nucleic acid construct comprising a sequence encoding a regulatable intron, as described above, hi one embodiment, the cell is a stable cell as described herein.

[0378] In one embodiment, a method for producing viral particles of the present invention may include providing and culturing cells containing a nucleic acid sequence or nucleic acid construct comprising a sequence encoding the regulatable intron. In one embodiment, the method further includes treating the cells to induce UPR, thereby inducing splicing of the excisable sequence from the regulatable intron. In one embodiment, treating the cells to induce UPR includes applying stress to the cells. For example, by administering to the cells chemical agents such as forskolin, dithiothreitol (DTT), tunicamycin, thapsigargin, saturated fatty acids, or agents capable of downregulating stearoyl-CoA desaturase enzyme activity, or by applying hypoxia, carbohydrate deprivation, or the like to the cells.

[0379] Advantageously, an unspliced ​​transcript produced from a protein-encoding nucleic acid sequence encodes a truncated or otherwise defective form of the protein as a result of the presence of the regulatable intron, but once the transcript is processed by the UPR machinery in the cell, the excisable sequence of the intron can be spliced ​​out and a functional protein can be produced from the transcript. Thus, splicing from the regulatable intron results in a functional mRNA that encodes a functional protein expression product.

[0380] In one embodiment, the regulatable intron can be spliced ​​by an IRE1 protein or its homolog or ortholog already present in the cell (homologs or orthologs of IRE1 are present in all eukaryotes, including fungi, plants and mammals).

[0381] In some embodiments, the regulatable intron is an XBP1 intron, a Hac1 intron, a bZIP60 intron, or a homolog thereof, meaning that the intron can be the wild-type form of an XBP1, Hac1, or bZIP60 intron, or a naturally occurring homolog thereof.

[0382] In one embodiment, the regulatable intron comprises the sequence CNG / CNG-Xn-CNG / CNG, where Xn represents a sequence of n bases in length, / represents a cleavage site, and the sequence CNG-Xn-CNG is excised from the transcript. Thus, in other words, the regulatable intron suitably comprises a central sequence (Xn) flanked by two splice site target sequences, each having the sequence CNG / CNG, where / represents a cleavage site.

[0383] CNG / CNG is a consensus splice site sequence that is targeted in a highly conserved manner by the UPR system in eukaryotic cells. As known in the art, this splice site consensus sequence is targeted by the IRE1 protein (whose homologs or orthologs exist in all eukaryotes, including fungi, plants, and mammals) when the UPR response is induced.

[0384] In various embodiments, the regulatory intron or Xn may be 10 to 500 nucleotides in length, 15 to 350 nucleotides in length, 15 to 100 nucleotides in length, 15 to 35 nucleotides in length, or 20 to 25 nucleotides in length. Thus, the excisable sequence of the regulatory intron suitably has a length of 16 to 506 nucleotides in length, 21 to 356 nucleotides in length, 21 to 106 nucleotides in length, 21 to 41 nucleotides in length, or 26 to 31 nucleotides in length.

[0385] There is considerable flexibility regarding the particular sequence of Xn: examples are described below, but many other variants could certainly be used, provided that the regulatable intron remains functional, i.e., is spliced ​​out of the transcript by the UPR system at the appropriate level.

[0386] In some embodiments, the regulatable intron comprises the sequence CNG / CNG-Xn-CNG / CNG[CG] (SEQ ID NO: 50), where Xn represents a sequence of length n nucleotides, / represents a cleavage site such that upon splicing, the excisable sequence CNG-Xn-CNG (SEQ ID NO: 51) is excised from the transcript, and the 5'-terminal nucleotide of sequence Xn is C or G.

[0387] In some embodiments, Xn comprises or consists of the sequence CACUCAGACUACGUGCACCU (SEQ ID NO: 52) or a sequence at least 60% identical thereto, at least 70% identical thereto, at least 80% identical thereto, at least 90% identical thereto, at least 95%, 96%, 97%, 98% or 99% identical thereto.

[0388] In some embodiments, Xn comprises or consists of one of the following sequences:

[0389] CACUCAGACUACGUGCACCU (SEQ ID NO: 53);

[0390] CACUCAGACUACGUGCUCCU (SEQ ID NO: 54);

[0391] CACUCAGACUACGUGCCCCU (SEQ ID NO: 55);

[0392] CACUCAGACUACGUGCGCCU (SEQ ID NO: 56); and

[0393] CACUCAGACUAUGUGCACCU (SEQ ID NO: 57);

[0394] In other embodiments, Xn comprises or consists of the sequence ACGGGCAACUUUACACGACG (SEQ ID NO: 58), or a sequence at least 60% identical thereto, at least 70% identical thereto, at least 80% identical thereto, at least 90% identical thereto, at least 95%, 96%, 97%, 98% or 99% identical thereto.

[0395] In one embodiment, the regulatable intron is the sequence CNG / CNGCACUCAGACUACGUGCACCUCNG / CNGC (SEQ ID NO: 59) or at least 60% identical thereto, at least 70% identical thereto or consisting of a sequence identical to, at least 80% identical to, at least 90% identical to, at least 95%, 96%, 97%, 98%, or 99% identical to, wherein / represents the cleavage site. In variant sequences with the above sequence identity levels, the splice site target sequence may remain CNG / CNGC, with sequence variation occurring in other regions.

[0396] In one embodiment, the regulatable intron is at least 60% identical to the sequence CAG / CAGCACUCAGACUACGUGCACCUCUG / CUGC (SEQ ID NO: 60), or at least 70% identical thereto. The splice site target sequence may remain CAG / CUGC, with sequence variation occurring in other regions.

[0397] In some embodiments, the regulatable intron comprises or consists of one of the following sequences:

[0398] CNG / CAGCACUCAGACUACGUGCACCUCUG / CNG (SEQ ID NO: 61);

[0399] CNG / CAGCACUCAGACUACGUGCUCCUCUG / CNG (SEQ ID NO: 62);

[0400] CNG / CAGCACUCAGACUACGUGCCCCUCUG / CNG (SEQ ID NO: 63);

[0401] CNG / CAGCACUCAGACUACGUGCGCCUCUG / CNG (SEQ ID NO: 64); and

[0402] CNG / CAGCACUCAGACUAUGUGCACCUCUG / CNG (SEQ ID NO: 65).

[0403] In other embodiments, the regulatable intron comprises or consists of one of the following sequences:

[0404] CAG / CAGCACUCAGACUACGUGCACCUCUG / CUGC (SEQ ID NO: 66);

[0405] CAG / CAGCACUCAGACUACGUGCUCCUCUG / CUGC (SEQ ID NO: 67);

[0406] CAG / CAGCACUCAGACUACGUGCCCCUCUG / CUGC (SEQ ID NO: 68);

[0407] CAG / CAGCACUCAGACUACGUGCGCCUCUG / CUGC (SEQ ID NO: 69); and

[0408] CAG / CAGCACUCAGACUAUGUGCACCUCUG / CUGC (SEQ ID NO: 70).

[0409] In another embodiment, the regulatable intron has the sequence CAG / CUGCAGCACUCAGACUACGUGCACCUCUG / CAG (SEQ ID NO: 71) or CAG / CUGCAGCACUCAGACUACGUGCACCUCUG / CUGG (SEQ ID NO: 72) ), where / represents the cleavage site. This sequence results from the addition of the trinucleotide CUG to the mammalian XBP1 intron sequence. The addition of this trinucleotide is thought to slightly deoptimize intron splicing, reducing unwanted splicing (and therefore background expression of the expression product) in cells.

[0410] Thus, in some embodiments, Xn is CAGCACUCAGACUACGUGCACCU (SEQ ID NO: 73).

[0411] In another embodiment, the regulatable intron comprises the following sequence: CNG / CAGACGGGCAACUUUACACGACGCUG / CNG (SEQ ID NO: 74), or a sequence at least 60% identical thereto, at least 70% identical thereto, at least 80% identical thereto, at least 90% identical thereto, at least 95%, 96%, 97%, 98%, or 99% identical thereto, where / represents the cleavage site. In variant sequences with the above sequence identity levels, the splice site target sequence may remain CNG / CNG, with sequence variation occurring in other regions.

[0412] In some embodiments, a splice site target sequence in a transcript (i.e., comprising the sequence CNG / CNG) may be flanked by sequences that can interact to form a stem-loop structure. Thus, the splice site target sequence is preferably flanked by sequences that are complementary to each other, such that the complementary sequences hybridize to each other to form a stem-loop structure in which the splice site target sequence is located at least partially or completely within the loop region of the stem-loop structure formed in the transcript.

[0413] In certain embodiments, when a stem-loop structure is formed, the stem-loop structure formed by the transcript preferably comprises a loop containing 6 to 9 nucleotides and a stem that is 3 to 10 nucleotides in length. In some embodiments, the stem-loop structure comprises a loop containing 7 to 8 nucleotides and a stem that is 4 to 8 nucleotides in length.

[0414] In certain embodiments in which a stem-loop structure is formed, the intron may suitably include a sequence at the splice target site as follows: -Yn-CNG / CNG-A-Zn- wherein A is a sequence having a length of 0 to 3 nucleotides, in some embodiments 1 or 2 nucleotides; / represents the cleavage site, Yn and Zn represent sequences that are complementary in nucleotide sequence when read in opposite directions and can therefore hybridize to form the stem of a stem-loop structure. Yn and Zn are preferably 3-10 nucleotides in length, and in some embodiments 4-8 nucleotides in length.

[0415] In some embodiments, the intron may suitably include a sequence at the splice target site as follows: -Zn-CNG / CNG[CG]-A-Yn-, wherein the components have the same meanings as above. In this case, A is , preferably having a length of 0, 1 or 2 nucleotides.

[0416] It will be apparent that providing the appropriate complementary sequences (e.g., Yn and Zn in the above structure) to provide the stem structure can be achieved by adapting the sequence of the intron to provide appropriate regions complementary to corresponding sequences in the adjacent coding (i.e., exon) sequence.

[0417] Further information regarding regulatable introns that may be used in the present invention can be found in PCT / GB2018 / 052387, which is incorporated herein by reference.

[0418] Hypoxia-inducible promoter:

[0419] In some embodiments, the hypoxia-inducible promoter is a synthetic hypoxia-inducible promoter. In some embodiments, the synthetic hypoxia-inducible promoter comprises at least one hypoxia-responsive element (HRE) that can be bound and activated by hypoxia-inducible factor (HIF).

[0420] HIFs are a family of transcription factors activated by a decrease in intracellular oxygen levels. Under normal oxygen conditions, HIFs are degraded after hydroxylation. Hypoxic conditions stabilize HIFs and prevent their degradation. This allows HIFs to translocate to the nucleus, bind to HREs, and activate HRE-responsive genes.

[0421] Hypoxia-inducible promoters typically comprise HRE that can be bound and activated by HIF, which is operably linked to a minimal promoter.However, in some cases, HRE that can be bound and activated by HIF is operably linked to a promoter other than a minimal promoter (for example, a proximal promoter, such as a tissue-specific proximal promoter).The specific promoter associated with HRE can be selected depending on the situation, but typically, a minimal promoter is preferred, especially when it is desired to minimize background expression level.

[0422] HREs generally consist of a multimer of short conserved sequences called HIF-binding sites (HBSs). As the name suggests, HIF binds to the HBSs, which then activate the HRE and drive transcription. Thus, the HREs of the present invention contain multiple HBSs, preferably three or more, more preferably three to ten, more preferably three to eight, and more preferably four to eight. In some preferred embodiments of the present invention, the HREs contain five, six, or eight HBSs.

[0423] The core consensus sequence of HBS has been determined. (SEQ ID NO: 75, where N represents any nucleotide). With the indication that A or G are optimal at position 1, a generally preferred consensus sequence is [AG]CGTG (SEQ ID NO: 76). Note that HBS is functional when present on either strand of double-stranded DNA (i.e., in either orientation). Thus, for example, HBS can be represented by the reverse complement consensus sequence CACG[CT] (SEQ ID NO: 77) in one strand, which indicates the presence of the sequence [AG]CGTG (SEQ ID NO: 76) on the corresponding complementary strand (in such a case, HBS can be described as being "inverted" or "opposite").

[0424] Each HBS contained in the HRE preferably has the consensus sequence NCGTG (SEQ ID NO: 7 5), and optionally the consensus sequence [AG]CGTG (SEQ ID NO: 76). Additional sequences adjacent to the consensus sequence may be present, which may have some effect on the affinity of HIF for HBS. Preferred HBSs for some embodiments of the present invention are discussed below.

[0425] Adjacent HBSs are typically, but not always, separated by a spacer sequence. The spacing between HBSs in an HRE can significantly affect the inducibility and / or overall power of a promoter. In some cases, it may be desirable to optimize the spacing between adjacent HBSs to maximize the inducibility and power of the promoter. In other cases, it may be desirable to use suboptimal spacing to provide a promoter with lower inducibility and / or overall power. Specific spacing between HBSs present in preferred embodiments of the present invention is discussed below. However, in general, the spacing between adjacent core consensus sequences in adjacent HBSs is typically preferred to be 3 to 50 nucleotides. To contribute to high-level expression, the spacing between core consensus sequences in adjacent HBSs is typically preferred to be 7 to 25 nucleotides, preferably about 8 to 22 nucleotides. For intermediate-level expression, the spacing between core consensus sequences in adjacent HBSs is typically preferred to be 5 to 6 nucleotides or 26 to 32 nucleotides. For low-level expression, the spacing between core consensus sequences in adjacent HBSs is typically preferred to be 2 to 4 nucleotides or 33 to 50 nucleotides. It will be appreciated that there is scope to vary the spacing between adjacent HBSs and thereby adjust the properties of the HRE.

[0426] The HRE is typically spaced from the promoter (e.g., a minimal promoter), but this is not required. The spacing can affect the inducibility and / or overall power of the promoter. In general, the spacing between the core consensus sequence in the final HBS (i.e., the one closest to the minimal promoter) and the TATA box of the minimal promoter (or an equivalent sequence if no TATA box is present) is preferably 0 to 200 nucleotides, more preferably 10 to 100 nucleotides, even more preferably 20 to 70 nucleotides, even more preferably 20 to 50 nucleotides, and even more preferably 20 to 30 nucleotides. To contribute to high levels of expression, the spacing between the final HBS and the TATA box of the minimal promoter (or an equivalent sequence if no TATA box is present) is typically preferably 20 to 30 nucleotides; spacings significantly greater or less than this result in weaker expression levels. It will be appreciated that there is scope for varying the spacing between the final HBS and the HRE, thereby adjusting the properties of the HRE.

[0427] In some embodiments, the HRE that can be bound and activated by HIF comprises at least one HBS that comprises or consists of the HRE1 sequence. The HRE1 HBS sequence is ACGTGC (SEQ ID NO: 78). Of course, HRE1 can be present on either strand of nucleic acid, and therefore, in such cases, the reverse HRE1 is represented by the presence of the reverse complementary sequence GCACGT (SEQ ID NO: 79).

[0428] In some embodiments, all HBSs present in an HRE comprise or consist of an HRE1 sequence. Each HRE1 sequence present in an HRE can be independently present in any orientation. In some embodiments, it is preferred that all HRE1 sequences present in an HRE are in the same orientation.

[0429] In some embodiments, the HRE that can be bound and activated by HIF comprises at least one HBS that comprises or consists of the HRE2 sequence. The sequence of HRE2 is CTGCACGTA (SEQ ID NO: 80). In HRE2, the HBS is When HRE1 is present in the reverse orientation, the HRE2 sequence contains the reverse complement of the HRE1 sequence. HRE2 may be present on either strand of the nucleic acid, and thus, in such cases, the reverse HRE2 may be indicated by the presence of the reverse complement sequence TACGTGCAG (SEQ ID NO: 81).

[0430] The HRE2 sequence is thought to be an optimized HBS that contains additional flanking sequences and binds more strongly to HIF than HRE1. Therefore, when high levels of promoter inducibility and power are desired, HRE2 may be preferred over HRE1.

[0431] In some embodiments, all HBSs present in an HRE comprise or consist of an HRE2 sequence. Since the HRE2 sequence effectively comprises an HRE1 sequence, it will be apparent that when an HRE2 is provided, an HRE1 is also necessarily present. Each HRE2 sequence present in an HRE can be independently present in either orientation. In some embodiments, it is preferred that all HRE2 sequences present in an HRE are in the same orientation.

[0432] In some embodiments, an HRE capable of being bound and activated by HIF comprises at least one HBS that comprises or consists of an HRE3 sequence or a functional variant thereof.

[0433] The HRE3 sequence is [ka] (SEQ ID NO: 82, HBSs are underlined). HRE3 represents a composite HBS comprising two individual HBSs (i.e., binding sites for HIF, underlined) separated by a spacer and with an additional spacer at each end. It can be seen that HRE3 comprises one HBS in each orientation (one comprising HRE1 and one comprising HRE2, with the HRE1 sequence located 5' to the HRE2 sequence). Given that each HRE3 sequence comprises two individual HBSs, for purposes of the present invention, each HRE3 sequence or a functional variant thereof contributes two individual HBSs to the total number of HBSs present in the HRE.

[0434] HRE3 or a functional variant thereof may be present on either strand of the nucleic acid, and thus in such cases the reverse orientation of HRE3 may be indicated by the presence of the reverse complementary sequence CATACGTGCAGAGACGCACGTACTCAAGGT (SEQ ID NO: 83).

[0435] As mentioned above, functional variants of HRE3 also form the embodiment of the present invention.Such variants are functional as long as they retain the ability to bind and activate HIF.Preferred functional variants of HRE3 retain the same HBS as HRE3 at substantially the same position and orientation, but contain different spacer sequences.Therefore, in some preferred embodiments, the functional variants of HRE3 suitably have the following sequence: S1-ACGTG-S2-CTGCACGTA-S3 (SEQ ID NO: 84); In the formula, S1 is a spacer having a length of 8 to 10, preferably 9; In the formula, S2 is a spacer having a length of 4 to 6, preferably 5; In the formula, S3 is a spacer having a length of 1 to 3, preferably 2.

[0436] In some embodiments of the invention, a functional variant of HRE3 comprises the sequence NNNNNNNNNACGTGNNNNNCTGCACGTANN (SEQ ID NO: 85).

[0437] In some embodiments, a functional variant of HRE3 has an overall sequence identity to HRE3 that is at least 80%, preferably at least 90%, more preferably at least 95% identical to HRE3, and the HBS sequence is completely identical to HRE3.

[0438] HRE3 is thought to be a particularly optimal sequence for strong binding to HIF. Therefore, if high levels of rapid inducibility and potency are desired, the presence of HRE3 or a functional variant thereof that maintains similar properties may be preferred.

[0439] In some embodiments, all HBSs present in the HRE comprise or consist of an HRE3 sequence or a functional variant thereof. The HRE3 sequence or a functional variant thereof present in the HRE can be independently present in any orientation. In some embodiments, it is preferred that all HRE3 sequences or functional variants thereof present in the HRE are in the same orientation.

[0440] In some embodiments, the HRE may include a combination of two or more of HRE1, HRE2 and / or HRE3.

[0441] In some embodiments, the HRE that can be bound and activated by HIF suitably comprises the following sequence: [ACGTGC-S] n - ACGTGC (SEQ ID NO: 86); In the formula, S is a spacer, and n is 2 to 9, preferably 3 to 7. Note that the sequence of the spacer can vary. That is, each repeating unit [ACGTGC-S] n (Sequence number The spacers in 87) may or may not have the same sequence or length.

[0442] The length of the spacer can be varied depending on the desired inducibility and power of the promoter.

[0443] Thus, in embodiments where it is desirable to maximize the inducibility and power of a promoter, spacers are provided such that the spacing between the core consensus sequences in adjacent HBSs is 7 to 18 nucleotides, preferably about 8 to 12 nucleotides, and more preferably about 10 nucleotides. While maximizing the inducibility and power of a promoter is often desirable, in some cases lower levels of inducibility and power may be desirable. In embodiments where a somewhat lower level of inducibility and power is desired, spacers can be provided such that adjacent HBSs are spaced a smaller or larger amount apart, e.g., 4 to 6 nucleotides or 19 to 50 nucleotides apart. The HRE1 HBS contains one nucleotide adjacent to the core consensus sequence (underlined -ACGTG). C , SEQ ID NO: 78), it will therefore be apparent that the spacers in these embodiments will take this into account to provide the desired spacing.

[0444] In some embodiments, the HRE that can be bound and activated by HIF suitably comprises the following sequence: ACGTGC-S-ACGTGC-S-ACGTGC-S-ACGTGC-S-ACGTGC (SEQ ID NO: 88) In the formula, S is a spacer.

[0445] Suitable lengths of spacers are described above. In some embodiments of the invention, the spacers each have a length of 30-50 nucleotides. In such cases, an exemplary, but non-limiting, spacer has the following sequence: GATGATGCGTAGCTAGTAGTGATGATGCGTAGCTAGTAGT (SEQ ID NO: 89);

[0446] In one embodiment, the HRE capable of being bound and activated by HIF suitably comprises the following sequence: [ka] [ka] (SEQ ID NO: 90, HBS underlined), or a functional variant thereof that is at least 80% identical thereto, preferably 85%, 90%, 95% or 99% identical thereto. Typically, in such functional variants, the HRE1 sequence is substantially or completely identical to the reference sequence, with substantially all sequence variation occurring in the spacer sequence, preferably.

[0447] Such HREs generally exhibit very low levels of inducibility and low expression levels when induced. This may be desirable in situations where background expression should be minimized and high levels of expression upon induction are not required. Optimizing the interval between HBSs can naturally result in higher levels of inducibility and expression upon induction.

[0448] In some preferred embodiments, the HRE capable of being bound and activated by HIF suitably comprises the following sequence: [CTGCACGTA-S] n -CTGCACGTA (SEQ ID NO: 91); In the formula, S is an optional spacer, and n is 2 to 9, preferably 3 to 7.

[0449] Note that the sequence of the spacer, if present, can vary. i.e., each repeat unit [CTGCACGTA-S] n The spacers in (SEQ ID NO: 92) may or may not have the same sequence or length.

[0450] Details of suitable spacing between core consensus sequences in adjacent HBSs are described above for the preceding embodiments, and these considerations apply equally to these embodiments. The HRE2 HBS comprises four nucleotides adjacent to the core consensus sequence (underlined - [ka] SEQ ID NO: 80), therefore, it will be apparent that the spacer in these embodiments will take this into account to provide the desired spacing.

[0451] In some embodiments of the invention, the HRE capable of being bound and activated by HIF suitably comprises the following sequence:

[0452] CTGCACGTA-S-CTGCACGTA-S-CTGCACGTA-S-CTGCACGTA-S-CTGCACGTA-S-CTGCACGTA(Sequence number No. 93); where S is a spacer. Suitable lengths of the spacer are described above.

[0453] In some embodiments of the invention, the spacers each have a length of 20 nucleotides. In such cases, an exemplary, but non-limiting, spacer has the following sequence: GATGATGCGTAGCTAGTAGT (SEQ ID NO: 94);

[0454] In one embodiment of the invention, the HRE capable of being bound and activated by HIF suitably comprises the following sequence:

[0455] [ka] (SEQ ID NO: 95, HBS underlined) or a functional variant comprising a sequence at least 80% identical thereto, preferably 85%, 90%, 95% or 99% identical thereto. Typically, in such functional variants, the HRE2 sequence is substantially or completely identical to the reference sequence, and it is preferred that substantially all sequence variations occur in the spacer sequence. Such HREs generally exhibit intermediate levels of inducibility and low expression levels when induced. This may be desirable in situations where background expression should be minimized and intermediate levels of expression are required upon induction. Further optimization of the spacing of the HBS may, of course, result in higher levels of inducibility and expression upon induction. Similarly, non-optimization may result in lower levels of inducibility and expression upon induction.

[0456] In some embodiments, the HRE that can be bound and activated by HIF suitably comprises the following sequence: [ka] (SEQ ID NO: 96, HBS underlined), or a functional variant comprising a sequence at least 80% identical thereto, preferably 85%, 90%, 95% or 99% identical thereto.

[0457] This HRE is found to contain no additional spacers between adjacent HRE2 elements, however, when considering the four adjacent nucleotides surrounding the core consensus sequence of HRE2, the core consensus sequence has an effective spacing of four nucleotides.

[0458] Such HRE generally exhibits intermediate level of inducibility and low expression level when induced. This may be desirable in situations where background expression should be minimized and intermediate level of expression is required when induced. Of course, further optimization of the interval between HBSs can result in higher level of inducibility and expression when induced. Similarly, non-optimization can result in lower level of inducibility and expression when induced.

[0459] In some preferred embodiments, the HRE that can be bound and activated by HIF suitably comprises 3 to 6 HRE3 sequences, preferably 3 to 5, preferably 4 HRE3 sequences, or functional variants thereof, wherein adjacent HRE3 sequences or functional variants thereof are separated from each other by a spacer having a length of 4 to 20 nucleotides, preferably 6 to 15 nucleotides, more preferably 9 nucleotides.

[0460] In a preferred embodiment, the HRE capable of being bound and activated by HIF suitably comprises the following sequence: [ACCTTGAGTACGTGCGTCTCTGCACGTATG-S] n -ACCTTGAGTACGTGCGTCTCTGCACGTATG (SEQ ID NO: 97); In the formula, S is an optional spacer, and n is 2 to 5, preferably 2 to 4, and preferably 3.

[0461] Note that the sequence of the spacer, if present, can vary. That is, each repeat unit [ACCTTGAGTACGTGCGTCTCTGCACGTATG-S] n The spacer in (SEQ ID NO: 98) is It will be understood that the above HRE3 sequences may, in some or all cases, be replaced by functional variants thereof, which may or may not have the same sequence or length.

[0462] Details of suitable spacing between core consensus sequences in adjacent HBSs are described above for the preceding embodiments, and these considerations apply equally to these embodiments. The HRE3 complex HBS comprises 11 nucleotides (underlined) flanking the region containing the two core consensus sequences. [ka] SEQ ID NO: 99), and therefore it will be apparent that the spacer in these embodiments will provide the desired spacing with this in mind. In some embodiments, the spacer S suitably has a length of 4 to 20 nucleotides, preferably 7 to 15 nucleotides, more preferably 9 nucleotides.

[0463] In some embodiments of the invention, the HRE capable of being bound and activated by HIF suitably comprises the following sequence:

[0464] [ka] (wherein S is a spacer). Suitable lengths of the spacer are described above. It will be understood that in some or all cases, the HRE3 sequences described herein can be replaced with functional variants thereof.

[0465] In some embodiments, the HRE that can be bound and activated by HIF suitably comprises the following sequence:

[0466] [ka] (wherein S is a spacer). Suitable lengths of the spacer are described above. It will be understood that in some or all cases, the HRE3 sequences described herein can be replaced with functional variants thereof.

[0467] In some embodiments of the invention, the spacers each have a length of 9 nucleotides. In such cases, an exemplary, but non-limiting, spacer has the following sequence: GCGATTAAG (SEQ ID NO: 102).

[0468] In one preferred embodiment of the invention, the HRE capable of being bound and activated by HIF suitably comprises the following sequence:

[0469] [ka] (SEQ ID NO: 103, HBS underlined), or a functional variant comprising a sequence at least 80% identical thereto, preferably 85%, 90%, 95% or 99% identical thereto. Typically, in such functional variants, the HRE1 and HRE2 sequences present in the HRE3 sequence are substantially or completely identical to the reference sequence, and it is preferred that substantially all sequence variation occurs in the spacer sequence.

[0470] Such HREs generally exhibit high levels of inducibility and high expression levels when induced. This may be desirable in situations where high levels of expression are required when induced. Further optimization of the HBS interval can potentially result in higher levels of inducibility and expression when induced. Similarly, non-optimization can result in lower levels of inducibility and expression when induced.

[0471] As described above, hypoxia-inducible promoters typically include an HRE that can be bound and activated by HIF, operably linked to a minimal or proximal promoter. Preferably, the promoter operably linked to the HRE is a minimal promoter.

[0472] The minimal promoter can be any suitable minimal promoter. A wide range of minimal promoters are known in the art. Suitable minimal promoters include, but are not limited to, the CMV minimal promoter (CMV-MP), the YB-TATA minimal promoter (YB-TABA), the HSV thymidine kinase minimal promoter (MinTK), and the SV40 minimal promoter (SV40-MP). The minimal promoter can be a synthetic minimal promoter. Particularly preferred minimal promoters are the CMV minimal promoter (CMV-MP) and the YB-TATA minimal promoter (YB-TABA).

[0473] The sequence of CMV-MP is as follows: AGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTAGATACGCCATCCACCGCTGTTTTGACCTCCATAGAAGATCGCCACC (SEQ ID NO: 104).

[0474] The sequence of YB-TATA is as follows: TCTAGAGGGTATATAATGGGGGCCA (SEQ ID NO: 105).

[0475] However, in some preferred embodiments of the invention, a longer sequence comprising YB-TATA MP is used. The sequence of this longer sequence of YB-TATA MP (referred to herein as longYB-TATA) is GCGATTAATCCATATGCTCTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 106). Thus, whenever YB-TATA is provided herein as a component of an inducible promoter, substantially equivalent sequences in which longYB-TATA is substituted for YB-TATA are also considered to be embodiments of the invention, with the spacing between the last HBS and the TATA box of the MP preferably being retained.

[0476] The sequence of MinTK is: TTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAA (SEQ ID NO: 10 7).

[0477] The sequence of SV40-MP is as follows: [ka]

[0478] The sequence of MP1 is as follows: [ka]

[0479] Therefore, a preferred embodiment comprises an HRE that can be bound and activated by HIF, operably linked to one of the above-mentioned minimal promoters, more preferably CMV-MP or YB-TATA, most preferably CMV-MP.When combined with the HRE of the present invention, CMV-MP has been shown to provide extremely high levels of inducibility and high promoter strength.Low background expression levels have also been observed.

[0480] The HRE is preferably separated from the minimal promoter (or other type of promoter, if used) by a spacer sequence. The spacing between the HRE and the minimal promoter can affect the inducibility and power of the hypoxia-inducible promoter. Generally, the spacing between the core consensus sequence in the last HBS (i.e., the one closest to the minimal promoter) and the TATA box of the minimal promoter (or an equivalent sequence if no TATA box is present) is preferably 10 to 100 nucleotides, more preferably 20 to 70 nucleotides, even more preferably 20 to 50 nucleotides, and even more preferably 20 to 30 nucleotides. In embodiments where optimizing the inducibility and power of the hypoxia-inducible promoter is desired, the spacing between the last HBS and the TATA box of the minimal promoter (or an equivalent sequence if no TATA box is present) is preferably 20 to 30 nucleotides. In embodiments where a slightly lower level of inducibility and power is desired, the spacing between the last HBS and the TATA box (or an equivalent sequence if no TATA box is present) may be smaller or larger, e.g., 0 to 10 nucleotides or 31 to 100 nucleotides. While it is often desirable to maximize the inducibility and power of a promoter, in some cases lower levels of inducibility and power may be desirable.

[0481] In exemplary, non-limiting embodiments, the hypoxia-inducible promoter comprises one of the following sequences (the HBS sequence is underlined and the minimal promoter sequence is shown in bold): [ka] [ka] (Synp-RTV-015; SEQ ID NO: 1), or a functional variant comprising a sequence at least 80% identical thereto, preferably 85%, 90%, 95% or 99% identical thereto; and [ka] (Synp-HYP-001, SEQ ID NO: 3) or a functional variant comprising a sequence at least 80% identical thereto, preferably 85%, 90%, 95% or 99% identical thereto;

[0482] Typically, in such functional variants, the HRE1, HRE2 and MP sequences are substantially identical to the reference sequence, with substantially all sequence variation occurring in the spacer sequence.

[0483] In some preferred embodiments, upon induction by hypoxia of the cells (e.g., after exposing the cells to 5% oxygen for 5 hours and previously being normoxia (e.g., 20% oxygen)), the expression level of the transgene increases by at least 5-fold, more preferably 10-fold, 15-fold, 20-fold, 30-fold or 50-fold.

[0484] In some preferred embodiments, upon induction (e.g., after exposing cells to 5% oxygen for 5 hours and previously in normoxia (e.g., 20% oxygen)), the expression level of the transgene is at least 50% of the expression level provided by the CMV-IE promoter (i.e., an otherwise identical vector in the same cells under the same conditions, but where expression of the transgene is under the control of a CMV-IE rather than a hypoxia-inducible promoter). More preferably, the expression level of the transgene is at least 75%, 100%, 150%, 200%, 300%, 400%, or 500% of the expression level provided by the CMV-IE promoter.

[0485] Other naturally occurring hypoxia-inducible promoters are described in US20110158947A1, which is incorporated herein by reference. Thus, in some embodiments, the hypoxia-inducible promoter is an adenosine A2B receptor (A2BR) promoter, a plasminogen activator receptor (uPAR) VEGF receptor (VEGFR1 and VEGFR2) promoter, a platelet-derived endothelial growth factor / thymidine phosphorylase (PDECGF / TP) promoter, a nitric oxide synthase (NOS) promoter, a phosphoglycerate kinase-1 (PGK-1) promoter, a pyruvate kinase M (PK-M) promoter, a glucose transporter 1 (GLUT 1) promoter, hypoxia-inducible factor 1 (HIF-1) promoter, early growth response 1 (Egr-1) promoter, nuclear factor kB (NFkB) promoter, hepatocyte growth factor activator (HGFA) promoter, vascular endothelial growth factor (VEGF) promoter, CXCL8 promoter, CCL11 promoter, transforming growth factor-β (TGF-β) promoter, procollagen promoter, integrin-linked kinase (ILK) promoter, K1PDC1 promoter, erythropoietin (EPO) promoter, serine / threonine kinase-15 (STK15) promoter, histone demethylase Jumonji domain-containing 1A (JMJD1A) promoter, endothelin-2 (EDN2) promoter, choline kinase (Chk) promoter, sphingosine kinase 1 promoter, carcinoembryonic antigen (CEA, ceacam5) promoter, monocyte chemoattractant protein-1 (MCP-1 / CCL2) promoter, MCP-5 (Ccl1 2) The promoter may be selected from the group consisting of a prostate-specific antigen (PSA) promoter, a c-Met promoter, a matrix metalloproteinase class III beta-tubulin (TUBB3) promoter, a glutamine:fructose-6-phosphate amidotransferase (GFAT) promoter, a protein phosphatase 1 nuclear-targeting subunit beta-secretase (BACE1) promoter, and a plasminogen activator inhibitor-1 (PAI-1) promoter.

[0486] Other naturally occurring hypoxia-inducible promoters are described in WO 2016 / 146819, which is incorporated herein by reference. See, e.g., Table 4.

[0487] Hypoxia-responsive elements are described in L. Marignol, M. Lawler, M. Coffey & D. Hollywood (2005) Achieving hypoxia-inducible gene expression in tumors, Cancer Biology & Therapy, 4:4, 365-370; US 6218179; Madan et al., PNAS 90:3928, 1993; JP2005095173A, US 2006 / 0099709; and WO1999 / 048916. A mouse hypoxia-responsive element is disclosed in US Patent No. 5,942,434.

[0488] Induction of a hypoxia-inducible promoter can be achieved by subjecting the cells to hypoxic conditions, i.e., treating the cell population to induce hypoxia in the cells, so that expression from a transgene linked to the hypoxia-inducible promoter is induced and an expression product is produced. Appropriate approaches will be apparent to those skilled in the art for any particular cell type. Generally, eukaryotic cells are cultured under aerobic conditions, and many approaches for achieving this for various cell and culture types are known in the art. Hypoxic conditions can be achieved by reducing the amount of oxygen supplied to the cells. For example, cells can be grown under normoxic conditions (e.g., about 20% oxygen) before switching to a gas mixture containing less or no oxygen to induce hypoxia. For example, a gas containing 5% oxygen can be used to induce hypoxia in cells. An exemplary suitable gas mixture for use in inducing hypoxic conditions in cell culture is 5% oxygen, 10% carbon dioxide, and 85% nitrogen, although other gas mixtures can be used. In another approach, hypoxia in cell culture can be induced by introducing an agent capable of inducing hypoxia in cells. For example, CoCl2 can be used at an appropriate concentration to induce hypoxia, e.g., at a final concentration of about 100 μM in cell culture medium. Generally, in the present invention, it is preferred that hypoxia be achieved without the addition of such agents, as they add cost, and in many cases, agents are undesirable and can be difficult to remove.

[0489] In some cases, it may be desirable to vary the amount of oxygen supplied to the cells while they are in hypoxic conditions to optimize or otherwise regulate the expression of a desired expression product. For example, it may be desirable to initially establish highly hypoxic conditions to strongly induce hypoxic conditions, followed by a period of culturing the cells under less hypoxic conditions that are less detrimental to the health and activity of the cells. Thus, the methods disclosed herein may include varying the level of hypoxia to which the cells are subjected.

[0490] Expression from a hypoxia-inducible promoter as discussed herein can be modulated (e.g., uninduced, repressed, or regulated) by changing the level of oxygen to which cells containing the promoter are exposed. For example, hypoxia-induced expression can be switched off (uninduced) by exposing the cells to normoxic conditions (e.g., exposure to 20% oxygen).

[0491] In one embodiment, the synthetic hypoxia-inducible promoter does not comprise or consist of one of the following structures: -HRE2-S 20 -HRE2-S 20 -HRE2-S 20 -HRE2-S 20 -HRE2-S 20 -HRE2-S 59 -CMV-MP; -HRE3-S9-HRE3-S9-HRE3-S9-HRE3-S 17 -YB-TABA-MP; and -HRE3-S9-HRE3-S9-HRE3-S9-HRE3-S 17 -CMV-MP. In the formula, S x represents a spacer of length X nucleotides.

[0492] In one embodiment, the synthetic hypoxia-inducible promoter does not comprise or consist of one of the following sequences: [ka]

[0493] Forskolin-inducible promoter:

[0494] In some embodiments, the inducible promoter is a forskolin-inducible promoter.

[0495] In some embodiments, the forskolin-inducible promoter is a synthetic forskolin-inducible promoter. In some embodiments, the synthetic forskolin-inducible promoter comprises a synthetic forskolin-inducible cis-regulatory element (CRE) that can be bound by CREB and / or AP1.

[0496] In one embodiment, the forskolin responsive enhancer element comprises: [ka] [ka] It has a sequence comprising:

[0497] In the sequence of SEQ ID NO: 107, cAMPRE Underlined text and the AP-3 site is indicated by Bold underlined text The sequences are indicated by a . The spaces between the sites are neutral DNA. As can be seen from this sequence, the novel enhancer element consists of 7-CRE and 6 AP-3 sites with a 5-bp spacer between the elements. This enhancer was combined with the following minimal promoters using a 5-bp spacer between the enhancer and the minimal promoter: YB-Tata (FORNYB-REP), CMV (FORNCMV), CMV53 (FORNCMV53), MinTK (FORNMinTK), MLP (FORNMLP), SV40 (FORNSV40), and pJB42 (FORNJB42). The sequences of the forskolin-responsive enhancer elements combined with the minimal promoters are provided herein, for example, in Example 7.

[0498] The enhancer element was further combined with the minimal promoter TATA-m6A, which has a sequence comprising (SEQ ID NO: 111). [ka]

[0499] SEQ ID NO: 111 is Underlined text The consensus sequence TATA box and Bold underlined text The m6a sequence, highlighted in red, is included. The TATA box is the minimal sequence required to stabilize transcription from enhancers, whereas the m6A sequence is a signal for mRNA methylation. This and other chemical modifications of mRNA (at least 160 of which are known) are thought to create another layer of post-transcriptional control during gene expression. Of these, m6a is the best understood, and studies have shown it is involved in numerous mRNA functions, such as splicing, export, translation, and stability. It has been observed that approximately one-quarter of all eukaryotic mRNAs contain at least one m6a site, making it the most common form of mRNA modification (Han et al., 2020). One such study of m6a methylation showed that placing a methylation sequence at the 5' end of the mRNA, before the ATG, can enhance transcript translation (Meyer et al., 2015). We adapted these findings to add the m6a sequence to our TATA minimal promoter to increase translation efficiency from a very small but weak minimal promoter. This should make it possible to achieve high expression while restoring the overall size of the promoter, generating novel minimal promoters.

[0500] One embodiment provided herein is a synthetic forskolin-inducible promoter comprising a sequence according to SEQ ID NO: 110, or a functional variant thereof.

[0501] In one embodiment, the synthetic forskolin-inducible promoter comprises a sequence at least 60%, 65%, 70%, 75%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:110.

[0502] In one embodiment, a functional variant of a synthetic forskolin-inducible promoter retains at least 25%, 50%, 75%, 80%, 85%, 80%, 95% or 100% of the activity of the reference promoter.

[0503] In one embodiment, the synthetic forskolin-inducible promoter is operably linked to a nucleic acid sequence that drives expression, such as a nucleic acid sequence encoding a toxic gene as described herein. However, the nucleic acid does not have to be a nucleic acid sequence as described herein. Any sequence can be operably linked to the synthetic forskolin-inducible promoter.

[0504] Although the CRE / promoter is referred to as forskolin-inducible, it can also be induced by other agents, as discussed in more detail below. The mechanism of induction by forskolin is via activation of adenylyl cyclase and the resulting increase in intracellular cAMP. Therefore, the CRE / promoter can also be induced by other activators of adenylyl cyclase or factors that increase intracellular cAMP.

[0505] Preferably, the CRE comprises at least two, more preferably at least three, transcription factor binding sites (TFBSs) for CREB and / or AP1 (as used herein, the term "TFBS for X" means a TFBS that can be bound by transcription factor X).

[0506] Preferably, the CRE comprises at least four TFBSs for CREB and / or AP1. Suitably, the CRE comprises 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 TFBSs for CREB and / or AP1.

[0507] Although there is no particular upper limit to the number of TFBS for CREB and / or AP1, it is generally preferred that a CRE contain no more than 15 TFBS for CREB and / or AP1, and optionally no more than 10 TFBS for CREB and / or AP1.

[0508] In some embodiments, the CRE comprises at least one TFBS for each of CREB and AP1. In some embodiments, the CRE comprises at least 2, 3, 4, 5, 6, or 7 TFBS for each of CREB and AP1.

[0509] The TFBS for CREB typically comprises or consists of the highly conserved consensus sequence TGACGTCA (SEQ ID NO: 112). This sequence is known as the cAMP responsive element (or cAMPRE or CRE; to avoid confusion with abbreviations for cis-regulatory elements, the abbreviation cAMPRE is used herein). Other cAMPREs that can be used are described below.

[0510] The TFBS for AP1 typically comprises or consists of the consensus sequence TGA[GC]TCA (SEQ ID NO: 113). In specific examples of the present invention, the sequences TGAGTCA (designated AP1(1), SEQ ID NO: 114), TGACTCAG (designated AP1(2), SEQ ID NO: 115), and TGACTCA (designated AP1(3), SEQ ID NO: 116) were used, and therefore AP1(1), AP1(3), and AP1(2) can be considered preferred TFBS for AP1. The general term AP1 for a TFBS refers to a TFBS comprising the above consensus sequence and encompasses both AP1(1), AP1(3), and AP1(2).

[0511] In some preferred embodiments, the CRE contains at least one TFBS for a transcription factor other than CREB and / or AP1. In some preferred embodiments of the present invention, the CRE contains at least one TFBS for ATF6 and / or hypoxia-inducible factor (HIF). The CRE may contain 2, 3, 4, 5, 6, 7, 8, 9, or 10 TFBS for a transcription factor other than CREB and / or AP1, such as ATF6 and / or HIF. In some embodiments of the present invention, the CRE contains at least one TFBS for each of ATF6 and HIF.

[0512] The TFBS for HIF is the consensus sequence NCGTG (SEQ ID NO: 75), more preferably comprises or consists of [AG]CGTG (SEQ ID NO: 76). This sequence is referred to as a HIF binding sequence (HBS). In a specific example of the present invention, the HBS sequence CTGCACGTA (designated HRE1, SEQ ID NO: 80) was used, and therefore HRE1 can be considered a preferred TFBS for HIF. However, other TFBS for HIF are known and can be used in the present invention, for example [ka] is.

[0513] The TFBS for ATF6 comprises or consists of the consensus sequence TGACGT (SEQ ID NO: 117), more preferably TGACGTG (SEQ ID NO: 118). For ATF6, the TFBS sequence TGACGTGCT (SEQ ID NO: 119) was used, which is the preferred However, in general, any sequence containing the consensus sequence TGACGT (SEQ ID NO: 117), more preferably TGACGTG (SEQ ID NO: 118), may be used. It is possible.

[0514] Each of the above-described TFBSs can exist in either orientation (i.e., they can be functional when present on either strand of double-stranded DNA). It will be apparent, therefore, that any TFBS can be represented by a reverse-complementary consensus sequence in one strand indicating the presence of the TFBS sequence on the corresponding complementary strand (in such cases, the TFBS can be described as "inverted" or "opposite-oriented"). In general, reference to a TFBS, whether by name or by listing the sequence of the TFBS, should be considered to refer to the presence of the TFBS in either orientation. When the sequence of a TFBS is listed, it should be understood that the orientation shown represents the specifically disclosed, typically preferred, embodiment.

[0515] In some embodiments, the CRE is: - 5 TFBS for CREB and 3 TFBS for AP1; - 5 TFBS for CREB and 4 TFBS for AP1; - 8 TFBS for AP1; -3 TFBSs for ATF6, 4 TFBSs for AP1 and 3 TFBSs for HIF; or -7 TFBSs for CREB and 6 TFBSs for AP1; Including, wherein adjacent TFBSs are optionally, but preferably, separated by a spacer sequence.

[0516] The spacer sequence can be of any suitable length. Typically, the spacer is 2 to 100 nucleotides, 5 to 50 nucleotides, 6 to 40 nucleotides, 7 to 30 nucleotides, 8 to 25 nucleotides, or 10 to 20 nucleotides in length. In certain embodiments of the present invention, spacers of 5, 10, or 20 nucleotides in length are used and function well, although spacers of other lengths can also be used. In some embodiments, the spacer is preferably a multiple of 5 nucleotides in length. One of skill in the art can readily determine the appropriate length of the spacer.

[0517] Note that the sequence and length of the spacers can vary. That is, each spacer in the sequence does not need to have the same sequence or length as any other. For convenience, some or all of the spacers between TFBSs in a CRE often have the same sequence and length, which may be preferred, but not required.

[0518] The TFBSs may suitably be in any order, but in preferred embodiments are provided in the order listed, i.e., in the first embodiment of the list above, from upstream to downstream, there are four TFBSs for cAMPRE, followed by three TFBSs for AP1.

[0519] In some embodiments, the CRE is: - 5 TFBS for CREB and 3 TFBS for AP1; - 5 TFBS for CREB and 4 TFBS for AP1; - 8 TFBS for AP1; - 3 TFBSs for ATF6, 4 TFBSs for AP1 and 3 TFBSs for HIF; or -7 TFBS for CREB and 6 TFBS for AP1; It consists of wherein adjacent TFBSs are optionally but preferably separated by a spacer sequence, suitable lengths of which are described above.

[0520] Again, the TFBSs may suitably be in any order, but in preferred embodiments are provided in the order listed.

[0521] In some embodiments, the CRE comprises one of the following structures: -cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1-S-AP1-S-AP1 (CRE containing 5x cAMPRE and 3x AP1 TFBS); -cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1(2)-S-AP1(2)-S-AP1(2)(5x cAMPRE and CRE containing 3x AP1(2) TFBS); -cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1-S-AP1-S-AP1-S-AP1 (CRE containing 5x cAMPRE and 4x AP1 TFBS); -cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1(2)-S-AP1(2)-S-AP1(2)-S-AP1(2)(CRE containing 5x cAMPRE and 4x AP1(2)TFBS); -AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-AP1 (C containing 8x AP1 TFBS) RE); -AP1(1)-S-AP1(1)-S-AP1(1)-S-AP1(1)-S-AP1(1)-S-AP1(1)-S-AP1(1)-S-AP1(1)(8x CRE containing AP1(1) TFBS); -ATF6-S-ATF6-S-ATF6-S-AP1-S-AP1-S-AP1-S-AP1-S-HIF-S-HIF-S-HIF (CRE containing 3x ATF6, 4x AP1 and 3x HIF TFBS); and -ATF6-S-ATF6-S-ATF6-S-AP1(1)-S-AP1(1)-S-AP1(1)-S-AP1(1)-S-HRE1-S-HRE1-S-HRE1( CRE containing 3x ATF6, 4x AP1(1) and 3x HRE1 TFBS); -cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1-S-AP1-S-AP1-S-AP1 (5x cAMPRE CRE containing 4x AP1 TFBS); and -cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1(1)-S-AP1(1)-S-AP1(1)-S-AP1(1)(CRE with 5x cAMPRE 4x AP1(1)TFBS); and -cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1(3)-S-AP1(3)-S-AP1(3)-S-AP1(3)-S-AP1(3)-S-AP1(3) (CRE containing 7x cAMPRE and 6 x AP1(3)); (wherein S represents an optional but preferred spacer sequence). Suitable lengths for the spacers are described above.

[0522] In these structures, references to a TF represent the presence of a TFBS for that TF. cAMPRE is used to refer to the TFBS for CREB.

[0523] In some particular embodiments, the CRE comprises one of the following structures: -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -AP1-S 10 -AP1-S 10 -AP1 (CRE containing 5x cAMPRE and 3x AP1 TFBS); -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -AP1(2)-S 10 -AP1(2)-S 10 -AP1(2) (CRE containing 5x cAMPRE and 3x AP1(2) TFBS); -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -AP1-S 10 -AP1-S 10 -AP1-S 10 -AP1 (CRE containing 5x cAMPRE and 4x AP1 TFBS); -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -AP1(2)-S10 -AP1(2)-S 10 -AP1(2)-S 10 -AP1(2) (CRE containing 5x cAMPRE and 4x AP1(2) TFBS); -AP1-S 20 -AP1-S 20 -AP1-S 20 -AP1-S 20 -AP1-S 20 -AP1-S 20 -AP1-S 20 -AP1 (8 x AP1 TF CRE including BS); -AP1(1)-S 20 -AP1(1)-S 20 -AP1(1)-S 20 -AP1(1)-S 20 -AP1(1)-S 20 -AP1(1)-S 20 -AP1(1)-S 20 -AP1(1) (CRE containing 8 × AP1(1) TFBS); -ATF6-S 20 -ATF6-S 20 -ATF6-S 20 -AP1-S 20 -AP1-S 20 -AP1-S 20 -AP1-S 20 -HIF-S 20 -HIF-S 20 -HIF (CRE containing 3x ATF6, 4x AP1 and 3x HIF TFBS); and -ATF6-S 20 -ATF6-S 20 -ATF6-S 20 -AP1(1)-S 20 -AP1(1)-S 20 -AP1(1)-S 20 -AP1(1)-S 20 -HRE1-S 20 -HRE1-S 20 -HRE1 (containing 3x ATF6, 4x AP1(1) and 3x HRE1 TFBS) MuCRE); -cAMPRE-S 10-cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -AP1-S 10 -AP1-S 10 -AP1-S 10 -AP1 (CRE containing 5 × cAMPRE4 × AP1 TFBS); and -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -AP1(1)-S 10 -AP1(1)-S 10 -AP1(1)-S 10 -AP1(1) (CRE containing 5 x cAMPRE4 x AP1(1) TFBS); and -cAMPRE-S5-cAMPRE- S5-cAMPRE- S5-cAMPRE- S5-cAMPRE- S5-cAMPRE- S5-cAMPRE- S5-AP1(3)- S5-AP1(3)- S5-AP1(3)- S5-AP1(3)- S5-AP1(3)- S5-AP1(3)(7xc CRE, including AMPRE and 6xAP1(3); (In the formula, S x represents a spacer sequence of length X nucleotides.

[0524] The spacer lengths specified above have been found to be effective in the specific examples described below. While other spacer lengths are expected to be functional, these represent preferred spacer lengths. This applies with respect to all aspects and embodiments of the invention that include these TFBSs as described below.

[0525] In some particular embodiments, the CRE comprises one of the following sequences: -TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGA[GC]TCA-S-TGA[GC]TCA-S-TGA[GC]TCA (SEQ ID NO: 120, 5x cAMPRE and 3x AP1 TFBS) including CRE); -TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGA[GC]TCA-S-TGA[GC]TCA-S-TGA[GC]TCA-S-TGA[GC]TCA (SEQ ID NO: 121, 5x cAMPRE and 4x AP1 CRE containing TFBS); -TGA[GC]TCA-S-TGA[GC]TCA-S-TGA[GC]TCA-S-TGA[GC]TCA-S-TGA[GC]TCA-S-TGA[GC]TCA-S-TGA[GC]TCA-S-TGA[GC]TCA (SEQ ID NO: 122, CRE containing 8x AP1 TFBS); and -TGACGT-S-TGACGT-S-TGACGT-S-TGA[GC]TCA-S-TGA[GC]TCA-S-TGA[GC]TCA-S- TGA[GC]TCA-S-[AG]CGTG-S-[AG]CGTG-S-[AG]CGTG(SEQ ID NO: 123, CRE 3x ATF6, 4x AP1 and 3x HIF TFBS); (wherein S represents an optional but preferred spacer sequence.) Suitable lengths for the spacer are described above.

[0526] In some particular embodiments, the CRE comprises one of the following sequences: -TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACTCAG-S-TGACTCAG-S-TGACTCAG (SEQ ID NO: 124, containing 5x cAMPRE and 3x AP1(2)TFBS) MuSynp-FORCSV-10 derived CRE); -TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACTCAG-S-TGACTCAG-S-TGACTCAG (SEQ ID NO: 125, CRE from Synp-FORCMV-09 containing 5x cAMPRE and 4x AP1(2) TFBS); -TGAGTCA-S-TGAGTCA-S-TGAGTCA-S-TGAGTCA-S-TGAGTCA-S-TGAGTCA-S-TGAGTCA-S-TGAGTCA (SEQ ID NO: 126, CRE from Synp-FMP-02 and Synp-FLP-01 containing 8x AP1(1) TFBS); -TGACGTGCT-S-TGACGTGCT-S-TGACGTGCT-S-TGAGTCA-S-TGGAGTCA-S-TGAGTCA-S- TGAGTCA-S-CTGCACGTA-S-CTGCACGTA-S-CTGCACGTA (SEQ ID NO: 127, 3x ATF6, 4x AP1 (1) and CRE containing 3x HRE1 TFBS); and -TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACTCA-S-TGACTCA-S-TGACTCA (SEQ ID NO: 128, a CRE containing 5x cAMPRE and 4x AP1(1) TFBS); and -TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACGTCA-S- - TGACGTCA-S-TGACGTCA-S- TGA[GC]TCA -S- TGA[GC]TCA -S- TGA[GC]TCA -S- TGA[GC]TCA -S- TGA[GC]TCA -S- TGA[GC]TCA (SEQ ID NO: 129, 7 x cAMPRE and 6 x AP1 CRE, including -TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACGTCA-S-TGACGTCA-S- TGACGTCA-S-TGACGTCA-S-TGACTCA-S- TGACTCA-S- TGACTCA-S- TGACTCA-S- TGACTCA-S- TGACTCA (SEQ ID NO: 130, 7 x cAMPRE and 6 x CRE from FORNEW, FORNCMV, FORNCMV53, FORNMinTK, FORNMLP, FORNSV40, FORNpJB42, FORNTATAm6a containing AP1(3)); (wherein S represents an optional but preferred spacer sequence.) Suitable lengths for the spacer are described above.

[0527] In some particularly preferred embodiments, the CRE has the following sequence: [ka] [ka] One of the or a functional variant of any of the above sequences, which comprises a sequence at least 80% identical thereto, preferably 85%, 90%, 95% or 99% identical thereto.

[0528] Typically, in such functional variants, the TFBS sequences present are substantially identical to the reference sequence, with substantially all of the mutations occurring in the intervening spacer sequence.

[0529] The above CREs have been shown to provide good levels of inducibility and strong expression upon induction, as well as low levels of background expression, when combined with a minimal promoter for an inducible promoter. Therefore, they are all useful for providing forskolin-inducible promoters. CREs exhibit some variability in terms of inducibility and expression level upon induction, allowing for the selection of promoters with desired characteristics.

[0530] A CRE having the following structure: cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1-S-AP1-S-AP1-S-AP has been shown to provide superior inducibility and expression properties when bound to a minimal promoter, and therefore represents a particularly preferred embodiment of the present invention.

[0531] A CRE with the following structure, ATF6-S-ATF6-S-ATF6-S-AP1-S-AP1-S-AP1-S-AP1-S-HIF-S-HIF-S-HIF, has been shown to provide exceptional inducibility and expression properties when bound to a minimal promoter. Therefore, such a CRE represents a particularly preferred embodiment of the present invention. It was surprising that such a CRE exhibited such excellent performance, given that it contains several TFBSs not known or expected to be induced by forskolin and that the TFBSs induced by forskolin are less abundant than some other, less potent CREs. Given the combination of TFBSs present in the CRE, an unexpected synergistic effect likely occurred.

[0532] A synthetic forskolin-inducible promoter containing the structure cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1(3)-S-AP1(3)-S-AP1(3)-S-AP1(3)-S-AP1(3) has been shown to offer exceptional properties in terms of inducibility and expression. Therefore, such promoters represent particularly preferred embodiments of the present invention. Given the combination of TFBS present in the CRE, certain synergistic effects appear to have occurred.

[0533] In a further embodiment, the promoter may comprise a cis-regulatory module (CRM) comprising a CRE according to the first aspect of the present invention. The other CRE in the CRM may be a forskolin-inducible CRE or may have any other function.

[0534] Preferably, the synthetic forskolin-inducible promoter comprises the above-mentioned CRE (or CRM) linked to a minimal promoter or proximal promoter, preferably a minimal promoter.

[0535] The minimal promoter can be any suitable minimal promoter. A wide range of minimal promoters are known in the art. Suitable minimal promoters include, but are not limited to, CMV minimal promoter (CMV-MP), YB-TATA minimal promoter (YB-TABA), HSV thymidine kinase minimal promoter (MinTK), SV40 minimal promoter (SV40-MP), or G6PC-MP (liver-derived non-TATA box MP). The minimal promoter can be a synthetic minimal promoter.

[0536] The sequence of CMV-MP is as follows: AGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTAGATACGCCATCCACCGCTGTTTTGACCTCCATAGAAGATCGCCACC (SEQ ID NO: 104).

[0537] The sequence of YB-TATA is as follows: GCGATTAATCCATATGCTCTAGAGGGTATATAATGGGGGCCACTAGTCTACTACCAGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO: 137).

[0538] However, a shorter version of YB-TATA MP is known in the art, which should provide a useful alternative to the YB-TATA MP sequence described above. The sequence of this shorter YB-TATA MP (referred to as sYB-TATA) is TCTAGAGGGGTATATAATGGGGGCCA (SEQ ID NO: 105). Therefore, as used herein, the inducible promoter Whenever YB-TATA is referenced as a component of a TATA, an equivalent sequence in which sYB-TATA is substituted for YB-TATA is also considered to be an alternative embodiment of the invention. In other words, in such an alternative, the sequence of sYB-TATA is retained, while the remainder of YB-TATA can be replaced with another sequence, typically a spacer sequence.

[0539] The sequence of MinTK MP is: TTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGACCCGCTTAA (SEQ ID NO: 10 7).

[0540] The sequence of SV40-MP is as follows: TGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATCGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAA (SEQ ID NO: 108).

[0541] The sequence of G6PC-MP is as follows: GGGCATATAAAACAGGGGCAAGGCACAGACTCATAGCAGAGCAATCACCACCAAGCCTGGAATAACTGCAGCCACC (SEQ ID NO: 109).

[0542] In some embodiments, the synthetic forskolin-inducible promoter comprises any one of the above-mentioned CRE sequences operably linked to a minimal promoter or a proximal promoter, preferably a minimal promoter.CRE is preferably linked to MP via a spacer, but in some cases, another CRE may be placed between them.CRE may also be operably linked to MP without a spacer.

[0543] The spacer sequence between the CRE and the minimal promoter can be any suitable length. Typically, the spacer is 5 to 100 nucleotides, 20 to 80 nucleotides, or 30 to 70 nucleotides long. For example, spacers of 5, 10, 18, 20, 21, 42, 50, 59, 65, and 66 nucleotides in length have been used in certain non-limiting examples of the present invention and function satisfactorily. However, spacers of other lengths can also be used, and those skilled in the art can easily determine the appropriate spacer length.

[0544] In some preferred embodiments, the synthetic forskolin-inducible promoter comprises one of the following structures: -cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1-S-AP1-S-AP1-S-MP (i.e. 5x cAMPRE and 3x CRE containing ATF6TFBS and MP); -cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1-S-AP1-S-AP1-S-AP1-S-MP i.e., 5x cAMPRE and 4x AP1 TFBS and CRE containing MP); -AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-MP (i.e., CRE containing 8x AP1 TFBS and MP); -ATF6-S-ATF6-S-ATF6-S-AP1-S-AP1-S-AP1-S-AP1-S-HIF-S-HIF-S-HIF-S-MP (i.e., CRE containing 3x ATF6, 4x AP1 and 3x HIF TFBS and MP); -cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1-S-AP1-S-AP1-S-AP1-S-MP i.e., 5x cAMPRE and 4x AP1 TFBSs and MP; and -cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1(3)-S-AP1(3)-S-AP1(3)-S-AP1(3)-S-AP1(3)-S-MP (7x cAMPRE and 6x AP CRE including 1(3) and MP); where S represents an optional but preferred spacer sequence and MP represents a minimal promoter. Suitable lengths of spacers are described above.

[0545] In a particularly preferred embodiment, the synthetic forskolin-inducible promoter comprises the following structure: ATF6-S-ATF6-S-ATF6-S-AP1-S-AP1-S-AP1-S-AP1-S-HIF-S-HIF-S-HIF-S-MP, wherein represents an optional but preferred spacer sequence, and MP represents a minimal promoter. More preferably, MP is CMV-MP.

[0546] In some preferred embodiments, the synthetic forskolin-inducible promoter comprises one of the following structures: -cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1-S-AP1-S-AP1-S-SV40-MP (i.e., CRE containing 5x cAMPRE and 3x AP1 TFBS and SV40-MP); -cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1-S-AP1-S-AP1-S-AP1-S-CMV-MP( i.e., 5x cAMPRE and 4x AP1 TFBS and CRE containing CMV-MP); -AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-AP1-S-(Min-TK or G6PC MP or CMV-MP) (i.e., CRE containing 8x AP1 TFBS and Min-TK or G6PC MP or CMV-MP); -ATF6-S-ATF6-S-ATF6-S-AP1-S-AP1-S-AP1-S-AP1-S-HIF-S-HIF-S-HIF-S-CMV-MP(Sunawa i.e., 3x ATF6, 4x AP1 and 3x HIF TFBS and CRE containing CMV-MP); -cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1-S-AP1-S-AP1-S-AP1-S-YB-TATA (CRE from 5x cAMPRE containing 4x AP1 TFBS and YB-TATA); and -cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-cAMPRE-S-AP1(3)-S-AP1(3)-S-AP1(3)-S-AP1(3)-S-AP1(3)-S-AP1(3)-S-(YB TATA or CMV-MP or CMV53 or MinTK or MLP or SV40 or pJV42 or TATAm6a) (i.e., CRE containing 7x cAMPRE and 6x AP1(3) and YB TATA or CMV-MP or CMV53 or MinTK or MLP or SV40 or pJV42 or TATAm6a), (wherein S represents an optional but preferred spacer sequence.) Suitable lengths for the spacer are described above.

[0547] In some preferred embodiments, the synthetic forskolin-inducible promoter comprises one of the following sequences: [ka] [ka] (wherein S represents an optional but preferred spacer sequence.) Suitable lengths for the spacer are described above.

[0548] In some preferred embodiments, the synthetic forskolin-inducible promoter comprises one of the following sequences (TFBS sequences are underlined and the minimal promoter sequence is in bold): [ka] [ka] or a functional variant of any of the above sequences, including a sequence at least 80% identical thereto, preferably 85%, 90%, 95% or 99% identical thereto.

[0549] Typically, in such functional variants, the TFBS and MP sequences present are substantially identical to the reference sequence, with substantially all sequence variation occurring in the spacer sequence between them.

[0550] The forskolin-inducible promoters described above have been shown to provide good levels of inducibility and strong expression upon induction, as well as low levels of background expression. Promoters exhibit some variability in terms of inducibility and expression levels upon induction, allowing for the selection of promoters with desired characteristics.

[0551] A synthetic forskolin-inducible promoter containing the structure ATF6-S-ATF6-S-ATF6-S-AP1-S-AP1-S-AP1-S-AP1-S-HIF-S-HIF-S-HIF-S-MP has been shown to offer exceptional properties in terms of inducibility and expression. Therefore, such a promoter represents a particularly preferred embodiment of the present invention. As noted above, this CRE was surprising given that it contains several TFBSs not known or expected to be induced by forskolin, and that the TFBSs induced by forskolin are less abundant than some other CREs, which are less inducible and potent. Given the combination of TFBSs present in the CRE, an unexpected synergistic effect likely occurred.

[0552] In a preferred embodiment of the invention, the inducibility of the promoter is such that upon induction (e.g., after exposure of cells, e.g., HEK293 cells, to 18 μM forskolin for 5 hours), the expression level of the transgene under the control of the promoter increases by at least 3-fold, more preferably 5-fold, 10-fold, 15-fold, 20-fold, 30-fold or 50-fold.

[0553] In some embodiments of the invention, upon induction (e.g., after exposing cells (e.g., HEK293) to 18 μM forskolin for 5 hours), the expression level of a transgene under the control of a promoter is at least 50% of the expression level provided by a CMV-IE promoter (i.e., an otherwise identical vector in the same cells under the same conditions, but where expression of the transgene is under the control of a CMV-IE rather than a forskolin-inducible promoter). More preferably, the expression level of the transgene is at least 75%, 100%, 150%, 200%, 300%, 400%, 500%, 750%, or 1000% of the expression level provided by a CMV-IE promoter.

[0554] The consensus cAMP response element TGACGTCA is described in JBC, Vol. 272, No. 31, Issue of August 1, pp. 19158-19164, 1997, which is incorporated herein by reference. The novel cAMP response element CACTTGATC is described in J. Neurochem, 63(1), 28-40 Jul. 1994, which is incorporated herein by reference, and this element can be used in the forskolin-inducible promoter described above.

[0555] cAMP response element (CRE) / cAMP autoregulatory response element (CARE) is a molecular endocrinology (Molecular Endocrinology, Volume 13, Issue 1). 7, 1 July 1999, Pages 1207-1217.

[0556] cAMP response elements are also described in Gut 03 May 2005, 54(9):1309-1317, e.g., Figure 2. Such elements can be used in forskolin-inducible promoters as described above.

[0557] Another cAMP-inducible promoter is described in U.S. Patent No. 6,596,508, which is incorporated herein by reference, see, for example, SEQ ID NO: 3 in U.S. Patent No. 659,650. Such promoters can be used in the present invention. A cAMP response element from the VIP promoter has also been disclosed (e.g., SEQ ID NOs: 1 and 2 in U.S. Patent No. 659,650).

[0558] Additional cAMP response elements are also described in U.S. Patent No. 8,986,937, which is incorporated herein by reference. Exemplary naturally occurring cAMP-inducible promoters described therein include the PEPCK promoter (Roesler et al. (1998) The Journal of Biological Chemistry, 273, 14950-14957); a promoter containing the cAMP response element (CRE) at position −294 relative to the translation start site of the human cyclin D2 promoter (Muniz et al. (2006) Biology of Reproduction 75(2):279-288); and a promoter containing the cAMP response element (CRE) of the lactate dehydrogenase A subunit promoter (Welfeld et al. et al. (1989) J. Biol. Chem. 264(12):6941-7. Exemplary cAMP-inducible promoters include the 236-nucleotide glycoprotein hormone alpha subunit promoter, which contains a cyclic AMP (cAMP) regulatory element (CRE) (AF401991), as described in U.S. Patent Application Publication No. US2008-0187942, published August 7, 2008, which is incorporated herein by reference. Such elements can be used in forskolin-inducible promoters as described above.

[0559] US9060310, incorporated herein by reference, describes additional cAMP response elements, such as various CRE-palindromes and hairpins of SEQ ID NOs: 2, 3, 8, 9, 10, and 11 of US9060310. Such cAMP response elements can be used in forskolin-inducible promoters as described above.

[0560] US20070036810 and Mayr B, Montminy M., Nat Rev Mol Cell Biol 2001 August;2(8):599-609 (both incorporated by reference) disclose cAMP response elements containing asymmetric mutations containing a palindromic sequence of TGACGTCA or a CRE half-site with the core sequence TGAC. Such elements can be used in forskolin-inducible promoters as described above.

[0561] Various cAMP-inducible genes / well-known targets of cAMP are also discussed in US20070036810 (incorporated herein by reference) (e.g., TSHalpha, phosphoenolpyruvate carboxykinase (PEPCK), crystallin alpha-B, and the EGF-like molecule amphiregulin). Promoters from such genes may also be relevant in the present context.

[0562] Suitable inducers capable of activating adenylyl cyclase include, but are not limited to: -Forskolin (a potent adenylyl cyclase activator (CAS number 66575-29-9)); -NKH477 (a water-soluble analogue of forskolin (CAS number 138605-00)); -PACAP-27 (a neuropeptide that stimulates adenylate cyclase (CAS number 127317-03-7)); -PACAP-38 (a neuropeptide that stimulates adenylate cyclase (CAS number 137061-48-4)); -Pertussis toxin CAS number 70323-44-3; and -Cholera toxin (CAS number 9012-63-9).

[0563] All of the above are commercially available from Sigma-Aldrich, Inc. (now part of Merck KGaA).

[0564] In some preferred embodiments of the present invention, the inducer comprises forskolin or NKH 477.

[0565] Forskolin is generally regarded as safe (GRAS) and is generally desirable from a safety perspective. Forskolin (also known as coleonol) is a labdane diterpene produced by the Indian Coleus plant (Plectranthus barbatus). Forskolin is commonly used in materials research to increase cyclic AMP levels. Forskolin is also used in traditional medicine. Because forskolin is GRAS, it is a preferred inducer for the promoter of the present invention in gene therapy applications.

[0566] NKH477 is a water-soluble analog of forskolin, which may be advantageous for ease of use, particularly in cell culture. Because NKH477 is water-soluble, it may be a preferred inducer.

[0567] The inducer can be administered to the cells by any suitable method, for example, the inducer can be added to the culture medium together with a suitable carrier, surfactant, etc., if necessary.

[0568] The appropriate dosage of any given inducer can be easily determined by one skilled in the art. Thus, for any inducer, one skilled in the art can easily determine the appropriate method for delivering the inducer to cells and the appropriate concentration to use. Generally speaking, the inducer can be administered at any appropriate concentration ranging from 1 nM to 1000 μM, and optionally from 0.1 μM to 100 μM.

[0569] Forskolin can be administered to cells at a concentration of 0.1 μM to 1000 μM, more preferably 1 μM to 100 μM, and even more preferably 5 μM to 30 μM. For example, a concentration of approximately 18 μM was determined to be optimal for inducing expression in HEK-293 cells.

[0570] NKH 477 can be suitably administered to cells at a concentration of 0.1 μM to 1000 μM, more preferably 1 μM to 100 μM, and even more preferably 2 μM to 20 μM. For example, administration of NKH 477 to cells at a concentration of approximately 8 μM has been determined to be optimal for inducing expression in HEK-293 cells.

[0571] The method may suitably include discontinuing administration of the inducer, which results in at least a decrease in expression of the expression product, typically returning to baseline levels over time.

[0572] The method may suitably involve varying the concentration of inducer administered to the cells over time, which can be used to modulate the level of expression of the expression product.

[0573] In some embodiments, the methods disclosed herein may include administering to the cell an inhibitor of adenylyl cyclase that acts to reduce or turn off expression of the expression product. Inhibitors of adenylyl cyclase include, but are not limited to: -NB001 - an inhibitor of adenylyl cyclase 1 (AC1); -9-Cyclopentyladenine monomethanesulfonate - a stable, cell-permeable, non-competitive adenylyl cyclase inhibitor; SQ 22,536 - cell-permeable adenylyl cyclase inhibitor; MDL-12,330A hydrochloride - adenylyl cyclase inhibitor; -2',5'-dideoxyadenosine - a cell-permeable adenylyl cyclase inhibitor; -2',5'-dideoxyadenosine 3'-triphosphate tetrasodium salt - a potent inhibitor of adenylyl cyclase; MANT-GTPγS - a potent and competitive adenylyl cyclase inhibitor; -2',3'-dideoxyadenosine-specific adenylyl cyclase inhibitor; -NKY80-selective adenylyl cyclase V inhibitors; and -KH7 - A selective inhibitor of soluble adenylyl cyclase.

[0574] All of the above are commercially available from Sigma-Aldrich, Inc. (now part of Merck KGaA).

[0575] Thus, administration of inhibitors of adenylyl cyclase can be used to switch off or reduce the expression of toxic proteins.

[0576] In one embodiment, the synthetic forskolin-inducible promoter does not comprise or consist of one of the following structures: -AP1-S 20 -AP1-S 20 -AP1-S 20 -AP1-S 20 -AP1-S 20 -AP1-S 20 -AP1-S 20 -AP1-S 59 -CMV-MP (i.e., the construct of RTV-17 containing 8xAP1 TFBS and CMV-MP); -ATF6-S 20 -ATF6-S 20 -ATF6-S 20 -AP1-S 20 -AP1-S 20 -AP1-S 20 -AP1-S 20 -HRE1-S 20 -HRE1-S 20 -HRE1-S 59 -CMV-MP (i.e., the construct of Synp-RTV-019 containing 3x ATF6, 4x AP1 and 3x HIF TFBSs and CMV-MP); -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -cAMPRE-S 10 -AP1-S 10 -AP1-S 10 -AP1-S 10-AP1-S0-YB-TATA-MP (i.e., the structure of FORCYB1 containing 5 × cAMPRE and 4 × AP1 TFBS and YB-TATA-MP). In the formula, S x represents a spacer of length X nucleotides.

[0577] In one embodiment, the synthetic forskolin-inducible promoter does not comprise or consist of one of the following sequences: [ka] [ka]

[0578] Temperature-inducible promoters:

[0579] Temperature-inducible promoters—Inducible promoters can be induced by a decrease in temperature (e.g., cold-shock responsive promoters). In some embodiments, the inducible promoter is a synthetic cold-shock responsive promoter derived from the S1006a gene (calcyclin) in CHO cells. The temperature sensitivity of the S1006a gene (calcyclin) promoter was identified by Thaisuchat et al., 2011 (Thaisuchat, H. et al. (2011) 'Identification of a novel temperature-sensitive promoter in CHO cells', BMC Biotechnology, 11. doi:10.1186 / 1472-6750-11-51), incorporated herein by reference. In some embodiments, the inducible promoter is one of the synthetic cold-shock responsive promoters shown in Figure 2 of Thaisuchat et al., 2011. These promoters are induced by a decrease in temperature, as shown in Figure 3 of Thaisuchat et al., 2011. Most of these synthetic promoter constructs exhibit expression similar to the known promoter SV40 at 37°C and are induced 2-3 fold when the temperature is lowered to 33°C. In some embodiments, the inducible promoter is sps5 from Figure 2 of Thaisuchat et al., 2011. In some preferred embodiments, the inducible promoter is sps8 from Figure 2 of Thaisuchat et al., 2011.

[0580] pH-inducible promoter:

[0581] An inducible promoter can be induced by a decrease or increase in pH to which cells containing the promoter are exposed. Suitably, the inducible promoter can be induced by a decrease in pH (i.e., a promoter inducible under acidic conditions). Suitable acid-inducible promoters are described in Hou et al., 2016 (Hou, J. et al. (2016) 'Isolation and functional validation of salinity and osmotic stress inducible promoter from the maize type-II H+-pyrophosphatase gene by deletion analysis in transgenic tobacco plants', PLoS ONE, 11(4), pp. 1-23. doi:10.1371 / journal.pone.0154041) (incorporated herein by reference).

[0582] In some embodiments, the inducible promoter is a synthetic promoter inducible under acidic conditions derived from the YGP1 gene or CCW14 gene. The inducibility of the YGP1 gene or CCW14 gene under acidic conditions was studied by Rajkumar et al., 2016 (Rajkumar, A. et al. (2016) 'Engineering of synthetic, stress-responsive yeast promoters', 44(17). doi:10.1093 / nar / gkw553) (incorporated herein by reference) and improved by modifying transcription factor binding sites. In some embodiments, the inducible promoter is one of the synthetic promoters inducible under acidic conditions shown in Figures 1A, 2A, 3A, and 4A of Rajkumar et al., 2016. These promoters are induced by a decrease in pH, as shown in Figures 1B, 2B, 3B, and 4B of Rajkumar et al., 2016. Most of these synthetic promoters are induced up to 10-15 fold when the pH is reduced from 6 to 3. In some preferred embodiments, the inducible promoter is YGP1pr from Figure 1 in Rajkumar et al., 2016. In other preferred embodiments, the inducible promoter is YGP1pr from Figure 1 in Rajkumar et al., 2016.

[0583] Osmolarity-inducible promoters:

[0584] The inducible promoter may be an osmolarity-inducible promoter. Suitable promoters induced by osmolarity are described in Zhang et al. (Molecular Biology Reports volume 39, pages 7347-7353 (2012)) (incorporated herein by reference).

[0585] Carbon source inducible promoter:

[0586] Inducible promoters can be induced by the addition of a specific carbon source (e.g., a non-sugar carbon source). Alternatively, inducible promoters can be induced by the withdrawal or absence of a carbon source. Suitable promoters induced by the presence or absence of various carbon sources are described in Weinhandl et al., 2014 (Weinhandl, K. et al. (2014) 'Carbon source dependent promoters in yeasts', Microbial Cell Factories, 13(1), pp. 1-17. doi:10.1186 / 1475-2859-13-5) (incorporated herein by reference).

[0587] Alcohol (e.g., ethanol) inducible promoters:

[0588] Inducible promoters can be induced by the addition of ethanol. Suitable promoters that are induced by ethanol are described in Matsuzawa et al. (Applied Mathematics, 2002). Microbiology and Biotechnology volume 97, pages 6835-6843 (2013)), which is incorporated herein by reference.

[0589] Amino acid inducible promoter:

[0590] The inducible promoter can be induced by adding one or more amino acids. Suitably, the amino acid can be an aromatic amino acid. Suitably, the amino acid can be GABA (gamma aminobutyric acid), which is also a neurotransmitter. Suitable promoters induced by aromatic amino acids and GABA are described in Kim et al. (Applied Microbiology and Biotechnology, volume 99, pages 2705-2714 (2015)) (incorporated herein by reference).

[0591] Hormone (e.g., ecdysone) inducible promoters:

[0592] The inducible promoter can be induced by a steroid hormone. Suitably, the steroid hormone can be ecdysone. A mammalian ecdysone inducible system was created by No, Yao and Evans (No, D., Yao, TP and Evans, RM (1996) 'Ecdysone-inducible gene expression in mammalian cells and transgenic mice', Proceedings of the National Academy of Sciences of the United States of America, 93(8), pp. 3346-3351. doi:10.1073 / pnas.93.8.3346) (incorporated herein by reference). No, Yao As shown in Figure 2 of No, Yao, and Evans, 1996, expression of the modified ecdysone receptor in mammalian cells results in induction of expression from an ecdysone-responsive promoter upon addition of ecdysone. As shown in Figure 6 of No, Yao, and Evans, 1996, this system has lower basal activity and is more inducible than the tetracycline-inducible system. Suitable commercially available induction systems are available from Agilent technologies and are listed in Agilent Technologies (2015)'s Complete Control The method is described in the 'Inducible Mammalian Expression System Instruction Manual', 217460, which is incorporated herein by reference.

[0593] Tetracycline-regulated promoter:

[0594] In some embodiments, the promoter can be induced by the presence or absence of tetracycline or a derivative thereof.

[0595] A suitable promoter that is induced in the absence of tetracycline or its derivatives is a promoter in the tet-OFF system. In the tet-OFF system, a tetracycline-regulated transactivator (tTA) can activate transcription from a tTA-dependent promoter in the absence of tetracycline or its derivatives. tTA and tTA-dependent promoters were first developed by Gossen and Bujard, 1992 (Gossen, M. and Bujard, H. (1992) 'Tight control of gene expression in mammalian cells by tetracycline-responsive promoters', Proceedings of the National Academy of Sciences of the United States of America, 89(12), pp. 5547-5551. doi:10.1073 / pnas.89.12.5547) (incorporated herein by reference). tTA was created by fusing the Tn10-encoded tetracycline resistance operon (tet repressor) of Escherichia coli with the cyclin-regulated transactivator (tTA), and a tTA-dependent promoter was created by combining the tet operator sequence with a minimal promoter derived from the human cytomegalovirus promoter IE (hCMV-IE). When tetracycline or its derivatives are added, tTA can no longer bind to its target sequence within the tTA-dependent promoter, and there is no expression from the tTA-dependent promoter. This is consistent with Jaisser, 2000 (Jaisser, F. (2000) 'Inducible gene expression and gene modification in transgenic mice', Journal of the American Society of Nephrology, 11 (SUPPL. 16), pp. 95-100 (incorporated herein by reference) in Figure 1A and described on page 96. The mechanism of conformational change brought about by binding of tetracycline or its derivatives to tTA is described in Orth et al., 2000 (Orth, P. et al. (2000) 'Structural basis of gene regulation by the tetracycline-inducible Tet repressor-operator system', Nature Structural Biology, 7 (3), pp. 215-219. doi:10.1038 / 73324) (incorporated herein by reference). Binding of tetracycline to TetR increases the separation of the bound DNA-binding domains, resulting in a loss of affinity of TetR for its operator DNA.

[0596] A suitable promoter that is induced by the presence of tetracycline or its derivatives is a promoter in the tet-ON system. As described by Gossen et al. (Science 23 Jun 1995: Vol. 268, Issue 5218, pp. 1766-1769 DOI: 10.1126 / science.7792603) (incorporated herein by reference), in the tet-ON system, the reverse tetracycline-regulated transactivator (rtTA) can activate transcription from a tTA-dependent promoter in the presence of tetracycline or its derivatives. In the absence of tetracycline or its derivatives, tTA can no longer bind to its target sequence in the tTA-dependent promoter, and there is no expression from the tTA-dependent promoter. This is described in Jaisser, 2000 (Jaisser, F. (2000) 'Inducible gene expression and gene modification in transgenic mice', Journal of the American Society of Nephrology, 11(SUPPL.16), pp. 95-100, incorporated herein by reference, is shown in Figure 1B and described on page 96.

[0597] Suitably, an improved variant of the reverse tetracycline-regulated transactivator (rtTA) is used.

[0598] Suitable refinement variants are identified by the method described in Urlinger et al., 2000 (Urlinger, S. et al. (2000) 'Exploring the sequence The results are listed in Table 1 of "Space for Tetracycline-Dependent Transcriptional Activators: Novel Mutations Yield Expanded Range and Sensitivity," Proceedings of the National Academy of Sciences of the United States of America, 97(14), pp. 7963-7968. doi:10.1073 / pnas.130192197 (incorporated herein by reference). The variants rtTA-S2 and rtTA-M2 exhibited lower basal activity as shown in Figure 3 of Urlinger et al., 2000, which indicates minimal background expression from the tTA-dependent promoter in the absence of tetracycline or its derivatives. Furthermore, rtTA-M2 has increased sensitivity to tetracycline and its derivatives, as shown in Figure 3 of Urlinger et al., 2000, and functions at 1 / 10 the concentration of rtTA. In some preferred embodiments, the improved variant of rtTA is rtTA-M2 of Urlinger et al., 2000.

[0599] Another improved variant is described by Zhou et al., 2006 (Zhou, X. et al. (2006) 'Optimization of the Tet-On system for regulated gene expression through The variants are listed in Table 1 of "viral evolution," Gene Therapy, 13(19), pp. 1382-1390. doi:10.1038 / sj.gt.3302780 (incorporated herein by reference). As shown in Figure 3 of Zhou et al., 2006, the majority of these variants were shown to have higher transcriptional activity and doxycycline sensitivity than rtTA. The best-performing variant was 7-fold more active and 100-fold more sensitive to doxycycline. In some preferred embodiments, the improved variant of rtTA is V14, V15, or V16 from Zhou et al., 2006.

[0600] A suitable commercially available tetracycline inducible system is the T-Rex system from Life-Technologies (see, for example, Life-Technologies (2014) 'Inducible Protein Expression Using the T-REx™ System', 1, pp. 1-12, available at: www.lifetechnologies.com / de / de / home / references / protocols / proteins-expression-isolation-and-analysis / protein-expression-protocol / inducible-protein-expression-using-the-trex-system.reg.us.html / ).

[0601] For example, induction in the absence of tetracycline and the presence of estrogen:

[0602] An inducible promoter can be induced by the absence of one molecule and the presence of a different molecule. In some embodiments, an inducible promoter can be induced by the removal of tetracycline and the addition of estrogen, as described in Iida et al., 1996 (Iida, A. et al. (1996) 'Inducible gene expression by retrovirus-mediated transfer of a modified tetracycline-regulated system.' Journal of Virology, 70(9), pp. 6054-6059. doi:10.1128 / jvi.70.9.6054-6059.1996) (incorporated herein by reference). This specific inducibility was achieved by adding the ligand-binding domain of the estrogen receptor to the carboxy terminus of the tTA transactivator. As shown in Figure 3 of Iida et al., 1996, such a modified transactivator exhibited high expression of a gene of interest in the absence of tetracycline and the presence of estrogen.

[0603] Induction by small molecule enhancers:

[0604] Inducible promoters can be induced by small molecule enhancers. Suitable promoters induced by small molecule enhancers (such as aromatic carboxylic acids, hydroxamic acids, and acetamides) are described in Allen et al. (Biotechnol.Bioeng.2008;100:1193-1204) (incorporated herein by reference).

[0605] Mifepristone (RU-486) ​​inducible promoter:

[0606] Inducible promoters can be induced by synthetic steroids. In some embodiments, inducible promoters can be induced by mifepristone, also known as RU-486. The hybrid mifepristone-responsive transcription factor, LexPR transactivator, is described in Emelyanov and Parinov, 2008 (Emelyanov, A. and Parinov, S. (2008) 'Mifepristone-inducible LexPR system to The LexPR gene was created by fusing the DNA-binding domain of the bacterial LexA repressor, the truncated ligand-binding domain of the human progesterone receptor, and the activation domain of the human NF-kB / p65 protein, as described in "Drive and control gene expression in transgenic zebrafish," Developmental Biology, 320(1), pp. 113-121. doi:10.1016 / j.ydbio.2008.04.042 (incorporated herein by reference). As shown in Figures 1 and 2 of Emelyanov and Parinov, 2008, upon addition of mifepristone, LexPR induces expression from a promoter sequence carrying a LexA binding site. A suitable commercially available mifepristone-inducible system is the GeneSwitch System (see, e.g., Fisher, T. (1994) "Inducible Protein Expression Using GeneSwitch™ Technology," pp. 1-25).

[0607] Cumate-inducible promoter:

[0608] In some embodiments, the inducible promoter can be induced by the presence or absence of cumate.

[0609] In the cumate switch system of Mullick et al., 2006 (Mullick, A. et al. (2006) 'The cumate gene switch: A system for regulated expression in mammalian cells', BMC Biotechnology, 6, pp. 1-18. doi:10.1186 / 1472-6750-6-43, incorporated herein by reference), the repressor CymR blocks transcription from promoters containing CuO sequences placed downstream of the promoter. Upon addition of cumate, the CymR repressor is unable to bind to CuO, allowing transcription from the CuO-containing promoter to proceed. This is shown in Figure 1B and Figure 2 of Mullick et al., 2006.

[0610] In another cumate switch system, a chimeric transactivator (cTA) created by fusing CymR with the activation domain of VP16 does not prevent transcription from a promoter containing a CuO sequence upstream of the promoter in the presence of cumate. In the absence of cumate, the chimeric transactivator (cTA) binds to the CuO sequence and prevents transcription. This is shown in Figure 1C and Figure 3 of Mullick et al., 2006.

[0611] In the third configuration, the reverse chimeric transactivator (rcTA) prevents transcription from promoters containing CuO sequences upstream of the promoter in the absence of cumate. In the presence of cumate, rcTA binds to the CuO sequence and can initiate transcription from promoters containing CuO sequences. This is shown in Figure 1D and Figure 7 of Mullick et al., 2006.

[0612] Suitable commercially available cumate inducible systems can be found in SBI Biosciences (see SBI (2020) 'Cumate-inducible Systems For the ultimate in gene expression control, use SBI's cumate-CUMATE-INDUCIBLE SYSTEMS', pp. 1-13, incorporated herein by reference).

[0613] 4-hydroxytamoxifen (OHT) inducible promoter:

[0614] The inducible promoter can be induced by 4-hydroxytamoxifen (OHT). A suitable 4-hydroxytamoxifen inducible promoter is described by Feil et al. (Biochemical and Biophysical Research Communications Volume 237, Issue 3, 28 August 1997, Page 752) (incorporated herein by reference).

[0615] gas inducible promoter:

[0616] The inducible promoter can be a gas-inducible promoter (e.g., an acetaldehyde-inducible promoter). Suitable gas-inducible promoters are described in Weber et al., 2004 (Weber, W. et al. (2004) 'Gas-inducible transgene expression in mammalian cells and mice', Nature Biotechnology, 22(11), pp. 1440-1444. doi:10.1038 / nbt1021) (incorporated herein by reference). As shown in Figure 1A, the native acetaldehyde-inducible AlcR-PalcA system from Asperigillus nidulans can be expressed by introducing an AlcR-specific operator module into a human minimal promoter (together P AIRThe AlcR has been adapted for mammalian use by the PAIR promoter (called the PAIR promoter). As shown in Figure 1C, Figure 2, and Figure 3, when AlcR is constitutively expressed in a cell of interest, upon introduction of acetaldehyde, it binds to AlcR, which then expresses a gene of interest under the control of the PAIR promoter. In the absence of acetaldehyde, the gene of interest is not expressed.

[0617] Riboswitch-, ribozyme-, and aptazyme-inducible promoters:

[0618] An inducible promoter can be induced by the presence or absence of a ribozyme, which in turn can be induced by a ligand.

[0619] An inducible promoter can be induced in the absence of a metabolite. In some embodiments, the metabolite can be glucosamine-6-phosphate responsive. Suitable ribozymes that act as glucosamine-6-phosphate responsive gene repressors are described in Winkler et al., 2004 (Winkler, W C et al. (2004) 'Control of gene expression by a natural metabolite-responsive ribozyme', Nature, 428(6980), pp. 281-286. doi:10.1038 / nature02362 (incorporated herein by reference). The ribozyme is activated by glucosamine-6-phosphate in a concentration-dependent manner as shown in Figure 2C, and cleaves the messenger RNA of the glmS gene. With modifications, this natural system can be applied to regulate genes of interest other than the glmS gene.

[0620] Protein expression can also be downregulated by ligand-induced aptazymes. Protein expression can be downregulated by aptazymes, which downregulate protein expression by small molecule-induced self-cleavage of the ribozyme, resulting in mRNA degradation (Zhong et al., 2016 (Zhong, G. et al. (2016) 'Rational design of aptazyme riboswitches for efficient control of gene expression in mammalian cells', eLife, 5 (NOVEMBER 2016). doi:10.7554 / eLife.18858) (incorporated herein by reference)). A suitable aptazyme is shown in Figure 4A of (Zhong et al., 2016). As shown in Figure 4 of (Zhong et al., 2016), these aptazymes reduce the relative expression of the target gene.

[0621] Also, protein expression can be upregulated by small molecule-dependent ribozymes.Ribozymes can be tetracycline-dependent.Suitable tetracycline-dependent ribozymes can be turned on protein expression switch by preventing the ribozyme cleavage that normally cuts mRNA in the absence of ligand, as described in Beilstein et al.(ACS Synth.Biol.2015,4,5,526-534) (incorporated herein by reference).

[0622] Protein expression can also be controlled by guanine-dependent aptazymes, as described in Nomura et al. (Chem. Commun., 2012, 48, 7215-7217), incorporated herein by reference.

[0623] Furthermore, an RNA structure combining a microRNA precursor analogue and a drug-inducible allosteric ribozyme that chemically induces RNAi in mammalian cells was developed by Kumar. et al (J. Am. Chem. Soc. 2009, 131, 39, 13906-13907), which is incorporated herein by reference.

[0624] Metallothionein inducible promoter:

[0625] Metallothionein-inducible promoters have been described in the literature, see, for example, Shinichiro Takahashi, "Positive and negative regulators of the metallothionein gene," Molecular Medicine Reports, March 9, 2015, pp. 795-799 (incorporated herein by reference).

[0626] Rapamycin-inducible promoter:

[0627] Inducible promoters can be induced by small molecule drugs such as rapamycin. A humanized system for pharmacologically regulating gene expression using rapamycin is described in Rivera et al., 1996 (Rivera et al. Nature Medicine volume 2, pages 1028-1032 (1996)) (incorporated herein by reference). Rivera et al., 1996 used the natural ability of rapamycin to bind to FKBP12, and then this complex binds to FRAP, to induce rapamycin-specific expression of a gene of interest. Induction was achieved by fusing one of the FKBP12 / FRAP proteins to the DNA-binding domain and the other to the activator domain. As shown in Figure 1b, FKBP and FRAP do not interact, so if FKBP is fused to the DNA-binding domain and FRAP is fused to the activator domain, the gene of interest will not be transcribed in the absence of rapamycin. As shown in Figures 2 and 3, in the presence of rapamycin, FKBP and FRAP interact, bringing the DNA binding domain and the activator domain into close contact, resulting in transcription of the gene of interest.

[0628] Chemically induced proximity-inducible promoters:

[0629] Inducible promoters can be regulated by chemical induction approach. A suitable small molecule-based system for regulating protein abundance or activity is described in Liang et al. (Sci Signal. 2011 Mar15;4(164):rs2.doi:10.1126 / scisignal.2001449) (incorporated herein by reference).

[0630] Gene expression was measured using the method described in Belshaw et al., 1996 (Belshaw, PJ et al. (1996) 'Controlling protein association and subcellular localization with a This can be induced by chemically induced proximity by a molecule combining two protein-binding surfaces, as shown in "A synthetic ligand that induces heterodimerization of proteins," Proceedings of the National Academy of Sciences of the United States of America, 93(10), pp. 4604-4607 (incorporated herein by reference). Transcriptional activation of a gene of interest by chemically induced proximity by a molecule combining two protein-binding surfaces is shown in Figure 3 of Belshaw et al.

[0631] Rheoswitch® Inducible Promoters:

[0632] Inducible promoters can be induced by synthetic small molecules. In some embodiments, these synthetic small molecules can be diacylhydrazine ligands. Suitable systems for inducible up- and down-regulation of gene expression are described in Cress et al. (Volume 66, Issue 8 Supplement, pp. 27) or Barrett et al. (Cancer Gene Therapy Volume 25, pages 106-116 (2018)) (incorporated herein by reference). The RheoSwitch® system consists of two chimeric proteins derived from the ecdysone receptor (EcR) and RXR, each fused to a DNA-binding domain and an acidic transcriptional activation domain. Upon binding of a synthetic small molecule ligand, the nuclear receptors heterodimerize to create a functional transcription factor that can activate transcription from a responsive promoter linked to a gene of interest.

[0633] CRISPR-inducible promoters:

[0634] Gene expression can be induced by CRISPR-based transcription factors. As shown in Figure 1A of Ferry, Lyutova, and Fulga, 2017 (Ferry, QRV, Lyutova, R., and Fulga, T.A. (2017) 'Rational design of inducible CRISPR guide RNAs for de novo assembly of transcriptional programs', Nature Communications. Nature Publishing Group, 8, pp. 1-10. doi:10.1038 / ncomms14633) (incorporated herein by reference), nuclease-deficient Cas9 can be directed to a sequence of interest by designing its associated single-stranded guide RNA (sgRNA), and gene expression can be regulated by tethering an effector domain to the sgRNA-Cas9 complex. A suitable, versatile inducible CRISPR-TR platform based on minimal manipulation of the sgRNA is described in Ferry, Lyutova, and Fulga, 2017.

[0635] CRISPR-based transcriptional regulation can also be induced by drugs.Suitable drug-inducible CRISPR-based transcriptional regulator system is shown in Zhang et al., 2019 (Zhang, J. et al. (2019) 'Drug Inducible CRISPR / Cas Systems', Computational and Structural Biotechnology Journal.Elsevier BV, 17, pp.1171-1177.doi:10.1016 / j.csbj.2019.07.015) (incorporated herein by reference).

[0636] In one embodiment, contacting the cells with an inducer or subjecting the cells to suitable inducing conditions results in the expression of at least one toxic protein.

[0637] The inducible promoters described herein can further regulate the expression of an inducer or repressor of the inducible promoter (e.g., an inducer or repressor of a second, different promoter) or the inducer or repressor itself. In one embodiment, the cell comprises a first inducible promoter operably linked to a repressive element capable of silencing protein expression.

[0638] In one embodiment, the first inducible promoter further encodes a protein that represses expression of the first inducible promoter.

[0639] In one embodiment, the cell comprises a first inducible promoter that further encodes a protein that induces the expression of a second inducible promoter.

[0640] Toxic genes Various aspects of the present invention described herein relate to the use of any of the inducible promoters presented herein to control the expression of toxic proteins in cells, such as viral vector-producing cells. As used herein, "toxic protein" refers to a gene product that, when expressed in a cell, exerts a toxic effect on the cell, adversely affecting the physiology of the cell, leading to reduced cell proliferation, apoptosis, and ultimately cell death. Although toxic proteins are not highly toxic initially, over time their expression can, for example, kill the cell.

[0641] Certain viral proteins required for viral vector propagation are toxic when expressed in cells, making it desirable to strictly control the expression of these genes during viral vector production. For example, the replication (rep) and capsid (cap) proteins required for AAV viral vector propagation are toxic when expressed in AAV-producing cells. Rep and cap each express a family of related proteins from a separate open reading frame and are produced by alternative mRNA splicing and distinct transcription and translation start sites. Rep proteins (Rep78, Rep68, Rep52, and Rep40) are involved in the replication, rescue, and integration of the AAV genome. Rep78 and Rep68 have the same amino-terminal sequence and share the same native promoter p5, but Rep78 contains an alternatively spliced ​​exon in rep68. Similarly, Rep52 and Rep40 have the same amino-terminal sequence and share the native p19 promoter downstream of the p5 promoter, but rep52 contains an alternatively spliced ​​exon in rep68. The Cap gene encodes three capsid proteins (VP1, VP2, and VP3) and an assembly activating protein (AAP), which promotes encapsidation to form virion capsids. Transcription of the Cap gene is driven by the p40 promoter. Helper virus genes used in AAV vector production can also produce toxic products. Helper genes traditionally used in AAV production include E1 (E1A and E1B), E2A, E4, and VA. RNA is one example. Furthermore, the polymerase (pol), group antigen (gag), and envelope (env) proteins required for the propagation of lentiviral or adenoviral vectors, for example, are toxic over time when expressed in viral vector-producing cells. The env protein is essential for the formation of the viral envelope. Gag is an acronym for group antigen (ag). Group antigens form the viral core structure, the RNA genome-binding protein, and are the major proteins comprising the nucleoprotein core particle. Pol, reverse transcriptase, is an essential enzyme that carries out the reverse transcription process, converting the RNA genome into a double-stranded DNA preintegrated form. The pol gene further encodes integrase and RNase H activities that function during genome reverse transcription. The tat and rev proteins can also be toxic to cells when expressed over time.

[0642] As described in the above aspects, expression of the Rep protein is under the control of a second regulatable promoter or a regulatable transcription factor. In one embodiment, the second regulatable promoter is an inducible promoter or contains a binding site for a regulatable transcription activator.

[0643] In one embodiment, the or each nucleic acid encoding a Rep protein is operably linked to an inducible promoter. Suitable inducible promoters are described elsewhere herein.

[0644] In one embodiment, the or each nucleic acid encoding a Rep protein is operably linked to a promoter containing a target site for binding of a regulatable transcriptional activator. Suitable regulatable transcriptional activators are described elsewhere herein (e.g., zinc finger transcriptional activators (ZF-TAs)).

[0645] In one embodiment, the first and second Rep proteins are encoded by a nucleic acid sequence, optionally by one or more nucleic acid sequences. In one embodiment, the first Rep protein is Rep78 and the second Rep protein is Rep52. In one embodiment, the or each nucleic acid encoding the first and second Rep proteins is under the control of a second regulatable promoter or regulatable transcriptional activator. In one embodiment, each nucleic acid encoding the first and second Rep proteins is under the control of a regulatable transcriptional activator. In one embodiment, each nucleic acid encoding the first and second Rep proteins is under the control of the same regulatable transcriptional activator. In one embodiment, the transcriptional activator is a zinc finger transcriptional activator (ZF-TA).

[0646] In one embodiment, the nucleic acid encoding the Rep protein comprises a modified p19 promoter. In one embodiment, the nucleic acid encoding the Rep78 protein comprises a modified p19 promoter. In one embodiment, the modified p19 promoter is modified to reduce expression. In one embodiment, the modified p19 promoter comprises one or more mutations.

[0647] In one embodiment, the modified p19 promoter comprises the following nucleic acid sequence: acgcAAtGcCGCCGGgGGaGcGAACAAaGTtGTtGACGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAaTGGGgaTGGACaAAcATAGAACAGTAcctg (SEQ ID NO: 149)

[0648] In one embodiment, the nucleic acid sequence encoding a Rep protein comprises a modified start codon. In one embodiment, the nucleic acid sequence encoding a large Rep protein (e.g., Rep78) comprises a modified start codon. In one embodiment, the nucleic acid sequence encoding a large Rep protein (e.g., Rep78) comprises a modified start codon selected from ACC, AUC, CUG, and AGG. In such an embodiment, the nucleic acid sequence encoding a small Rep (e.g., Rep52) protein comprises a typical start codon. In such an embodiment, the nucleic acid sequence encoding a small Rep (e.g., Rep52) protein comprises an ATG start codon.

[0649] In one embodiment, the nucleic acid sequence encoding the large Rep protein, eg, the Rep78 protein, includes a CUG start codon.

[0650] In one embodiment, the nucleic acid encoding the modified Rep protein comprising a modified start codon comprises the following sequence (the modified start codon is in bold):

[0651] [ka] [ka]

[0652] In one embodiment, the Rep protein is a modified Rep protein. The modified Rep protein is Rep78. In one embodiment, the modified Rep protein has a lysine to arginine mutation at amino acid 84. One skilled in the art can generate modified Rep proteins using standard single-site mutagenesis PCR-based assays. DNA sequencing can be used, for example, to detect Rep proteins with amino acid substitutions.

[0653] In one embodiment, the modified Rep protein is a modified Rep78 and comprises the following sequence (the lysine to arginine mutation is in bold):

[0654] [ka] [ka]

[0655] In one embodiment, the nucleic acid encoding the Rep protein further comprises a nucleic acid encoding a ribozyme protein at its 3' end.

[0656] In one embodiment of any aspect, the or each Rep protein may include any combination of the features described above to optimize expression.

[0657] In one embodiment, the Rep protein comprises a modified p19 promoter and an amino acid substitution mutation. In one embodiment of any aspect, the Rep protein comprises a modified p19 promoter and a nucleic acid encoding a ribozyme at its 3' end. In one embodiment, the Rep protein comprises a modified start codon and a modified p19 promoter. In one embodiment, the Rep protein comprises a modified start codon and a nucleic acid encoding a ribozyme at its 3' end. In one embodiment, the Rep protein comprises a modified start codon and an amino acid substitution. In one embodiment, the Rep protein comprises an amino acid substitution and a nucleic acid encoding a ribozyme at its 3' end.

[0658] In one embodiment of any aspect, the Rep protein comprises an amino acid substitution, is a modified Rep protein, and further comprises a nucleic acid encoding a ribozyme at its 3' end. In one embodiment of any aspect, the Rep protein comprises a modified start codon, an amino acid substitution, and further comprises a nucleic acid encoding a ribozyme at its 3' end. In one embodiment of any aspect, the Rep protein comprises an amino acid substitution, comprises a modified p19 promoter, and comprises a modified start codon. In one embodiment of any aspect, the Rep protein comprises a modified p19 promoter, a modified start codon, and a nucleic acid encoding a ribozyme at its 3' end.

[0659] In one embodiment, the nucleic acid encoding the Rep protein comprising the modified start codon, amino acid substitutions, and modified p19 promoter comprises the following sequence (these features are shown in consecutive bold): [ka] [ka]

[0660] In one embodiment, the Rep protein comprising the modified start codon, amino acid substitutions, and modified p19 promoter comprises the following sequence:

[0661] [ka] [ka]

[0662] In one embodiment of any aspect, the Rep protein comprises a modified start codon, a modified p19 promoter, and is a modified Rep protein, further comprising a nucleic acid encoding a ribozyme at its 3' end.

[0663] In one embodiment of any aspect, the Rep protein comprises a CUG start codon, a modified p19 promoter, a lysine to arginine mutation at amino acid 84, and further comprises a nucleic acid encoding a ribozyme at its 3' end.

[0664] In one embodiment, a large Rep, e.g., Rep78, and a small Rep, e.g., Rep52, are under the control of separate or distinct regulatable elements such that expression of each Rep protein is independent of the other. In this way, small Rep expression can be easily controlled.

[0665] In one embodiment, the toxic protein is any viral protein known in the art, for example, any component or product of a virus. Viral proteins include, but are not limited to, structural proteins, nonstructural proteins, regulatory proteins, and accessory proteins for any virus. In one embodiment, the toxic protein is a capsid protein, an envelope protein, a membrane fusion protein, a nonstructural protein, or a viral accessory protein. In one embodiment, the toxic protein is the Rep protein described above.

[0666] Viral membrane fusion proteins are classified into four distinct classes, each identified by a characteristic structural conformation: (Class I) post-fusion conformations have a distinct central coiled-coil structure composed of a characteristic trimer of α-helical hairpins, such as the HIV glycoprotein gp41; (Class II) lack a central coiled-coil structure and contain a characteristic elongated β-sheet ectodomain structure that reassembles into a trimer of hairpins, such as the dengue virus E protein and the West Nile virus E protein; (Class III) structural conformations combine features from class I and class II viral membrane fusion proteins, such as the rabies virus glycoprotein G; and (Class IV) viral fusion proteins are fusion-associated small transmembrane (FAST) proteins, which do not form hairpins or trimers of hairpin structures themselves. FAST proteins are encoded by members of the non-enveloped Reoviridae family of viruses.

[0667] Viral nonstructural proteins are proteins encoded by the viral genome and expressed in infected cells. However, these proteins do not assemble within the virion; rather, viral nonstructural proteins perform important functions that affect the replication and assembly process. Some viral nonstructural protein functions include replicon formation, immunomodulation, and transactivation of viral structural protein-encoding genes. For example, in hepatitis C virus, viral nonstructural proteins interact with the cellular vesicle membrane transport protein hVAP-33 to assemble the replicon. The viral nonstructural 4b (NS4B) protein modifies the host cell membrane and initiates the replication complex formation process. Other viral nonstructural proteins, such as NS5A, NS5B, and NS3, are also recruited to the complex, and NS4B interacts with them to bind to viral RNA. An exemplary immunomodulatory protein is the viral nonstructural protein NS1 in West Nile virus, which prevents complement activation through binding to the complement regulatory protein factor H.

[0668] Viral accessory proteins, also known as auxiliary proteins, are encoded by the genome of retroviruses. Most viral accessory proteins only perform their function in specific cell types and do not significantly affect viral replication. However, in certain instances, the function of viral accessory proteins may be necessary to maintain viral replication.

[0669] In one embodiment, the toxic gene is a Cas protein. Exemplary Cas proteins include Cpf1, C2c1, C2c3, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas100, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, These include, but are not limited to, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, C2c1, C2c3, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, and Cas13c.

[0670] In one embodiment, the Cas protein is, for example, Cas9 or a Cas9 variant isolated from the bacterium Streptococcus pyogenes (SpCas9). CRISPR-associated nuclease associates with a guide RNA (gRNA) that guides the nuclease to a desired target sequence, for example, a protospacer adjacent motif (PAM) sequence downstream of the target sequence for cleavage. When Cas9 recognizes the PAM sequence (5'-NGG-3 in the case of SpCas9, where N is any nucleotide), a double-strand break (DSB) occurs at the target locus. Cas9 activity is the collective force of two parts of the protein: a recognition lobe that senses the complementary sequence of gRNA and a nuclease lobe that cleaves DNA.

[0671] In one embodiment, the Cas protein is an enhanced specificity spCas9 (eSpCas9) variant, which is further described in Slaymaker, et al. Science. 2016;351(6268):84-88, which is incorporated herein by reference in its entirety.

[0672] In one embodiment, Cas protein is a natural variant of Cas.Cas9 variants include, for example, Staphylococcus aureus (SaCas9), Streptococcus thermophilus (StCas9), Neisseria meningitidis (NmCas9), Francisella novicida (FnCas9) and Campylobacter jejuni (CjCas9), to name a few, in CRISPR experiments.Nuclease can be determined based on preferred PAM sequence or size, for example, SaCas9 nuclease is about 1 kb smaller in size than SpCas9, so it can be more easily packaged into viral vectors. For example, CasX and CasY (Burstein, David, et al. New CRISPR-Cas systems from uncultivated microbes. Nature 542.7640(2017):237, incorporated by reference in its entirety) are two of the most compact naturally occurring CRISPR variants.

[0673] The sequences of Cas9 from various species are known in the art, for example, Cas9 from S. aureus (saCas9) has the sequence of SEQ ID NO: 154.

[0674] SEQ ID NO: 154 is the amino acid sequence encoding Cas9 of Staphylococcus aureus. [ka]

[0675] In one embodiment, the Cas protein is Cas9 from Campylobacter jejuni (C. jejuni), which C. jejuni Cas9 (CjCas9) is further described, for example, in International Patent Application WO2016021973A1, the entire contents of which are incorporated herein by reference.

[0676] SEQ ID NO: 155 is the amino acid sequence encoding CjCas9. [ka] [ka]

[0677] In one embodiment, the Cas protein is Cas12a (also known as Cpf1). Cas9 requires a guanine-rich PAM sequence (NGG), making it less suitable for targeting AT-rich sequences. Zetsche et al. have characterized a nuclease (see, e.g., US2016 / 0208243 for sequences and variants, incorporated by reference in its entirety) that can be used to target AT-rich DNA sequences. Cpf1 generates staggered double-strand breaks in target DNA rather than the blunt-end breaks generated by SpCas9, making it useful for experiments relying on HDR repair success. Cpf1 is also smaller than SpCas9 and does not require tra...

Claims

[Claim 1] The invention described in the specification.