Pharmaceutical combinations of HBV-targeting therapeutic oligonucleotides and TLR7 agonists for HBV treatment.

A combination of HBV-targeting therapeutic oligonucleotides and TLR7 agonists addresses the limitations of current HBV treatments by enhancing immune response and achieving reduced HBsAg and HBV-DNA levels, paving the way for a functional cure.

JP2026069791APending Publication Date: 2026-04-24F HOFFMANN LA ROCHE & CO AG
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025196810
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-08-05
Filing Date
2025-11-17
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Current treatments for chronic hepatitis B virus (HBV) infection, such as nucleos(t)ide analogs, fail to achieve a functional cure due to low levels of hepatitis B surface antigen (HBsAg) clearance and lack of anti-HBs antibodies, necessitating a combination therapy to address viral antigens and enhance immune response.

Method used

A combination therapy comprising an HBV-targeting therapeutic oligonucleotide, such as RNAi or antisense oligonucleotides, and a TLR7 agonist, administered via different routes to enhance immune activation and HBsAg reduction, achieving improved serum HBV-DNA reduction and delayed rebound at lower doses.

Benefits of technology

The combination therapy significantly reduces serum HBV-DNA and HBsAg levels, offering a broader therapeutic range and improved efficacy compared to single-component treatments, potentially leading to a functional cure by enhancing immune response and reducing viral persistence.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026069791000109
    Figure 2026069791000109
  • Figure 2026069791000110
    Figure 2026069791000110
  • Figure 2026069791000111
    Figure 2026069791000111
Patent Text Reader

Abstract

This provides a combination of pharmaceuticals for treating hepatitis B virus infection. [Solution] A therapeutic oligonucleotide and formula (I) or (II): TIFF2026069791000108.tif48137 Alternatively, pharmaceutical combinations comprising or comprising a pharmaceutically acceptable salt, enantiomer, or diastereomer of TLR7 agonist thereof are provided.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Field of Invention The present invention relates to compositions and methods for treating hepatitis B virus infection. In particular, the present invention relates to a combination therapy for use in treating patients with chronic hepatitis B, comprising administering an HBV-targeting therapeutic oligonucleotide and a TLR7 agonist. [Background technology]

[0002] background HBV infection remains a major global health problem, affecting an estimated 350 million chronic carriers. Approximately 25% of carriers can be predicted to die from chronic hepatitis, cirrhosis, or liver cancer. Hepatitis B virus is the second most important carcinogen after tobacco and causes 60-80% of all primary liver cancers.

[0003] The outer envelope protein of HBV is collectively known as the hepatitis B surface antigen (HBsAg). HBsAg consists of three related polypeptides called S, M, and L, encoded by overlapping open reading frames (ORFs). The smallest envelope protein is S, a 226-amino acid molecule called S-ORF. M and L are produced from upstream translation initiation sites, adding 55 and 108 amino acids, respectively, to S. The HBV S, M, and L glycoproteins are found on the viral envelope of intact infectious HBV virions called Dane particles. All three are produced and secreted in very excessive amounts to form non-infectious subviral spherical and filamentous particles (both called decoy particles) found in the blood of chronic HBV patients. The amount of HBsAg on the surface of decoy particles is thought to inhibit humoral immunity and spontaneous clearance in patients with chronic HBV infection (CHB).

[0004] The current standard treatment for chronic HBV infection is treatment with oral nucleoside(tide) analogs such as entecavir or tenofovir, which suppress HBV replication by inhibiting HBV DNA synthesis but do not directly act on viral antigens such as HBsAg. Nucleoside(tide) analogs show only low levels of HBsAg clearance, even with long-term treatment. In this respect, patients with chronic hepatitis B exhibit a very weak HBV T cell response and lack anti-HBs antibodies, which is thought to be one reason why these patients are unable to clear the virus.

[0005] A clinically important goal is to achieve functional cure of chronic HBV infection, defined as HBsAg seroconversion and serum HBV-DNA removal. This is expected to result in a sustained response, thereby preventing the development of cirrhosis and liver cancer and extending survival time. Currently, chronic HBV infection cannot be completely eradicated due to the long-term or persistent nature of the viral genome as covalently closed circular DNA (cccDNA) within the nucleus of infected hepatocytes. Complete cure from chronic HBV infection would require the removal of this cccDNA from aa-infected hepatocytes.

[0006] The review article Soriano et al 2017 Expert Opinion on Investigational Drugs Vol.26, pp 843 describes the current state of drug development aimed at achieving either a functional or complete cure for HBV. The article highlights some of the more than 30 drugs currently being tested in HBV therapy, noting that any effective treatment resulting in a cure is likely to be viral-targeted therapy. It also mentions the need for a combination of therapy and immunotherapy.

[0007] Toll-like receptors (TLR7s) are components of the innate immune response to viral infections and are primarily expressed on plasmacytoid cells and B cells. Altered responsiveness of such immune cells may contribute to a reduced innate immune response during chronic viral infections. Therefore, agonist-induced activation of TLR7s represents a possible approach for the treatment of chronic viral infections using immunotherapy. Several TLR agonists, including GS-9620, have been tested in clinical trials. Alternative TLR7 agonists are described in International Publications 2006 / 066080, 2016 / 055553, and 2016 / 91698.

[0008] Antisense oligonucleotides are essentially single-stranded oligonucleotides that can regulate the expression of target genes by hybridizing to target nucleic acids. Target regulation may be downregulation by RNase H-mediated degradation or transcriptional blockade. Antisense oligonucleotides can also upregulate targets, for example, through splice switching or microRNA repression. For targets in the liver, GalNAc conjugation has proven highly effective for delivering antisense oligonucleotides. International Publications 2014 / 179627 and 2015 / 173208 describe HBV treatment in hepatocytes by degradation of HBV mRNA using single-stranded antisense oligonucleotides in combination with GalNAc conjugation. Various combination therapies, including the TLR7 agonist GS-9620, are briefly mentioned in International Publication 2015 / 173208.

[0009] International Publication No. 2016 / 077321 describes HBV treatment in hepatocytes by degradation of HBV mRNA using double-stranded siRNA in combination with GalNAc conjugation on the sense strand. Various combination therapies, including TLR7 agonists, are briefly mentioned.

[0010] To the best of our knowledge, no specific combination of therapeutic oligonucleotides and TLR7 agonists has been tested in vitro or in vivo.

[0011] Purpose of the invention This invention identifies novel combinations of therapeutic oligonucleotides and TLR7 agonists targeting HBV, which offer advantages over single-compound treatment in terms of long-term serum HBV-DNA reduction and delayed rebound in HBsAg. Furthermore, when using combination therapy, significantly improved effects can be achieved at 3 to 5 times lower doses compared to drug concentrations used in single-component treatment, and essentially the same effect can be achieved at 3 to 5 times lower doses compared to the same combination at high doses, thus achieving an expanded therapeutic range with combination therapy. [Overview of the Initiative]

[0012] Summary of the Invention One embodiment of the present invention comprises or comprises a pharmaceutical combination comprising a first medical compound which is a therapeutic oligonucleotide and a second medical compound which is a TLR7 agonist of formula (I) or (II) as defined below. A preferred embodiment of the present invention comprises or comprises a pharmaceutical combination comprising a first medical compound which is an RNAi oligonucleotide (preferably an oligonucleotide for reducing the expression of HBsAg mRNA, the oligonucleotide comprising an antisense chain of 19 to 30 nucleotides in length, the antisense chain comprising a region complementary to the sequence of HBsAg mRNA shown in ACAANAAUCCUCACAAUA (SEQ ID NO: 33)) and a second medical compound which is a TLR7 agonist of formula (I) or (II) as defined below. Another embodiment of the present invention is A The pharmaceutical combination comprises or consists of a first medical compound which is an antisense oligonucleotide, preferably a 13-22 nucleotide long GalNAc conjugate antisense oligonucleotide having a sequence of at least 12 nucleotides that is 100% complementary to the sequence of positions 1530-1602 of Sequence ID No. 1, and a second medical compound which is a TLR7 agonist of formula (I) or (II) as defined below.

[0013] Equations (I) and (II): [ka] In the formula, X is either CH2 or S, In formula (I), R1 is -OH or -H, and R2 is 1-hydroxypropyl or hydroxymethyl. In formula (II), R1 is -OH or -H or acetoxy, and R2 is 1-acetoxypropyl or 1-hydroxypropyl or 1-hydroxymethyl or acetoxy(cyclopropyl)methyl or acetoxy(propyne-1-yl)methyl. or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0014] A further aspect of the present invention relates to a combination of pharmaceuticals for use in the treatment of HBV-infected individuals, particularly those with chronic HBV.

[0015] A further aspect of the present invention is the use of a therapeutic oligonucleotide in the manufacture of a first pharmaceutical for treating hepatitis B virus infection, wherein the first pharmaceutical is the therapeutic oligonucleotide described in this application, and the first pharmaceutical is administered in combination with a second pharmaceutical, wherein the second pharmaceutical is a TLR7 agonist described in this application.

[0016] In one embodiment, the therapeutic oligonucleotide compound (first pharmaceutical or first medical compound) is formulated for subcutaneous injection, and the TLR7 agonist compound (second pharmaceutical or second medical compound) is formulated for oral administration. Since the medical compounds are administered via two different routes of administration, they can follow different dosing schedules. For optimal combined effect, the first and second medical compounds are administered at intervals of less than one month, e.g., less than one week, e.g., two days, e.g., on the same day.

[0017] A further aspect of the present invention is a kit of parts comprising a first medical compound (first pharmaceutical) and a package insert containing instructions for administering a second medical compound (second pharmaceutical) in the treatment of HBV. In one embodiment, the kit of parts comprises both the first and second medical compounds.

[0018] A further aspect of the present invention is a method for treating hepatitis B virus infection, comprising administering a therapeutically effective amount of a therapeutic oligonucleotide (first pharmaceutical) described in this application in combination with a therapeutically effective amount of a TLR7 agonist (second pharmaceutical) described in this application to a subject infected with hepatitis B virus, such as a chronically infected individual.

[0019] In a very preferred embodiment, the therapeutic oligonucleotide referred to in this application is an RNAi oligonucleotide, preferably a small interfering RNA (siRNA), preferably an RNAi oligonucleotide or siRNA for reducing the expression of HBsAg mRNA. In a different embodiment, the therapeutic oligonucleotide is an antisense oligonucleotide, preferably a GalNAc-conjugated antisense oligonucleotide, preferably an antisense oligonucleotide targeting HBV or a GalNAc-conjugated antisense oligonucleotide. [Brief explanation of the drawing]

[0020] [Figure 1-1]Exemplary antisense oligonucleotide conjugates exhibiting various stereoisomers are illustrated. Oligonucleotides are represented as either dashed lines (A-D), “oligonucleotides” (E-H and K), or T2 (I-J), with the asialocryprotein receptor targeting conjugate moiety being a trivalent N-acetylgalactosamine moiety. Compounds A-D include a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In compounds A and B, the oligonucleotide is directly bound to the asialocryprotein receptor targeting conjugate moiety without a linker. In compounds C and D, the oligonucleotide is bound to the asialocryprotein receptor targeting conjugate moiety via a C6 linker. Compounds E-J include commercially available trebler brancher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. Compound K consists of monomeric GalNAc phosphoramidite, which is added to the oligonucleotide while it remains on a solid support as part of the synthesis, with X=S or O and n=1-3 (see International Publication No. 2017 / 178656). Figures 1B and 1D, also referred to herein as GalNAc2 or GN2, represent the absence and presence of a C6 linker, respectively. [Figure 1-2]Exemplary antisense oligonucleotide conjugates exhibiting various stereoisomers are illustrated. Oligonucleotides are represented as either dashed lines (A-D), “oligonucleotides” (E-H and K), or T2 (I-J), with the asialocryprotein receptor targeting conjugate moiety being a trivalent N-acetylgalactosamine moiety. Compounds A-D include a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In compounds A and B, the oligonucleotide is directly bound to the asialocryprotein receptor targeting conjugate moiety without a linker. In compounds C and D, the oligonucleotide is bound to the asialocryprotein receptor targeting conjugate moiety via a C6 linker. Compounds E-J include commercially available trebler brancher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. Compound K consists of monomeric GalNAc phosphoramidite, which is added to the oligonucleotide while it remains on a solid support as part of the synthesis, with X=S or O and n=1-3 (see International Publication No. 2017 / 178656). Figures 1B and 1D, also referred to herein as GalNAc2 or GN2, represent the absence and presence of a C6 linker, respectively. [Figure 1-3]Exemplary antisense oligonucleotide conjugates exhibiting various stereoisomers are illustrated. Oligonucleotides are represented as either dashed lines (A-D), “oligonucleotides” (E-H and K), or T2 (I-J), with the asialocryprotein receptor targeting conjugate moiety being a trivalent N-acetylgalactosamine moiety. Compounds A-D include a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In compounds A and B, the oligonucleotide is directly bound to the asialocryprotein receptor targeting conjugate moiety without a linker. In compounds C and D, the oligonucleotide is bound to the asialocryprotein receptor targeting conjugate moiety via a C6 linker. Compounds E-J include commercially available trebler brancher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. Compound K consists of monomeric GalNAc phosphoramidite, which is added to the oligonucleotide while it remains on a solid support as part of the synthesis, with X=S or O and n=1-3 (see International Publication No. 2017 / 178656). Figures 1B and 1D, also referred to herein as GalNAc2 or GN2, represent the absence and presence of a C6 linker, respectively. [Figure 1-4]Exemplary antisense oligonucleotide conjugates exhibiting various stereoisomers are illustrated. Oligonucleotides are represented as either dashed lines (A-D), “oligonucleotides” (E-H and K), or T2 (I-J), with the asialocryprotein receptor targeting conjugate moiety being a trivalent N-acetylgalactosamine moiety. Compounds A-D include a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In compounds A and B, the oligonucleotide is directly bound to the asialocryprotein receptor targeting conjugate moiety without a linker. In compounds C and D, the oligonucleotide is bound to the asialocryprotein receptor targeting conjugate moiety via a C6 linker. Compounds E-J include commercially available trebler brancher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. Compound K consists of monomeric GalNAc phosphoramidite, which is added to the oligonucleotide while it remains on a solid support as part of the synthesis, with X=S or O and n=1-3 (see International Publication No. 2017 / 178656). Figures 1B and 1D, also referred to herein as GalNAc2 or GN2, represent the absence and presence of a C6 linker, respectively. [Figure 1-5]Exemplary antisense oligonucleotide conjugates exhibiting various stereoisomers are illustrated. Oligonucleotides are represented as either dashed lines (A-D), “oligonucleotides” (E-H and K), or T2 (I-J), with the asialocryprotein receptor targeting conjugate moiety being a trivalent N-acetylgalactosamine moiety. Compounds A-D include a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In compounds A and B, the oligonucleotide is directly bound to the asialocryprotein receptor targeting conjugate moiety without a linker. In compounds C and D, the oligonucleotide is bound to the asialocryprotein receptor targeting conjugate moiety via a C6 linker. Compounds E-J include commercially available trebler brancher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. Compound K consists of monomeric GalNAc phosphoramidite, which is added to the oligonucleotide while it remains on a solid support as part of the synthesis, with X=S or O and n=1-3 (see International Publication No. 2017 / 178656). Figures 1B and 1D, also referred to herein as GalNAc2 or GN2, represent the absence and presence of a C6 linker, respectively. [Figure 1-6]Exemplary antisense oligonucleotide conjugates exhibiting various stereoisomers are illustrated. Oligonucleotides are represented as either dashed lines (A-D), “oligonucleotides” (E-H and K), or T2 (I-J), with the asialocryprotein receptor targeting conjugate moiety being a trivalent N-acetylgalactosamine moiety. Compounds A-D include a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In compounds A and B, the oligonucleotide is directly bound to the asialocryprotein receptor targeting conjugate moiety without a linker. In compounds C and D, the oligonucleotide is bound to the asialocryprotein receptor targeting conjugate moiety via a C6 linker. Compounds E-J include commercially available trebler brancher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. Compound K consists of monomeric GalNAc phosphoramidite, which is added to the oligonucleotide while it remains on a solid support as part of the synthesis, with X=S or O and n=1-3 (see International Publication No. 2017 / 178656). Figures 1B and 1D, also referred to herein as GalNAc2 or GN2, represent the absence and presence of a C6 linker, respectively. [Figure 1-7]Exemplary antisense oligonucleotide conjugates exhibiting various stereoisomers are illustrated. Oligonucleotides are represented as either dashed lines (A-D), “oligonucleotides” (E-H and K), or T2 (I-J), with the asialocryprotein receptor targeting conjugate moiety being a trivalent N-acetylgalactosamine moiety. Compounds A-D include a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In compounds A and B, the oligonucleotide is directly bound to the asialocryprotein receptor targeting conjugate moiety without a linker. In compounds C and D, the oligonucleotide is bound to the asialocryprotein receptor targeting conjugate moiety via a C6 linker. Compounds E-J include commercially available trebler brancher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. Compound K consists of monomeric GalNAc phosphoramidite, which is added to the oligonucleotide while it remains on a solid support as part of the synthesis, with X=S or O and n=1-3 (see International Publication No. 2017 / 178656). Figures 1B and 1D, also referred to herein as GalNAc2 or GN2, represent the absence and presence of a C6 linker, respectively. [Figure 1-8]Exemplary antisense oligonucleotide conjugates exhibiting various stereoisomers are illustrated. Oligonucleotides are represented as either dashed lines (A-D), “oligonucleotides” (E-H and K), or T2 (I-J), with the asialocryprotein receptor targeting conjugate moiety being a trivalent N-acetylgalactosamine moiety. Compounds A-D include a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In compounds A and B, the oligonucleotide is directly bound to the asialocryprotein receptor targeting conjugate moiety without a linker. In compounds C and D, the oligonucleotide is bound to the asialocryprotein receptor targeting conjugate moiety via a C6 linker. Compounds E-J include commercially available trebler brancher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. Compound K consists of monomeric GalNAc phosphoramidite, which is added to the oligonucleotide while it remains on a solid support as part of the synthesis, with X=S or O and n=1-3 (see International Publication No. 2017 / 178656). Figures 1B and 1D, also referred to herein as GalNAc2 or GN2, represent the absence and presence of a C6 linker, respectively. [Figure 1-9]Exemplary antisense oligonucleotide conjugates exhibiting various stereoisomers are illustrated. Oligonucleotides are represented as either dashed lines (A-D), “oligonucleotides” (E-H and K), or T2 (I-J), with the asialocryprotein receptor targeting conjugate moiety being a trivalent N-acetylgalactosamine moiety. Compounds A-D include a dyridine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In compounds A and B, the oligonucleotide is directly bound to the asialocryprotein receptor targeting conjugate moiety without a linker. In compounds C and D, the oligonucleotide is bound to the asialocryprotein receptor targeting conjugate moiety via a C6 linker. Compounds E-J include commercially available trebler brancher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. Compound K consists of monomeric GalNAc phosphoramidite, which is added to the oligonucleotide while it remains on a solid support as part of the synthesis, with X=S or O and n=1-3 (see International Publication No. 2017 / 178656). Figures 1B and 1D, also referred to herein as GalNAc2 or GN2, represent the absence and presence of a C6 linker, respectively. [Figure 2] Structural formula of CMP No. 29_1. Its pharmaceutically active salt contains monovalent or divalent cations, such as Na+, K+, and Ca2+, or mixtures thereof associated with the compound. [Figure 3] Structural formula of CMP No. 23_1. Its pharmaceutically active salt contains monovalent or divalent cations, such as Na+, K+, and Ca2+, or mixtures thereof associated with the compound. [Figure 4] Structural formula of CMP No. 16_1. Its pharmaceutically active salt contains monovalent or divalent cations, such as Na+, K+, and Ca2+, or mixtures thereof associated with the compound. [Figure 5] Structural formula of CMP No. 15_1. Its pharmaceutically active salt contains monovalent or divalent cations, such as Na+, K+, and Ca2+, or mixtures thereof associated with the compound. [Figure 6]Structural formula of CMP No. 15_2. Its pharmaceutically acceptable salt contains monovalent or divalent cations, such as Na+, K+, and Ca2+, or mixtures thereof associated with the compound. [Figure 7] Structural formula of CMP No. 26_1. Its pharmaceutically active salt contains monovalent or divalent cations, such as Na+, K+, and Ca2+, or mixtures thereof associated with the compound. [Figure 8] Structural formula of CMP No. 20_1. Its pharmaceutically acceptable salt contains monovalent or divalent cations, such as Na+, K+, and Ca2+, or mixtures thereof associated with the compound. [Figure 9A] This panel shows the effects of various single and combination treatments on HBV-DNA in serum from AAV / HBV mice. Panel A: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg every other day (QOD) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 1.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel B: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg weekly (QW) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 1.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel C: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg every other day (QOD) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 7.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel D: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg weekly (QW) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 7.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). [Figure 9B]This panel shows the effects of various single and combination treatments on HBV-DNA in serum from AAV / HBV mice. Panel A: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg every other day (QOD) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 1.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel B: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg weekly (QW) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 1.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel C: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg every other day (QOD) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 7.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel D: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg weekly (QW) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 7.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). [Figure 9C]This panel shows the effects of various single and combination treatments on HBV-DNA in serum from AAV / HBV mice. Panel A: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg every other day (QOD) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 1.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel B: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg weekly (QW) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 1.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel C: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg every other day (QOD) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 7.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel D: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg weekly (QW) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 7.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). [Figure 9D]This panel shows the effects of various single and combination treatments on HBV-DNA in serum from AAV / HBV mice. Panel A: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg every other day (QOD) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 1.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel B: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg weekly (QW) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 1.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel C: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg every other day (QOD) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 7.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel D: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg weekly (QW) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 7.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). [Figure 10A]This panel shows the effects of various single and combination treatments on HBsAg in serum from AAV / HBV mice. Panel A: Mice after treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg every other day (QOD) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 1.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel B: Mice after treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg weekly (QW) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 1.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel C: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg every other day (QOD) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 7.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel D: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg weekly (QW) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 7.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). [Figure 10B]This panel shows the effects of various single and combination treatments on HBsAg in serum from AAV / HBV mice. Panel A: Mice after treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg every other day (QOD) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 1.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel B: Mice after treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg weekly (QW) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 1.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel C: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg every other day (QOD) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 7.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel D: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg weekly (QW) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 7.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). [Figure 10C]This panel shows the effects of various single and combination treatments on HBsAg in serum from AAV / HBV mice. Panel A: Mice after treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg every other day (QOD) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 1.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel B: Mice after treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg weekly (QW) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 1.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel C: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg every other day (QOD) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 7.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel D: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg weekly (QW) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 7.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). [Figure 10D]This panel shows the effects of various single and combination treatments on HBsAg in serum from AAV / HBV mice. Panel A: Mice after treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg every other day (QOD) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 1.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel B: Mice after treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg weekly (QW) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 1.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel C: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg every other day (QOD) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 7.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). Panel D: After treatment with physiological saline (vehicle, dashed lines and circles); CMP No. VI (TLR7 agonist) administered at 100 mg / kg weekly (QW) (dashed line; rectangle); CMP No. 15_1 (anti-HBV ASO) administered at 7.5 mg / kg (dashed line; triangle); or a combination of both (solid lines and squares). [Figure 11] An example of RNAi target sites on a schematic diagram of the HBV genome structure is shown. [Figure 12] This report presents a single-dose evaluation of oligonucleotides for reducing HBsAg expression in HDI mice. [Figure 13] This graph shows the time course of plasma HBsAg levels during a specific administration regimen using HBsAg-targeted oligonucleotides. As shown in this example, the oligonucleotides demonstrated preclinical efficacy and maintained sufficiently reduced levels beyond the duration of administration. [Figure 14]The graph shows the results of HBsAg mapping in HeLa cells using a reporter assay. Unmodified siRNA targeting position 254 of the HBV genome was used as a positive control at specific concentrations. A commercially available silencer siRNA from Thermo Fisher was used as a negative control in these experiments. Error bars represent SEM results. [Figure 15] This study presents a genotype conservation comparison showing that a designed mismatch of the HBsAg-targeted oligonucleotide HBV-219 increases overall HBV genotype coverage. [Figure 16] This shows a vector designed for the psiCHECK2 reporter assay using HBV genotype A as the prototype sequence. [Figure 17] Several examples of oligonucleotides designed to evaluate the effect of introducing mismatches are shown. The oligonucleotide sequences of the parent and mismatched strands are aligned, and the mismatch position is indicated by a box. The corresponding reporter sequences used in the psiCHECK2 reporter assay are further shown. [Figure 18] This shows single-dose titration plots of oligonucleotides evaluated in mismatch tests, demonstrating that guide chain mismatches are acceptable in vivo. [Figure 19] An in vivo dose titration plot is shown demonstrating that the incorporation of mismatches into HBsAg-targeted oligonucleotides does not adversely affect in vivo efficacy. [Figure 20] Examples of chemically modified, double-stranded HBsAg-targeted oligonucleotides (HBV(s)-219) are shown. Darker shades represent 2'-O-methylribonucleotides, while lighter shades represent 2'-fluorodeoxyribonucleotides. [Figure 21A] This shows the results of immunohistochemical staining to detect the intracellular distribution of HBV core antigen (HBcAg) in hepatocytes. [Figure 21B] The RNA sequencing results, obtained by mapping the detected RNA transcript sequences to HBV pgRNA, are shown. [Figure 22A]This shows the time course of HBsAg mRNA expression after treatment with HBV(s)-219 oligonucleotide precursor HBV(s)-219P2, which targets HBsAg mRNA, and RNAi oligonucleotides that target HBV X antigen (HBxAg) mRNA, compared to the vehicle control, in a hydrodynamic injection (HDI) model of HBV. [Figure 22B] This shows the time course of HBsAg mRNA expression in the AAV-HBV model after treatment with HBV(s)-219P2, an HBV(s)-219 oligonucleotide precursor targeting HBsAg mRNA, and RNAi oligonucleotides targeting HBxAg mRNA, compared to the vehicle control. [Figure 23] The results of immunohistochemical staining showing the intracellular distribution of HBcAg in hepatocytes obtained from AAV-HBV models and HBV HDI models after treatment with HBV(s)-219 oligonucleotide targeting HBsAg mRNA, compared to vehicle controls and RNAi oligonucleotides targeting HBxAg mRNA (GalXC-HBVX). [Figure 24A] This study demonstrates the antiviral activity of HBV(s)-219 precursor 1 (HBV(s)-219 P1) in a PXB-HBV model. A cohort of nine mice was subcutaneously administered either 0 or 3 mg / kg of HBV(s)-219P1 in PBS for three weekly doses. Six mice from each cohort were analyzed for serum HBsAg and serum HBV DNA by non-terminal mandibular buccal hemorrhage at the indicated time points (Figures 24A and 24B). On day 28 after starting with the initial dose of HBV(s)-219P1, all remaining mice were euthanized, and liver biopsies were collected for liver HBV DNA (Figure 24C) and liver cccDNA (Figure 24D) by RT-qPCR. [Figure 24B]This study demonstrates the antiviral activity of HBV(s)-219 precursor 1 (HBV(s)-219 P1) in a PXB-HBV model. A cohort of nine mice was subcutaneously administered either 0 or 3 mg / kg of HBV(s)-219P1 in PBS for three weekly doses. Six mice from each cohort were analyzed for serum HBsAg and serum HBV DNA by non-terminal mandibular buccal hemorrhage at the indicated time points (Figures 24A and 24B). On day 28 after starting with the initial dose of HBV(s)-219P1, all remaining mice were euthanized, and liver biopsies were collected for liver HBV DNA (Figure 24C) and liver cccDNA (Figure 24D) by RT-qPCR. [Figure 24C] This study demonstrates the antiviral activity of HBV(s)-219 precursor 1 (HBV(s)-219 P1) in a PXB-HBV model. A cohort of nine mice was subcutaneously administered either 0 or 3 mg / kg of HBV(s)-219P1 in PBS for three weekly doses. Six mice from each cohort were analyzed for serum HBsAg and serum HBV DNA by non-terminal mandibular buccal hemorrhage at the indicated time points (Figures 24A and 24B). On day 28 after starting with the initial dose of HBV(s)-219P1, all remaining mice were euthanized, and liver biopsies were collected for liver HBV DNA (Figure 24C) and liver cccDNA (Figure 24D) by RT-qPCR. [Figure 24D] This study demonstrates the antiviral activity of HBV(s)-219 precursor 1 (HBV(s)-219 P1) in a PXB-HBV model. A cohort of nine mice was subcutaneously administered either 0 or 3 mg / kg of HBV(s)-219P1 in PBS for three weekly doses. Six mice from each cohort were analyzed for serum HBsAg and serum HBV DNA by non-terminal mandibular buccal hemorrhage at the indicated time points (Figures 24A and 24B). On day 28 after starting with the initial dose of HBV(s)-219P1, all remaining mice were euthanized, and liver biopsies were collected for liver HBV DNA (Figure 24C) and liver cccDNA (Figure 24D) by RT-qPCR. [Figure 25A]This study demonstrates that HBV(s)-219 precursor 2 (HBV(s)-219P2) enhances the antiviral activity of entecavir. In an HBV mouse hydrodynamic injection (HDI) model, a single dose of HBV(s)-219P2 was administered subcutaneously to mice on day 1, followed by daily oral administration of 500 ng / kg of entecavir (ETV) for 14 days. Circulating viral load (HBV DNA) was measured by qPCR (Figure 25A). Plasma HBsAg levels were measured by ELISA (Figure 25B). Liver HBV mRNA and pgRNA levels were measured by qPCR (Figure 25C). The results show a clear additive effect with combination therapy. ETV therapy alone does not demonstrate efficacy against circulating HBsAg or liver viral RNA. The antiviral activity of HBV(s)-219P2, as measured by HBsAg or HBV RNA, is not affected by co-administration of ETV. "BLOD" means "below the detection limit." [Figure 25B] This study demonstrates that HBV(s)-219 precursor 2 (HBV(s)-219P2) enhances the antiviral activity of entecavir. In an HBV mouse hydrodynamic injection (HDI) model, a single dose of HBV(s)-219P2 was administered subcutaneously to mice on day 1, followed by daily oral administration of 500 ng / kg of entecavir (ETV) for 14 days. Circulating viral load (HBV DNA) was measured by qPCR (Figure 25A). Plasma HBsAg levels were measured by ELISA (Figure 25B). Liver HBV mRNA and pgRNA levels were measured by qPCR (Figure 25C). The results show a clear additive effect with combination therapy. ETV therapy alone does not demonstrate efficacy against circulating HBsAg or liver viral RNA. The antiviral activity of HBV(s)-219P2, as measured by HBsAg or HBV RNA, is not affected by co-administration of ETV. "BLOD" means "below the detection limit." [Figure 25C]This study demonstrates that HBV(s)-219 precursor 2 (HBV(s)-219P2) enhances the antiviral activity of entecavir. In an HBV mouse hydrodynamic injection (HDI) model, a single dose of HBV(s)-219P2 was administered subcutaneously to mice on day 1, followed by daily oral administration of 500 ng / kg of entecavir (ETV) for 14 days. Circulating viral load (HBV DNA) was measured by qPCR (Figure 25A). Plasma HBsAg levels were measured by ELISA (Figure 25B). Liver HBV mRNA and pgRNA levels were measured by qPCR (Figure 25C). The results show a clear additive effect with combination therapy. ETV therapy alone does not demonstrate efficacy against circulating HBsAg or liver viral RNA. The antiviral activity of HBV(s)-219P2, as measured by HBsAg or HBV RNA, is not affected by co-administration of ETV. "BLOD" means "below the detection limit." [Figure 26A] This figure compares the HBsAg inhibitory activity of GalNac conjugate oligonucleotides targeting the S antigen (HBV(s)-219P2) or the X antigen (named GalXC-HBVX). The results show that HBVS-219P2 inhibits HBsAg for a longer period than GalXC-HBVX or equimolar combinations of both RNAi agents. Figure 26A shows that the location of the RNAi target site in the HBV genome affects HBsAg recovery dynamics in HBV-expressing mice. Figure 26B shows plasma HBsAg levels 2 weeks (left panel) and 9 weeks (right panel) after administration, demonstrating that targeting the HBVX coding region alone or in combination with HBV(s)-219P2 shortens the duration of activity. Individual animal data are shown. Some data points (brightest gray circles) were below the detection limit. [Figure 26B]This figure compares the HBsAg inhibitory activity of GalNac conjugate oligonucleotides targeting the S antigen (HBV(s)-219P2) or the X antigen (named GalXC-HBVX). The results show that HBVS-219P2 inhibits HBsAg for a longer period than GalXC-HBVX or equimolar combinations of both RNAi agents. Figure 26A shows that the location of the RNAi target site in the HBV genome affects HBsAg recovery dynamics in HBV-expressing mice. Figure 26B shows plasma HBsAg levels 2 weeks (left panel) and 9 weeks (right panel) after administration, demonstrating that targeting the HBVX coding region alone or in combination with HBV(s)-219P2 shortens the duration of activity. Individual animal data are shown. Some data points (brightest gray circles) were below the detection limit. [Figure 27A] Figure 27A shows the intracellular location of the HBV core antigen (HBcAg) in HBV-expressing mice treated with HBV(s)-219P2, GalXC-HBVX, or a 1:1 combination. Figure 27A shows representative hepatocytes in liver sections stained for HBcAg, obtained at weeks 1, 2, 6, 9, and 13 post-administration. Figure 27B shows the percentage of HBcAg-positive cells with nuclear staining in each animal (n=3 / group, 50 cells counted per animal, 2 weeks post-administration). Alternative sequences targeting within the X and S open reading frames were designed and tested. Figure 27C shows the intracellular distribution of HBcAg in hepatocytes obtained at weeks 2, 3, and 9 post-administration of alternative RNAi oligos targeting either the S or X antigen. [Figure 27B]Figure 27A shows the intracellular location of the HBV core antigen (HBcAg) in HBV-expressing mice treated with HBV(s)-219P2, GalXC-HBVX, or a 1:1 combination. Figure 27A shows representative hepatocytes in liver sections stained for HBcAg, obtained at weeks 1, 2, 6, 9, and 13 post-administration. Figure 27B shows the percentage of HBcAg-positive cells with nuclear staining in each animal (n=3 / group, 50 cells counted per animal, 2 weeks post-administration). Alternative sequences targeting within the X and S open reading frames were designed and tested. Figure 27C shows the intracellular distribution of HBcAg in hepatocytes obtained at weeks 2, 3, and 9 post-administration of alternative RNAi oligos targeting either the S or X antigen. [Figure 27C] Figure 27A shows the intracellular location of the HBV core antigen (HBcAg) in HBV-expressing mice treated with HBV(s)-219P2, GalXC-HBVX, or a 1:1 combination. Figure 27A shows representative hepatocytes in liver sections stained for HBcAg, obtained at weeks 1, 2, 6, 9, and 13 post-administration. Figure 27B shows the percentage of HBcAg-positive cells with nuclear staining in each animal (n=3 / group, 50 cells counted per animal, 2 weeks post-administration). Alternative sequences targeting within the X and S open reading frames were designed and tested. Figure 27C shows the intracellular distribution of HBcAg in hepatocytes obtained at weeks 2, 3, and 9 post-administration of alternative RNAi oligos targeting either the S or X antigen. [Figure 28] This document presents dose information based on cohort data from studies designed to evaluate the safety and tolerability of HBV(s)-219 in healthy patients, as well as the therapeutic efficacy of HBV(s)-219 in HBV patients. [Figure 29A-1] The chemical structures of HBV(s)-219 and HBV(s)-219P2 are shown. (Figure 29A) Chemical structure of HBV(s)-219. (Figure 29B) Chemical structure of HBV(s)-219P2. [Figure 29A-2] The chemical structures of HBV(s)-219 and HBV(s)-219P2 are shown. (Figure 29A) Chemical structure of HBV(s)-219. (Figure 29B) Chemical structure of HBV(s)-219P2. [Figure 29A-3] The chemical structures of HBV(s)-219 and HBV(s)-219P2 are shown. (Figure 29A) Chemical structure of HBV(s)-219. (Figure 29B) Chemical structure of HBV(s)-219P2. [Figure 29A-4] The chemical structures of HBV(s)-219 and HBV(s)-219P2 are shown. (Figure 29A) Chemical structure of HBV(s)-219. (Figure 29B) Chemical structure of HBV(s)-219P2. [Figure 29B-1] The chemical structures of HBV(s)-219 and HBV(s)-219P2 are shown. (Figure 29A) Chemical structure of HBV(s)-219. (Figure 29B) Chemical structure of HBV(s)-219P2. [Figure 29B-2] The chemical structures of HBV(s)-219 and HBV(s)-219P2 are shown. (Figure 29A) Chemical structure of HBV(s)-219. (Figure 29B) Chemical structure of HBV(s)-219P2. [Figure 29B-3] The chemical structures of HBV(s)-219 and HBV(s)-219P2 are shown. (Figure 29A) Chemical structure of HBV(s)-219. (Figure 29B) Chemical structure of HBV(s)-219P2. [Figure 29B-4] The chemical structures of HBV(s)-219 and HBV(s)-219P2 are shown. (Figure 29A) Chemical structure of HBV(s)-219. (Figure 29B) Chemical structure of HBV(s)-219P2. [Figure 30] This shows the effects of HBV-LNA (CMP number 15_1, the antisense oligonucleotide according to the present invention) and DCR-S219 (RNAi oligonucleotide according to the present invention, specifically siRNA) on the decrease in HBsAg titer over time. "DCR-AUD1" (a control siRNA targeting sequences other than HBV) and "vehicle" (sterile water) are negative controls. In Figure 30, the dose of HBV-LNA is 6.6 mg / kg and the dose of DCR-S219 is 9 mg / kg, but the molar dose of HBV-LNA is approximately three times that of DCR-S219. [Modes for carrying out the invention]

[0021] definition Oligonucleotides As used herein, the term “oligonucleotide” is defined as is generally understood by those skilled in the art to be a molecule comprising two or more covalently bonded nucleosides. Such covalently bonded nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are typically prepared in the laboratory by solid-phase chemical synthesis, followed by purification and isolation. When referring to the sequence of an oligonucleotide, the sequence or order of the nucleic acid base portions of the covalently bonded nucleotide or nucleoside, or their modifications, is referred to. The oligonucleotides of the present invention are artificial, chemically synthesized, and typically purified or isolated. The oligonucleotides of the present invention may contain one or more modified nucleosides or nucleotides, such as 2'-saccharide-modified nucleosides.

[0022] Furthermore, oligonucleotides are short nucleic acids, for example, less than 100 nucleotides in length. Oligonucleotides may be single-stranded or double-stranded. Oligonucleotides may or may not have a double-stranded region. A range of non-limiting examples include, but are not limited to, small interfering RNA (siRNA), microRNA (miRNA), short hairpin RNA (shRNA), Dicer substrate interfering RNA (dsiRNA), antisense oligonucleotides, short siRNA, or single-stranded siRNA. In some embodiments, double-stranded oligonucleotides are RNAi oligonucleotides.

[0023] synthesis As used herein, the term “synthetic” means a nucleic acid or other molecule that is artificially synthesized (e.g., using a machine (e.g., a solid nucleic acid synthesizer)) or otherwise does not originate from a natural source (e.g., a cell or organism) that normally produces molecules.

[0024] Double-stranded oligonucleotides As used herein, the term “double-stranded oligonucleotide” refers to an oligonucleotide in substantially double-stranded form. In some embodiments, double-stranded oligonucleotides The complementary base pairing of the double-stranded region of a rheotide is formed between the antiparallel sequences of nucleotides of covalently separated nucleic acid strands. In some embodiments, the complementary base pairing of the double-stranded region of a double-stranded oligonucleotide is formed between the antiparallel sequences of nucleotides of covalently bonded nucleic acid strands. In some embodiments, the complementary base pairing of the double-stranded region of a double-stranded oligonucleotide is formed from single-stranded nucleic acids folded (e.g., via hairpins) to provide a complementary antiparallel sequence of nucleotides to base pair together. In some embodiments, a double-stranded oligonucleotide comprises two covalently separated nucleic acid strands that are fully double-stranded with each other. However, in some embodiments, a double-stranded oligonucleotide comprises two covalently separated nucleic acid strands that are partially double-stranded, e.g., having overhangs at one or both ends. In some embodiments, a double-stranded oligonucleotide comprises partially complementary antiparallel sequences of nucleotides and may therefore have one or more mismatches, which may include internal mismatches or terminal mismatches.

[0025] chain As used herein, the term “chain” refers to a single continuous sequence of nucleotides linked together by internucleotide bonds (e.g., phosphodiester bonds, phosphorothioate bonds). In some embodiments, the chain has two free ends, for example, a 5' end and a 3' end.

[0026] Double chain As used herein, the term “double heddi” in relation to nucleic acids (e.g., oligonucleotides) refers to a structure formed by the complementary base pairing of two antiparallel nucleotides.

[0027] Overhang As used herein, the term “overhang” refers to a terminal unpaired nucleotide (or more) resulting from one strand or region that extends beyond the end of the complementary strand forming the double helix. In some embodiments, the overhang includes one or more unpaired nucleotides extending from the 5' or 3' terminal double helix region of the double-stranded oligonucleotide. In certain embodiments, the overhang is a 3' or 5' overhang on the antisense or sense strand of the double-stranded oligonucleotide.

[0028] loop As used herein, the term “loop” refers to an unpaired region of a nucleic acid (e.g., oligonucleotide) adjacent to two antiparallel regions of a nucleic acid that are sufficiently complementary to each other so that, under appropriate hybridization conditions (e.g., in phosphate buffer, in a cell), the two antiparallel regions adjacent to the unpaired region hybridize to form a double helix (called a “stem”).

[0029] RNAi oligonucleotides As used herein, the term "RNAi oligonucleotide" means either (a) a double-stranded oligonucleotide having a sense strand (passenger) and an antisense strand (guide), wherein the antisense strand or a portion thereof is used by the Argonaut 2 (Ago2) endonuclease in cleaving target mRNA, or (b) a single-stranded oligonucleotide having a single-stranded antisense strand, wherein the antisense strand (or a portion thereof) is used by the Ago2 endonuclease in cleaving target mRNA.

[0030] RNAi agents The terms "iRNA," "RNAi agent," and "iRNA agent" are used interchangeably in this specification. "RNA interfering agent" and "RNA interfering agent" as used herein mean active agents, such as RNAi oligonucleotides, that contain RNA nucleosides and mediate targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. iRNAs direct sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). iRNAs regulate, for example, inhibit, the expression of target nucleic acids in cells, such as cells within a subject, such as a mammalian subject. RNAi agents include single-stranded RNAi agents and double-stranded siRNAs, as well as short hairpin RNA (shRNA). The oligonucleotides of the present invention, or their sequence nucleotide sequences, may be in the form of an RNAi agent or may form part of an RNAi agent such as siRNA or shRNA. In some embodiments of the present invention, the oligonucleotides of the present invention, or their sequence nucleotide sequences, are RNAi agents such as siRNAs.

[0031] siRNA The term "siRNA" refers to a small, interfering ribonucleic acid RNAi agent, a type of double-stranded RNA molecule, also known in the art as short interfering RNA or silencing RNA. siRNA typically comprises a sense strand (also called a passenger strand) and an antisense strand (also called a guide strand), each strand being 17–30 nucleotides long, typically 19–25 nucleosides long. The sense strand is complementary, such that the antisense strand is fully complementary to the target nucleic acid (preferably a mature mRNA sequence), and the sense strand is complementary to the antisense strand; therefore, the sense and antisense strands form a double helix or double-stranded region. siRNA strands can form a blunt-ended double helix, or, advantageously, the 3' ends of the sense and antisense strands can form a 3' overhang of, for example, 1, 2, or 3 nucleosides. In some embodiments, both the sense and antisense strands have a 2nt 3' overhang. Therefore, the double-stranded region can be, for example, 17-25 nucleotides long, or for example, 21-23 nucleotides long.

[0032] Once inside the cell, the antisense strand is incorporated into a RISC complex that mediates targeted degradation or inhibition of the target nucleic acid. siRNA typically contains a modified nucleoside in addition to the RNA nucleoside, or in some embodiments, all nucleotides of the siRNA strand may be modified (sense 2' sugar modified nucleosides such as LNA (see, e.g., International Publication Nos. 2004083430 and 2007085485), 2'-fluoro, 2'-O-methyl, or 2'-O-methoxyethyl may be incorporated into the siRNA). In some embodiments, the passenger strand of the siRNA can be discontinuous (see, e.g., International Publication No. 2007107162). The incorporation of thermally destabilized nucleotides occurring in the seed region of the siRNA antisense strand has been reported to be useful in reducing the off-target activity of the siRNA (see, e.g., International Publication No. 18098328).

[0033] In some embodiments, the dsRNA agent, such as the siRNA of the present invention, comprises at least one modified nucleotide. In some embodiments, substantially all of the nucleotides in the sense strand are modified; substantially all of the nucleotides in the antisense strand are modified; or substantially all of the nucleotides in the sense strand and substantially all of the nucleotides in the antisense strand are modified. In yet another embodiment, all of the nucleotides in the sense strand are modified; all of the nucleotides in the antisense strand are modified; or all of the nucleotides in the sense strand and all of the nucleotides in the antisense strand are modified.

[0034] In some embodiments, modified nucleotides include deoxy-nucleotides, 3'-terminal deoxythymine (dT) nucleotides, 2'-O-methyl-modified nucleotides, 2'-fluoro-modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, unlocked nucleotides, conformation-restricted nucleotides, and constrained nucleotides. Chill nucleotides, unbasic nucleotides, 2'-amino modified nucleotides, 2'-O-allyl modified nucleotides, 2'-C-alkyl modified nucleotides, 2'-hydroxyl modified nucleotides, 2'-methoxyethyl modified nucleotides, 2'-O-alkyl modified nucleotides, morpholino nucleotides, siRNA can be independently selected from the group consisting of phosphoramidates, non-natural base-containing nucleotides, unbound nucleotides, tetrahydropyran-modified nucleotides, 1,5-anhydrous hexitol-modified nucleotides, cyclohexenyl-modified nucleotides, phosphorothioate-containing nucleotides, methylphosphonate-containing nucleotides, 5'-phosphonate-containing nucleotides, 5'-phosphate mimetic-containing nucleotides, glycol-modified nucleotides, and 2-O-(N-methylacetamide)-modified nucleotides, as well as combinations thereof. Preferably, the siRNA contains a 5'-phosphate group or a 5'-phosphate mimetic at the 5' end of the antisense strand. In some embodiments, the 5' end of the antisense strand is an RNA nucleoside.

[0035] In one embodiment, the dsRNA agent further comprises at least one phosphorothioate or methylphosphonate internucleotide bond. The phosphorothioate or methylphosphonate internucleotide bond may be at the 3' end of one or both strands (e.g., antisense strand or sense strand), or the phosphorothioate or methylphosphonate internucleoside bond may be at the 5' end of one or both strands (e.g., antisense strand or sense strand), or the phosphorothioate or methylphosphonate internucleoside bond may be at both the 5' and 3' ends of one or both strands (e.g., antisense strand or sense strand). In some embodiments, the remaining internucleoside bond is a phosphodiester bond.

[0036] The dsRNA agent may further contain a ligand. In some embodiments, the ligand binds to the 3' end of the sense strand. For biological distribution, the siRNA can be conjugated to the target ligand and / or formulated, for example, into lipid nanoparticles.

[0037] Other aspects of the present invention relate to pharmaceutical compositions comprising these dsRNAs, such as siRNA molecules suitable for therapeutic use, and to methods for inhibiting the expression of target genes by administering dsRNA molecules, such as siRNA, of the present invention, for the treatment of various disease conditions disclosed herein.

[0038] Tetraloop As used herein, the term “tetraloop” refers to a loop that increases the stability of adjacent stem double helices formed by the hybridization of adjacent nucleotide sequences. The increase in stability is the T of the adjacent stem double helices that would be expected on average from a set of equally lengthed loops consisting of randomly selected nucleotide sequences. m The melting temperature of adjacent stem double chains is higher than (T mThis can be detected as an increase in ). For example, a tetraloop can give a hairpin containing a double helix with a length of at least 2 base pairs a melting temperature of at least 50°C, at least 55°C, at least 56°C, at least 58°C, at least 60°C, at least 65°C, or at least 75°C in 10 mM NaHPO4. In some embodiments, a tetraloop can stabilize base pairs of adjacent stem double helixes by stacking interactions. Furthermore, interactions between nucleotides in a tetraloop include, but are not limited to, non-Watson-Crick base pairings, stacking interactions, hydrogen bonding, and contact interactions (Cheong et al., Nature 1990 Aug.16;346(6285):680-2; Heus and Pardi, Science 1991 Jul.12;253(5016):191-4). In some embodiments, a tetraloop contains 4 to 5 nucleotides. In certain embodiments, a tetraloop may be modified or unmodified (e.g., condylation of the targeting portion). It comprises or consists of 3, 4, 5, or 6 nucleotides (which may or may not be regulated). In one embodiment, the tetraloop consists of 4 nucleotides. Any nucleotide may be used in the tetraloop, and the standard IUPAC-IUB symbols for such nucleotides may be used, as described in Cornish-Bowden (1985) Nucl. Acids Res. 13:3021-3030. For example, the letter "N" may be used to indicate that any base can be in that position, the letter "R" may be used to indicate that A (adenine) or G (guanine) can be in that position, and "B" may be used to indicate that C (cytosine), G (guanine), or T (thymine) can be in that position. Examples of tetraloops include the UNCG family of tetraloops (e.g., UUCG), the GNRA family of tetraloops (e.g., GAAA), and the CUUG tetraloop (Woese et al., Proc Natl Acad Sci USA. 1990 November; 87(21): 8467-71; Antao et al., Nucleic Acids Res. 1991 Nov. 11; 19(21): 5901-5). Examples of DNA tetraloops include the d(GNNA) family of tetraloops (e.g., d(GTTA)), the d(GNRA) family of tetraloops, the d(GNAB) family of tetraloops, the d(CNNG) family of tetraloops, and the d(TNCG) family of tetraloops (e.g., d(TTCG)). See, for example, Nakano et al. Biochemistry, 41(48), 14281-14292, 2002. SHINJI et al. Nippon Kagakkai Koen Yokoshu VOL.78th; NO.2; PAGE.731 (2000). These documents are incorporated herein with respect to relevant disclosures. In some embodiments, the tetraloop is contained within a tetraloop structure containing nicks.

[0039] A tetra-loop structure containing Nick A "nicked tetraloop structure" is an RNAi oligonucleotide structure characterized by the presence of separate sense (passenger) and antisense (guide) strands, where the sense strand has a region complementary to the antisense strand, and at least one of the strands, generally the sense strand, has a tetraloop configured to stabilize adjacent stem regions formed within at least one of the strands.

[0040] Antisense oligonucleotides As used herein, the term “antisense oligonucleotide” is defined as an oligonucleotide capable of regulating the expression of a target gene by hybridizing to a target nucleic acid, particularly a continuous sequence on the target nucleic acid. Antisense oligonucleotides are not inherently double-stranded and are therefore not siRNA or shRNA. Preferably, the antisense oligonucleotides of the present invention are single-stranded. The single-stranded oligonucleotides of the present invention are understood to be capable of forming hairpins or intermolecular double structures (double helixes between two molecules of the same oligonucleotide) as long as the degree of intra- or in-self complementarity is less than 50% over the entire length of the oligonucleotide.

[0041] Advantageously, the single-stranded antisense oligonucleotides of the present invention do not contain RNA nucleosides, thus reducing nuclease resistance.

[0042] Advantageously, the oligonucleotide of the present invention comprises one or more modified nucleosides or nucleotides, such as 2'-saccharide-modified nucleosides. Furthermore, it is advantageous that the unmodified nucleosides are DNA nucleosides.

[0043] Sequential nucleotide sequence The term "sequential nucleotide sequence" refers to the sequence of oligonucleotides complementary to the target nucleic acid. This refers to a region. This term is used herein interchangeably with the terms “continuous nucleic acid sequence” and “oligonucleotide motif sequence.” In some embodiments, all nucleotides of the oligonucleotide constitute a continuous nucleotide sequence. In some embodiments, the oligonucleotide includes a continuous nucleotide sequence, e.g., an FG-F' gapmer region, and optionally includes a nucleotide linker region that can be used to attach further nucleotides, e.g., functional groups, to the continuous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. It is understood that the continuous nucleotide sequence of an oligonucleotide cannot be longer than the oligonucleotide itself, and that the oligonucleotide cannot be shorter than the continuous nucleotide sequence.

[0044] nucleotide Nucleotides are components of oligonucleotides and polynucleotides, and for the purposes of this invention, this includes both naturally occurring and non-naturally occurring nucleotides. Nucleotides, such as DNA nucleotides and RNA nucleotides, naturally consist of a ribose sugar moiety, a nucleic acid base moiety, and one or more phosphate groups (which are not present in nucleosides). Nucleosides and nucleotides can also be interchangeably referred to as "units" or "monomers."

[0045] Deoxyribonucleotide As used herein, the term “deoxyribonucleotide” refers to a nucleotide that, compared to a ribonucleotide, has a hydrogen atom instead of a hydroxyl group at the 2' position of its pentose sugar. A modified deoxyribonucleotide is a deoxyribonucleotide that has one or more modifications or substitutions of atoms other than the 2' position, including modifications or substitutions of sugars, phosphate groups, or bases.

[0046] Ribonucleotides As used herein, the term "ribonucleotide" refers to a nucleotide having ribose as its pentose sugar and a hydroxyl group at its 2' position. A modified ribonucleotide is a ribonucleotide having one or more modifications or substitutions of atoms other than the 2' position, including modifications or substitutions of ribose, a phosphate group, or a base.

[0047] Modified nucleoside As used herein, the terms “modified nucleoside” or “nucleoside modification” refer to a nucleoside modified compared to an equivalent DNA or RNA nucleoside by introducing one or more modifications to the sugar moiety or (nucleic acid) base moiety. In preferred embodiments, a modified nucleoside includes a modified sugar moiety. The term modified nucleoside may also be used interchangeably with the terms “nucleoside analog” or modified “unit” or modified “monomer.” A nucleoside having an unmodified DNA or RNA sugar moiety is referred to herein as a DNA or RNA nucleoside. A nucleoside having modifications to the base region of a DNA or RNA nucleoside is still generally referred to as DNA or RNA if they are Watson-Crick base-pairable.

[0048] Modified nucleotides As used herein, the term “modified nucleotide” refers to a nucleotide having one or more chemical modifications compared to a corresponding reference nucleotide selected from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, adenine deoxyribonucleotide, guanine deoxyribonucleotide, cytosine deoxyribonucleotide, and thymidine deoxyribonucleotide. In some embodiments, the modified nucleotide is a nucleotide that does not exist in nature. In some embodiments, the modified nucleotide has one or more chemical modifications to its sugar, nucleic acid base, and / or phosphate group. In some embodiments, the modified nucleotide has one or more chemical moieties conjugated to a corresponding reference nucleotide. Typically, the modified nucleotide confers one or more desirable properties to the nucleic acid in which it is present. For example, the modified nucleotide may improve thermal stability, resistance to degradation, nuclease resistance, solubility, bioavailability, biological activity, or reduced immunogenicity.

[0049] Inter-modified nucleoside bonding The term “modified nucleoside bond” is defined as a bond other than a phosphodiester (PO) bond that covalently bonds two nucleosides together, as is commonly understood by those skilled in the art. Accordingly, the oligonucleotides of the present invention may include modified nucleoside bonds. In some embodiments, modified nucleoside bonds increase the nuclease resistance of the oligonucleotide compared to phosphodiester bonds. In naturally occurring oligonucleotides, modified nucleoside bonds, which include phosphate groups that generate phosphodiester bonds between adjacent nucleosides, are particularly useful for stabilizing oligonucleotides for in vivo use and may play a role in protecting the DNA or RNA nucleoside regions of the oligonucleotides of the present invention from nuclease cleavage, for example, within gap region G of gapmer oligonucleotides, and within modified nucleoside regions such as regions F and F'.

[0050] In one embodiment, the oligonucleotide comprises one or more modified nucleoside bonds modified from a native phosphodiester so that, for example, one or more of these modified nucleoside bonds are more resistant to nuclease attack. Nuclease resistance can be determined by incubating the oligonucleotide in serum or by using a nuclease resistance assay (e.g., snake venom phosphodiesterase (SVPD)), both of which are well known in the art. Nucleoside bonds that can enhance the nuclease resistance of an oligonucleotide are called nuclease-resistant nucleoside bonds. In some embodiments, at least 50% of the nucleoside bonds of the oligonucleotide or its sequence of nucleotides are modified, for example, at least 60%, for example at least 70%, for example at least 75%, for example at least 80%, or for example at least 90% of the nucleoside bonds of the oligonucleotide or its sequence of nucleotides are modified. In some embodiments, all of the nucleoside bonds of the oligonucleotide or its sequence of nucleotides are modified. In some embodiments, it will be recognized that the nucleoside to which the oligonucleotide of the present invention is attached to a non-nucleotide functional group, such as a conjugate, may be a phosphodiester. In some embodiments, all nucleoside bonds of the oligonucleotide or its sequential nucleotide sequence are nuclease-resistant nucleoside bonds.

[0051] In the oligonucleotides of the present invention, it is advantageous to use phosphorothioate nucleoside bonds.

[0052] Phosphothioate nucleoside binding is particularly useful due to its nuclease resistance, beneficial pharmacokinetics, and ease of manufacture. In some embodiments, at least 50% of the nucleoside bindings of an oligonucleotide or its sequence of nucleotides are phosphorothioates, and at least 60%, e.g., at least 70%, e.g., at least 75%, e.g., at least 80%, or e.g., at least 90%, of the nucleoside bindings of an oligonucleotide or its sequence of nucleotides are phosphorothioates. In some embodiments, all of the nucleoside bindings of an oligonucleotide or its sequence of nucleotides are phosphorothioates.

[0053] In some embodiments, the oligonucleotides of the present invention include, in addition to phosphorodithioate bonds, both phosphorothioate nucleoside-to-nucleoside bonds and at least one phosphodiester bond, such as a 2, 3, or 4 phosphodiester bond. In gapmer oligonucleotides, the phosphodiester bond, if present, is not properly located between consecutive DNA nucleosides in gap region G.

[0054] Nuclease-resistant bindings, such as phosphorothioate bindings, are particularly useful in oligonucleotide regions that can recruit nucleases when forming a double helix with the target nucleic acid, such as region G of a gapmer. However, phosphorothioate bindings can also be useful in non-nuclease-recruiting regions and / or affinity-enhancing regions, such as regions F and F' of a gapmer. In some embodiments, the gapmer oligonucleotide may contain one or more phosphodiester bindings in region F or F', or in both regions F and F', and all internucleoside bindings in region G may be phosphorothioates.

[0055] Advantageously, all nucleoside bonds in the continuous nucleotide sequence of the oligonucleotide are phosphorothioates, or all nucleoside bonds of the oligonucleotide are phosphorothioate bonds. In particular, all nucleoside bonds in the continuous nucleotide sequence of the antisense oligonucleotide are phosphorothioates, or all nucleoside bonds of the antisense oligonucleotide are phosphorothioate bonds.

[0056] As disclosed in European Patent No. 2742135, therapeutic oligonucleotides may include other nucleoside bonds (other than phosphodiesters and phosphorothioates), such as alkylphosphonate / methylphosphonate nucleoside bonds, which, according to European Patent No. 2742135, may be resistant, for example, within the gap region of another DNA phosphorothioate.

[0057] Nucleic acid bases The term "nucleic acid base" includes the purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides, which form hydrogen bonds in nucleic acid hybridization. In the context of this invention, the term "nucleic acid base" also includes modified nucleic acid bases that function during nucleic acid hybridization, although these may differ from naturally occurring nucleic acid bases. In this context, "nucleic acid base" refers to both naturally occurring nucleic acid bases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, and variants that do not exist naturally. Such variants are, for example, Hirao et al (2012) Accounts of Chemical Research vol 45 page This is described in 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.

[0058] In some embodiments, the nucleic acid base moiety is modified by replacing a purine or pyrimidine with a nucleic acid base selected from modified purines or pyrimidines, such as substituted purines or pyrimidines, such as isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiozolocytosine, 5-propynylcytosine, 5-propynyluracil, 5-bromouracil, 5-thiazolouracil, 2-thiouracil, 2'-thiothymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0059] The nucleic acid base portion may be represented by a letter code for each corresponding nucleic acid base, for example, A, T, G, C, or U, where each letter is an optionally modified nucleic acid base with equivalent function. It may also include the following. For example, in the example oligonucleotides, the nucleic acid base portion is selected from A, T, G, C, and 5-methylcytosine. Optionally, 5-methylcytosine LNA nucleoside may be used for the LNA gapmer.

[0060] Modified oligonucleotides The term "modified oligonucleotide" refers to an oligonucleotide containing one or more sugar-modified nucleosides and / or modified nucleoside bonds. The term "chimeric" oligonucleotide is a term used in the literature to describe oligonucleotides that have modified nucleosides.

[0061] Complementarity As used herein, “complementary” refers to a structural relationship between two nucleotides (e.g., on two opposing nucleic acids or on opposing regions of a nucleic acid chain) or between two sequences of nucleotides that enables the two nucleotides or two sequences of nucleotides to form a base pair with one another. For example, a purine nucleotide of one nucleic acid complementary to a pyrimidine nucleotide of an opposing nucleic acid may form a base pair by forming a hydrogen bond with one another. In some embodiments, complementary nucleotides can base pair in a Watson-Crick manner or in any other manner that enables the formation of a stable double helix. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). Oligonucleotides may contain nucleosides with modified nucleic acid bases; for example, 5-methylcytosine is often used in place of cytosine, and therefore the term complementarity will be understood to encompass Watson-Crick base pairing between unmodified and modified nucleic acid bases (see, for example, Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).

[0062] The term "% complementary," as used herein, refers to the percentage of nucleotides in a sequence of nucleic acid molecules (e.g., oligonucleotides) that are complementary to a reference sequence (e.g., a target sequence or sequence motif) across the sequence. Therefore, the percentage of complementarity is calculated by counting the number of aligned nucleic acid bases that are complementary between two sequences (e.g., from Watson-Crick base pairs), dividing that number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. In such a comparison, nucleic acid bases / nucleotides that do not align (e.g., form base pairs) are referred to as mismatches. Insertions and deletions are not permitted in the calculation of the % complementarity of a sequence of nucleotides. In determining complementarity, it will be understood that chemical modifications of nucleic acid bases are ignored as long as the nucleic acid base retains its functional ability to form, for example, Watson-Crick base pairs (e.g., 5-methylcytosine is considered identical to cytosine for the purposes of % identity calculations).

[0063] The term "perfectly complementary" refers to 100% complementarity.

[0064] The following is an example of a continuous nucleotide sequence that is perfectly complementary to the region of the HBV transcript.

[0065] The following is an example of a sequence of nucleotides (SEQ ID NO: 6) that is perfectly complementary to the HBV target region (SEQ ID NO: 28). [ka]

[0066] In some embodiments, the two nucleic acids may have regions of multiple nucleotides that are complementary to each other so as to form a complementary region, as described herein.

[0067] Domain of Complementarity As used herein, the term “complementary region” refers to a sequence of nucleotides in a nucleic acid (e.g., a double-stranded oligonucleotide) that is sufficiently complementary to the antiparallel sequence of nucleotides, enabling hybridization between two nucleotide sequences under appropriate hybridization conditions, such as in phosphate buffer or within a cell.

[0068] identity As used herein, the term "identity" refers to the percentage of nucleotides in a sequence of nucleic acid molecules (e.g., oligonucleotides) that are identical to a reference sequence (e.g., a sequence motif) across the sequence. Therefore, the percentage of identity is calculated by counting the number of identical (matching) aligned nucleic acid bases between two sequences (in the sequence of the compound of the present invention and the reference sequence), dividing that number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. Thus, the percentage of identity = (number of matches × 100) / length of the aligned region (e.g., sequence of nucleotides). Insertions and deletions are not permitted in the calculation of the percentage of identity of a sequence of nucleotides. It will be understood that, in determining identity, chemical modifications of nucleic acid bases are ignored as long as the nucleic acid base retains its functional ability to form Watson-Crick base pairs (e.g., 5-methylcytosine is considered identical to cytosine for the purposes of calculating the percentage of identity).

[0069] Hybridization As used herein, the terms “hybridize” or “to hybridize” should be understood as two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid) forming a double helix by forming hydrogen bonds between base pairs on opposing strands. The affinity of the bond between the two nucleic acid strands is the strength of hybridization. This is defined as the melting temperature (T), which is the temperature at which half of the oligonucleotide forms a double helix with the target nucleic acid. m It is often explained by ). Under physiological conditions, T mIt is not strictly proportional to affinity (Mergny and Lacroix (2003) "Oligonucleotides" Vol. 13, pp. 515-537). The standard-state Gibbs free energy ΔG° more accurately represents binding affinity, where ΔG° = -RTln(K d The dissociation constant (K) of the reaction is determined by the reaction. d ) is associated with the equation, where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔG° for the reaction between an oligonucleotide and a target nucleic acid reflects strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction at an aqueous concentration of 1 M, pH 7, and temperature of 37°C. Hybridization of oligonucleotides into target nucleic acids is a spontaneous reaction, and in the case of a spontaneous reaction, ΔG° is less than zero. ΔG° can be measured experimentally, for example, by using isothermal titration calorimetry (ITC) methods, as described in Hansen et al., 1965, Chem.Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today. Those skilled in the art will know that commercially available instruments are available for ΔG° measurement. ΔG° is described in Santa Lucia, 1999 Using the nearest neighbor model described in Proc Natl Acad Sci USA. 95:1460-1465, the thermodynamic parameters can be numerically estimated using appropriately obtained thermodynamic parameters described in Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405. To ensure the possibility of modulating the intended nucleic acid target by hybridization, the oligonucleotides of the present invention hybridize to target nucleic acids with an approximate ΔG° value of less than -10 kcal for oligonucleotides of 10 to 30 nucleotides in length. In some embodiments, the degree or intensity of hybridization is measured by the standard-state Gibbs free energy ΔG°. Oligonucleotides can hybridize to target nucleic acids with estimated ΔG° values ​​of less than -10 kcal for oligonucleotides of 8 to 30 nucleotides in length, e.g., less than -15 kcal, e.g., less than -20 kcal, and e.g., less than -25 kcal. In some embodiments, oligonucleotides hybridize to target nucleic acids with estimated ΔG° values ​​of -10 to -60 kcal, e.g., -12 to -40, e.g., -15 to -30 kcal, or -16 to -27 kcal, e.g., -18 to -25 kcal.

[0070] target nucleic acid According to the present invention, the target nucleic acid is a nucleic acid that encodes the hepatitis B virus, and may be, for example, a gene, RNA, mRNA, viral mRNA, or cDNA sequence. The target nucleic acid is represented by Sequence ID No. 1 and its naturally occurring variants.

[0071] With regard to in vivo or in vitro applications, the oligonucleotides of the present invention are typically capable of inhibiting the expression of HBV target nucleic acids in cells expressing HBV target nucleic acids. The continuous sequence of nucleic acid bases of the oligonucleotides of the present invention is typically measured over the length of the oligonucleotide and is complementary to the HBV target nucleic acid, except for optionally one or two mismatches and optionally a nucleotide-based linker region that can conjugate the oligonucleotide to any functional group such as a conjugate, or other non-complementary terminal nucleotides (e.g., D' or D'').

[0072] target sequence As used herein, the term “target sequence” refers to a sequence of nucleotides present in a target nucleic acid, comprising a nucleic acid base sequence complementary to the oligonucleotide of the present invention. In some embodiments, the target sequence consists of a region on the target nucleic acid having a nucleic acid base sequence complementary to the continuous nucleotide sequence of the oligonucleotide of the present invention. This region of the target nucleic acid may interchangeably be referred to as a target nucleotide sequence, target sequence, or target region. In some embodiments, the target sequence may be longer than the complementary sequence of a single oligonucleotide and may represent a preferred region of the target nucleic acid that can be targeted by, for example, some oligonucleotides of the present invention.

[0073] The HBV mRNA target region of a therapeutic oligonucleotide represented by the sequence at positions 1530-1602 of SEQ ID NO: 1 or SEQ ID NO: 28 is described herein. This target region may be divided into smaller target sequences, selected from the group consisting of positions 1530-1602; 1530-1598; 1530-1543; 1530-1544; 1531-1543; 1551-1565; 1551-1566; 1577-1589; 1577-1591; 1577-1592; 1578-1590; 1578-1592; 1583-1598; 1584-1598; 1585-1598 or 1583-1602 of SEQ ID NO: 1.

[0074] In one embodiment, the therapeutic oligonucleotide of the present invention comprises a sequence of nucleotides that is complementary to or hybridizes with the target sequence at positions 1530-1602 of SEQ ID NO: 1 or SEQ ID NO: 28. In particular, 1530-1544;1531-1543;1585- For target sequences selected from the groups consisting of 1598 and 1583-1602.

[0075] The target sequences that antisense oligonucleotides complement or hybridize generally contain a sequence of at least 10 consecutive nucleic acid bases. The sequence of consecutive nucleotides in the target region is 10 to 50 nucleotides, e.g., 12 to 30, e.g., 14 to 20, e.g., 15 to 18 consecutive nucleotides.

[0076] target cell As used herein, the term “target cell” refers to a cell expressing the target nucleic acid. In some embodiments, the target cell may be in vivo or in vitro. In some embodiments, the target cell may be a rodent cell such as a mouse cell or a human cell, or an HBV-infected mammalian cell, such as an HBV-infected hepatocyte.

[0077] In a preferred embodiment, the target cells express HBV mRNA and secrete HBsAg and HBeAg.

[0078] liver cells As used herein, the term “hepatocyte” (singular or plural) refers to the cells of the parenchymal tissue of the liver. These cells constitute approximately 70–85% of the liver’s mass and produce serum albumin, fibrinogen, and the prothrombin group of coagulation factors (excluding factors 3 and 4). Markers of hepatocyte lineage cells may include, but are not limited to, transthyretin (Ttr), glutamine synthetase (Glul), hepatocyte nuclear factor 1a (Hnf1a), and hepatocyte nuclear factor 4a (Hnf4a). Markers of mature hepatocytes may include, but are not limited to, cytochrome P450 (Cyp3a11), fumarylacetoacetate hydrolase (Fah), glucose 6-phosphate (G6p), albumin (Alb), and OC2-2F8. For example, see Huch et al., (2013), Nature, 494(7436):247-250 (the contents of which are incorporated herein by reference).

[0079] Reduced expression As used herein, the term “reduced gene expression” refers to a decrease in the amount of RNA transcript or protein encoded by the gene and / or the amount of gene activity in a cell or subject compared to a suitable reference cell or subject. For example, treating cells with a pharmaceutical combination or a double-stranded oligonucleotide (e.g., having an antisense strand complementary to the HBsAg mRNA sequence) may result in a decrease in the amount of RNA transcript, protein and / or enzyme activity (e.g., encoded by the S gene of the HBV genome) compared to cells not treated with the pharmaceutical combination or the double-stranded oligonucleotide, respectively. Similarly, as used herein, “reduce expression” refers to an action that results in a decrease in the expression of a gene (e.g., the S gene of the HBV genome).

[0080]

[0081] The term "naturally occurring variant" refers to variants of the target nucleic acid that occur naturally within defined taxa such as HBV genotypes A to H. Typically, when referring to a "naturally occurring variant" of a polynucleotide, the term may also encompass any allelic variant of the target sequence encoding genomic DNA found by chromosomal translocation or duplication, and the RNA derived therefrom, such as mRNA. "Naturally occurring variants" may also include variants derived from alternative splicing of the target sequence mRNA. For example, when referring to a particular polypeptide sequence, the term may refer to naturally occurring forms of the protein that can be processed by co- or post-translational modifications such as signal peptide cleavage, proteolytic cleavage, glycosylation, etc. This also includes proteins in their naturally occurring forms that can be processed.

[0082] High-affinity modified nucleoside High-affinity modified nucleosides are modified nucleotides that, when incorporated into an oligonucleotide, increase the affinity of the oligonucleotide for its complementary target, as measured by, for example, the melting temperature (T m ). The high-affinity modified nucleosides of the present invention preferably result in an increase in melting temperature of +0.5 to +12 o °C per modified nucleoside, more preferably +1.5 to +10 o °C, and most preferably +3 to +8 o °C. Numerous high-affinity modified nucleosides are known in the art, including, for example, many 2'-substituted nucleosides and locked nucleic acids (LNA) (see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).

[0083] Sugar modification The oligomers of the present invention may contain one or more nucleosides with a modified sugar moiety, i.e., a sugar moiety that is modified compared to the ribose sugar moiety found in DNA and RNA.

[0084] Numerous nucleosides with ribose sugar moieties have been created primarily to improve certain properties of oligonucleotides, such as affinity and / or nuclease resistance.

[0085] Such modifications include those in which the ribose ring structure is modified by replacing it with, for example, a hexose ring (HNA) or a bicyclic ring (typically having a biradical bridge between the C2 and C4 carbons of the ribose ring (LNA)), or an unbonded ribose ring (e.g., UNA) that typically lacks a bond between the C2 and C3 carbons. Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (International Publication No. 2011 / 017521) or tricyclic nucleic acids (International Publication No. 2013 / 154798). Modified nucleosides also include those in which the sugar moiety is replaced with a non-sugar moiety, for example, a peptide nucleic acid (PNA) or a morpholino nucleic acid.

[0086] Sugar modifications also include modifications made by changing substituents on the ribose ring to groups other than hydrogen, or to 2'-OH groups that are naturally present in DNA and RNA nucleosides. Substituents can be introduced, for example, at the 2', 3', 4', or 5' positions.

[0087] 2' sugar-modified nucleoside 2'-sugar-modified nucleosides are nucleosides having substituents other than H or -OH at the 2' position (2'-substituted nucleosides), or nucleosides containing a 2'-bonded biradical that can form a bridge between the 2' carbon and the second carbon of the ribose ring, such as LNA (2'-4' biradical bridged) nucleosides.

[0088] In fact, the development of 2'-sugar-substituted nucleosides has attracted considerable attention, and numerous 2'-substituted nucleosides have been found to possess beneficial properties when incorporated into oligonucleotides. For example, 2'-modified sugars can impart enhanced binding affinity and / or increased nuclease resistance to oligonucleotides. Examples of 2'-substituted nucleosides include 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. For further examples, see, for instance, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug D See development, 2000, 3(2), 293-213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. The following are some examples of 2' substitution modified nucleosides. [ka]

[0089] In relation to the present invention, the 2'-substituted sugar-modified nucleoside does not contain a 2'-crosslinked nucleoside such as LNA.

[0090] Locked nucleic acid nucleosides (LNA nucleosides) "LNA nucleosides" are 2'-modified nucleosides containing a biradical (also called a "2'-4' bridge") that links the C2' and C4' of the ribose sugar ring of the above nucleoside, thereby restricting or fixing the conformation of the ribose ring. These nucleosides are also referred to in the literature as cross-linked nucleic acids or bicyclic nucleic acids (BNAs). Fixation of the ribose conformation is related to improved hybridization affinity (double helix stabilization) when LNAs are incorporated into oligonucleotides of complementary RNA or DNA molecules. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary double helix.

[0091] Non-restrictive, exemplary LNA nucleosides are described in International Publications 99 / 014226, 00 / 66604, 98 / 039352, 2004 / 046160, 00 / 047599, 2007 / 134181, 2010 / 077578, 2010 / 036698, 2007 / 090071, 2009 / 006478, 2011 / 156202, 2008 / 154401, 2009 / 067647, 2008 / 150729, Morita et al. al., Bioorganic&Med.Chem.Lett.12,73-76,Seth et al. al.J.Org.Chem.2010, Vol 75(5)pp.1569-81, and Mitsuoka et al., Nucleic Acids Research This is disclosed in 2009, 37(4), 1225-1238, and in Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667.

[0092] Further non-limiting, exemplary LNA nucleosides are disclosed in Scheme 1.

[0093] [ka]

[0094] Certain LNA nucleosides are beta-D-oxy-LNA, 6'-methyl-beta-D-oxy-LNA, e.g., (S)-6'-methyl-beta-D-oxy-LNA(ScET) and ENA. A particularly favorable LNA is beta-D-oxy-LNA.

[0095] Phosphate analog As used herein, the term “phosphate analog” refers to a chemical moiety that mimics the electrostatic and / or steric properties of a phosphate group. In some embodiments, the phosphate analog is located at the 5' terminal nucleotide of an oligonucleotide in place of the 5'-phosphate, which is often susceptible to enzymatic removal. In some embodiments, the 5'-phosphate analog contains a phosphatase-resistant linkage. Examples of phosphate analogs include 5'-phosphonates such as 5'-methylenephosphonate (5'-MP) and 5'-(E)-vinylphosphonate (5'-VP). In some embodiments, the oligonucleotide has a phosphate analog (referred to as a “4'-phosphate analog”) at the 4'-carbon position of the sugar at its 5' terminal nucleotide. An example of a 4'-phosphate analog is an oxymethylphosphonate or analog thereof, in which the oxygen atom of the oxymethyl group is bonded to the sugar moiety (e.g., its 4'-carbon). For example See U.S. Provisional Patent Application No. 62 / 383,207, filed September 2, 2016, and U.S. Provisional Patent Application No. 62 / 393,401, filed September 12, 2016. The contents of each of these phosphate analogs are incorporated herein by reference. Other modifications to the 5' end of oligonucleotides have been developed (see, for example, International Publication No. 2011 / 133871; U.S. Patent No. 8,927,513; and Prakash et al. (2015), Nucleic Acids Res., 43(6):2993-3011. The contents of each of these phosphate analogs are incorporated herein by reference).

[0096] Nuclease-mediated degradation Nuclease-mediated degradation refers to oligonucleotides that can mediate the degradation of complementary nucleotide sequences when they form a double helix with such sequences.

[0097] In some embodiments, antisense oligonucleotides may function via nuclease-mediated degradation of target nucleic acids, and the oligonucleotides of the present invention can recruit nucleases, particularly endonucleases, preferably endoribonucleases (RNases) such as RNase H. An example of an oligonucleotide design that functions via a nuclease-mediated mechanism is an oligonucleotide that typically contains a region of at least 5 or 6 consecutive DNA nucleosides, with affinity-enhancing nucleosides, such as gapmers, headmers, and tailmers, flanked on one or both sides.

[0098] Activation and recruitment of RNase H In one embodiment, the therapeutic oligonucleotide is an antisense oligonucleotide capable of recruiting RNase H. RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a double helix with a complementary RNA molecule. International Publication 01 / 23613 provides an in vitro method for determining RNase H activity, which may be used to determine the ability to recruit RNase H. Typically, an oligonucleotide is considered capable of recruiting RNase H if it has an initial rate measured at at least 5% of the initial rate determined using the methodology provided in Examples 91-95 of International Publication 01 / 23613 (incorporated herein by reference), e.g., at least 10% or more than 20% of the initial rate measured at pmol / l / min. Recombinant human RNase H1 is available from Lubio Science GmbH, Lucerne, Switzerland, for use in determining RNase H activity.

[0099] Gapmar In some embodiments of the present invention, the therapeutic oligonucleotide is an antisense oligonucleotide, the nucleic acid molecule or its sequence of nucleotides is a gapmer antisense oligonucleotide. Antisense gapmers are typically used to inhibit target nucleic acids via RNase H-mediated degradation. In one embodiment of the present invention, the antisense oligonucleotide is capable of recruiting RNase H.

[0100] A gapmer antisense oligonucleotide comprises at least three distinct structural regions, a 5'-flank, a gap, and a 3'-flank, FG-F', in a 5'->3' orientation. The "gap" region (G) contains a stretch of continuous DNA nucleotides that allows the oligonucleotide to recruit RNase H. The gap region contains one or more glycosylated nucleosides, preferably high-affinity glycosylated nucleosides, in the 5' adjacent region (FG-F'). ) is flanked by a 3'-adjacent region (F') containing one or more glycosylated nucleosides, preferably high-affinity glycosylated nucleosides. One or more glycosylated nucleosides in regions F and F' enhance the affinity of the oligonucleotide to the target nucleic acid (i.e., this is an affinity-enhancing glycosylated nucleoside). In some embodiments, one or more glycosylated nucleosides in regions F and F' are 2'-glycosylated nucleosides, such as high-affinity 2'-glycosylated nucleosides, independently selected from, for example, LNA and 2'-MOE.

[0101] In gapmer designs, the outermost 5' and 3' nucleosides of the gap region are DNA nucleosides, located adjacent to the sugar-modified nucleosides of the 5'(F) or 3'(F') region, respectively. A flank may be further defined by having at least one sugar-modified nucleoside at the end furthest from the gap region, i.e., the 5' end of a 5' flank and the 3' end of a 3' flank.

[0102] Region FG-F' forms a continuous nucleotide sequence. The antisense oligonucleotide of the present invention or its continuous nucleotide sequence may include the gapmer region of formula FG-F'.

[0103] The total length of the gapmer design FG-F' can be, for example, 12 to 30 nucleosides, for example, 13 to 24, for example, 14 to 22 nucleosides, for example, 13 to 17, for example, 14 to 16 nucleosides.

[0104] For example, the gapmer oligonucleotide of the present invention can be represented by the following formula: F 1-6 -G 6-16 -F' 1-6 ,for example F 1-4 -G 7-10 -F' 2-4

[0105] However, the total length of the gapmer region FG-F' is at least 12, for example, at least 13 nucleotides long.

[0106] In one aspect of the present invention, an antisense oligonucleotide or a sequence of nucleotides thereof consists of or comprises a gapmer of the formula 5'-FG-F'-3', wherein regions F and F' independently contain or consist of 1 to 8 nucleosides, of which 1 to 4 are 2'-sugar modified, defining the 5' and 3' ends of the F and F' regions, and G is an RNase. This is a region of 6 to 16 nucleosides that can mobilize H.

[0107] In one embodiment of the present invention, the continuous nucleotide sequence is a gapmer of formula 5'-FG-F'-3', where regions F and F' independently consist of 2 to 4 2'-sugar-modified nucleotides defining the 5' and 3' ends of regions F and F', and G is a region of 6 to 10 DNA nucleosides capable of recruiting RNase H.

[0108] In some embodiments, the gap region G may consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive phosphorothioate-binding DNA nucleosides. In some embodiments, the gap region G consists of 7 to 10 DNA nucleosides. In some embodiments, all nucleoside bonds within the gap are phosphorothioate bonds.

[0109] In some embodiments, regions F and F' independently consist of or include a sequence of glycosylated nucleosides. In some embodiments, the glycosylated nucleosides of region F independently include 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, and MO E units, LNA units, arabino nucleic acid (ANA) units, and 2'-fluoro-ANA units may be selected.

[0110] In some embodiments, region F or F', or all nucleosides in F and F', are LNA nucleosides, such as those independently selected from beta-D-oxy LNA, ENA, or ScET nucleosides. In some embodiments, region F consists of 1 to 5, for example, 2 to 4, for example, 3 to 4, for example, 1, 2, 3, 4, or 5 consecutive LNA nucleosides. In some embodiments, all nucleosides in regions F and F' are beta-D-oxy LNA nucleosides.

[0111] In some embodiments, region F or F', or all nucleosides in F and F', are 2'-substituted nucleosides, such as OMe or MOE nucleosides. In some embodiments, region F consists of 1, 2, 3, 4, 5, 6, 7, or 8 consecutive OMe or MOE nucleosides. In some embodiments, only one of the flanking regions may consist of a 2'-substituted nucleoside, such as OMe or MOE nucleosides. In some embodiments, the 5'(F) flanking region consists of a 2'-substituted nucleoside, such as OMe or MOE nucleosides, while the 3'(F') flanking region includes at least one LNA nucleoside, such as beta-D-oxyLNA nucleoside or cET nucleoside. In some embodiments, the 3'(F') flanking region consists of a 2'-substituted nucleoside, such as OMe or MOE nucleoside, while the 5'(F) flanking region includes at least one LNA nucleoside, such as beta-D-oxyLNA nucleoside or cET nucleoside.

[0112] Further gapmer designs are disclosed in International Publication Nos. 2004 / 046160, 2007 / 146511, and 2008 / 113832, which are incorporated herein by reference.

[0113] LNA gapmer An LNA gapmer is a gapmer containing or consisting of an LNA nucleoside in one or both of regions F and F'. A beta-D-oxy gapmer is a gapmer containing or consisting of a beta-D-oxy LNA nucleoside in one or both of regions F and F'.

[0114] In some embodiments, the LNA gapmer is given by the formula: [LNA] 1-5 -[Area G] 6-10 -[LNA] 1-5 And region G is as defined in the definition of gapmer region G.

[0115] MOE Gap Marker A MOE gapmer is a gapmer in which regions F and F' consist of MOE nucleosides. In some embodiments, the MOE gapmer is designed [MOE] 1-8 -[Area G] 5-16 -[MOE] 1-8 For example, [MOE] 2-7 -[Area G] 6-14 -[MOE] 2-7 For example, [MOE] 3-6 -[Area G] 8-12 -[MOE] 3-6 Here, region G is as defined in the definition of a gapmer. MOE gapmers with a 5-10-5 design (MOE-DNA-MOE) are widely used in the art.

[0116] Mixed wing gap mar Mixed wing gapmers have one or both of regions F and F' as 2'-substituted nucleosides, such as 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, The LNA gapmer comprises a 2'-substituted nucleoside, such as a MOE nucleoside, independently selected from the group consisting of arabino nucleic acid (ANA) units and 2'-fluoro-ANA units. In some embodiments, at least one of regions F and F', or both regions F and F', comprises at least one LNA nucleoside, the remaining nucleosides in regions F and F' are independently selected from the group consisting of MOE and LNA. In some embodiments, at least one of regions F and F', or both regions F and F', comprises at least two LNA nucleosides, the remaining nucleosides in regions F and F' are independently selected from the group consisting of MOE and LNA. In some mixed-wing embodiments, one or both regions F and F' may further comprise one or more DNA nucleosides.

[0117] The mixed wing gapmer design is disclosed in International Publication No. 2008 / 049085 and International Publication No. 2012 / 109395 (both of which are incorporated herein by reference).

[0118] Region D' or D'' within the oligonucleotide In some embodiments, the oligonucleotides of the present invention may comprise, or consist of, a sequence of oligonucleotides complementary to the target nucleic acid, e.g., a gapmer FG-F', and further 5' and / or 3' nucleosides. The further 5' and / or 3' nucleosides may be fully complementary to the target nucleic acid or not. Such further 5' and / or 3' nucleosides may be referred to herein as regions D' and D''.

[0119] The addition of region D' or D'' may be used to link a continuous nucleotide sequence, such as a gapmer, to a conjugate moiety or another functional group. When used to link a continuous nucleotide sequence to a conjugate moiety, it can act as a bio-cleavable linker. Alternatively, it may be used to provide exonuclease protection or to facilitate synthesis or manufacture. Regions D' and D'' are joined to the 5' end of region F or the 3' end of region F', respectively, to form the following equations: D'-FG-F', FG-F'-D'' or

[0120] The D'-FG-F'-D'' design can be generated. In this case, FG-F' are gapmer portions of the oligonucleotide, and regions D' or D'' constitute separate portions of the oligonucleotide. The transitions between region D' and the F region, and between region F' and the D'' region, are characterized by nucleosides having phosphodiester bonds toward the D' or D'' region and phosphorothioate bonds toward the F or F' region, and the nucleosides are considered to be part of a gapmer (a sequence of nucleotides complementary to the target nucleic acid).

[0121] Region D' or D'' independently contains or consists of 1, 2, 3, 4, or 5 additional nucleotides, which may or may not be complementary to the target nucleic acid. The nucleotides adjacent to the F or F' region are not sugar-modified nucleotides such as DNA or RNA, nor are they base-modified versions thereof. Region D' or D'' can function as a nuclease-sensitive biocleavable linker (see definition of linker). In some embodiments, the additional 5' and / or 3' terminal nucleotides are linked by phosphodiester bonds and are DNA or RNA. Nucleotide-based biocleavable linkers suitable for use as region D' or D'' are disclosed in International Publication 2014 / 076195, which includes, as an example, phosphodiester-linked DNA dinucleotides. In some embodiments, region D' or D'' is not complementary to the target nucleic acid or contains at least a 50% mismatch.

[0122] In some embodiments, region D' or D'' contains or consists of a dinucleotide of the sequence AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, where C may be 5-methylcytosine and / or T may be replaced by U. The nucleoside bond in the dinucleotide is a phosphodiester bond. In some embodiments, region D' or D'' consists of or comprises the trinucleotides of the sequences AAA, AAT, AAC, AAG, ATA, ATT, ATC, ATG, ACA, ACT, ACC, ACG, AGA, AGT, AGC, AGG, TAA, TAT, TAC, TAG, TTA, TTT, TTC, TAG, TCA, TCT, TCC, TCG, TGA, TGT, TGC, TGG, CAA, CAT, CAC, CAG, CTA, CTG, CTC, CTT, CCA, CCT, CCC, CCG, CGA, CGT, CGC, CGG, GAA, GAT, GAC, CAG, GTA, GTT, GTC, GTG, GCA, GCT, GCC, GCG, GGA, GGT, GGC, and GGG, where C is 5-methylcytosine and / or T is replaced by U. The nucleoside bond is a phosphodiester bond. When referring to the (naturally occurring) nucleic acid bases A (adenine), T (thymine), U (uracil), G (guanine), and C (cytosine), it will be understood that these can be substituted with nucleic acid base analogs that function as equivalent natural nucleic acid bases (e.g., base pairs with complementary nucleosides).

[0123] In one embodiment, the antisense oligonucleotide of the present invention includes regions D' and / or D'' in addition to the continuous nucleotide sequence constituting the gapmer.

[0124] In some embodiments, the antisense oligonucleotide of the present invention can be represented by the following formula: D'-FG-F', especially D' 1-3 -F 1-4 -G 6-10 -F' 2-4 FG-F'-D'', in particular, F 1-4 -G6-10 -F' 2-4 -D'' 1-3 D'-FG-F'-D'', especially D' 1-3 -F 1-4 -G 6-10 -F' 2-4 -D'' 1-3

[0125] In some embodiments, the internucleoside bond located between region D' and region F is a phosphodiester bond. In some embodiments, the internucleoside bond located between region F' and region D'' is a phosphodiester bond.

[0126] Conjugate As used herein, the term "conjugate" refers to a non-nucleotide portion (conjugate), such as a GalNAc cluster, that can be covalently bound to a therapeutic oligonucleotide. The terms "conjugate" and "cluster" or "conjugate portion" may be used interchangeably. In some examples, a conjugated therapeutic oligonucleotide may also be referred to as an oligonucleotide conjugate. In one embodiment, the conjugate is a targeted ligand.

[0127] Targeted ligand As used herein, the term “targeting ligand” refers to a molecule that selectively binds to a homologous molecule (e.g., a receptor) of a tissue or cell of interest, and is conjugable to other substances (e.g., carbohydrates, amino sugars, cholesterol, polypeptides, or lipids) for the purpose of targeting other substances to the tissue or cell of interest. For example, in some embodiments, the targeting ligand may be conjugated to an oligonucleotide for the purpose of targeting the oligonucleotide to a specific tissue or cell of interest. In some embodiments, the targeting ligand selectively binds to cell surface receptors. Thus, in some embodiments, when the targeting ligand is conjugated to an oligonucleotide, selective binding to receptors expressed on the cell surface, as well as endosomal translocation by the cell of the complex containing the oligonucleotide, targeting ligand, and receptor, to a specific cell, thereby targeting the oligonucleotide to the cell. This facilitates the delivery of the targeting ligand. In some embodiments, the targeting ligand is conjugated to an oligonucleotide via a linker that is cleaved after or during cell internalization, so that the oligonucleotide is released from the targeting ligand within the cell.

[0128] Oligonucleotide linker A conjugate or linker is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. Conjugate groups can be conjugated to oligonucleotides directly or via a linking portion (e.g., a linker or tether). Linkers help to covalently conjugate a conjugate group to an oligonucleotide or sequence of nucleotides complementary to the target nucleic acid.

[0129] In some embodiments of the present invention, the therapeutic oligonucleotide optionally includes a linker region located between an oligonucleotide complementary to the target nucleic acid or a conjugate to a sequence of nucleotides.

[0130] Such linkers may be bio-cleavable linkers comprising or consisting of physiologically unstable bonds that can be cleaved under conditions normally encountered or similar to those encountered in the mammalian body. In one embodiment, the bio-cleavable linker is susceptible to S1 nuclease cleavage.

[0131] For biocleavable linkers positioned between the conjugate and the therapeutic oligonucleotide, it is preferable that the cleavage rate observed in the target tissue (e.g., muscle, liver, kidney, or tumor) is greater than that observed in serum. Appropriate methods for determining the level (%) of cleavage in the target tissue or by S1 nuclease relative to serum are described in the "Materials and Methods" section. In some embodiments, the biocleavable linker is cleaved by at least about 20%, for example, at least about 30%, for example, at least about 40%, for example, at least about 50%, for example, at least about 60%, for example, at least about 70%, for example, at least about 75% compared to a standard.

[0132] In preferred embodiments, the nuclease-sensitive linker comprises a nucleoside between 1 and 10, for example, nucleosides 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, more preferably nucleosides between 2 and 6, and most preferably 2 to 4, comprising at least two consecutive phosphodiester bonds, for example, at least three, four, or five consecutive phosphodiester bonds. Preferably, the nucleosides are DNA or RNA. A bio-cleavable linker containing a phosphodiester (PO linker) is described in detail in International Publication No. 2014 / 076195 (incorporated herein by reference).

[0133] Additional or alternative linkers, which are not necessarily biocleavable but primarily serve to covalently link conjugates to oligonucleotides, may also be used alone or in combination with PO linkers. Non-cleavable linkers may include chain structures or oligomers of repeating units such as ethylene glycol, amino acid units, or aminoalkyl groups. In some embodiments, the non-cleavable linker is an aminoalkyl group, such as a C2-C36 aminoalkyl group including a C6-C12 aminoalkyl group. In preferred embodiments, the linker is a C6 aminoalkyl group.

[0134] Hepatitis B virus As used herein, "Hepatitis B virus" or "HBV" refers to approximately 3,200 salts. The term "HBV" refers to members of the Hepadnaviridae family that possess a small double-stranded DNA genome with a base pair and affinity for hepatocytes. "HBV" includes hepatitis B viruses that infect any of the following hosts: various mammals (e.g., humans, non-human primates, etc.) and birds (e.g., ducks). "HBV" includes any known HBV genotype, e.g., serotypes A, B, C, D, E, F, and G; any HBV serotype or HBV subtype; any HBV isolate; HBV variants, e.g., HBeAg-negative variants, drug-resistant HBV variants (e.g., lamivudine-resistant variants; adefovir-resistant mutants; tenofovirus-resistant mutants; entecavir-resistant mutants, etc.).

[0135] HBV is a small DNA virus belonging to the Hepadnaviridae family, classified as the type species of the genus Orthohepadnavirus. An HBV viral particle (virion) contains an outer lipid envelope and an icosahedral nucleocapsid core composed of proteins. The nucleocapsid generally encapsulates viral DNA and DNA polymerase, which has reverse transcriptase activity similar to that of retroviruses. The HBV outer envelope contains embedding proteins involved in viral binding to and entry into susceptible cells. HBV that attacks the liver is classified according to at least 10 genotypes (A-J) based on its sequence. Generally, there are four genes encoded by the genome, which are called C, P, S, and X. The core protein is encoded by gene C (HBcAg), which has an upstream in-frame AUG start codon preceding its start codon from which the precore protein is produced. HBeAg is produced by the proteolytic processing of the precore protein. DNA polymerase is encoded by gene P. The gene S encodes the surface antigen (HBsAg). The HBsAg gene is a single long open reading frame, but it contains three in-frame "start" (ATG) codons that divide the gene into three parts: pre-S1, pre-S2, and S. Due to the multiple start codons, three different sizes of polypeptides are produced, called large, medium, and small (pre-S1 + pre-S2 + S, pre-S2 + S, or S). These can have a ratio of 1:1:4 (Heermann et al., 1984).

[0136] Hepatitis B virus (HBV) proteins can be organized into several categories and functions. Polymerases function as reverse transcriptases (RT) to produce viral DNA from pregenomic RNA (pgRNA) and as DNA-dependent polymerases to produce covalent closed circular DNA (cccDNA) from viral DNA. These are covalently bonded to the 5' end of the minus strand. Core proteins produce the viral capsid and secreted E antigen. Surface antigens are hepatocyte-internalization ligands and are also the main components of viral globular and filamentous particles. Aviral particles are produced in much greater quantities than Dane particles (infectious virions) and can act as immune decoys.

[0137] Hepatitis B virus surface antigen As used herein, the terms “hepatitis B virus surface antigen” or “HBsAg” refer to the S-domain protein encoded by gene S (e.g., ORF S) of the HBV genome. Hepatitis B virus particles harbor viral nucleic acid within a core particle encased in three proteins encoded by gene S: a large surface protein, an intermediate surface protein, and a major surface protein. Of these proteins, the major surface protein is generally about 226 amino acids and contains only the S-domain.

[0138] infection As used herein, the term “infection” refers to the pathogenic invasion and / or proliferation of a microorganism, such as a virus, in a subject. Infection can be lysogenic, for example, with viral DNA dormant within the cell. Alternatively, infection can be lytic, for example, with the virus actively proliferating and causing the destruction of infected cells. Infection may not necessarily cause clinically apparent symptoms. It is not necessary to induce an infection. The infection may remain localized or may be transmitted, for example, through the blood or lymphatic system of the subject. For example, an individual with HBV infection can be identified by detecting viral load, surface antigen (HBsAg), e-antigen (HBeAg), and one or more of the various other assays known in the art for detecting HBV infection. Assays for detecting HBV infection may include testing a serum or blood sample for the presence of HBsAg and / or HBeAg, and optionally further screening for the presence of one or more viral antibodies (e.g., IgM and / or IgG) to compensate for any period during which HBV antigen may be at undetectable levels.

[0139] HBV infection The term “Hepatitis B virus infection” or “HBV infection” is commonly known in the technical field to refer to an infectious disease caused by the hepatitis B virus (HBV) that affects the liver. HBV infection can be acute or chronic. Some infected individuals may have no symptoms during the initial infection and then rapidly develop illness accompanied by vomiting, yellowish skin, fatigue, dark urine, and abdominal pain (Hepatitis B Fact Sheet 204, who.int. July 2014, accessed November 4, 2014). In many cases, these symptoms can last for several weeks and can be fatal. It can take 30 to 180 days for symptoms to begin. 90% of people infected around birth develop chronic hepatitis B infection, and less than 10% of people infected after the age of 5 develop it (Hepatitis B FAQs on Public Transmission, Centers for Disease Control and Prevention (CDC), accessed November 29, 2011). Most people with chronic diseases do not experience symptoms, but cirrhosis and liver cancer can eventually develop (Chang, 2007, Semin). Fetal Neonatal Med, 12:160-167). These complications result in death in 15–25% of those with chronic disease ("Hepatitis B Fact Sheet 204," who.int., July 2014, accessed November 4, 2014). In this specification, the term "HBV infection" includes acute and chronic hepatitis B infection. The term "HBV infection" also includes the asymptomatic, symptomatic, and asymptomatic chronic stages of initial HBV infection.

[0140] Liver inflammation As used herein, the terms “hepatitis” or “inflammation of the liver” refer to a physical condition in which the liver becomes swollen, dysfunctional, and / or painful, particularly as a result of damage or infection that may be caused by exposure to hepatotoxic drugs. Symptoms may include jaundice (yellowing of the skin or eyes), fatigue, weakness, nausea, vomiting, loss of appetite, and weight loss. If left untreated, hepatitis may progress to fibrosis, cirrhosis, liver failure, or liver cancer.

[0141] liver fibrosis As used herein, the terms “hepatic fibrosis” or “liver fibrosis” refer to the excessive accumulation of extracellular matrix proteins in the liver, which may include collagen (I, III, and IV), fibronectin, undulin, elastin, laminin, hyaluronan, and proteoglycans, resulting from inflammation and hepatocyte death. If left untreated, hepatic fibrosis can progress to cirrhosis, liver failure, or liver cancer.

[0142] TLR7 As used herein, "TLR7" refers to Toll-like receptor 7 of any species of origin (e.g., human, mouse, woodchuck, etc.).

[0143] TLR7 Agonist As used herein, "TLR7 agonist" refers to a compound that acts as an agonist of TLR7. Unless otherwise indicated, TLR7 agonists include any isomer (e.g., diastereomer or enantiomer), salt, solvate, polymorph, etc. This may include compounds in pharmaceutically acceptable forms. The TLR agonism for a particular compound can be determined in any suitable manner. For example, an assay for detecting the TLR agonism of a test compound is described, for example, in U.S. Provisional Patent Application No. 60 / 432,650, filed December 11, 2002, and a recombinant cell line suitable for use in such an assay is described, for example, in U.S. Provisional Patent Application No. 60 / 432,651, filed December 11, 2002. A further assay for evaluating TLR7 agonists is the HEK293-Blue-hTLR-7 cell assay described in Example 43 of International Publication No. 2016 / 091698 (this assay is incorporated herein by reference).

[0144] Diastereomer As used herein, the term "diastereomer" refers to a stereoisomer having two or more chiral centers, in which the molecules are not mirror images of each other. Diastereomers have different physical properties, such as melting point, boiling point, spectral characteristics, activity, and reactivity.

[0145] Compounds of general formulas (I) to (V) containing one or more chiral centers can exist as racemates, diastereomer mixtures, or optically active single isomers. Racemates can be separated into enantiomers according to known methods. In particular, diastereomer salts that can be separated by crystallization are formed from racemic mixtures by reaction with optically active acids such as D- or L-tartaric acid, mandelic acid, malic acid, lactic acid, or camphor sulfonic acid.

[0146] Pharmaceutically acceptable salts The compounds according to the present invention may exist in the form of their pharmaceutically acceptable salts.

[0147] The term "pharmaceutically acceptable salt" refers to a salt that retains the biological efficacy and properties of a free base or free acid, and is not biologically or otherwise undesirable. Salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid, particularly hydrochloric acid, as well as with organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and N-acetylcysteine.

[0148] Alternatively, these salts can be prepared by adding an inorganic or organic base to a free acid. Salts derived from inorganic bases include, but are not limited to, salts of sodium, potassium, lithium, ammonium, calcium, and magnesium. Salts derived from organic bases include, but are not limited to, primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, lysine, arginine, N-ethylpiperidine, piperidine, and salts of polyamine resins. The compounds of formula (I) can also exist in zwitterionic form. Particularly preferred are pharmaceutically acceptable salts of the compounds of formula (I) of hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and methanesulfonic acid.

[0149] Chemical modification of salts of pharmaceutical compounds is a well-known technique among pharmaceutical chemists to improve the physical and chemical stability, hygroscopicity, fluidity, and solubility of the compounds. This is exemplified by Bastin, Organic Process Research & Development. 2000,4,427-435 or in Ansel,In:Pharmaceutical Dosage Forms and Drug Delivery Systems,6th ed.(1995),pp.196 and 1456-1457 It is stated. For example, a pharmaceutically acceptable salt of a compound provided herein may be a sodium salt.

[0150] Combinations of medications As used herein, a pharmaceutical combination is understood as a combination of at least two different active compounds or prodrugs (medical compounds or pharmaceuticals) for treating a disease. A pharmaceutical combination may include compounds that are combined physically, chemically, or otherwise (e.g., in the same vial); compounds that are packaged together (e.g., as two separate objects in the same package (kit of parts) for either simultaneous or separate administration); or compounds that are provided separately but intended to be used together (e.g., the combination is explicitly stated on the compound label or accompanying documentation). In one embodiment, a pharmaceutical combination consists of a medical compound formulated for oral administration and a medical compound formulated for subcutaneous injection.

[0151] approximately As used herein, the terms “approximately” or “about” refer to values ​​similar to the reference values ​​stated when applied to one or more values ​​of interest. In certain embodiments, unless otherwise specified or particularly evident from the context, the terms “approximately” or “about” refer to a range of values ​​that fall within the range of 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or lower in either direction (greater than or less than) the reference values ​​stated (unless such numbers would exceed 100% of the possible values).

[0152] Administration As used herein, the terms “administer” or “give” mean to provide a substance (e.g., a drug combination or oligonucleotide) to a subject in a pharmacologically useful manner (e.g., to treat a symptom in the subject).

[0153] Asialoglycoprotein receptor (ASGPR) As used herein, the terms “asialoglycoprotein receptor” or “ASGPR” refer to a two-component C-type lectin formed by a major 48 kDa subunit (ASGPR-1) and a secondary 40 kDa subunit (ASGPR-2). ASGPR is primarily expressed on the sinusoidal surface of hepatocyte cells and plays a major role in the binding, internalization, and subsequent clearance of circulating glycoproteins containing terminal galactose or N-acetylgalactosamine residues (asialoglycoproteins).

[0154] Prodrug As used herein, the term “prodrug” refers to a form or derivative of a compound that is metabolized in a living organism, for example by a biological fluid or enzyme, after administration to a pharmacologically active form of the compound in order to produce a desired pharmacological effect. Prodrugs are described, for example, in *Organic Chemistry of Drug Design and Drug Action* by Richard B. Silverman, Academic Press, San Diego, 2004, Chapter 8 Prodrugs and Drug Delivery Systems, pp. 497-558.

[0155] subject As used herein, the term “subject” means any mammal, including mice, rabbits, and humans. In one embodiment, the subject is a human or a non-human primate. “Individual” Alternatively, the term "patient" may be used interchangeably with "subject."

[0156] treatment As used herein, terms such as “treatment,” “to treat,” and “to treat” generally mean obtaining a desired pharmacological and / or physiological effect. This effect is therapeutic in that it partially or completely cures a disease and / or adverse effects caused by the disease. The effect is provided by administering a therapeutic agent (e.g., a combination of pharmaceuticals or oligonucleotides) to a subject for the purpose of improving the subject’s health and / or well-being with respect to an existing condition (e.g., an existing HBV infection) or for the purpose of preventing or reducing the likelihood of the condition developing (e.g., preventing hepatic fibrosis, hepatitis, liver cancer or other conditions associated with HBV infection). As used herein, the term “treatment” encompasses any treatment of HBV infection in a subject and includes: (a) inhibiting the disease, i.e., stopping its development, such as inhibiting the increase of HBsAg and / or HBeAg; or (b) improving the disease (i.e., mitigating it), i.e., causing the regression of the disease, such as suppressing HBsAg and / or HBeAg production. Therefore, compounds or combinations of compounds that improve and / or inhibit HBV infection are compounds or combinations of compounds that treat HBV infection. Preferably, as used herein, the term “treatment” refers to a medical intervention for an already manifested disorder, such as treatment for an already defined and manifested HBV infection, particularly chronic HBV infection.

[0157] In some embodiments, the treatment involves reducing the frequency or severity of at least one sign, symptom, or contributing factor of a condition (e.g., HBV infection or a related condition) experienced by the subject. During HBV infection, the subject may exhibit symptoms such as yellowing of the skin and eyes (jaundice), dark urine, extreme fatigue, nausea, vomiting, and abdominal pain. Therefore, in some embodiments, the treatment provided herein, e.g., a combination of medications, may result in a reduction in the frequency or severity of one or more of such symptoms. However, HBV infection can develop into one or more hepatic conditions such as cirrhosis, hepatic fibrosis, hepatitis, or liver cancer. Therefore, in some embodiments, the treatment provided herein, e.g., a combination of medications, may result in a reduction in the frequency or severity of one or more of such conditions, or in prevention or mitigation.

[0158] Therapeutic effective dose The term "therapeutic dose" refers to the amount of the compound or pharmaceutical combination of the present invention, when administered to a subject, that (i) treat or prevent a particular disease, condition, or disorder; (ii) reduce, alleviate, or eliminate one or more symptoms of a particular disease, condition, or disorder; or (iii) prevent or delay the onset of one or more symptoms of a particular disease, condition, or disorder as described herein. The therapeutic dose will vary depending on the compound, the state of the disease being treated, the severity of the disease being treated, the age and relative health status of the subject, the route and form of administration, the judgment of the attending physician or veterinarian, and other factors.

[0159] Excipients As used herein, the term “excipient” refers to a non-therapeutic agent that may be included, for example, in one or more compositions comprising a pharmaceutical that is part of a pharmaceutical combination, in order to provide or contribute to a desired consistency or stabilizing effect.

[0160] Detailed description of the invention The present invention relates to pharmaceutical combinations comprising two categories of compounds: i) therapeutic oligonucleotides and ii) TLR7 agonists, each contained in a pharmaceutically acceptable carrier. The pharmaceutical combinations are intended for use in the treatment of hepatitis B virus infection, particularly in the treatment of patients with chronic HBV.

[0161] Although each category of compounds in a combination is listed separately, it should be understood that at least one compound from each category is present in the drug combination. The compounds can be administered simultaneously or separately. Compounds in the category of therapeutic oligonucleotides targeting HBV may be administered parenterally (e.g., intravenously, subcutaneously, or intramuscularly). TLR7 agonists may be administered enterally (e.g., orally or through the gastrointestinal tract).

[0162] In the first embodiment, the therapeutic oligonucleotide targeting HBV is an RNAi oligonucleotide for reducing the expression of HBsAg mRNA, preferably an RNAi oligonucleotide. In the second embodiment, the therapeutic oligonucleotide targeting HBV is an antisense oligonucleotide targeting HBV, preferably a GalNAc-conjugated antisense oligonucleotide.

[0163] 1. The RNAi oligonucleotide of the present invention In some embodiments, the first medicament in the pharmaceutical combination of the present invention is an inhibitor based on an oligonucleotide of HBV surface antigen expression that can be used to achieve a therapeutic benefit. Through the examination of HBV surface antigen mRNA and the testing of different oligonucleotides, a potent oligonucleotide for reducing the expression of HBV surface antigen (HBsAg) to treat HBV infection has been developed. The oligonucleotides provided herein are designed in some embodiments to target HBsAg mRNA sequences that cover >95% of the known HBV genome across all known genotypes. In some embodiments, such oligonucleotides result in a reduction of >90% of HBV pregenomic RNA (pgRNA) and HBsAg mRNA in the liver. In some embodiments, the reduction in HBsAg expression persists for a long period after a single dose or treatment regimen.

[0164] Accordingly, in some embodiments, the oligonucleotides provided herein are designed to have a region complementary to HBsAg mRNA for the purpose of targeting intracellular transcripts and inhibiting their expression. The complementary region is generally of a length and base content suitable for enabling the oligonucleotide (or its chain) to anneal to HBsAg mRNA for the purpose of inhibiting its expression. In some embodiments, the complementary region is at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleotides long. In some embodiments, the oligonucleotides provided herein have a region complementary to HBsAg mRNA in the range of 12-30 (e.g., 12-30, 12-22, 15-25, 17-21, 18-27, 19-27, or 15-30) nucleotides long. In some embodiments, the oligonucleotides provided herein have a region complementary to HBsAg mRNA that is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long.

[0165] In some embodiments, the oligonucleotides provided herein are designed to target mRNA sequences encoding HBsAg. For example, in some embodiments, oligonucleotides are provided having an antisense strand having a region complementary to the sequence shown below: ACAANAAUCCUCACAAUA (SEQ ID NO: 33), where N refers to any nucleotide (A, G, T, or C). In some embodiments, the oligonucleotide further comprises a sense strand that forms a double-stranded region with the antisense strand. In some embodiments, the sense strand has a region complementary to the sequence described below: UUNUUGUGAGGAUUN (SEQ ID NO: 34). In some embodiments, the sense strand includes a region complementary to the sequence shown below (shown from 5' to 3'): UUAUU GUGAGGAUUNUUGUC (Sequence ID 35).

[0166] In some embodiments, the antisense strand comprises or consists of the sequences described below: UUAUUGUGAGGAUUNUUGUCGG (SEQ ID NO: 36). In some embodiments, the antisense strand comprises or consists of the sequences described below: UUAUUGUGAGGAUUCUUGUCGG (SEQ ID NO: 37). In some embodiments, the antisense strand comprises or consists of the sequences described below: UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 38). In some embodiments, the sense strand comprises or consists of the sequences described below: ACAANAAUCCUCACAAUAA (SEQ ID NO: 39). In some embodiments, the sense strand comprises or consists of the sequences described below: GACAANAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 40). In some embodiments, the sense strand comprises or consists of the sequences described below: GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 41). In some embodiments, the sense strand comprises or consists of the sequences described below: GACAAGAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 42).

[0167] In some embodiments, the oligonucleotide for reducing HBsAg mRNA expression comprises an antisense strand and a sense strand forming a double-stranded region, wherein the sense strand comprises the sequence described in any one of SEQ ID NOs: 39-42, and the antisense strand comprises the sequence described in any one of SEQ ID NOs: 36-38. In some embodiments, the sense strand comprises 2'-fluoro and 2'-O-methyl modified nucleotides and at least one phosphorothioate nucleotide interbonding. In some embodiments, the sense strand is conjugated to an N-acetylgalactosamine (GalNAc) moiety. In some embodiments, the antisense strand comprises 2'-fluoro and 2'-O-methyl modified nucleotides and at least one phosphorothioate nucleotide interbonding. In some embodiments, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense strand comprises a phosphate analog. In some embodiments, each of the antisense and sense strands comprises a 2'-fluoro and 2'-O-methyl modified nucleotide and at least one phosphorothioate nucleotide interbond, the 4'-carbon of the 5'-nucleotide sugar of the antisense strand comprises a phosphate analog, and the sense strand is conjugated to an N-acetylgalactosamine (GalNAc) moiety.

[0168] In some embodiments, the sense strand containing the sequence described in any one of SEQ ID NOs: 40-42 includes 2'-fluoromodified nucleotides at positions 3, 8-10, 12, 13, and 17. In some embodiments, the sense strand contains 2'-O-methylmodified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26, and 31-36. In some embodiments, the sense strand contains one phosphorothioate nucleotide linkage. In some embodiments, the sense strand contains a phosphorothioate nucleotide linkage between the nucleotides at positions 1 and 2. In some embodiments, the sense strand is conjugated to an N-acetylgalactosamine (GalNAc) moiety.

[0169] In some embodiments, an antisense chain containing the sequence described in any one of SEQ ID NOs: 36-38 includes 2'-fluoromodified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16, and 19. In some embodiments, the antisense chain includes 2'-O-methylmodified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18, and 20-22. In some embodiments, the antisense chain includes three phosphorothioate nucleotide interlinks. In some embodiments, the antisense chain includes phosphorothioate nucleotide interlinks between nucleotides 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22. The bond is included. In some embodiments, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense chain contains a phosphate analog.

[0170] I. Double-stranded oligonucleotides for targeting HBsAg mRNA A variety of oligonucleotide structures exist that are useful for targeting HBsAg mRNA expression in the drug combinations of this disclosure, including RNAi, antisense, and miRNA. Any of the structures described herein or elsewhere may be used as a framework for incorporating or targeting the sequences described herein. Double-stranded oligonucleotides for targeting HBV antigen expression (e.g., via the RNAi pathway) generally have a sense strand and an antisense strand that form a double helix with each other. In some embodiments, the sense strand and antisense strand are not covalently bonded. However, in some embodiments, the sense strand and antisense strand are covalently bonded.

[0171] In some embodiments of the present invention, double-stranded oligonucleotides for reducing HBsAg mRNA expression are involved in RNA interference (RNAi). For example, RNAi oligonucleotides have been developed using each strand having a size of 19 to 25 nucleotides with at least one 3' overhang of 1 to 5 nucleotides (see, e.g., U.S. Patent No. 8,372,968). Longer oligonucleotides have also been developed that are treated by Dicer to produce active RNAi products (see, e.g., U.S. Patent No. 8,883,996). Further research has resulted in elongated double-stranded oligonucleotides in which at least one end of at least one strand extends beyond the double-stranded targeting region, including structures in which one of the strands contains a thermodynamically stabilized tetraloop structure (see, e.g., U.S. Patents No. 8,513,207 and 8,927,705, and International Publication No. 2010033225; disclosures of these oligonucleotides are incorporated herein by reference). Such structures may include single-strand elongation (on one or both sides of the molecule) and double-strand elongation.

[0172] In some embodiments, the oligonucleotides provided herein are cleavable by the Dicer enzyme. Such oligonucleotides may have an overhang (e.g., 1, 2, or 3 nucleotides long) at the 3' end of the sense strand. Such oligonucleotides (e.g., siRNA) may include a 21-nucleotide guide strand that is antisense to the target RNA and a complementary passenger strand, and both strands anneal to form a 19 bp double helix and two nucleotide overhangs at either or both of the 3' ends. Longer oligonucleotide designs are also available, including oligonucleotides having a 23-nucleotide guide strand and a 21-nucleotide passenger strand, with a blunt end on the right side of the molecule (3' end of passenger strand / 5' end of guide strand) and a 2-nucleotide 3' guide strand overhang on the left side of the molecule (5' end of passenger strand / 3' end of guide strand). Such molecules have a 21-base-pair double helix region. See, for example, U.S. Patents 9012138, 9012621, and 9193753. Each of these is incorporated herein with respect to their respective disclosures.

[0173] In some embodiments, the oligonucleotides disclosed herein may comprise a sense strand and an antisense strand, both in the range of 17–26 (e.g., 17–26, 20–25, 19–21, or 21–23) nucleotide lengths. In some embodiments, the sense strand and the antisense strand are of equal length. In some embodiments, for oligonucleotides having a sense strand and an antisense strand both in the range of 21–23 nucleotide lengths, the 3' overhang of the sense strand, the antisense strand, or both the sense strand and the antisense strand is 1 or 2 nucleotides long. In some embodiments, the oligonucleotide has a 23-nucleotide guide strand and a 21-nucleotide passenger strand. The molecule has a blunt end on the right side (3' end of the passenger strand / 5' end of the guide strand) and a 2-nucleotide 3' guide strand overhang on the left side (5' end of the passenger strand / 3' end of the guide strand). Such molecules have a 21-base-pair double-stranded region. In some embodiments, the oligonucleotide comprises a 25-nucleotide sense strand and a 27-nucleotide antisense strand, which, when acted upon by a dicer enzyme, result in an antisense strand incorporated into the mature RISC.

[0174] Other oligonucleotide designs for use in the compositions and methods disclosed herein include 16-mer siRNA (e.g., Nucleic Acids in Chemistry and Biology. Blackburn (ed.), Royal Society of Chemistry, 2006), shRNA (e.g., having a stem of 19 bp or less; e.g., Moore et al. Methods Mol. Biol. 2010; 629:141-158), blunt siRNA (e.g., 19 bp in length; e.g., Kraynack and Baker, RNA Vol. 12, p163-176 (2006)), asymmetric siRNA (aiRNA; e.g., Sun et al., Nat. Biotechnol. 26, 1379-1382 (2008)), and asymmetric short double-stranded siRNA (e.g., Chang et al. See al., Mol Ther. 2009 Apr;17(4):725-32, forked siRNA (e.g., Hohjoh, FEBS Letters, Vol 557, issues 1-3; Jan 2004, p 193-198), single-stranded siRNA (Elsner; Nature Biotechnology 30, 1063 (2012)), dumbbell-shaped circular siRNA (e.g., Abe et al. J Am This includes oligonucleotides (see Chem Soc 129:15108-15109 (2007)) and small internally segmented interfering RNAs (sisiRNA; see, e.g., Bramsen et al., Nucleic Acids Res. 2007 Sep;35(17):5886-5897). Each of the aforementioned references is incorporated in whole by reference with respect to the relevant disclosures therein. Further non-limiting examples of oligonucleotide structures that may be used in pharmaceutical combinations in some embodiments to reduce or inhibit HBsAg expression are microRNAs (miRNAs), short hairpin RNAs (shRNAs), and short siRNAs (see, e.g., Hamilton et al., Embo J., 2002, 21(17):4671-4679; also see U.S. Patent Application No. 20090099115).

[0175] a. Antisense chain In some embodiments, the antisense strand of an oligonucleotide may be called the “guide strand.” For example, if the antisense strand can engage with the RNA-inducible silencing complex (RISC) and bind to the Argonaut protein, or engage with or bind to one or more similar factors to directly silence the target gene, it may be called the guide strand. In some embodiments, the sense strand complementary to the guide strand may be called the “passenger strand.”

[0176] In some embodiments, the oligonucleotides provided herein include an antisense chain up to 50 nucleotides long (e.g., up to 30, up to 27, up to 25, up to 21, or up to 19 nucleotides). In some embodiments, the oligonucleotides provided herein include an antisense chain that is at least 12 nucleotides long (e.g., at least 12, at least 15, at least 19, at least 21, at least 25, or at least 27 nucleotides). In some embodiments, the antisense chain of the oligonucleotides disclosed herein is in the range of 12 to 50 or 12 to 30 nucleotides long (e.g., 12 to 30, 11 to 27, 11 to 25, 15 to 21, 15 to 27, 17 to 21, 17 to 25, 19 to 27, or 19 to 30). In one embodiment, the antisense chain of any one of the oligonucleotides disclosed herein is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides long.

[0177] In some embodiments, the antisense strand includes a region complementary to the sequence described in AATCTCACA (SEQ ID NO: 43) (shown from 5' to 3'); in some embodiments, the antisense strand includes the sequence described in UGUGAGGAUU (SEQ ID NO: 44) (shown from 5' to 3'); in some embodiments, the antisense strand includes the sequence described in TGTGAGGATT (SEQ ID NO: 45) (shown from 5' to 3').

[0178] In some embodiments, the oligonucleotide for reducing HBsAg mRNA expression may include an antisense strand having a region complementary to the sequence described in SEQ ID NO: 43 and one or two non-complementary nucleotides at its 3' end. In some embodiments, the antisense strand may include the nucleotide sequence described in any one of SEQ ID NOs: 36-38.

[0179] In some embodiments, the oligonucleotide for reducing HBsAg mRNA expression may include an antisense strand having a region complementary to the sequence described in SEQ ID NO: 43, wherein the antisense strand does not have the sequence described in any one of the following (described in 5' to 3'): TATTGTGAGGATTCTTGTCA (SEQ ID NO: 46); CGGTATTGTGAGGATTCTTG (SEQ ID NO: 47); TGTGAGGATTCTTGTCAACA (SEQ ID NO: 48); UAUUGUGAGGAUUUUUGUCAA (SEQ ID NO: 49); UGCGGUAUUGUGAGGAUUCTT (SEQ ID NO: 50); ACAGCATTGTGAGGATTCTTGTC (SEQ ID NO: 51); UAUUGUGAGGAUUUUUGUCAACA (SEQ ID NO: 52); AUUGUGAGGAUUUUUGUCAACAA (SEQ ID NO: 53); and UUGUGAGGAUUUUUGUCAACAAG (SEQ ID NO: 54). In some embodiments, the antisense strand differs from the nucleotide sequence shown in SEQ ID NO: 36, 37, or 38 by only 3 nucleotides or less.

[0180] b. Sense chain In some embodiments, a double-stranded oligonucleotide may have a sense strand up to 40 nucleotides long (e.g., up to 40, up to 35, up to 30, up to 27, up to 25, up to 21, up to 19, up to 17, or up to 12 nucleotides). In some embodiments, an oligonucleotide may have a sense strand at least 12 nucleotides long (e.g., at least 12, at least 15, at least 19, at least 21, at least 25, at least 27, at least 30, at least 35, or at least 38 nucleotides). In some embodiments, an oligonucleotide may have a sense strand in the range of 12 to 50 nucleotides long (e.g., 12 to 40, 12 to 36, 12 to 32, 12 to 28, 15 to 40, 15 to 36, 15 to 32, 15 to 28, 17 to 21, 17 to 25, 19 to 27, 19 to 30, 20 to 40, 22 to 40, 25 to 40, or 32 to 40). In some embodiments, the oligonucleotide may have a sense chain of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 30, 31, 32, 33, 34, 35, 36, 37, 38, 29, 39, or 40 nucleotides in length. In some embodiments, the sense chain of the oligonucleotide is longer than 27 nucleotides (e.g., 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides). In some embodiments, the sense chain of the oligonucleotide is longer than 25 nucleotides (e.g., 26, 27, 28, 29, or 30 nucleotides).

[0181] In some embodiments, the sense strand includes a stem loop at its 3' end. In some embodiments, the sense strand includes a stem loop at its 5' end. In some embodiments, the strand containing the stem loop is in the range of 2 to 66 nucleotides in length (e.g., 2 to 66, 10 to 52, 14 to 40, 2 to 30, 4 to 26, 8 to 22, 12 to 18, 10 to 22, 14 to 26, or 14 to 30 nucleotides). In some embodiments, the strand containing the stem loop is 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the stem includes a double helix of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 nucleotides in length. In some embodiments, the stem-loop provides better protection of the molecule against degradation (e.g., enzymatic degradation) and facilitates targeting for delivery to target cells. For example, in some embodiments, the loop provides additional nucleotides that can be modified without substantially affecting the gene expression inhibitory activity of the oligonucleotide. In a particular embodiment, an oligonucleotide is provided herein, where the sense strand comprises the stem-loop described below (e.g., at its 3' end): S1-L-S2, where S1 is complementary to S2, and L forms a loop between S1 and S2 of up to 10 nucleotides in length (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length).

[0182] In some embodiments, the stem-loop loop (L) is a tetraloop (e.g., within a nicked tetraloop structure). The tetraloop may contain ribonucleotides, deoxyribonucleotides, modified nucleotides, and combinations thereof. Typically, the tetraloop has 4-5 nucleotides.

[0183] c. Length of the double chain In some embodiments, the double-strand formed between the sense strand and the antisense strand is at least 12 (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21) nucleotides in length. In some embodiments, the double-strand formed between the sense strand and the antisense strand is in the range of 12 to 30 nucleotides in length (e.g., 12 to 30, 12 to 27, 12 to 22, 15 to 25, 18 to 30, 18 to 22, 18 to 25, 18 to 27, 18 to 30, 19 to 30 or 21 to 30 nucleotides in length). In some embodiments, the double-strand formed between the sense strand and the antisense strand is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. In some embodiments, the double-strand formed between the sense strand and the antisense strand does not extend over the entire length of the sense strand and / or the antisense strand. In some embodiments, the double-strand between the sense strand and the antisense strand extends over the entire length of either the sense strand or the antisense strand. In certain embodiments, the double-strand between the sense strand and antisense strand extends over the entire length of both the sense strand and the antisense strand.

[0184] d. Oligonucleotide termini In some embodiments, the oligonucleotide comprises a sense strand and an antisense strand, whereby a 3'-overhang is present on either the sense strand or the antisense strand, or both the sense strand and the antisense strand. In some embodiments, the oligonucleotides provided herein have one 5' end that is less thermodynamically stable compared to the other 5' ends. In some embodiments, an asymmetric oligonucleotide is provided that includes a blunt end at the 3' end of the sense strand and an overhang at the 3' end of the antisense strand. In some embodiments, the 3' overhang on the antisense strand is 1 to 8 nucleotides in length (e.g., 1, 2, 3, 4, 5, 6, 7 or 8 nucleotides in length).

[0185] Typically, RNAi oligonucleotides have two nucleotide overhangs at the 3' end of the antisense (guide) strand. However, other overhangs are also possible. In some embodiments, the overhang is a 3' overhang containing 1–6 nucleotides, optionally 1–5, 1–4, 1–3, 1–2, 2–6, 2–5, 2–4, 2–3, 3–6, 3–5, 3–4, 4–6, 4–5, 5–6 nucleotides, or 1, 2, 3, 4, 5, or 6 nucleotides. However, in some embodiments, the overhang is a 5' overhang containing 1–6 nucleotides, optionally 1–5, 1–4, 1–3, 1–2, 2–6, 2–5, 2–4, 2–3, 3–6, 3–5, 3–4, 4–6, 4–5, 5–6 nucleotides, or 1, 2, 3, 4, 5, or 6 nucleotides.

[0186] In some embodiments, one or more (e.g., two, three, or four) terminal nucleotides at the 3' or 5' end of the sense and / or antisense strand are modified. For example, in some embodiments, one or two terminal nucleotides at the 3' end of the antisense strand are modified. In some embodiments, the last nucleotide at the 3' end of the antisense strand is modified, for example, including a 2'-modification, e.g., 2'-O-methoxyethyl. In some embodiments, the last one or two terminal nucleotides at the 3' end of the antisense strand are complementary to the target. In some embodiments, the last one or two nucleotides at the 3' end of the antisense strand are not complementary to the target.

[0187] In some embodiments, a double-stranded oligonucleotide is provided having a nicked tetraloop structure in the 3'-terminal sense strand and two terminal overhang nucleotides at the 3' end of the antisense strand. In some embodiments, the two terminal overhang nucleotides are GG. Typically, one or both of the two terminal GG nucleotides of the antisense strand are complementary or non-complementary to the target.

[0188] In some embodiments, the 5' and / or 3' ends of the sense strand or antisense strand have reverse capped nucleotides.

[0189] In some embodiments, one or more (e.g., two, three, four, five, or six) modified nucleotide links are provided between the terminal nucleotides at the 3' or 5' ends of the sense and / or antisense strands. In some embodiments, modified nucleotide links are provided between overhang nucleotides at the 3' or 5' ends of the sense and / or antisense strands.

[0190] e. Mismatch In some embodiments, an oligonucleotide may have one or more (e.g., 1, 2, 3, 4, or 5) mismatches between the sense strand and the antisense strand. If there are two or more mismatches between the sense strand and the antisense strand, they may be arranged consecutively (e.g., two, three, or more consecutively) or scattered throughout the complementary region. In some embodiments, the 3' end of the sense strand contains one or more mismatches. In one embodiment, two mismatches are incorporated into the 3' end of the sense strand. In some embodiments, base mismatches or destabilization of the segment at the 3' end of the sense strand of the oligonucleotide improved the efficacy of the synthetic double helix in RNAi, possibly by facilitating processing by Dicer.

[0191] In some embodiments, the antisense strand is one or more compared to the corresponding transcript sequence. A complementary region may have regions that complement an HBsAg transcript containing multiple mismatches. The complementary region on an oligonucleotide may have up to 1, 2, 3, 4, 5, etc., as long as it maintains the ability to form complementary base pairs with the transcript under appropriate hybridization conditions. Alternatively, the complementary region of an oligonucleotide may have 1 or fewer, 2 or fewer, 3 or fewer, 4 or fewer, or 5 or fewer mismatches, as long as it maintains the ability to form complementary base pairs with HBsAg mRNA under appropriate hybridization conditions. In some embodiments, if there are two or more mismatches in a complementary region, they may be arranged consecutively (e.g., 2, 3, 4, or more consecutively) or scattered throughout the complementary region, as long as the oligonucleotide maintains the ability to form complementary base pairs with HBsAg mRNA under appropriate hybridization conditions.

[0192] II. Single-stranded oligonucleotides In some embodiments, the RNAi oligonucleotides for reducing HBsAg expression described herein are single-stranded oligonucleotides complementary to HBsAg mRNA. Such structures may include, but are not limited to, single-stranded RNAi oligonucleotides. Recent attempts have demonstrated the activity of single-stranded RNAi oligonucleotides (see, for example, Matsui et al. (May 2016), Molecular Therapy, Vol.24(5), 946-955).

[0193] Such single-stranded RNAi oligonucleotides may technically be considered antisense oligonucleotides, but they can still function through the mechanism of RNA interference and possess the characteristics described herein for RNAi oligonucleotides.

[0194] 2. Specific RNAi oligonucleotides of the present invention To facilitate reference and avoid unnecessary repetition, some definitions of RNAi oligonucleotides of the present invention as described herein are also referred to by the following "RNAi numbers".

[0195] In one embodiment, the RNAi oligonucleotide in the pharmaceutical combination of the present invention is an oligonucleotide that targets HBV. This RNAi oligonucleotide is also referred to herein as RNAi number 1.

[0196] In one embodiment, the RNAi oligonucleotide in the pharmaceutical combination of the present invention is HBsAg This RNAi oligonucleotide targets mRNA. This RNAi oligonucleotide is also referred to as RNAi number 2 in this specification.

[0197] In one embodiment, the RNAi oligonucleotide in the pharmaceutical combination of the present invention is HBsAg This RNAi oligonucleotide reduces mRNA expression. This RNAi oligonucleotide is also referred to as RNAi number 3 in this specification.

[0198] In one embodiment, the RNAi oligonucleotide in the pharmaceutical combination of the present invention is an oligonucleotide comprising an antisense chain of 19 to 30 nucleotides in length, wherein the antisense chain includes a region complementary to the sequence of HBsAg mRNA described in SEQ ID NO: 33 (ACAANAAUCCUCACAAUA). This RNAi oligonucleotide is also referred to herein as RNAi number 4.

[0199] In one embodiment, the RNAi oligonucleotide in the pharmaceutical combination of the present invention is an oligonucleotide for reducing the expression of HBsAg mRNA, and the oligonucleotide comprises an antisense strand of 19 to 30 nucleotides in length, the antisense strand being ACAANAAUCCUCACAAUA (the sequence of HBsAg mRNA as described in SEQ ID NO: 33) In contrast, it includes a complementary region. This RNAi oligonucleotide is also referred to as RNAi number 5 in this specification.

[0200] In one embodiment, the RNAi oligonucleotide in the pharmaceutical combination of the present invention is an oligonucleotide for reducing the expression of hepatitis B virus surface antigen (HBsAg) mRNA, and the oligonucleotide comprises an antisense strand and a sense strand that forms a double-stranded region. The sense strand is the sequence described in GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 41), comprising 2'-fluoromodified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methylmodified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36, and a phosphorothioate bond between the nucleotides at positions 1 and 2, wherein each nucleotide in the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety. The antisense strand is the sequence described in UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 38), and consists of 2'-fluoromodified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O-methylmodified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22, and a sequence containing phosphorothioate bonds between nucleotides at positions 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22. The 4'-carbon of the sugar in the 5'-nucleotide of the antisense chain contains methoxyphosphonate (MOP). This RNAi oligonucleotide is also referred to herein as RNAi number 6.

[0201] In one embodiment, the RNAi oligonucleotide in the pharmaceutical combination of the present invention is an oligonucleotide comprising an antisense strand and a sense strand that forms a double-stranded region. The sense strand comprises the sequence described in GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 41), which includes 2'-fluoromodified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methylmodified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36, and one phosphorothioate nucleotide bond between nucleotides at positions 1 and 2, wherein each nucleotide of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety, and the -GAAA- sequence has the following structure: [ka] Includes, The antisense chain is the sequence described in UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 38), comprising 2'-fluoromodified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O-methylmodified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22, and a sequence containing five phosphorothioate nucleotide interlinks between nucleotides 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense chain has the following structure: [ka] It has.

[0202] This RNAi oligonucleotide is also referred to herein as RNAi number 7. In one embodiment, RNAi number 7 is an oligonucleotide for reducing the expression of HBsAg mRNA. In one embodiment, the sense strand or antisequence of RNAi number 7 is used. The sense strand, or both the antisense and sense strands, consist of the respective sequences described above for these strands in RNAi number 7. In one embodiment of RNAi number 7, sequence number 41 is 5'-GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC-3' and / or sequence number 38 is 5'-UUAUUGUGAGGAUUUUUGUCGG-3'.

[0203] In one embodiment, the RNAi oligonucleotide in the pharmaceutical combination of the present invention has the structure shown in Figure 29A. This RNAi oligonucleotide is also referred to herein as RNAi number 8.

[0204] In one embodiment, the RNAi oligonucleotide in the pharmaceutical combination of the present invention is the oligonucleotide HBV(s)-219. This RNAi oligonucleotide is also referred to herein as RNAi number 9.

[0205] 3. Oligonucleotide modification of the RNAi agent of the present invention The modifications discussed in this section are particularly preferred for implementation with RNAi oligonucleotides in the present invention.

[0206] Oligonucleotides can be modified in various ways to improve or control specificity, stability, delivery, bioavailability, resistance to nuclease degradation, immunogenicity, base-pairing properties, RNA distribution and cellular uptake, and other characteristics relevant to therapeutic or research use. See, for example, Bramsen et al., Nucleic Acids Res., 2009, 37, 2867-2881; Bramsen and Kjems (Frontiers in Genetics, 3(2012):1-22). Thus, in some embodiments, the therapeutic oligonucleotides of the present disclosure may include one or more appropriate modifications. In some embodiments, the modified nucleotide has modifications in its base (or nucleic acid base), sugar (e.g., ribose, deoxyribose), or phosphate group.

[0207] The number of modifications on an oligonucleotide and the position of those nucleotide modifications can affect the properties of the oligonucleotide. For example, oligonucleotides can be delivered in vivo by conjugating or encapsulating them in lipid nanoparticles (LNPs) or similar carriers. However, if the oligonucleotide is not protected by LNPs or similar carriers, it may be advantageous for at least some of its nucleotides to be modified. Thus, in any particular embodiment of the therapeutic oligonucleotides provided herein, all or substantially all of the nucleotides of the oligonucleotide are modified. In some particular embodiments, more than half of the nucleotides are modified. In some particular embodiments, less than half of the nucleotides are modified. Typically, in bare delivery, all sugars are modified at the 2' position. These modifications may be reversible or irreversible. In some embodiments, the oligonucleotides disclosed herein have a sufficient number and variety of modified nucleotides to produce desired properties (e.g., protection from enzymatic degradation, ability to target desired cells after in vivo administration, and / or thermodynamic stability).

[0208] I. Sugar modification In some embodiments, the modified sugar (also referred to herein as a sugar analog) comprises a modified deoxyribose or ribose moiety, for example, one or more modifications occurring at the 2', 3', 4', and / or 5' carbon positions of the sugar. In some embodiments, the modified sugar also comprises non-natural alternative carbon structures, e.g., locked nucleic acids ("LNA") (see, e.g., Koshkin et al. (1998), Tetrahedron 54, 3607-3630), unlocked nucleic acids ("UNA") (see, e.g., Snead et al. (See 2013), Molecular Therapy-Nucleic Acids, 2, e103), and cross-linked nucleic acids ("BNA") (e.g., Imanishi and This may include those present in Obika (2002), The Royal Society of Chemistry, Chem.Commun., 1653–1659. Koshkin et al., Snead et al., and Imanishi and Obika are incorporated herein by reference with respect to their disclosures relating to sugar modifications.

[0209] In some embodiments, nucleotide modifications in sugars include 2' modifications. These 2' modifications can be 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-deoxy-2'-fluoro-β-d-arabinonucleotides. Typically, the modifications are 2'-fluoro, 2'-O-methyl, or 2'-O-methoxyethyl. In some embodiments, sugar modifications include modifications of the sugar ring, which may include modifications of one or more carbons on the sugar ring. For example, sugar modifications of a nucleotide may include the 2'-oxygen of the sugar being bonded to the 1'-carbon or 4'-carbon of the sugar, or the 2'-oxygen being bonded to the 1'-carbon or 4'-carbon via an ethylene or methylene bridge. In some embodiments, the modified nucleotide has an acyclic sugar lacking a 2'-carbon-3'-carbon bond. In some embodiments, the modified nucleotide has, for example, a thiol group at the 4' position of the sugar.

[0210] In some embodiments, the terminal 3'-terminal group (e.g., 3'-hydroxyl) is a phosphate group or another group, which can be used, for example, to attach a linker, adapter or label, or to directly ligate an oligonucleotide to another nucleic acid.

[0211] II. 5' terminal phosphate In some embodiments, the 5'-terminal phosphate group of the oligonucleotide enhances the interaction with Argonaut 2. However, oligonucleotides containing a 5'-phosphate group are readily degraded via phosphatases or other enzymes, which can limit their bioavailability in vivo. In some embodiments, the oligonucleotide contains a 5'-phosphate analog that is resistant to such degradation. In some embodiments, the phosphate analog may be oxymethylphosphonate, vinylphosphonate, or malonylphosphonate. In certain embodiments, the 5' end of the oligonucleotide chain is bonded to a chemical moiety that mimics the electrostatic and steric properties of a natural 5'-phosphate group ("phosphate mimic") (see, e.g., Prakash et al. (2015), Nucleic Acids Res., Nucleic Acids Res. 2015 Mar 31;43(6):2993-3011, the content of which relating to phosphate analogs is incorporated herein by reference). Numerous phosphate mimetic compounds that can be attached to the 5' end have been developed (see, for example, U.S. Patent No. 8,927,513, the content of which relating to phosphate analogs is incorporated herein by reference). Other modifications to the 5' end of oligonucleotides have been developed (see, for example, International Publication No. 2011 / 133871, the content of which relating to phosphate analogs is incorporated herein by reference). In certain embodiments, a hydroxyl group is attached to the 5' end of the oligonucleotide.

[0212] In some embodiments, oligonucleotides have a phosphate analog (referred to as a "4'-phosphate analog") at the 4'-carbon position of the sugar. For example, see U.S. Provisional Patent Application No. 62 / 383,207, filed September 2, 2016, entitled 4'-Phosphate Analogs and Oligonucleotides Comprising the Same, and U.S. Provisional Patent Application No. 12, filed September 12, 2016, entitled 4'-Phosphate See U.S. Provisional Patent Application No. 62 / 393,401, entitled "Analogs and Oligonucleotides Comprising the Same." The details relating to each of these phosphate analogs are incorporated herein by reference. In some embodiments, the oligonucleotides provided herein include a 4'-phosphate analog at the 5' terminal nucleotide. In some embodiments, the phosphate analog is an oxymethylphosphonate or analog thereof, in which the oxygen atom of the oxymethyl group is bonded to the sugar moiety (e.g., its 4'-carbon). In other embodiments, the 4'-phosphate analog is a thiomethylphosphonate or aminomethylphosphonate (in which the sulfur atom of the thiomethyl group or the nitrogen atom of the aminomethyl group is bonded to the 4'-carbon of the sugar moiety) or an analog thereof. In a particular embodiment, the 4'-phosphate analog is an oxymethylphosphonate. In some embodiments, the oxymethylphosphonate is represented by the formula -O-CH2-PO(OH)2 or -O-CH2-PO(OR)2, where R is independently selected from H, a CH3 alkyl group, CH2CH2CN, CH2OCOC(CH3)3, CH2OCH2CH2Si(CH3)3, or a protecting group. In certain embodiments, the alkyl group is CH2CH3. More typically, R is independently selected from H, CH3, or CH2CH3.

[0213] In certain embodiments, the phosphate analog bound to the oligonucleotide is a methoxyphosphonate (MOP). In certain embodiments, the phosphate analog bound to the oligonucleotide is a 5'-monomethyl protected MOP. In some embodiments, the following uridine nucleotides containing phosphate analogs may be used, for example, at position 1 of the guide (antisense) chain. [ka]

[0214] This modified nucleotide is called [Mephosphonic acid-4O-mU] or 5'-methoxyphosphonic acid-4'oxy-2'-O-methyluridine.

[0215] III. Inter-nucleoside bonding In some embodiments, phosphate modification or substitution may result in an oligonucleotide containing at least one (e.g., at least one, at least two, at least three, or at least five) modified nucleotide interbondings. In some embodiments, any one of the oligonucleotides disclosed herein contains 1 to 10 (e.g., 1 to 10, 2 to 8, 4 to 6, 3 to 10, 5 to 10, 1 to 5, 1 to 3, or 1 to 2) modified nucleotide interbondings. In some embodiments, any one of the oligonucleotides disclosed herein contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 modified nucleotide interbondings.

[0216] The modified nucleotide bond may be a phosphorothioate bond, a phosphorothioate bond, a phosphotriester bond, a thionoalkylphosphonate bond, a thionoalkylphosphotriester bond, a phosphoramidite bond, a phosphonate bond, or a boranophosphate bond. In some embodiments, any of the oligonucleotides disclosed herein At least one modified nucleotide bond is a phosphorothioate bond.

[0217] IV. Base Modification In some embodiments, the oligonucleotides provided herein have one or more modified nucleic acid bases. In some embodiments, the modified nucleic acid base (also referred to herein as a base analog) is ligated to the 1' position of the nucleotide sugar moiety. In certain embodiments, the modified nucleic acid base is a nitrogen base. In certain embodiments, the modified nucleic acid base does not contain a nitrogen atom. See, for example, U.S. Patent Application Publication No. 20080274462. In some embodiments, the modified nucleotide contains a universal base. However, in certain embodiments, the modified nucleotide does not contain a nucleic acid base (debasic).

[0218] In some embodiments, the universal base is a heterocyclic moiety located at the 1' position of the nucleotide sugar moiety in a modified nucleotide, or an equivalent position of a nucleotide sugar moiety substitution that, when present in a double helix, can be located opposite two or more bases without substantially altering the structure of the double helix. In some embodiments, a single-stranded nucleic acid containing a universal base has a lower T than a double helix formed from a reference single-stranded nucleic acid (e.g., oligonucleotide) that is perfectly complementary to the target nucleic acid. m It forms a double helix with a target nucleic acid having the universal base. However, in some embodiments, compared to a reference single-stranded nucleic acid in which the universal base is substituted with a base resulting in a single mismatch, the single-stranded nucleic acid containing the universal base has a higher T than the double helix formed with nucleic acids containing the mismatch base. m It forms a double helix with the target nucleic acid which has the following properties.

[0219] Non-limiting examples of universally binding nucleotides include inosine, 1-β-D-ribofuranosyl-5-nitroindole, and / or 1-β-D-ribofuranosyl-3-nitropyrrole (U.S. Patent Application Publication No. 20070254362 by Quay et al.; Van Aerschot et al., An acyclic 5-nitroindazole nucleoside analogue as ambiguous nucleoside, Nucleic Acids Res. 1995 Nov 11;23(21):4363-70; Loakes et al., 3-Nitropyrrole and 5-nitroindole as universal bases in primers for DNA sequencing). and PCR, Nucleic Acids Res. 1995 Jul 11;23(13):2361-6; Loakes and Brown, 5-Nitroindole as an universal base analogue, Nucleic Acids Res. 1994 Oct 11;22(20):4039-43. Each of the above is incorporated herein by reference with respect to their disclosures relating to base modification.

[0220] V. Reversible modification Certain modifications can be made to protect oligonucleotides from the in vivo environment before they reach target cells, but this may reduce their potency or activity once they reach the cytosol of the target cell. Reversible modifications can be made so that the molecule retains desirable properties outside the cell and is then removed upon entering the cytosolic environment of the cell. Reversible modifications can be removed, for example, by the action of intracellular enzymes or by intracellular chemical conditions (e.g., via reduction by intracellular glutathione).

[0221] In some embodiments, reversibly modified nucleotides include a glutathione-sensitive moiety. Typically, nucleic acid molecules are chemically modified with a cyclic disulfide moiety to mask the negative charge generated by the internucleotide diphosphate bond, thereby facilitating cell uptake and nuclease absorption. Improves resistance. See U.S. Patent Application Publication No. 2011 / 0294869 ("Traversa"), originally assigned to Traversa Therapeutics, Inc., PCT Publication No. WO 2015 / 188197 ("Solstice"), Solstice Biologics, Ltd., Meade et al., Nature Biotechnology, 2014, 32:1256-1263 ("Meade"), and PCT Publication No. WO 2014 / 088920, Merck Sharp & Dohme Corp. Each of these is incorporated by reference for disclosure of such modifications. This reversible modification of the internucleotide diphosphate bond is designed to be cleaved intracellularly by the reducing environment of the cytosol (e.g., glutathione). Previous examples include neutralizing phosphotriester modifications reported to be cleavable intracellularly (Dellinger). et al. J. Am. Chem. Soc. 2003, 125:940-950).

[0222] In some embodiments, such reversible modifications allow for protection of the oligonucleotide during in vivo administration (e.g., passing through the blood and / or cellular lysosome / endosomal compartments) where the oligonucleotide is exposed to nucleases and other harsh environmental conditions (e.g., pH). When released into the cytosol of a cell where glutathione levels are higher than in the extracellular space, the modification is reversed, resulting in a cleaved oligonucleotide. Using reversible glutathione-sensitive moieties makes it possible to introduce sterically larger chemical groups into the oligonucleotide of interest compared to the available options using irreversible chemical modifications. This is because these larger chemical groups are removed in the cytosol and therefore do not interfere with the biological activity of the oligonucleotide within the cytosol of a cell. As a result, these larger chemical groups can be manipulated to impart various advantages to the nucleotide or oligonucleotide, such as nuclease resistance, lipophilicity, charge, thermal stability, specificity, and reduced immunogenicity. In some embodiments, the structure of the glutathione-sensitive moiety can be manipulated to alter the dynamics of its release.

[0223] In some embodiments, the glutathione-sensitive moiety is bonded to the sugar of the nucleotide. In some embodiments, the glutathione-sensitive moiety is bonded to the 2'-carbon of the sugar of the modified nucleotide. In some embodiments, the glutathione-sensitive moiety is located at the 5'-carbon of the sugar, particularly when the modified nucleotide is the 5'-terminal nucleotide of an oligonucleotide. In some embodiments, the glutathione-sensitive moiety is located at the 3'-carbon of the sugar, particularly when the modified nucleotide is the 3'-terminal nucleotide of an oligonucleotide. In some embodiments, the glutathione-sensitive moiety includes a sulfonyl group. See, for example, U.S. Provisional Patent Application No. 62 / 378,635, filed on 23 August 2016, entitled *Compositions Comprising Reversibly Modified Oligonucleotides and Uses Thereof*. Its contents are incorporated herein by reference with respect to its relevant disclosures.

[0224] IV. Targeted Ligands In some embodiments, it may be desirable to target one or more cells or one or more organs with the oligonucleotides of this disclosure. Such strategies may help to avoid undesirable effects in other organs or to avoid excessive loss of oligonucleotides to cells, tissues, or organs that are not beneficial to the oligonucleotides. Accordingly, in some embodiments, the oligonucleotides disclosed herein may be modified to facilitate targeting of specific tissues, cells, or organs, for example, to facilitate delivery of oligonucleotides to the liver. In certain embodiments, the oligonucleotides disclosed herein may be modified to facilitate delivery of oligonucleotides to hepatocytes in the liver. In some embodiments, the oligonucleotides include nucleotides conjugated to one or more targeting ligands.

[0225] Targeting ligands may include carbohydrates, amino sugars, cholesterol, peptides, polypeptides, proteins, or portions of proteins (e.g., antibodies or antibody fragments) or lipids. In some embodiments, the targeting ligand is an aptamer. For example, the targeting ligand may be an RGD peptide used to target tumor vascular structures or glioma cells, a CREKA peptide for targeting tumor vascular structures or stomas, transferrin, lactoferrin, or an aptamer for targeting transferrin receptors expressed on CNS vascular structures, or an anti-EGFR antibody for targeting EGFR on glioma cells. In certain embodiments, the targeting ligand is one or more GalNAc moieties.

[0226] In some embodiments, one or more nucleotides (e.g., 1, 2, 3, 4, 5, or 6) of an oligonucleotide are each conjugated to a distinct targeting ligand. In some embodiments, 2 to 4 nucleotides of an oligonucleotide are each conjugated to a distinct targeting ligand. In some embodiments, the targeting ligand is conjugated to 2 to 4 nucleotides at either the sense strand or antisense strand, so that the targeting ligand is like the bristles of a toothbrush and the oligonucleotide is like a toothbrush (e.g., the ligand is conjugated to an overhang or extension of 2 to 4 nucleotides on the 5' or 3' end of the sense strand or antisense strand). For example, the oligonucleotide may contain a stem loop at either the 5' or 3' end of the sense strand, and 1, 2, 3, or 4 nucleotides of the stem loop can be individually conjugated to the targeting ligand.

[0227] In some embodiments, it is desirable to target hepatocytes of the target liver with oligonucleotides that reduce HBV antigen expression. For this purpose, any suitable hepatocyte-targeting moiety may be used.

[0228] GalNAc is a high-affinity ligand for the asialocrypoprotein receptor (ASGPR), which is primarily expressed on the sinusoidal surface of hepatocytes and plays a major role in the binding, internalization, and subsequent clearance of circulating glycoproteins containing terminal galactose or N-acetylgalactosamine residues (asialocrypoproteins). By using (indirect or direct) conjugation of the GalNAc moiety to the oligonucleotides of this disclosure, these oligonucleotides can be targeted to ASGPR expressed on these hepatocytes.

[0229] In some embodiments, the oligonucleotides of the Disclosure are directly or indirectly conjugated to monovalent GalNAc. In some embodiments, the oligonucleotides are directly or indirectly conjugated to two or more monovalent GalNAc (i.e., conjugated to two, three, or four monovalent GalNAc moieties, typically three or four monovalent GalNAc moieties). In some embodiments, the oligonucleotides of the Disclosure are conjugated to one or more divalent GalNAc, trivalent GalNAc, or tetravalent GalNAc moieties.

[0230] In some embodiments, one or more nucleotides (e.g., 1, 2, 3, 4, 5, or 6) of the oligonucleotide are each conjugated to a GalNAc moiety. In some embodiments, 2 to 4 nucleotides of the loop (L) of the stem-loop are each conjugated to a separate GalNAc. In some embodiments, the targeting ligand is conjugated to 2 to 4 nucleotides at the end of either the sense strand or the antisense strand, such that the GalNAc moiety resembles the bristles of a toothbrush and the oligonucleotide resembles a toothbrush (e.g., the ligand is conjugated to either the sense strand or the antisense strand). (The GalNAc moiety is conjugated to an overhang or extension of 2 to 4 nucleotides on the 5' or 3' end of the antisense strand.) For example, an oligonucleotide may contain a stem loop at either the 5' or 3' end of the sense strand, and 1, 2, 3, or 4 nucleotides of the stem loop may be individually conjugated to the GalNAc moiety. In some embodiments, the GalNAc moiety is conjugated to nucleotides of the sense strand. For example, four GalNAc moieties can be conjugated to nucleotides in a tetraloop of the sense strand, with each GalNAc moiety being conjugated to one nucleotide.

[0231] In some embodiments, the oligonucleotides herein include monovalent GalNAc bound to a guanidine nucleotide, called [ademG-GalNAc] or 2'-aminodiethoxymethanol-guanidine-GalNAc, as shown below. [ka]

[0232] In some embodiments, the oligonucleotides herein include a monovalent GalNAc bound to an adenine nucleotide, called [ademA-GalNAc] or 2'-aminodiethoxymethanol-adenine-GalNAc, as shown below. [ka]

[0233] An example of such a conjugation is shown below for a loop containing the nucleotide sequence GAAA from 5' to 3' (L = linker, X = heteroatom). The stem bond point is shown. Such a loop may be located at positions 27-30 of the molecule shown in Figure 20, for example. In the chemical formula, [ka] This is a binding site to the oligonucleotide chain. [ka]

[0234] Targeting ligands can be conjugated to nucleotides using appropriate methods or chemistry (e.g., click chemistry). In some embodiments, the targeting ligand is conjugated to a nucleotide using a click linker. In some embodiments, an acetal linker is used to conjugate the targeting ligand to one nucleotide of any of the oligonucleotides described herein. Acetal linkers are disclosed, for example, in International Patent Application Publication No. WO2016100401 A1, published on June 23, 2016, and the content relating to such linkers is incorporated herein by reference. In some embodiments, the linker is an unstable linker. However, in other embodiments, the linker is fairly stable.

[0235] An example of a loop containing the nucleotide GAAA from 5' to 3', where the GalNAc portion is attached to the loop's nucleotide using an acetal linker, is shown below. Such loops can exist, for example, at positions 27-30 in the molecule shown in Figure 20. In the chemical formula, [ka] This is a binding site to the oligonucleotide chain. [ka]

[0236] 4. Further GalNAc-conjugate therapeutic oligonucleotides targeting HBV In one embodiment, the oligonucleotides of the present invention are therapeutic oligonucleotides that target HBV mRNA and whose delivery to the liver, particularly hepatocytes, is improved by conjugation to an asialoglycoprotein receptor (ASGPR)-targeting conjugate such as a divalent, trivalent, or tetravalent GalNAc cluster (an exemplary example in Figure 1). International Publication No. 2015 / 173208 describes such GalNAc-conjugate antisense oligonucleotides (SEQ ID NO: 1) that target HBV mRNA and their manufacture.

[0237] The GalNAc conjugate therapeutic oligonucleotides in the pharmaceutical combination of the present invention can reduce the expression of HBV mRNA (target nucleic acid), particularly the expression of HBsAg and HBx (both encoded by Sequence ID No. 1) of the hepatitis B virus. Furthermore, the GalNAc conjugate therapeutic oligonucleotides of the present invention can preferably reduce HBsAg expression from HBV fragments incorporated into chromosomes.

[0238] In some embodiments, the GalNAc conjugate therapeutic oligonucleotide of the present invention binds to a target nucleic acid at a level of at least 10% or 20%, more preferably, at a level of normal expression (e.g., GalNAc conjugate therapeutic oligonucleotide). Reduces expression by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% compared to the expression level in the absence of the nucleotide.

[0239] In one embodiment, the GalNAc-conjugate therapeutic oligonucleotides of the present invention can downregulate (e.g., inhibit, reduce, or eliminate) the expression of HBx or HBsAg genes. Such downregulation can typically occur in target cells, e.g., mammalian cells, e.g., human cells, e.g., liver cells, e.g., hepatocytes, particularly HBV-infected hepatocytes. In some embodiments, the GalNAc-conjugate therapeutic oligonucleotides of the present invention bind to target nucleic acids and affect expression inhibition by at least 50% compared to normal expression levels, more preferably by at least 60%, 70%, 80%, 90%, or 95% compared to normal expression levels (e.g., expression levels in the absence of the GalNAc-conjugate therapeutic oligonucleotide). The regulation of HBV mRNA and HBsAg and HBV DNA expression levels can be determined using the methods described in the Materials and Methods section.

[0240] One aspect of the present invention relates to a therapeutic oligonucleotide comprising a continuous nucleotide sequence of 12 to 30 nucleotides in length having at least 90% complementarity to positions 1530 to 1602 of Sequence ID No. 1.

[0241] In one embodiment of the present invention, the therapeutic oligonucleotide is complementary to a sequence selected from positions 1530-1602;1530-1598;1530-1543;1530-1544;1531-1543;1551-1565;1551-1566;1577-1589;1577-1591;1577-1592;1578-1590;1578-1592;1583-1598;1584-1598;1585-1598 and 1583-1602 of SEQ ID NO: 1. In particular, therapeutic oligonucleotides that have 100% complementarity to the target sequences at positions 1530-1544, 1531-1543, 1583-1602, and 1583-1598 are advantageous.

[0242] In some embodiments, the therapeutic oligonucleotide comprises a continuous sequence of 12 to 30 nucleotides in length, which is at least 91% complementary, e.g., at least 92%, e.g., at least 93%, e.g., at least 94%, e.g., at least 95%, e.g., at least 96%, e.g., at least 97%, e.g., at least 98%, 99%, or 100% complementary, to a region of the target nucleic acid or target sequence.

[0243] It is advantageous that the consecutive nucleotide sequence is perfectly complementary (100% complementary) to a consecutive sequence in the target sequence selected from the group consisting of positions 1530-1602;1530-1598;1530-1543;1530-1544;1531-1543;1551-1565;1551-1566;1577-1589;1577-1591;1577-1592;1578-1590;1578-1592;1583-1598;1584-1598;1585-1598, or 1583-1602 of SEQ ID NO: 1, or in some embodiments, there may be one or two mismatches between the therapeutic oligonucleotide and the target sequence.

[0244] In one embodiment of the present invention, the GalNAc conjugate antisense oligonucleotide is 13 to 20 nucleotides long and has a sequence of at least 12 nucleotides that is 100% complementary to the sequence at positions 1530-1602 of SEQ ID NO: 1 or SEQ ID NO: 28. It is understood that this compound is to be combined with a TLR7 agonist, as described in the section on TLR7 agonists.

[0245] In some embodiments, the antisense oligonucleotides of the present invention are 13-24 nucleotides. The creotide length includes, for example, 13 to 22, or 14 to 20 consecutive nucleotide lengths, or consists of these. In a preferred embodiment, the antisense oligonucleotide includes, or consists of, 13 to 18, or 15 to 18 nucleotide lengths.

[0246] In some embodiments, the sequential nucleotide sequence includes or consists of 12 to 20 nucleotides in length, e.g., 12 to 18, e.g., 13 to 17, e.g., 13 to 15, e.g., 13, 14, 15, 16, or 17 nucleotides. Since the antisense oligonucleotide may include, for example, a further nucleoside acting as a biocleavable linker between the sequential nucleotide sequence and the conjugate, it should be understood that the sequential nucleotide sequence is always equal to or shorter than the total length of the antisense oligonucleotide. Furthermore, it should be understood that any range provided herein includes the endpoint of the range. Therefore, when an antisense oligonucleotide is described as containing 12 to 30 nucleotides, it includes both 12 and 30 nucleotides.

[0247] In some embodiments, the continuous nucleotide sequence includes or consists of a sequence selected from the group consisting of the following:

[0248] gcgtaaagagagg(sequence number 2); gcgtaaagagaggt(sequence number 3); cgcgtaaagagaggt(Sequence 4); agaaggcacagacgg(sequence number 5); gagaaggcacagacgg(sequence number 6); agcgaagtgcacacgg(sequence number 7); gaagtgcacacgg(sequence number 8); gcgaagtgcacacgg(indicate number 9); agcgaagtgcacacg(sequence number 10); cgaagtgc acacg(code element 11); aggtgaagcgaagtgc(sequence number 12); aggtgaagcgaagtg(sequence number 13); aggtgaagcgaagt(sequence number 14); and gcagaggtgaagcgaagtgc (Sequence ID 29).

[0249] In some embodiments, the antisense oligonucleotide comprises or consists of a 12 to 22-nucleotide length having a continuous nucleotide sequence of at least 12 nucleotides having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of the following.

[0250] gcgtaaagagagg(sequence number 2); gcgtaaagagaggt(sequence number 3); and cgcgtaaagagaggt (Sequence ID 4).

[0251] In some embodiments, the antisense oligonucleotide comprises or consists of a 12-22 nucleotide length having a sequence of at least 12 nucleotides having at least 90% identity, preferably 100% identity, to a sequence selected from the following:

[0252] agaaggcacagacgg(sequence number 5); or gagaaggcacagacgg (Sequence ID 6).

[0253] In some embodiments, the antisense oligonucleotide is selected from the group consisting of the following: It comprises or consists of a 12 to 22 nucleotide length having a continuous nucleotide sequence of at least 12 nucleotides having at least 90% identity, preferably 100%, with respect to the selected sequence.

[0254] agcgaagtgcacacgg(sequence number 7); gaagtgcacacgg(sequence number 8); gcgaagtgcacacgg(indicate number 9); agcgaagtgcacacg(sequence number 10); cgaagtgc acacg(code element 11); aggtgaagcgaagtgc(Sequence ID 12) aggtgaagcgaagtg(sequence number 13); aggtgaagcgaagt(sequence number 14); and gcagaggtgaagcgaagtgc (Sequence ID 29).

[0255] In some embodiments, the antisense oligonucleotide comprises or consists of a 12 to 22-nucleotide length having a continuous nucleotide sequence of at least 12 nucleotides having at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of the following.

[0256] aggtgaagcgaagtgc(Sequence ID 12) aggtgaagcgaagtg(sequence number 13); aggtgaagcgaagt(sequence number 14); and gcagaggtgaagcgaagtgc (Sequence ID 29).

[0257] 5. Oligonucleotide modification of the antisense oligonucleotide of the present invention The modifications discussed in this section are particularly preferred for implementation with antisense oligonucleotides of the present invention.

[0258] It is understood that continuous nucleic acid base sequences (motif sequences) can be modified, for example, to increase nuclease resistance and / or binding affinity to target nucleic acids.

[0259] In one embodiment, the consecutive nucleic acid base sequence of the oligonucleotide contains at least one modified internucleoside bond. Preferred internucleoside modifications are described in the "Definition" section of "Modified Internucleoside Bonds". It is advantageous if at least 75%, for example all, of the internucleoside bonds in the consecutive nucleotide sequence are internucleoside bonds. In some embodiments, all internucleoside bonds in the consecutive sequence of oligonucleotides are phosphorothioate bonds.

[0260] The oligonucleotides of the present invention are designed using modified nucleosides and DNA nucleosides. It is advantageous to use high-affinity modified nucleosides.

[0261] In one embodiment, the oligonucleotide comprises at least three modified nucleosides, e.g., at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 modified nucleosides. In one embodiment, the oligonucleotide comprises 3 to 8 modified nucleosides, e.g., 4 to 6 modified nucleosides, e.g., 4, 5, or 6 nucleosides, e.g., 5 or 6 modified nucleosides. Preferred modifications are described in the “Modified Nucleosides,” “High-Affinity Modified Nucleosides,” “Sugar Modifications,” “2' Sugar Modifications,” and the “Definitions” section for Locked Nucleic Acids (LNAs).

[0262] In one embodiment, the oligonucleotide comprises one or more sugar-modified nucleosides, such as 2'-sugar-modified nucleosides. Preferably, the oligonucleotide of the present invention comprises one or more 2'-sugar-modified nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides. It is advantageous if one, more, or all of the modified nucleosides are locked nucleic acid (LNA).

[0263] In some embodiments, the oligonucleotides of the present invention, for example, a continuous nucleotide sequence, comprises at least one LNA nucleoside, for example, 1, 2, 3, 4, 5, 6, 7, or 8 LNA nucleosides, for example, 2 to 6 LNA nucleosides, for example, 3 to 6 LNA nucleosides, 4 to 6 LNA nucleosides, or 4, 5, or 6 LNA nucleosides.

[0264] In some embodiments, at least 75%, for example, at least 80%, for example, at least 85%, for example, at least 90% of the modified nucleosides of the oligonucleotide are LNA nucleosides. In further embodiments, all of the modified nucleosides of the oligonucleotide are LNA nucleosides. In further embodiments, the LNA nucleosides are selected from beta-D-oxyLNA, thioLNA, aminoLNA, oxyLNA, ScET and / or ENA in a beta-D or alpha-L configuration or a combination thereof. In further embodiments, all LNA nucleosides are beta-D-oxyLNA. In further embodiments, the cytosine unit is 5-methylcytosine. For the nuclease stability of the oligonucleotide or continuous nucleotide sequence, it is advantageous to have at least one LNA nucleoside at the 5' end and at least two LNA nucleosides at the 3' end of the nucleotide sequence.

[0265] 6. Antisense oligonucleotide design for RNase H mobilization In embodiments of the present invention in which the therapeutic oligonucleotide is an antisense oligonucleotide, the oligonucleotide of the present invention, when hybridized to a target nucleic acid, produces RNase H can be mobilized.

[0266] The pattern in which modified nucleosides (such as high-affinity modified nucleosides) are incorporated into oligonucleotide sequences is generally referred to as oligonucleotide design.

[0267] In one embodiment of the present invention, where the therapeutic oligonucleotide is an antisense oligonucleotide, favorable structural designs are, for example, the gapmer designs described in the "Definitions" section for "Gapmer," "LNA Gapmer," "MOE Gapmer," and "Mixed Wing Gapmer." Gapmer designs include gapmers having uniform flanks and mixed wing-flanks. In the present invention, it is advantageous when the sequential nucleotide sequence of the present invention is a gapmer of the FG-F' design. In some embodiments, the gapmer is an LNA or MOE gapmer having a subsequent uniform flank design of 3-7-3, 3-8-2, 3-8-3, 2-9-4, 3-9-3, 3-10-3, or 5-10-5.

[0268] In some embodiments, the antisense oligonucleotide comprises or consists of a 12-22 nucleotide length having a continuous nucleotide sequence selected from the group consisting of: GCGtaaagagaGG(Sequence ID 2); GCGtaaagagAGG(Sequence ID 2); GCGtaaagagaGGT(Sequence ID 3); CGCgtaaagagaGGT(Sequence ID 4); AGAaggcacagaCGG(Sequence ID 5); GAGaaggcacagaCGG(SEQ ID NO: 6); AGCgaagtgcacaCGG(Sequence ID 7); GAAgtgcacacGG(Sequence ID 8); GAAgtgcacaCGG(Sequence 8); GCGaagtgcacaCGG(Sequence ID 9); AGCgaagtgcacACG(Sequence ID 10); CGAagtgcacaCG(Sequence ID 11); AGGtgaagcgaagTGC(sequence number 12); AGGtgaagcgaaGTG (Sequence ID 13) AGgtgaagcgaAGTG(Sequence ID 13); and AGGtgaagcgaAGT(Sequence ID 14); Uppercase letters indicate LNA nucleosides such as beta-D-oxy LNA, while lowercase letters indicate DNA nucleosides.

[0269] In some embodiments, the antisense oligonucleotide comprises or consists of a 12-22 nucleotide length having a continuous nucleotide sequence selected from the group consisting of: GCGtaaagagaGG(Sequence ID 2); GCGtaaagagAGG(Sequence ID 2); GCGtaaagagaGGT(SEQ ID NO: 3); and CGCgtaaagagaGGT(Sequence ID 4); Uppercase letters indicate LNA nucleosides such as beta-D-oxy LNA, while lowercase letters indicate DNA nucleosides.

[0270] In some embodiments, the antisense oligonucleotide comprises or consists of a 12-22 nucleotide length having a continuous nucleotide sequence comprising the following:

[0271] AGAaggcacagaCGG(SEQ ID NO: 5); or GAGaaggcacagaCGG(SEQ ID NO: 6); Uppercase letters indicate LNA nucleosides such as beta-D-oxy LNA, while lowercase letters indicate DNA nucleosides.

[0272] In some embodiments, the antisense oligonucleotide comprises or consists of a 12-22 nucleotide length having a continuous nucleotide sequence selected from the group consisting of: AGCgaagtgcacaCGG(Sequence ID 7); GAAgtgcacacGG(Sequence ID 8); GAAgtgcacaCGG(Sequence 8); GCGaagtgcacaCGG(Sequence ID 9); AGCgaagtgcacACG(Sequence ID 10); CGAagtgcacaCG(Sequence ID 11); AGGtgaagcgaagTGC(sequence number 12); AGGtgaagcgaaGTG (Sequence ID 13) AGgtgaagcgaAGTG(Sequence ID 13); and AGGtgaagcgaAGT(Sequence ID 14); Uppercase letters indicate LNA nucleosides such as beta-D-oxy LNA, while lowercase letters indicate DNA nucleosides.

[0273] In some embodiments, the antisense oligonucleotide comprises or consists of a 12-22 nucleotide length having a continuous nucleotide sequence selected from the group consisting of: AGGtgaagcgaagTGC(sequence number 12); AGGtgaagcgaaGTG (Sequence ID 13) AGgtgaagcgaAGTG(Sequence ID 13); and AGGtgaagcgaAGT(Sequence ID 14); Uppercase letters indicate LNA nucleosides such as beta-D-oxy LNA, while lowercase letters indicate DNA nucleosides.

[0274] In some embodiments, the antisense oligonucleotide comprises or consists of a 20-24 nucleotide length having the following consecutive nucleotide sequence.

[0275] GCAGAggtgaagcgaAGTGC (Sequence ID 29) Uppercase underlined letters indicate MOE nucleosides, while lowercase letters indicate DNA nucleosides.

[0276] Table 1 below shows the motif sequences of the continuous nucleotide sequences of antisense oligonucleotides targeting positions 1530-1602 of Sequence ID No. 1, as well as an overview of these gapmer designs intended for use in the present invention. [Table 1]

[0277] In the design column of Table 1, uppercase letters represent 2'-glycosylated nucleosides, particularly LNA nucleosides such as beta-D-oxy-LNA, or MOE nucleosides, while lowercase letters represent DNA nucleosides. The nucleoside bonds may be phosphodiesters or phosphorothioates. In some embodiments, all nucleoside bonds are phosphorothioates.

[0278] In all cases, the antisense oligonucleotide may further include regions D' and / or D'' at the 5' or 3' end of the FG-F' design, as described in the "Definition" section of "Region D' or D'' in the oligonucleotide". Some embodiments The antisense oligonucleotides of the present invention have 1 to 5, for example, 1, 2, or 3 phosphodiester-linked nucleoside units, e.g., DNA units, at the 5' or 3' end of the gapmer region. DNA nucleosides generally have nucleic acid bases as defined in the definition of nucleic acid bases, such as naturally occurring DNA nucleosides having nucleic acid bases selected from purines (e.g., adenine and guanine) and pyrimidines (e.g., uracil, thymine, and cytosine). In some embodiments, the antisense oligonucleotides of the present invention consist of two 5' phosphodiester-linked DNA nucleosides followed by an FG-F' gapmer region as defined in the "Definitions" section. Oligonucleotides containing phosphodiester-linked DNA units at the 5' or 3' end are suitable for conjugation and may further include a conjugated moiety as described herein. For delivery to the liver, the ASGPR-targeting moiety is particularly advantageous as a conjugated moiety.

[0279] In some embodiments, the antisense oligonucleotide comprises or consists of a sequence selected from the group consisting of: cagcgtaaagagagg (Sequence ID 15) cagcgtaaagagaggt (Sequence ID 16) cacgcgtaaagagaggt (Sequence ID 17) caagaaggcacagacgg (Sequence ID 18) cagagaaggcacagacgg (Sequence ID 19) caagcgaagtgcacacgg (Sequence ID 20) cagaagtgcacacgg (Sequence ID 21) cagcgaagtgcacacgg (Sequence ID 22) caagcgaagtgcacacg (Sequence ID 23) cacgaagtgcacacg (Sequence code 24) caaggtgaagcgaagtgc (Sequence ID 25) caaggtgaagcgaagtg (Sequence No. 26) caaggtgaagcgaagt(Sequence No. 27) (Starting from the 5' end) the nucleosidic bonds between the nucleosides at positions 1-3 are phosphodiester bonds, and the nucleosidic bonds between positions 3 and 4 are phosphorothioate bonds (the nucleoside at position 3 is the 5' end of the continuous nucleotide sequence). It is advantageous that all nucleosidic bonds from position 4 to the 3' end of the oligonucleotide are phosphorothioate bonds. In one embodiment, the continuous nucleotide sequence has the corresponding sequence design shown in Table 1.

[0280] 7. Conjugates that bind to asialoclycoproteins Conjugates capable of binding to the asialoglycoprotein receptor (ASGPR) are particularly useful for targeting hepatocytes in the liver. Conjugates comprising at least two carbohydrate moieties selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-isobutanoylgalactosamine can generally bind to ASGPR. While N-acetylgalactosamine (GalNAc) moieties have been shown to be advantageous for targeting ASGPR, alternatives from the above list, such as galactose, can also be used. In one embodiment, the conjugate consists of 2 to 4 terminal GalNAc moieties linked to a spacer that ligates each GalNAc moiety to a blancher molecule, thereby forming a cluster that can be bound to therapeutic oligonucleotides.

[0281] GalNAc clusters can be generated, for example, by linking the GalNAc portion to a spacer via its Cl carbon. A preferred spacer is a flexible hydrophilic spacer. This is a spacer (US Patent No. 5,885,968; Biessen et al. J. Med. Chem. 1995, Vol. 39, pp. 1538-1546). A preferred flexible hydrophilic spacer is a PEG spacer. A preferred PEG spacer is a PEG3 spacer. A branching point can be any small molecule that allows for the attachment of two or three GalNAc moieties (or other asialoglycoprotein receptor targeting moieties) and further allows for the attachment of the branching point to an oligonucleotide; such constructs are called GalNAc clusters or GalNAc conjugates. An exemplary group of branching points is dyridines. A dyridine molecule contains three amine groups to which three GalNAc moieties or other asialoglycoprotein receptor targeting moieties can be bound, and a carboxyl-reactive group to which the dyridine can be bound to an oligomer. Khorev, et al 2008 Bioorg. Med. Chem. Vol. 16, pp. 5216 also describes the synthesis of suitable trivalent branching agents. Other commercially available blanchers include 1,3-bis-[5-(4,4'-dimethoxytrityloxy)pentylamide]propyl-2-[(2-cyanoethyl)-(N,N-diisopropyl)]phosphoramidite (Glen Research catalog number 10-1920-xx); tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propyloxymethyl]ethyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (Glen Research catalog number 10-1922-xx); and

[0282] These are tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propyloxymethyl]methyleneoxypropyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite and 1-[5-(4,4'-dimethoxy-trityloxy)pentylamide]-3-[5-fluorenomethoxy-carbonyl-oxy-pentylamide]-propyl-2-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (Glen Research catalog number: 10-1925-xx). Other GalNAc clusters may include small peptides with a GalNAc moiety attached, such as Tyr-Glu-Glu-(aminohexylGalNAc)3(YEE(ahGalNAc)3); glycotripeptides that bind to asialoclycoprotein receptors on hepatocytes, see, e.g., Duff, et al., Methods Enzymol, 2000, 313, 297; lysine-based galactose clusters (e.g., L3G4; Biessen, et al., Cardovasc. Med., 1999, 214); and corane-based galactose clusters (e.g., carbohydrate recognition motifs for asialoclycoprotein receptors).

[0283] In one embodiment of the present invention, the therapeutic oligonucleotide of the present invention is conjugated to a GalNAc cluster to improve the pharmacology of the oligonucleotide, for example, by influencing cell distribution, particularly cell uptake of the oligonucleotide in hepatocytes.

[0284] A suitable GalNAc conjugate is one that can bind to the asialoglycoprotein receptor (ASGPR), such as a divalent, trivalent, or tetravalent GalNAc cluster. In particular, conjugates of trivalent N-acetylgalactosamine are suitable for binding to ASGPR; see, for example, WO2014 / 076196, WO2014 / 207232, WO2014 / 179620, WO2016 / 055601 and WO2017 / 178656 (incorporated herein by reference). Figure 1 shows a diagram of a suitable GalNAc conjugate that has been subjected to at least in vitro studies. However, alternative GalNAc conjugates may also be suitable if they can bind to the asialoglycoprotein receptor. Such conjugates help to promote the uptake of oligonucleotides into the liver while reducing their presence in the kidneys, and This increases the liver / kidney ratio of GalNAc-conjugated oligonucleotides compared to the unconjugated version of the same oligonucleotide.

[0285] GalNAc clusters can be bound to the 3' or 5' end of oligonucleotides using methods known in the art. In one embodiment, the GalNAc cluster is bound to the 5' end of the oligonucleotide.

[0286] One or more linkers can be inserted between the conjugate (such as the launcher portion of the conjugate) and the oligonucleotide. It is advantageous to have a biocleavable linker between the conjugate and the therapeutic oligonucleotide, optionally combined with an uncleavable linker such as a C6 linker. The linker(s) can be selected from those listed in the "Definition" section of "Linker," with linkers in the biocleavable region D' or D'' being particularly advantageous. Since the GalNAc cluster and biocleavable PO linker are removed from the gapmer or continuous nucleotide sequence upon entering the cell, a GalNAc conjugate oligonucleotide having a biocleavable linker between the conjugate and the gapmer or continuous nucleotide sequence is an effective prodrug.

[0287] In one embodiment, the conjugate portion is trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 1.

[0288] In one embodiment, the GalNAc conjugate antisense oligonucleotide is selected from the group consisting of the following: [Table 1-2] Uppercase bold letters represent beta-D-oxy LNA units, lowercase letters represent DNA units, the subscript "o" represents a phosphodiester bond, the subscript "s" represents a phosphorothioate bond, the superscript "m" represents DNA or beta-D-oxy LNA units containing a 5-methylcytosine base, and GN2-C6 represents a GalNAc 2 conjugate with a C6 linker.

[0289] In one embodiment, the GalNAc conjugate antisense oligonucleotide is selected from the group consisting of the following: [Table 1-3] Uppercase bold letters represent beta-D-oxy LNA units, lowercase letters represent DNA units, the subscript "o" represents a phosphodiester bond, the subscript "s" represents a phosphorothioate bond, the superscript "m" represents DNA or beta-D-oxy LNA units containing a 5-methylcytosine base, and GN2-C6 represents a GalNAc 2 conjugate with a C6 linker.

[0290] In one embodiment, the GalNAc-conjugated antisense oligonucleotide is as follows: [Table 1-4] Uppercase bold letters represent beta-D-oxy LNA units, lowercase letters represent DNA units, the subscript "o" represents a phosphodiester bond, the subscript "s" represents a phosphorothioate bond, the superscript "m" represents DNA or beta-D-oxy LNA units containing a 5-methylcytosine base, and GN2-C6 represents a GalNAc 2 conjugate with a C6 linker.

[0291] In one embodiment, the GalNAc conjugate antisense oligonucleotide is selected from the group consisting of the following: [Table 1-5] Uppercase bold letters represent beta-D-oxy LNA units, lowercase letters represent DNA units, the subscript "o" represents a phosphodiester bond, the subscript "s" represents a phosphorothioate bond, the superscript "m" represents DNA or beta-D-oxy LNA units containing a 5-methylcytosine base, and GN2-C6 represents a GalNAc 2 conjugate with a C6 linker.

[0292] In one embodiment, the GalNAc conjugate antisense oligonucleotide is selected from the group consisting of the following: [Table 1-6] Uppercase bold letters represent beta-D-oxy LNA units, lowercase letters represent DNA units, the subscript "o" represents a phosphodiester bond, the subscript "s" represents a phosphorothioate bond, the superscript "m" represents DNA or beta-D-oxy LNA units containing a 5-methylcytosine base, and GN2-C6 represents a GalNAc 2 conjugate with a C6 linker.

[0293] In one embodiment, the GalNAc conjugate antisense oligonucleotide is selected from the group consisting of the following: [Table 1-7] Uppercase bold letters represent beta-D-oxy LNA units, lowercase letters represent DNA units, the subscript "o" represents a phosphodiester bond, the subscript "s" represents a phosphorothioate bond, the superscript "m" represents DNA or beta-D-oxy LNA units containing a 5-methylcytosine base, and GN2-C6 represents a GalNAc 2 conjugate with a C6 linker.

[0294] Table 2 below shows antisense oligonucleotide sequences having a bio-cleavable CA linker (if present) at the 5-terminus, and shows a GalNAc-conjugated antisense oligonucleotide targeting positions 1530-1602 of Sequence ID No. 1. [Table 2] Gated antisense oligonucleotide. Uppercase bold letters represent beta-D-oxy LNA units, uppercase underlined letters represent MOE, lowercase letters represent DNA units, the subscript "o" represents a phosphodiester bond, the subscript "s" represents a phosphorothioate bond, the superscript "m" represents DNA or beta-D-oxy LNA units containing a 5-methylcytosine base, and GN2-C6 represents a GalNAc 2 conjugate with a C6 linker (Figure 1D). Compounds 15-27-1 are all described in International Publication No. 2015 / 173208, compound 29-1 is described in International Publication No. 2014 / 179627, and some of the compounds are also shown in the figures in Table 2.

[0295] 8. TLR7 agonist The TLR7 agonists of the present invention are 3-substituted 5-amino-6H-thiazolo[4,5-d]pyrimidine-2,7-dione compounds having Toll-like receptor agonist activity, as well as their prodrugs. Such TLR7 agonists and their prodrugs, as well as their manufacture, are described in International Publication Nos. 2006 / 066080, 2016 / 055553, and 2016 / 091698 (by reference herein). (It will be incorporated into...)

[0296] In one aspect of the present invention, the TLR7 agonist in the pharmaceutical combination of the present invention is defined by formula (I): [ka] In the formula, X is either CH2 or S, R1 is -OH or -H, R2 is either 1-hydroxypropyl or hydroxymethyl. It is represented by, Or formula (II): [ka] In the formula, X is either CH2 or S, R1 is -OH, -H, or acetoxy. R2 is 1-acetoxypropyl or 1-hydroxypropyl or 1-hydroxymethyl or acetoxy(cyclopropyl)methyl or acetoxy(propyne-1-yl)methyl. It is represented by, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0297] The compound of formula (I) is an active TLR7 agonist.

[0298] In one embodiment of the present invention, a subset of the active TLR7 agonist of formula (I) is given by formula (V): [ka] In the formula, R1 is -OH and R2 is 1-hydroxypropyl or hydroxymethyl. It is represented by, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0299] In one embodiment of the present invention, the substituent R2 in formula (I) or (V) is [ka] Selected from.

[0300] The compound of formula (II) is a TLR7 agonist prodrug. In one embodiment, the prodrug contains the following in R2: [ka] It is a single prodrug having substituents selected from the following.

[0301] In another embodiment, the prodrug is R2 as follows: [ka] It is a biprodrug having substituents selected from the following.

[0302] A subset of the TLR7 agonist prodrugs of formula (II) is given by formula (III): [ka] In the formula, R1 is -OH or acetoxy, and R2 is 1-acetoxypropyl or 1-hydroxypropyl or 1-hydroxymethyl or [ka] That is Represented by, or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof; or Formula (IV): [ka] In the formula, R1 is acetoxy(cyclopropyl)methyl or acetoxy(propyne-1-yl)methyl, or [ka] That is It is represented by, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0303] The compound of formula (IV) is a double prodrug, similar to the compound of formula (III), where R1 is OH and R2 is 1-acetoxypropyl. The compound of formula (III) is a triple prodrug, where R1 is acetoxy and R2 is a triple prodrug.

[0304] After administration, the compounds of formula (II), (III), or (IV) are metabolized to their active forms, which are useful TLR7 agonists.

[0305] In one embodiment, the TLR7 agonist used in the pharmaceutical combination of the present invention is [(1S)-1-[(2S,4R,5R)-5-(5-amino-2-oxothiazolo[4,5-d]pyrimidine-3-yl)-4-hydroxytetrahydrofuran-2-yl]propyl]acetate (CMP No. VI); 5-amino-3-[(2R,3R,5S)-3-hydroxy-5-[(1S)-1-hydroxypropyl]tetrahydrofuran-2-yl]-6H-thiazolo[4,5-d]pyrimidine-2,7-dione (CMP number VII); 5-amino-3-[(2R,3R,5S)-3-hydroxy-5-[(1S)-1-hydroxypropyl]tetrahydrofuran-2-yl]thiazolo[4,5-d]pyrimidine-2-one (CMP number VIII); 5-amino-3-(3'-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidine-2-one (CMP number IX); 5-amino-3-(2'-O-acetyl-3'-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidine-2-one (CMP number X); 5-amino-3-(3'-deoxy-β-D-ribofuranosyl)-3H,6H-thiazolo[4,5-d]pyrimidine-2,7-dione (CMP number XI); [(S)-[(2S,5R)-5-(5-amino-2-oxothiazolo[4,5-d]pyrimidine-3-yl)-1,3-oxathiolan-2-yl]-cyclopropyl-methyl]acetate (CMP number XII); and (1S)-1-[(2S,5R)-5-(5-amino-2-oxo-thiazolo[4,5-d]pyrimidine-3-yl)-1,3-oxathiolan-2-yl]buta-2-inyl]acetate (CMP number XIII) and pharmaceutically acceptable salts, enantiomers or diastereomers thereof It is selected from the group consisting of the following.

[0306] Table 3 lists the TLR7 agonists used in this invention, including references to documents describing their manufacture. [Table 3-1] [Table 3-2]

[0307] In a particularly preferred embodiment, the TLR7 agonist is CMP number VI.

[0308] 9. Pharmaceutical Compositions In further embodiments, the present invention provides a pharmaceutical composition comprising either the aforementioned therapeutic oligonucleotide or TLR7 agonist or a salt thereof, and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant. In one embodiment, the therapeutic oligonucleotide and the TLR7 agonist in the pharmaceutical combination of the present invention are administered in separate compositions. In one embodiment, the therapeutic oligonucleotide is formulated in phosphate-buffered saline for subcutaneous administration, and the TLR7 agonist is formulated as a tablet for oral administration.

[0309] The therapeutic oligonucleotides in the pharmaceutical combination of the present invention can be mixed with pharmaceutically acceptable active or inactive substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for the preparation of pharmaceutical compositions depend on many criteria, including, but are not limited to, the route of administration, the severity of the disease, or the dose administered. pharmaceutically acceptable diluents for therapeutic oligonucleotides include phosphate-buffered saline (PBS), and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In several embodiments, the pharmaceutically acceptable diluent for the therapeutic oligonucleotide is sterile phosphate-buffered saline. In some embodiments, the oligonucleotide is used at a concentration of 50 to 150 mg / ml in the pharmaceutically acceptable diluent. The therapeutic oligonucleotide or pharmaceutical composition containing the therapeutic oligonucleotide is administered by parenteral routes, including intravenous, intra-arterial, subcutaneous, or intramuscular injection or infusion. In one embodiment, the oligonucleotide conjugate is administered intravenously. Subcutaneous administration is advantageous for the therapeutic oligonucleotide. In some embodiments, the oligonucleotide conjugate or pharmaceutical composition of the present invention is administered in doses of 0.5 to 6.0 mg / kg, for example, 0.75 to 5.0 mg / kg, for example, 1.0 to 4 mg / kg. Administration can be performed once a week, once every two weeks (every other week), once every three weeks, once a month, or at longer intervals.

[0310] In the case of a TLR7 agonist in the pharmaceutical combination of the present invention, a pharmaceutically effective amount of the compound of the present invention is administered enterally (e.g., orally or through the gastrointestinal tract). The TLR7 agonist compound of the present invention can be administered in any convenient dosage form, such as tablets, powders, capsules, solutions, dispersions, suspensions, syrups, sprays, suppositories, gels, or emulsions in unit doses. In particular, oral unit dosage forms such as tablets and capsules can be used. For example, the pharmaceutically effective amount of the TLR7 agonist compound of the present invention is in the range of about 75 to 250 mg, for example, 100 to 200 mg, for example, 150 to 170 mg per dose. Administration may be daily, every other day (QOD), or weekly (QW).

[0311] Suitable carriers and excipients are well known to those skilled in the art and are described in detail, for example, Ansel, Howard C., et al., Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems. Philadelphia: Lippincott, Williams & Wilkins, 2004; Gennaro, Alfonso R., et al., Remington: The Science and Practice of Pharmacy. Philadelphia: Lippincott, Williams & Wilkins, 2000; and Rowe, Raymond C., Handbook of Pharmaceutical Excipients. Chicago, Pharmaceutical Press, 2005.

[0312] These compositions may be sterilized by conventional sterilization techniques or subjected to a sterile filter. The resulting aqueous solutions can be packaged for immediate use or freeze-dried, and the freeze-dried preparations are combined with a sterile aqueous carrier before administration. The pH of the preparations will typically be 3 to 11, more preferably 5 to 9 or 6 to 8, most preferably 7 to 8, for example, 7 to 7.5. The resulting solid-form compositions can be packaged in multiple single-dose units, each containing a fixed amount of the above-mentioned drug or group of drugs, such as in sealed tablet or capsule packages.

[0313] 10. Formulations of therapeutic oligonucleotides Various formulations have been developed to facilitate the use of therapeutic oligonucleotides, which may be applicable to therapeutic oligonucleotides used in the pharmaceutical combinations of the present invention. For example, oligonucleotides may be delivered to a target or cellular environment using formulations that minimize degradation, facilitate delivery and / or uptake, or provide the oligonucleotide in the formulation with other beneficial properties. In some embodiments, pharmaceutical combinations are provided herein that include a first pharmaceutical composition comprising an oligonucleotide (e.g., single-stranded or double-stranded oligonucleotide) for reducing the expression of HBV antigen (e.g., HBsAg). When such a composition is administered to a target either directly into the environment of target cells or systemically, a sufficient portion of the oligonucleotide enters the cells and is adequately configured to reduce HBV antigen expression. It can be formulated as follows. Any of a variety of suitable oligonucleotide formulations can be used to deliver the oligonucleotides for HBV antigen reduction disclosed herein. In some embodiments, the oligonucleotides of the pharmaceutical combination of the present invention are formulated in buffers such as phosphate-buffered saline, liposomes, micellar structures and capsids.

[0314] Formulations of oligonucleotides containing cationic lipids can facilitate the transfection of oligonucleotides into cells. For example, cationic lipids such as lipofectin, cationic glycerol derivatives, and polycationic molecules (e.g., polylysine) can be used. Suitable lipids include oligofectamine, lipofectamine (Life Technologies), NC388 (Ribozyme Pharmaceuticals, Inc., Boulder, Colo.), or FuGene 6 (Roche), all of which can be used according to the manufacturer's instructions.

[0315] Therefore, in some embodiments, the oligonucleotide formulation includes lipid nanoparticles. In some embodiments, the excipient may include liposomes, lipids, lipid complexes, microspheres, fine particles, nanospheres, or nanoparticles, or may be formulated in other ways for administration to target cells, tissues, organs, or bodies requiring such administration (see, for example, Remington: The Science and Practice of Pharmacy, 22nd edition, Pharmaceutical Press, 2013).

[0316] In some embodiments, the formulations disclosed herein include excipients. In some embodiments, the excipients provide the composition with improved stability, improved absorption, improved solubility, and / or therapeutic enhancement of the active ingredient. In some embodiments, the excipient is a buffer (e.g., sodium citrate, sodium phosphate, Tris base, or sodium hydroxide) or a vehicle (e.g., a buffer solution, petrolatum, dimethyl sulfoxide, or mineral oil). In some embodiments, the oligonucleotide is freeze-dried to extend its shelf life and then dissolved before use (e.g., administration to a subject). Therefore, the excipient in a composition containing any one of the oligonucleotides described herein may be a cryoprotectant (e.g., mannitol, lactose, polyethylene glycol, or polyvinylpyrrolidone) or a decay temperature modifier (e.g., dextran, Ficol, or gelatin).

[0317] In some embodiments of the pharmaceutical combination of the present invention, the composition comprising an oligonucleotide is formulated to be compatible with the intended route of administration. Examples of routes of administration include parenteral administration, such as intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Subcutaneous formulations are particularly advantageous when the oligonucleotide in the pharmaceutical combination of the present invention is an RNAi oligonucleotide.

[0318] Pharmaceutical compositions suitable for injection include sterile aqueous solutions (if water-soluble) or dispersions, and sterile powders for the immediate preparation of sterile injection solutions or dispersions. Suitable carriers include physiological saline, bacteriostatic water, Cremophor EL.™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). The carrier may be water, a solvent, or a dispersion medium. The solvent or dispersion medium may include, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.) and suitable mixtures thereof. In many cases, it is preferable to include isotonic agents, such as sugars, polyhydric alcohols, such as mannitol, sorbitol, and sodium chloride in the composition. The sterile injection solution is, if necessary, in a selected solvent containing one or a combination of the components listed above. It can be prepared by incorporating the required amount of oligonucleotides and then sterilizing by filtration.

[0319] In some embodiments of the pharmaceutical combinations of the present invention, the compositions in the combination may contain at least about 0.1% or more of a therapeutic agent (e.g., an oligonucleotide for reducing HBV antigen expression), while the percentage of the active ingredient(s) may be about 1% to about 80% or more of the total weight or volume of the composition. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations are conscientious by those skilled in the art preparing such pharmaceutical formulations, and therefore, various dosages and treatment regimens may be desirable.

[0320] While some embodiments focus on the liver-targeted delivery of any of the oligonucleotides disclosed herein, targeting of other tissues is also intended. 11. Pharmaceutical combinations and kits of parts

[0321] One aspect of the present invention relates to a pharmaceutical combination of a therapeutic oligonucleotide targeting HBV and a TLR7 agonist, each formulated in a pharmaceutically acceptable carrier, as described herein.

[0322] The pharmaceutical combination of the present invention can be used to treat HBV infection more effectively than the therapeutic oligonucleotide or TLR7 agonist contained herein alone. In one embodiment, the pharmaceutical combination of the present invention can be used to inhibit HBV more rapidly, inhibit HBV for a longer duration, and / or inhibit HBV with a greater effect than the therapeutic oligonucleotide or TLR7 agonist contained herein alone. These effects can be measured by a decrease in HBsAg titration. In one embodiment, the pharmaceutical combination of the present invention causes a decrease in HBsAg titer more rapidly than the therapeutic oligonucleotide or TLR7 agonist contained herein alone. In one embodiment, the pharmaceutical combination of the present invention causes a decrease in HBsAg titer for a longer period than the therapeutic oligonucleotide or TLR7 agonist contained herein alone. In one embodiment, the pharmaceutical combination of the present invention causes a greater decrease in HBsAg titer than the therapeutic oligonucleotide or TLR7 agonist contained herein alone.

[0323] In preferred embodiments of the present invention, the pharmaceutical combination comprises or comprises the RNAi oligonucleotide and TLR7 agonist described herein. In one embodiment of the present invention, the pharmaceutical combination comprises or consists of an RNAi oligonucleotide and a TLR7 agonist of formula (I) or (II): [ka] In the formula, X is either CH2 or S, In formula (I), R1 is -OH or -H, and R2 is 1-hydroxypropyl or hydroxymethyl. In formula (II), R1 is -OH or -H or acetoxy, and R2 is 1-acetoxy. It is oxypropyl or 1-hydroxypropyl or 1-hydroxymethyl or acetoxy(cyclopropyl)methyl or acetoxy(propyne-1-yl)methyl. or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0324] The RNAi oligonucleotides and TLR7 agonists of the present invention are described individually in, for example, sections 1 to 3 and 8 above.

[0325] In one embodiment of the present invention, the drug combination can be selected from the compounds in the vertical and horizontal columns of Table 4. Each possible combination is indicated by "x". [Table 4]

[0326] Tables 5 and 6 below show selected combinations of RNAi oligonucleotides (vertical) and TLR7 agonists (horizontal). [Table 5] [Table 6]

[0327] In one embodiment of the present invention, the drug combination is selected from the group consisting of the following: RNAi number 1 and CMP number VI; RNAi number 2 and CMP number VI; RNAi number 3 and CMP number VI; RNAi number 4 and CMP number VI; RNAi number 5 and CMP number VI; RNAi number 6 and CMP number VI; RNAi number 7 and CMP number VI; RNAi number 8 and CMP number VI; RNAi number 9 and CMP number VI; RNAi number 1 and CMP number VII; RNAi number 2 and CMP number VII; RNAi number 3 and CMP number VII; RNAi number 4 and CMP number VII; RNAi number 5 and CMP number VII; RNAi number 6 and CMP number VII; RNAi number 7 and CMP number VII; RNAi number 8 and CMP number VII; RNAi number 9 and CMP number VII; RNAi number 1 and CMP number VIII; RNAi number 2 and CMP number VIII; RNAi number 3 and CMP number VIII; RNAi number 4 and CMP number VIII; RNAi number 5 and CMP number VIII; RNAi number 6 and CMP number VIII; RNAi number 7 and CMP number VIII; RNAi number 8 and CMP number VIII; RNAi number 9 and CMP number VIII; RNAi number 1 and CMP number XIII; RNAi number 2 and CMP number XIII; RNAi number 3 and CMP number XIII; RNAi number 4 and CMP number XIII; RNAi number 5 and CMP number XIII; RNAi number 6 and CMP number XIII; RNAi number 7 and CMP number XIII; RNAi number 8 and CMP number XIII; RNAi number 9 and CMP number XIII; or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0328] In one embodiment, the therapeutic oligonucleotide of the pharmaceutical combination of the present invention consists of an RNAi oligonucleotide with RNAi number 7: An oligonucleotide for reducing the expression of hepatitis B virus surface antigen (HBsAg) mRNA, wherein the oligonucleotide comprises an antisense strand and a sense strand that forms a double-stranded region. The sense strand comprises the sequence described in GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 41), which includes 2'-fluoromodified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methylmodified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36, and one phosphorothioate nucleotide bond between nucleotides at positions 1 and 2, wherein each nucleotide of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety, and the -GAAA- sequence has the following structure: [ka] Includes, The antisense chain is the sequence described in UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 38), comprising 2'-fluoromodified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O-methylmodified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22, and a sequence containing five phosphorothioate nucleotide interlinks between nucleotides 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense chain has the following structure: [ka] It has, TLR7 agonist is CMP number VI: [ka] It is either a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0329] In a particularly preferred embodiment of the pharmaceutical combination comprising an RNAi oligonucleotide and a TLR7 agonist, the TLR7 agonist is CMP number VI.

[0330] In one embodiment, the pharmaceutical combination comprising the RNAi oligonucleotide of the present invention and a TLR7 agonist further comprises a CpAM (core protein allosteric modulator).

[0331] In a preferred embodiment, the CpAM is compound (CpAM1). Compound (CpAM1) is a CpAM for the treatment and / or prophylaxis of HBV in humans by targeting the HBV capsid, disclosed in International Publication No. 2015132276. The structure of compound (CpAM1) is shown below: [ka] During the ceremony, R 1 is hydrogen, halogen or C 1-6 It is alkyl, R 2 is hydrogen or halogen, R 3 is hydrogen or halogen, R 4 is C 1-6 It is alkyl, R 5 is hydrogen, hydroxyl C 1-6 Alkyl, aminocarbonyl, C 1-6 It is an alkoxycarbonyl or carboxyl, R 6 is hydrogen, C 1-6 Alkoxycarbonyl or carboxy-C m H 2m -and, X is a carbonyl or sulfonyl, Y is -CH2-, -O-, or -N(R 7 )- and, In the formula, R 7 is hydrogen, C 1-6 Alkyl, Halo C 1-6 Alkyl, C 3-7 Cycloalkyl-C m H 2m -, C 1-6 Alkoxycarbonyl-C m H 2m -, -C t H 2t -COOH, -HALOC 1-6 alkyl-COOH, -(C 1-6 Alkoxy)C 1-6 alkyl-COOH, -C 1-6 Alkyl-OC 1-6 alkyl-COOH, -C 3-7 Cycloalkyl-C m H 2m -COOH, -C m H 2m -C 3-7 Cycloalkyl-COOH, hydroxy-C t H 2t -, carboxyspiro[3.3]heptyl or carboxyphenyl-C m H 2m -, carboxypyridinyl-C m H 2m -and, W is -CH2-, -C(C 1-6 Alkyl)2-, -O- or carbonyl, n is either 0 or 1. m is between 0 and 7. t is between 1 and 7. or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0332] In a more preferred embodiment, the CpAM is compound (CpAM 2) or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof. Compound (CpAM 2) is a CpAM for the treatment and / or prophylaxis of HBV in humans by targeting the HBV capsid, which is disclosed in Example 76 of International Publication No. 2015132276 and can be prepared accordingly. The structure of compound (CpAM 2) is shown below: [ka]

[0333] In a more preferred embodiment, CpAM is 3-[(8aS)-7-[[(4S)-5-ethoxycarbonyl-4-(3-fluoro-2-methylphenyl)-2-thiazole-2-yl-1,4-dihydropyrimidine-6-yl]methyl]-3-oxo-5,6,8,8a-tetrahydro-1H-imidazo[1,5-a]pyrazine-2-yl]-2,2-dimethylpropanoic acid, which is disclosed in Example 76 of International Publication No. 2015132276 and can be prepared accordingly.

[0334] In another embodiment of the present invention, the pharmaceutical combination comprises or comprises a 13-22 nucleotide length GalNAc conjugate antisense oligonucleotide having a sequence of at least 12 nucleotides that is 100% complementary to the sequence of positions 1530-1602 of SEQ ID NO: 1, and a TLR7 agonist of formula (I) or (II): [ka] In the formula, X is either CH2 or S, In formula (I), R1 is -OH or -H, and R2 is 1-hydroxypropyl or hydroxymethyl. In formula (II), R1 is -OH or -H or acetoxy, and R2 is 1-acetoxypropyl or 1-hydroxypropyl or 1-hydroxymethyl or acetoxy(cyclopropyl)methyl or acetoxy(propyne-1-yl)methyl. or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0335] The HBV-targeting GalNAc-conjugate antisense oligonucleotides and TLR7 agonists of the present invention are described, for example, individually in sections 4-6 and 8 above.

[0336] In one embodiment of the present invention, the drug combination can be selected from the compounds in the vertical and horizontal columns of Table 7. Each possible combination is indicated by "x". [Table 7]

[0337] Tables 8 and 9 below show selected combinations of GalNAc conjugate antisense oligonucleotides (vertical) and TLR7 agonists (horizontal). [Table 8] [Table 9]

[0338] In one embodiment of the present invention, the drug combination is selected from the group consisting of the following: CMP numbers 15_1 and VI, CMP numbers 15_2 and VI; CMP numbers 16_1 and VI; CMP numbers 20_1 and VI; CMP numbers 23_1 and VI; CMP numbers 26_1 and VI; CMP numbers 29_1 and VI; CMP numbers 15_1 and VII, CMP numbers 15_2 and VII; CMP numbers 16_1 and VII; CMP numbers 20_1 and VII; CMP numbers 23_1 and VII; CMP numbers 26_1 and VII; CMP numbers 29_1 and VII; CMP numbers 15_1 and VIII, CMP numbers 15_2 and VIII; CMP numbers 16_1 and VIII; CMP numbers 20_1 and VIII; CMP numbers 23_1 and VII; CMP number 26_1 and VIII; CMP numbers 29_1 and VIII; and CMP numbers 15_1 and XIII, CMP numbers 15_2 and XIII; CMP numbers 16_1 and XIII; CMP numbers 20_1 and XIII; CMP numbers 23_1 and XIII; CMP numbers 26_1 and XIII, and CMP numbers 29_1 and XIII; or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0339] In one embodiment, the drug combination consists of a GalNAc conjugate antisense oligonucleotide of CMP number 15_1 shown in Figure 5, and the TLR7 agonist is CMP number VI: [ka] It is either the same as or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0340] In a particularly preferred embodiment of the pharmaceutical combination containing an antisense oligonucleotide, the TLR7 agonist is CMP number VI.

[0341] The terms “kit” or “kit of parts” refer to an assembly of materials used in treating an HBV-infected individual, including instructions on how the treatment will be performed.

[0342] One aspect of the present invention is a kit of parts containing one, two, or more therapeutic active ingredients (e.g., medical components or pharmaceuticals), two of which are selected from therapeutic oligonucleotides and TLR7 agonists as described herein.

[0343] One embodiment of the present invention is a kit of parts comprising the therapeutic oligonucleotide described herein and the TLR7 agonist described herein as medical components.

[0344] In one embodiment, the kit of the present invention comprises a first pharmaceutical product, which is a therapeutic oligonucleotide as described herein formulated for subcutaneous injection, and a second pharmaceutical product, which is a TLR7 agonist as described herein formulated for oral administration. The therapeutic oligonucleotide may be formulated as a liquid in a vial containing one or more doses, or in a pre-filled syringe containing one pharmaceutically effective dose. Alternatively, the therapeutic oligonucleotide may be in the form of a lyophilized powder, and the kit may include a solvating agent for preparing the therapeutic oligonucleotide for injection. It is understood that all pharmaceutical products for injection are sterile. The TLR7 agonist in the kit may be in tablet form (or alternative unit dose forms for oral administration, such as capsules and gels) having a single pharmaceutically effective dose pr. tablet, and the kit may contain multiple tablets.

[0345] In a further embodiment, the kit of parts of the present invention further includes a package insert instructing the administration of a therapeutic oligonucleotide in combination with a TLR7 agonist for treating hepatitis B virus infection. In particular, the package insert describes the treatment of chronic hepatitis B virus infection.

[0346] The kit may include only one medical component and a package insert instructing its use in combination with other medical components. In one embodiment, the kit of parts of the present invention includes or contains a package insert instructing its use in combination with a first pharmaceutical, which is a therapeutic oligonucleotide described herein, and a TLR7 agonist, which is purchased separately but described herein as a second pharmaceutical. In another embodiment, the kit of parts of the present invention includes or contains a package insert instructing its use in combination with a first pharmaceutical, which is a TLR7 agonist described herein, and a therapeutic oligonucleotide, which is purchased separately but described herein as a second pharmaceutical.

[0347] In some embodiments, the pharmaceutical combinations of the present invention may be used in combination with a third therapeutic agent or further therapeutic agents(s), which may be included in a kit of parts or supplied separately. Further therapeutic agents may, for example, be standard care for the treatment of HBV infection, particularly chronic HBV infection.

[0348] 12.Applications The pharmaceutical combination of the present invention is intended for use in the treatment of hepatitis B virus infection, particularly in the treatment of patients with chronic HBV.

[0349] The pharmaceutical combination of the present invention can be used as a therapeutic agent and for prevention.

[0350] The pharmaceutical combination of the present invention can be used as a combination of hepatitis B virus targeted therapy and immunotherapy. In particular, when used to treat HBV in infected cells, the pharmaceutical combination of the present invention can affect one or more HBV infection parameters, i) reducing cellular HBV mRNA, ii) reducing serum HBV DNA, and / or iii) reducing HBV viral antigens such as HBsAg and HBeAg. In one embodiment of the present invention, the effect on one or more of these parameters is improved compared to the effect achieved when the treatment is carried out with the individual medical components of the pharmaceutical combination.

[0351] The effect against HBV infection can be measured in vitro using HBV-infected primary human hepatocytes or HBV-infected HepaRG cells or ASGPR-HepaRG cells (see, e.g., PCT / EP2018 / 078136). The effect against HBV infection can also be measured using the AAV / HBV mouse model (AAV / HBV) (Dan Yang, et al. 2014 Cellular & Molecular Immunology 11, 71-78) or HBV minicircle mice (available from Covance Shanghai, see also Guo et al 2016 Sci Rep 6:2552 and Yan et al 2017 J Hepatology 66(6):1149-1157) or the humanized hepatocyte PXB mouse model (available from PhoenixBio, see also Kakuni et al. It can also be measured in vivo using (see also al 2014 Int.J.Mol.Sci.15:58-74). Inhibition of HBsAg and / or HBeAg secretion can be measured by ELISA using, for example, the CLIA ELISA kit (Autobio Diagnostic), according to the manufacturer's instructions. Reduction of HBV mRNA and pgRNA can be measured by qPCR, for example, as described in the Materials and Methods section. Further methods for evaluating whether a test compound inhibits HBV infection are to measure HBV DNA secretion by qPCR, for example, as described in International Publication No. 2015 / 173208, or by Northern blotting, in situ hybridization, or immunofluorescence.

[0352] One embodiment of the present invention provides a therapeutic oligonucleotide that targets HBV mRNA as described herein. The pharmaceutical combination of a nucleotide and the TLR7 agonist described herein offers advantages over single-compound treatment (therapeutic oligonucleotide alone or TLR7 agonist alone). These advantages may include, for example, i) a longer-lasting reduction in serum HBV-DNA compared to monotherapy; ii) a delayed rebound of HBsAg compared to monotherapy; and / or iii) an increased therapeutic range. The term “therapeutic range” or “pharmaceutical range” in relation to a drug refers to the range of drug doses that can effectively treat a disease without toxic effects. In one embodiment of the present invention, an increase in the therapeutic range can be achieved by combination therapy compared to monotherapy.

[0353] In the study of this application, it was observed that when using combination therapy, significantly improved effects could be achieved with doses 3 to 5 times lower compared to the doses required when using monotherapy, and essentially the same effect could be achieved with combination therapy at doses 3 to 5 times lower compared to the same combination at higher doses. For example, monotherapy requires high doses (7.5 mg / kg of anti-HBV antisense oligonucleotide or 100 mg of TLR7 agonist every other day (QOD)) to achieve efficient reduction of HBsAg, while combination therapy with low doses (1.5 mg / kg and 100 mg weekly (QW)) of HBsAg has been shown to reduce HBsAg to below the detection limit and to significantly extend the rebound time compared to high-dose monotherapy. Furthermore, when using a combination of anti-HBV therapeutic oligonucleotides administered at a five-fold lower dose (1.5 mg / kg vs. 7.5 mg / kg) in combination with a TLR7 agonist administered once a week instead of every other day (corresponding to a four-fold dose reduction), the rebound of the viral parameter HBsAg can be delayed to a similar extent. Similar results are observed for HBV-DNA reduction.

[0354] The present invention provides a method for treating or preventing HBV infection, comprising administering a therapeutically or prophylactically effective amount of the pharmaceutical combination of the present invention to a subject suffering from or susceptible to HBV infection.

[0355] A further aspect of the present invention relates to the use of the pharmaceutical combination of the present invention for inhibiting or treating the development of chronic HBV infection.

[0356] One aspect of the present invention is a method for treating an individual infected with HBV (such as an individual with chronic HBV infection), comprising a pharmaceutically effective amount of a therapeutic oligonucleotide as defined herein, and a pharmaceutically effective amount of a TLR7 agonist of formula (I) or (II). [ka] In the formula, X is either CH2 or S, In formula (I), R1 is -OH or -H, and R2 is 1-hydroxypropyl or hydroxymethyl. For formula (II), in an HBV-infected individual, R1 is -OH or -H or acetoxy, and R2 is 1-acetoxypropyl or 1-hydroxypropyl or 1-hydroxymethyl or acetoxy(cyclopropyl)methyl or acetoxy(propyne-1-yl)methyl. This method involves administering [a substance].

[0357] The present invention also relates to the therapeutic oligonucleotide described in this application for use as a pharmaceutical in combination therapy. The present invention also relates to the TLR7 agonist described in this application for use as a pharmaceutical in combination therapy.

[0358] In particular, therapeutic oligonucleotides as defined herein, and TLR7 agonists of formula (I) or (II): [ka] In the formula, X is either CH2 or S, In formula (I), R1 is -OH or -H, and R2 is 1-hydroxypropyl or hydroxymethyl. In formula (II), R1 is -OH or -H or acetoxy, and R2 is 1-acetoxypropyl or 1-hydroxypropyl or 1-hydroxymethyl or acetoxy(cyclopropyl)methyl or acetoxy(propyne-1-yl)methyl. This is intended for use in the treatment of hepatitis B virus infection.

[0359] One embodiment of the present invention is the use of a therapeutic oligonucleotide in the manufacture of a first pharmaceutical for treating hepatitis B virus infection, such as chronic HBV virus infection, wherein the first pharmaceutical is a therapeutic oligonucleotide described in this application, and the first pharmaceutical is administered in combination with a second pharmaceutical, the second pharmaceutical being a TLR7 agonist described in this application.

[0360] In one embodiment of the present invention, a medical composition containing a therapeutic oligonucleotide is administered as a subcutaneous dose. In a further embodiment of the present invention, a TLR7 agonist is to be administered as an oral dose. Since the medical compositions are administered via two different routes of administration, they can follow different dosing schedules.

[0361] The pharmaceutical combination according to the present invention is typically administered in an effective dose.

[0362] In one embodiment, the therapeutic oligonucleotide described in this application is administered subcutaneously weekly or monthly in a dose range of 1 mg / kg to 4 mg / kg for 24 to 72 weeks, e.g., 36 to 60 weeks, e.g., 48 weeks; the TLR7 agonist described in this application is administered orally every other day (QOD) in a unit dose range of 150 to 170 mg for 8 to 26 weeks, e.g., 10 to 24 weeks, e.g., 12 or 13 weeks, followed by weekly administration (QW) for 24 to 48 weeks, e.g., 30 to 40 weeks, e.g., 35 weeks. During the every-other-day administration period, there may be a treatment rest period of 10 to 14 weeks, e.g., 12 weeks. The number of doses of the TLR7 agonist administered throughout the treatment period is 60 to 100 doses, e.g., 75 to 90 doses, e.g., 81, 82, 83 or 84 doses. The number of doses administered for therapeutic oligonucleotides is 6 to 72 doses, for example 9 to 15 doses, for example 12 or 48 doses.

[0363] For optimal combined efficacy, therapeutic oligonucleotides and TLR7 agonists are administered at intervals of less than one month, e.g., less than one week, e.g., two days, e.g., on the same day.

[0364] 13.How to use I. Decreased HBsAg expression In some embodiments, a method is provided for delivering to cells an effective amount of any one of the pharmaceutical combinations of the present invention, comprising the oligonucleotides disclosed herein, particularly the RNAi oligonucleotides disclosed herein, for the purpose of reducing HBsAg expression. The method provided herein is useful in any suitable cell type. In some embodiments, the cells are any cells expressing the HBV antigen (e.g., hepatocytes, macrophages, monocyte-derived cells, prostate cancer cells, brain cells, endocrine tissue, bone marrow, lymph nodes, lungs, gallbladder, liver, duodenum, small intestine, pancreas, kidneys, gastrointestinal tract, bladder, adipose and soft tissue, and skin). In some embodiments, the cells are primary cells obtained from the subject and may have undergone a limited number of passages, so that the cells substantially retain their native phenotypic properties. In some embodiments, the cells to which the oligonucleotide is delivered are ex vivo or in vitro (i.e., can be delivered to cells in culture or to an organism in which the cells reside). In a particular embodiment, a method is provided for delivering a pharmaceutical combination comprising an effective amount of any of the oligonucleotides disclosed herein, in particular any one of the RNAi oligonucleotides disclosed herein, to cells for the purpose of reducing HBsAg expression in hepatocytes only.

[0365] In some embodiments, oligonucleotides in the pharmaceutical combinations disclosed herein can be introduced using a suitable nucleic acid delivery method, which includes injecting a solution containing oligonucleotides, impacting with oligonucleotide-coated particles, exposing cells or organisms to a solution containing oligonucleotides, or electroporation of cell membranes in the presence of oligonucleotides. Other suitable methods for delivering oligonucleotides to cells may also be used, such as lipid-mediated carrier transport, chemical-mediated transport, and cationic liposome transfection, such as calcium phosphate.

[0366] The results of inhibition can be confirmed by appropriate assays for evaluating one or more characteristics of cells or subjects, or by biochemical techniques for evaluating molecules (e.g., RNA, protein) exhibiting HBV antigen expression. In some embodiments, the extent to which the oligonucleotides of the pharmaceutical combinations provided herein reduce the level of HBV antigen expression is evaluated by comparing the level of HBV antigen expression (e.g., mRNA or protein level) with an appropriate control (e.g., the level of HBV antigen expression in cells or cell populations that have not been delivered with the pharmaceutical combination or have been delivered with a negative control). In some embodiments, the appropriate control level of HBV antigen expression may be a predetermined level or value such that the control level does not need to be measured each time. The predetermined level or value may take various forms. In some embodiments, the predetermined level or value may be a single cutoff value such as a median or mean.

[0367] In some embodiments, administration of a combination of pharmaceuticals containing the oligonucleotides described herein, particularly the RNAi oligonucleotides described herein, results in a decrease in the expression level of HBV antigen (e.g., HBsAg) in cells. In some embodiments, the decrease in the HBV antigen expression level may be to less than 1%, less than 5%, less than 10%, less than 15%, less than 20%, less than 25%, less than 30%, less than 35%, less than 40%, less than 45%, less than 50%, less than 55%, less than 60%, less than 70%, less than 80%, or less than 90% compared to a suitable control level of HBV antigen. A suitable control level is a cell or cell that has not been in contact with the combination of pharmaceuticals containing the oligonucleotides described herein, particularly the RNAi oligonucleotides. This may be the level of HBV antigen expression in a population. In some embodiments, the effect of delivering oligonucleotides of the pharmaceutical combination of the present invention to cells by the method disclosed herein is evaluated after a finite period. For example, the level of HBV antigen can be analyzed intracellularly at least 8 hours, 12 hours, 18 hours, 24 hours, or at least 1, 2, 3, 4, 5, 6, 7, 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, 84, 91, 98, 105, 112, 119, 126, 133, 140, or 147 days after introducing the oligonucleotide into the cells.

[0368] In some embodiments, the decrease in HBV antigen (e.g., HBsAg) expression levels persists for a long period after administration. In some embodiments, a detectable decrease in HBsAg expression persists within 7 to 70 days after administration of the oligonucleotide of the pharmaceutical combination of the present invention, especially when the oligonucleotide is an antisense oligonucleotide. For example, in some embodiments, the detectable decrease persists within 10 to 70, 10 to 60, 10 to 50, 10 to 40, 10 to 30, or 10 to 20 days after administration of the oligonucleotide. In some embodiments, the detectable decrease persists within 20 to 70, 20 to 60, 20 to 50, 20 to 40, or 20 to 30 days after administration of the oligonucleotide of the pharmaceutical combination of the present invention, especially when the oligonucleotide is an antisense oligonucleotide. In some embodiments, the detectable decrease persists within 30 to 70, 30 to 60, 30 to 50, or 30 to 40 days after administration of the oligonucleotide of the pharmaceutical combination of the present invention, especially when the oligonucleotide is an antisense oligonucleotide. In some embodiments, the detectable decrease persists within a period of 40-70, 40-60, 40-50, 50-70, 50-60, or 60-70 days after administration of the oligonucleotide of the pharmaceutical combination of the present invention, particularly when the oligonucleotide is an antisense oligonucleotide.

[0369] In some embodiments, a detectable decrease in HBsAg expression persists within a period of 2 to 21 weeks after administration of the oligonucleotide of the pharmaceutical combination of the present invention, particularly when the oligonucleotide is an antisense oligonucleotide. For example, in some embodiments, a detectable decrease persists within a period of 2 to 20, 4 to 20, 6 to 20, 8 to 20, 10 to 20, 12 to 20, 14 to 20, 16 to 20, or 18 to 20 weeks after administration of the oligonucleotide of the pharmaceutical combination of the present invention, particularly when the oligonucleotide is an antisense oligonucleotide. In some embodiments, a detectable decrease persists within a period of 2 to 16, 4 to 16, 6 to 16, 8 to 16, 10 to 16, 12 to 16, or 14 to 16 weeks after administration of the oligonucleotide of the pharmaceutical combination of the present invention, particularly when the oligonucleotide is an antisense oligonucleotide. In some embodiments, the detectable decrease persists within a period of 2–12, 4–12, 6–12, 8–12, or 10–12 weeks after administration of the oligonucleotide of the pharmaceutical combination of the present invention, particularly when the oligonucleotide is an antisense oligonucleotide. In some embodiments, the detectable decrease persists within a period of 2–10, 4–10, 6–10, or 8–10 weeks after administration of the oligonucleotide of the pharmaceutical combination of the present invention, particularly when the oligonucleotide is an antisense oligonucleotide.

[0370] In some embodiments, the oligonucleotides of the pharmaceutical combination of the present invention are delivered in the form of a transgene engineered to express the oligonucleotide (e.g., its sense and antisense strands) within a cell, particularly when the oligonucleotide is an antisense oligonucleotide. In some embodiments, the oligonucleotides of the pharmaceutical combination of the present invention are delivered using a transgene engineered to express any oligonucleotide disclosed herein, particularly when the oligonucleotide is an antisense oligonucleotide. The transgene is delivered using a viral vector (e.g., adenovirus, retrovirus, vaccinia virus, poxvirus, adeno-associated virus, or herpes simplex virus) or a non-viral vector (e.g., plasmid or synthetic mRNA). It can be delivered in this manner. In some embodiments, the introduced gene of the pharmaceutical combination of the present invention can be directly injected.

[0371] II. Treatment Methods Aspects of this disclosure relate to methods for reducing HBsAg expression (e.g., reducing HBsAg expression) for the treatment of HBV infection in a subject. In some embodiments, the method may involve administering a pharmaceutical combination containing an effective amount of any one of the oligonucleotides disclosed herein to a subject in need. This disclosure provides both prophylactic and therapeutic methods for treating subjects at risk of (or susceptible to) HBV infection and / or diseases or disorders associated with HBV infection.

[0372] In certain embodiments, the Disclosure provides a method for preventing a disease or disorder described herein in a subject by administering a therapeutic agent (e.g., a therapeutic combination, an oligonucleotide or vector, or a transgene encoding such a combination) to the subject. In some embodiments, particularly when the oligonucleotide of the therapeutic combination is an RNAi oligonucleotide, the subject treated is one who would benefit therapeutically from, for example, a reduction in the amount of HBsAg protein in the liver. Subjects at risk of disease or disorder can be identified, for example, by one or a combination of diagnostic or prognostic assays known in the Art (e.g., identification of cirrhosis and / or hepatitis). Administration of the prophylactic agent may be carried out before the detection or manifestation of symptoms characteristic of the disease or disorder, so that the disease or disorder is prevented or its progression is delayed.

[0373] The methods described herein typically involve administering an effective dose of a therapeutic combination, i.e., a dose that can produce the desired therapeutic outcome, to a subject. A therapeutically acceptable dose may be a dose that can treat a disease or disorder. The appropriate dose for any one subject depends on certain factors, including the size of the subject, body surface area, age, the specific composition administered, the active ingredient(s) in the composition, the time and route of administration, the subject's overall health, and other drugs administered concurrently. For example, the dose may range from 0.1 mg / kg to 12 mg / kg. The dose may also range from 0.5 to 10 mg / kg. Alternatively, the dose may range from 1.0 to 6.0 mg / kg. The dose may also range from 3.0 to 5.0 mg / kg.

[0374] In some embodiments, the subject is administered one of the therapeutic combination compositions disclosed herein by enteral (e.g., orally, via gastric feeding tube, duodenal feeding tube, gastrostomy, or rectal), parenteral (e.g., subcutaneous injection, intravenous injection or infusion, intra-arterial injection or infusion, intraosseous injection, intramuscular injection, intracerebral injection, intraventricular injection, intrathecal injection), topical (e.g., on the skin, by inhalation, via eye drops, or via mucous membrane), or direct injection into a target organ (e.g., the liver of the subject). Typically, the therapeutic combination oligonucleotides disclosed herein are administered intravenously or subcutaneously.

[0375] As a non-limiting set of examples, the oligonucleotides of the therapeutic combinations of the disclosure are typically administered four times a year (every three months), every two months (every two months), monthly, or weekly. For example, oligonucleotides may be administered every one, two, or three weeks. Oligonucleotides may be administered daily.

[0376] In preferred embodiments, the RNAi compound of the present invention is an siRNA targeting HBV and is administered subcutaneously in doses of 0.1 mg / kg to 7 mg / kg, preferably 0.5 mg / kg to 6.5 mg / kg, and most preferably 1 mg / kg to 6 mg / kg. In one embodiment, the dose is administered once every two weeks, once every four weeks, or once every six weeks. In preferred embodiments, the dose is administered once a month. In particularly preferred embodiments, the dose is 1 mg / kg to 6 mg / kg. The dose is administered once a month at a rate of g / kg. "Once a month" is understood to mean that a continuous dose is administered at intervals of approximately one calendar month.

[0377] In some embodiments, the subject being treated is a human, a non-human primate, or another mammal. Other exemplary subjects include livestock such as dogs and cats; livestock such as horses, cattle, pigs, sheep, goats, and chickens; and animals such as mice, rats, guinea pigs, and hamsters.

[0378] Embodiment The following embodiments of the present invention can be used in combination with any other embodiments described herein.

[0379] 1. Therapeutic oligonucleotides, and formulas (I) or (II): [ka] A combination of pharmaceuticals containing or comprising a TLR7 agonist In the formula, X is either CH2 or S, In formula (I), R1 is -OH or -H, and R2 is 1-hydroxypropyl or hydroxymethyl. In formula (II), R1 is -OH or -H or acetoxy, and R2 is 1-acetoxypropyl or 1-hydroxypropyl or 1-hydroxymethyl or acetoxy(cyclopropyl)methyl or acetoxy(propyne-1-yl)methyl. or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0380] 2. The pharmaceutical combination according to Embodiment 1, wherein the therapeutic oligonucleotide is an RNAi oligonucleotide.

[0381] 3. The pharmaceutical combination according to Embodiment 2, wherein the RNAi oligonucleotide is an oligonucleotide that targets HBV (RNAi number 1).

[0382] 4. The pharmaceutical combination according to Embodiment 2 or 3, wherein the RNAi oligonucleotide is an oligonucleotide that targets HBsAg mRNA (RNAi number 2).

[0383] 5. The pharmaceutical combination according to any one of Embodiments 2 to 4, wherein the RNAi oligonucleotide is an oligonucleotide that reduces the expression of HBsAg mRNA (RNAi number 3).

[0384] 6. The pharmaceutical combination according to any one of Embodiments 2 to 5, wherein the RNAi oligonucleotide is an oligonucleotide containing an antisense strand of 19 to 30 nucleotides in length, and the antisense strand contains a region complementary to the sequence of HBsAg mRNA (RNAi number 4) described in ACAANAAUCCUCACAAUA (SEQ ID NO: 33).

[0385] 7. The pharmaceutical combination according to any one of Embodiments 2 to 5, wherein the RNAi oligonucleotide is an oligonucleotide for reducing the expression of hepatitis B virus surface antigen (HBsAg) mRNA, the oligonucleotide is an oligonucleotide containing an antisense strand of 19 to 30 nucleotides in length, and the antisense strand contains a region complementary to the sequence of HBsAg mRNA (RNAi number 5) described in ACAANAAUCCUCACAAUA (SEQ ID NO: 33).

[0386] 8. The pharmaceutical combination according to Embodiment 6 or 7, wherein the RNAi oligonucleotide further comprises a sense strand 19 to 50 nucleotides long, and the sense strand forms a double-stranded region with the antisense strand.

[0387] 9. The pharmaceutical combination according to Embodiment 8, wherein the sense chain includes a region complementary to the sequence described in UUNUUGUGAGGAUUN (SEQ ID NO: 34).

[0388] 10. The pharmaceutical combination according to Embodiment 8 or 9, wherein the sense chain includes a region complementary to the sequence described in 5'-UUAUUGUGAGGAUUNUUGUC (SEQ ID NO: 35).

[0389] 11. The pharmaceutical combination according to Embodiment 9, wherein the antisense chain comprises the sequence described in UUAUUGUGAGGAUUNUUGUCGG (SEQ ID NO: 36).

[0390] 12. The pharmaceutical combination according to Embodiment 9, wherein the antisense chain consists of the sequence described in UUAUUGUGAGGAUUCUUGUCGG (Sequence ID 37).

[0391] 13. The pharmaceutical combination according to Embodiment 9, wherein the antisense chain consists of the sequence described in UUAUUGUGAGGAUUUUUGUCGG (Sequence ID 38).

[0392] 14. A pharmaceutical combination according to any one of Embodiments 8 to 12, wherein the sense chain contains the sequence described in ACAANAAUCCUCACAAUAA (Sequence ID 39).

[0393] 15. A pharmaceutical combination according to any one of Embodiments 8 to 14, wherein the sense chain contains the sequence described in GACAANAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (Sequence ID 40).

[0394] 16. A pharmaceutical combination according to any one of Embodiments 8 to 14, wherein the sense chain consists of the sequence described in GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (Sequence ID 41).

[0395] 17. A pharmaceutical combination according to any one of Embodiments 8 to 14, wherein the sense chain consists of the sequence described in GACAAGAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (Sequence ID 42).

[0396] 18. The RNAi oligonucleotide is an oligonucleotide for reducing the expression of hepatitis B virus surface antigen (HBsAg) mRNA, wherein the oligonucleotide comprises an antisense strand and a sense strand forming a double-stranded region, the sense strand comprising the sequence described in GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 41), and the antisense strand comprising the sequence described in UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 38), Each of the antisense strand and the sense strand comprises one or more 2'-fluoro and 2'-O-methyl modified nucleotides and at least one phosphorothioate bond, anti The pharmaceutical combination according to any one of Embodiments 2 to 5, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the sense chain contains a phosphate analog, and the sense chain is conjugated to one or more N-acetylgalactosamine (GalNAc) moieties.

[0397] 19. RNAi oligonucleotides are oligonucleotides for reducing the expression of hepatitis B virus surface antigen (HBsAg) mRNA, and the oligonucleotides include an antisense strand and a sense strand that forms a double-stranded region. The sense strand is the sequence described in GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 41), comprising a sequence containing 2'-fluoromodified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methylmodified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36, and at least one phosphorothioate nucleotide interbond, wherein the sense strand is conjugated to one or more N-acetylgalactosamine (GalNAc) moieties. The antisense chain is the sequence described in UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 38), comprising a sequence including 2'-fluoromodified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O-methylmodified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22, and at least three interphosphothioate nucleotide bonds, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense chain contains a phosphate analog, as described in any one of Embodiments 2 to 5.

[0398] 20. The pharmaceutical combination according to Embodiment 19, wherein the sense strand includes a phosphorothioate bond between the nucleotides at positions 1 and 2.

[0399] 21. The pharmaceutical combination according to Embodiment 19 or 20, wherein the antisense chain contains five phosphorothioate bonds between nucleotides 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22.

[0400] 22. The 5'-nucleotide of the antisense strand has the following structure: [ka] A pharmaceutical combination according to any one of embodiments 19 to 21, having the above characteristics.

[0401] 23. The pharmaceutical combination according to any one of embodiments 19 to 22, wherein one or more nucleotides of the -GAAA- sequence on the sense strand are conjugated to a monovalent GalNAc portion.

[0402] 24. The pharmaceutical combination according to Embodiment 23, wherein each nucleotide of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNAc portion.

[0403] 25. The GAAA motif has the following structure: [ka] Includes, During the ceremony, L represents a bond, a click chemistry handle, or a linker of 1 to 20 consecutive covalent atoms selected from the group consisting of substituted and unsubstituted alkylenes, substituted and unsubstituted alkenylenes, substituted and unsubstituted alkylenes, substituted and unsubstituted heteroalkylenes, substituted and unsubstituted heteroalkenylenes, substituted and unsubstituted heteroalkylenes, and combinations thereof. The pharmaceutical combination according to Embodiment 24, wherein X is O, S, or N.

[0404] The pharmaceutical combination according to Embodiment 25, wherein 26.L is an acetal linker.

[0405] 27. The pharmaceutical combination according to Embodiment 25 or 26, wherein X is O.

[0406] 28. The -GAAA- sequence has the following structure: [ka] A pharmaceutical combination according to Embodiment 20, including the above.

[0407] 29. The pharmaceutical combination according to Embodiment 8, wherein the sense strand comprises the following stem loop at its 3' end: S1-L-S2, where S1 is complementary to S2 and L forms a loop between S1 and S2 up to 6 nucleotides in length.

[0408] The pharmaceutical combination according to Embodiment 29, wherein 30.L is a tetraloop.

[0409] 31. The pharmaceutical combination according to Embodiment 29 or 30, wherein L forms a 4-nucleotide loop between S1 and S2.

[0410] 32. The pharmaceutical combination according to any one of embodiments 29 to 31, comprising a sequence in which L is represented as GAAA.

[0411] 33. A pharmaceutical combination according to any one of embodiments 29 to 32, wherein up to four L nucleotides of the stem loop are each conjugated to a separate GalNAc.

[0412] 34. A pharmaceutical combination according to any one of embodiments 6 to 16, wherein the RNAi oligonucleotide comprises at least one modified nucleotide.

[0413] 35. The pharmaceutical combination according to Embodiment 34, wherein the modified nucleotide includes a 2'-modification.

[0414] 36. In the pharmaceutical combination according to Embodiment 35, the 2'-modification is selected from 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-deoxy-2'-fluoro-β-d-arabinonucleotide.

[0415] 37. A pharmaceutical combination according to any one of Embodiments 6 to 16, wherein all nucleotides of the RNAi oligonucleotide are modified nucleotides.

[0416] 38. A pharmaceutical combination according to any one of embodiments 6 to 16, wherein the RNAi oligonucleotide comprises at least one modified nucleotide bond.

[0417] 39. The pharmaceutical combination according to Embodiment 38, wherein at least one modified nucleotide bond is a phosphorothioate bond.

[0418] 40. A pharmaceutical combination according to any one of embodiments 6 to 16, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense chain contains a phosphate analog.

[0419] 41. A pharmaceutical combination according to any one of embodiments 6 to 16, wherein at least one nucleotide of the oligonucleotide is conjugated to a targeting ligand.

[0420] 42. The pharmaceutical combination according to Embodiment 41, wherein the targeted ligand is the N-acetylgalactosamine (GalNAc) moiety.

[0421] 43. RNAi oligonucleotides are oligonucleotides for reducing the expression of hepatitis B virus surface antigen (HBsAg) mRNA, and the oligonucleotides include an antisense strand and a sense strand that forms a double-stranded region. The sense strand is the sequence described in GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 41), comprising 2'-fluoromodified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methylmodified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36, and a phosphorothioate bond between the nucleotides at positions 1 and 2, wherein each nucleotide in the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNAc moiety. The antisense strand is the sequence described in UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 38), and consists of 2'-fluoromodified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O-methylmodified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22, and a sequence containing phosphorothioate bonds between nucleotides at positions 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22. The pharmaceutical combination according to any one of Embodiments 2 to 5, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense chain contains methoxyphosphonate (MOP) (RNAi number 6).

[0422] 44. RNAi oligonucleotides are oligonucleotides that reduce the expression of hepatitis B virus surface antigen (HBsAg) mRNA, and these oligonucleotides are It includes a sense chain and a sense chain that forms a double-stranded region, The sense strand comprises the sequence described in GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 41), which includes 2'-fluoromodified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methylmodified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36, and one phosphorothioate nucleotide bond between nucleotides at positions 1 and 2, wherein each nucleotide of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNAc moiety, and the -GAAA- sequence has the following structure: [ka] Includes The antisense chain is the sequence described in UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 38), comprising 2'-fluoromodified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O-methylmodified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22, and a sequence containing five phosphorothioate nucleotide interlinks between nucleotides 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense chain has the following structure: [ka] A pharmaceutical combination according to any one of embodiments 2 to 5, having the above characteristics.

[0423] 45. A pharmaceutical combination according to any one of Embodiments 2 to 5, wherein the RNAi oligonucleotide has the structure shown in Figure 29A (RNAi number 8).

[0424] 46. ​​A pharmaceutical combination according to any one of Embodiments 2 to 5, wherein the RNAi oligonucleotide is oligonucleotide HBV(s)-219 (RNAi number 9).

[0425] 47. The pharmaceutical combination according to Embodiment 1, wherein the therapeutic oligonucleotide is a 13-22 nucleotide long GalNAc conjugate antisense oligonucleotide having a sequence of at least 12 nucleotides that is 100% complementary to the sequence from position 1530 to 1602 of Sequence ID No. 1.

[0426] 48. The pharmaceutical combination according to Embodiment 47, wherein the continuous nucleotide sequence is 100% complementary to a target sequence selected from the group consisting of positions 1530-1598;1530-1543;1530-1544;1531-1543;1551-1565;1551-1566;1577-1589;1577-1591;1577-1592;1578-1590;1578-1592;1583-1598;1584-1598;1585-1598 and 1583-1602 of SEQ ID NO: 1.

[0427] 49. The pharmaceutical combination according to Embodiment 47 or 48, wherein the continuous nucleotide sequence is 12 to 16 nucleotides long.

[0428] 50. The sequential nucleotide sequence of the GalNAc conjugate antisense oligonucleotide is as follows: gcgtaaagagagg(sequence number 2); gcgtaaagagaggt(sequence number 3); cgcgtaaagagaggt(Sequence 4); agaaggcacagacgg(sequence number 5); gagaaggcacagacgg(sequence number 6); agcgaagtgcacacgg(sequence number 7); gaagtgcacacgg(sequence number 8); gcgaagtgcacacgg(indicate number 9); agcgaagtgcacacg(sequence number 10); cgaagtgc acacg(code element 11); aggtgaagcgaagtgc(Sequence ID 12) aggtgaagcgaagtg(sequence number 13); aggtgaagcgaagt(sequence number 14); and gcagaggtgaagcgaagtgc (Sequence ID 29) A pharmaceutical combination according to any one of embodiments 47 to 49, which is selected from the group consisting of or a pharmaceutically acceptable salt thereof.

[0429] 51. The pharmaceutical combination according to any one of Embodiments 47 to 50, wherein the continuous nucleotide sequence of the GalNAc conjugate antisense oligonucleotide is a gapmer of formula 5'-FG-F'-3', regions F and F' independently consist of 2 to 5 2'-sugar-modified nucleotides defining the 5' and 3' ends of regions F and F', and G is a DNA nucleoside region of 6 to 10 that can recruit RNase H.

[0430] 52. The pharmaceutical combination according to Embodiment 51, wherein the 2'-sugar-modified nucleoside is independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, 2'-fluoro-ANA, and LNA nucleosides.

[0431] 53. The pharmaceutical combination according to Embodiment 51 or 52, wherein one or more 2'-sugar-modified nucleosides are MOE nucleosides.

[0432] 54. The pharmaceutical combination according to Embodiment 51 or 52, wherein one or more 2'-sugar-modified nucleosides are LNA nucleosides.

[0433] 55. The pharmaceutical combination according to Embodiment 54, wherein the modified LNA nucleoside is selected from oxy-LNA, amino-LNA, thio-LNA, cET, and ENA.

[0434] 56. The pharmaceutical combination according to Embodiment 54 or 55, wherein the modified LNA nucleoside is an oxy LNA having a subsequent 2'-4' crosslinked -O-CH2-.

[0435] 57. The pharmaceutical combination according to Embodiment 56, wherein the oxy-LNA is beta-D-oxy-LNA.

[0436] 58. The pharmaceutical combination according to Embodiment 54 or 55, wherein the modified LNA nucleoside is followed by a cET having a 2'-4' crosslinked-O-CH(CH3)-.

[0437] The pharmaceutical combination according to Embodiment 58, wherein 59.cET is (S)cET, i.e., 6'(S)methyl-beta-D-oxy LNA.

[0438] 60. The pharmaceutical combination according to Embodiment 54 or 55, wherein LNA is ENA and is followed by a 2'-4' crosslinked-O-CH2-CH2-.

[0439] 61. The sequential nucleotide sequence of the GalNAc conjugate antisense oligonucleotide is GCGtaaagagaGG(Sequence ID 2); GCGtaaagagAGG(Sequence ID 2); GCGtaaagagaGGT(Sequence ID 3); CGCgtaaagagaGGT(Sequence ID 4); AGAaggcacagaCGG(Sequence ID 5); GAGaaggcacagaCGG(SEQ ID NO: 6); AGCgaagtgcacaCGG(Sequence ID 7); GAAgtgcacacGG(Sequence ID 8); GAAgtgcacaCGG(Sequence 8); GCGaagtgcacaCGG(Sequence ID 9); AGCgaagtgcacACG(Sequence ID 10); CGAagtgcacaCG(Sequence ID 11); AGGtgaagcgaagTGC(sequence number 12); AGGtgaagcgaaGTG (Sequence ID 13) AGgtgaagcgaAGTG(Sequence ID 13); AGGtgaagcgaAGT(SEQ ID NO: 14); and GCAGAGgtgaagcgaAGTGC (Sequence No. 29) A pharmaceutical combination according to any one of Embodiments 47 to 60, selected from the group consisting of the following, where uppercase letters indicate LNA or MOE nucleosides and lowercase letters indicate DNA nucleosides.

[0440] 62. A pharmaceutical combination according to any one of Embodiments 47 to 61, wherein at least 50% of the nucleoside bonds in the continuous nucleotide sequence are phosphorothioate nucleoside bonds.

[0441] 63. A pharmaceutical combination according to any one of Embodiments 47 to 62, wherein all nucleoside-to-nucleoside bonds in the continuous nucleotide sequence of the GalNAc conjugate antisense oligonucleotide are phosphorothioate nucleoside-to-nucleoside bonds.

[0442] 64. The pharmaceutical combination according to any one of Embodiments 47 to 63, wherein the GalNAc conjugate of the GalNAc conjugate antisense oligonucleotide is a divalent, trivalent, or tetravalent GalNAc cluster.

[0443] 65. The pharmaceutical combination according to Embodiment 64, wherein the GalNAc conjugate is selected from Figure 1B, Figure 1D, or Figure 1J.

[0444] 66. A pharmaceutical combination according to any one of Embodiments 47 to 65, wherein the continuous nucleotide sequences of a GalNAc conjugate and a GalNAc conjugate antisense oligonucleotide are covalently linked by a PO linker containing 2, 3, 4, or 5 phosphodiester-linked DNA nucleosides.

[0445] 67. The pharmaceutical combination according to Embodiment 66, wherein the PO linker is part of an antisense oligonucleotide and consists of a cytosine and adenine (CA) dinucleotide sequence having at least two phosphodiester bonds, one of which is between C and A and the other is toward a GalNAc cluster.

[0446] 68. A pharmaceutical combination according to any one of Embodiments 47 to 67, wherein the GalNAc conjugate antisense oligonucleotide is 12 to 18 nucleotides long.

[0447] 69. GalNAc-conjugate antisense oligonucleotides [Table 9-2] A pharmaceutical combination according to any one of Embodiments 47 to 68, selected from the group consisting of the following, where uppercase bold letters represent beta-D-oxy LNA units, lowercase letters represent DNA units, the subscript "o" represents a phosphodiester bond, the subscript "s" represents a phosphorothioate bond, the superscript "m" represents DNA or a beta-D-oxy LNA unit containing a 5-methylcytosine base, and GN2-C6 represents a GalNAc 2 conjugate having a C6 linker, or a pharmaceutically acceptable salt thereof.

[0448] 70. GalNAc-conjugate antisense oligonucleotides are 5'-Figure 1J- o G s C s A s G s A sgsgstsgsasasgscsgsas A s G s T s G s C -3' (Figure 2), in which underlined uppercase letters represent MOE units, lowercase letters represent DNA units, the subscript "o" represents a phosphodiester bond, and the subscript "s" represents a phosphorothioate bond, as described in any one of Embodiments 47 to 69.

[0449] 71. The TLR7 agonist is given by equation (III): [ka] And, A pharmaceutical combination according to any one of Embodiments 1 to 70, wherein R1 is -OH or acetoxy, and R2 is 1-acetoxypropyl, 1-hydroxypropyl, or 1-hydroxymethyl, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0450] 72. The TLR7 agonist is given by equation (IV): [ka] And, The pharmaceutical combination according to any one of Embodiments 1 to 70, wherein R1 is acetoxy(cyclopropyl)methyl or acetoxy(propyne-1-yl)methyl.

[0451] 73. The TLR7 agonist is given by equation (V): [ka] And, A pharmaceutical combination according to any one of Embodiments 1 to 70, wherein R1 is -OH and R2 is 1-hydroxypropyl or hydroxymethyl, or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.

[0452] 74. TLR7 Agonist, [(1S)-1-[(2S,4R,5R)-5-(5-amino-2-oxothiazolo[4,5-d]pyrimidine-3-yl)-4-hydroxytetrahydrofuran-2-yl]propyl]acetate (CMP No. VI); 5-amino-3-[(2R,3R,5S)-3-hydroxy-5-[(1S)-1-hydroxypropyl]tetrahydrofuran-2-yl]-6H-thiazolo[4,5-d]pyrimidine-2,7-dione (CMP number VII); 5-amino-3-[(2R,3R,5S)-3-hydroxy-5-[(1S)-1-hydroxypropyl]tetrahydrofuran-2-yl]thiazolo[4,5-d]pyrimidine-2-one (CMP number VIII); 5-amino-3-(3'-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidine-2-one (CMP number IX); 5-amino-3-(2'-O-acetyl-3'-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidine-2-one (CMP number X); 5-amino-3-(3'-deoxy-β-D-ribofuranosyl)-3H,6H-thiazolo[4,5-d]pyrimidine-2,7-dione (CMP number XI); [(S)-[(2S,5R)-5-(5-amino-2-oxothiazolo[4,5-d]pyrimidine-3-yl)-1,3-oxathiolan-2-yl]-cyclopropyl-methyl]acetate (CMP number XII); and (1S)-1-[(2S,5R)-5-(5-amino-2-oxothiazolo[4,5-d]pyrimidine-3-yl)-1,3-oxathiolan-2-yl]buta-2-inyl]acetate (CMP number XIII); A pharmaceutical combination according to any one of Embodiments 1 to 73, which is selected from the group consisting of, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0453] 75. Combinations containing RNAi oligonucleotides and TLR7 agonists include the following: RNAi number 1 and CMP number VI; RNAi number 2 and CMP number VI; RNAi number 3 and CMP number VI; RNAi number 4 and CMP number VI; RNAi number 5 and CMP number VI; RNAi number 6 and CMP number VI; RNAi number 7 and CMP number VI; RNAi number 8 and CMP number VI; RNAi number 9 and CMP number VI; RNAi number 1 and CMP number VII; RNAi number 2 and CMP number VII; RNAi number 3 and CMP number VII; RNAi number 4 and CMP number VII; RNAi number 5 and CMP number VII; RNAi number 6 and CMP number VII; RNAi number 7 and CMP number VII; RNAi number 8 and CMP number VII; RNAi number 9 and CMP number VII; RNAi number 1 and CMP number VIII; RNAi number 2 and CMP number VIII; RNAi number 3 and CMP number VIII; RNAi number 4 and CMP number VIII; RNAi number 5 and CMP number VIII; RNAi number 6 and CMP number VIII; RNAi number 7 and CMP number VIII; RNAi number 8 and CMP number VIII; RNAi number 9 and CMP number VIII; RNAi number 1 and CMP number XIII; RNAi number 2 and CMP number XIII; RNAi number 3 and CMP number XIII; RNAi number 4 and CMP number XIII; RNAi number 5 and CMP number XIII; RNAi number 6 and CMP number XIII; RNAi number 7 and CMP number XIII; RNAi number 8 and CMP number XIII, or RNAi number 9 and CMP number XIII; A pharmaceutical combination according to any one of embodiments 2 to 46 and 71 to 74, which is selected from the group consisting of, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0454] 76. The RNAi oligonucleotide is RNAi number 7. It is an oligonucleotide containing an antisense strand and a sense strand that forms a double-stranded region. The sense strand comprises the sequence described in GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 41), which includes 2'-fluoromodified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methylmodified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36, and one phosphorothioate nucleotide bond between nucleotides at positions 1 and 2, wherein each nucleotide of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety, and the -GAAA- sequence has the following structure: [ka] Includes, The antisense chain is the sequence described in UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 38), comprising 2'-fluoromodified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O-methylmodified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22, and a sequence containing five phosphorothioate nucleotide interlinks between nucleotides 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense chain has the following structure: [ka] It has, TLR7 agonist is CMP number VI: [ka] A pharmaceutical combination according to any one of embodiments 2 to 46 and 71 to 74, which is a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0455] 77. Combinations containing a GalNAc conjugate antisense oligonucleotide and a TLR7 agonist include the following combinations: CMP numbers 15_1 and VI, CMP numbers 15_2 and VI; CMP numbers 16_1 and VI; CMP numbers 20_1 and VI; CMP numbers 23_1 and VI; CMP numbers 26_1 and VI; CMP numbers 29_1 and VI; CMP numbers 15_1 and VII, CMP numbers 15_2 and VII; CMP numbers 16_1 and VII; CMP numbers 20_1 and VII; CMP numbers 23_1 and VII; CMP numbers 26_1 and VII; CMP numbers 29_1 and VII; CMP numbers 15_1 and VIII, CMP number 1 A pharmaceutical combination according to any one of Embodiments 47 to 74, selected from the group consisting of 5_2 and VIII; CMP numbers 16_1 and VIII; CMP numbers 20_1 and VIII; CMP numbers 23_1 and VII; CMP numbers 26_1 and VIII; CMP numbers 29_1 and VIII; CMP numbers 15_1 and XIII, CMP numbers 15_2 and XIII; CMP numbers 16_1 and XIII; CMP numbers 20_1 and XIII; CMP numbers 23_1 and XIII; CMP numbers 26_1 and XIII; and CMP numbers 29_1 and XIII, or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof.

[0456] 78. The GalNAc conjugate antisense oligonucleotide is CMP number 15_1 shown in Figure 5, and the TLR7 agonist is CMP number VI: [ka] A pharmaceutical combination, pharmaceutical combination according to any one of embodiments 47 to 74, which is a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0457] 79. A pharmaceutical combination according to any one of Embodiments 1 to 78, wherein a therapeutic oligonucleotide is formulated with a pharmaceutically acceptable salt.

[0458] 80. The pharmaceutically acceptable salt is a metal cation ion, preferably a pharmaceutically acceptable salt is Na + or K + The pharmaceutical combination described in Embodiment 79.

[0459] 81. Therapeutic oligonucleotides and TLRs according to any one of Embodiments 1 to 80 A pharmaceutical combination according to any one of Embodiments 1 to 80, wherein the agonist is formulated with a pharmaceutically acceptable carrier.

[0460] 82. The pharmaceutical combination according to Embodiment 81, wherein the pharmaceutically acceptable carrier is water.

[0461] 83. A pharmaceutical combination according to any one of Embodiments 1 to 82, wherein a therapeutic oligonucleotide is formulated in phosphate-buffered saline.

[0462] 84. The pharmaceutical combination according to any one of Embodiments 1 to 83, wherein the therapeutic oligonucleotide is formulated for subcutaneous injection and the TLR7 agonist is formulated for oral administration.

[0463] 85. The pharmaceutical combination according to any one of Embodiments 1 to 83, wherein the therapeutic oligonucleotide is formulated for intravenous injection and the TLR7 agonist is formulated for oral administration.

[0464] The pharmaceutical combination according to any one of Embodiments 2 to 46, 75, 76 and 79 to 83, wherein the therapeutic oligonucleotide is an siRNA formulated for subcutaneous injection and the TLR7 agonist is formulated for oral administration.

[0465] The pharmaceutical combination according to any one of Embodiments 1 to 86, comprising an RNAi oligonucleotide and a TLR7 agonist, and further comprising a CpAM (core protein allosteric modulator).

[0466] 88. The CpAM is a compound (CpAM1) represented as follows:

Chemical formula

[0467] 89. CpAM is a compound (CpAM2) [ka] The pharmaceutical combination according to Embodiment 87 or 88, which is a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof.

[0468] 90. A pharmaceutical combination comprising an RNAi oligonucleotide, a TLR7 agonist, and a CpAM, wherein the RNAi oligonucleotide is RNAi number 7: It is an oligonucleotide containing an antisense strand and a sense strand that forms a double-stranded region. The sense strand comprises the sequence described in GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 41), which includes 2'-fluoromodified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methylmodified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36, and one phosphorothioate nucleotide bond between nucleotides at positions 1 and 2, wherein each nucleotide of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNAc moiety, and the -GAAA- sequence has the following structure: [ka] Includes, The antisense chain is the sequence described in UUAUUGUGAGGAUUUUUGUCGG (SEQ ID NO: 38), comprising 2'-fluoromodified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O-methylmodified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22, and a sequence containing five phosphorothioate nucleotide interlinks between nucleotides 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense chain has the following structure: [ka] It has, TLR7 agonist is CMP number VI: [ka] It is, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof; CpAM is the compound (CpAM2): [ka] or a combination of pharmaceutically acceptable salts, enantiomers, or diastereomers thereof.

[0469] 91. A pharmaceutical composition comprising the pharmaceutical combination described in any one of Embodiments 1 to 90.

[0470] 92. A kit of parts comprising a therapeutic oligonucleotide according to any one of Embodiments 1 to 90 and a package insert describing the administration of a TLR7 agonist for treating hepatitis B virus infection.

[0471] 93. The kit of parts according to Embodiment 92, wherein the TLR7 agonist described in the attached document is the TLR7 agonist described in any one of Embodiments 1 to 90.

[0472] 94. A kit of parts according to Embodiment 92 or 93, comprising a therapeutic oligonucleotide according to any one of Embodiments 1 to 90 and a TLR7 agonist according to any one of Embodiments 1 to 90.

[0473] 95. A kit of parts according to any one of embodiments 92 to 94, wherein a therapeutic oligonucleotide is formulated for subcutaneous injection and a TLR7 agonist is formulated for oral administration.

[0474] 96. A kit of parts according to any one of embodiments 92 to 95, wherein the accompanying leaflet describes the treatment of chronic hepatitis B virus infection.

[0475] 97. A pharmaceutical combination, composition, or kit according to any one of Embodiments 1 to 96, wherein the therapeutic oligonucleotide is in the form of a transgene that has been engineered to express an oligonucleotide in a cell.

[0476] 98. Use of any one of the pharmaceutical combinations, compositions, or kits described in Embodiments 1 to 97 for treating hepatitis B virus infection.

[0477] 99. The use according to Embodiment 98, wherein the hepatitis B virus infection being treated is a chronic hepatitis B virus infection.

[0478] 100. The use according to Embodiment 98 or 99, wherein the therapeutic oligonucleotide and TLR7 agonist are ...

Claims

1. Therapeutic oligonucleotides, and formulas (I) or (II): 【Chemistry 1】 or a combination of pharmaceuticals comprising a pharmaceutically acceptable salt, enantiomer, or diastereomer of the TLR7 agonist thereof, In the formula, X is CH 2 Or it is S, Regarding equation (I), R 1 is -OH or -H, and R 2 It is 1-hydroxypropyl or hydroxymethyl, Regarding equation (II), R 1 R is -OH or -H or acetoxy, 2 This is 1-acetoxypropyl, 1-hydroxypropyl, 1-hydroxymethyl, acetoxy(cyclopropyl)methyl, or acetoxy(propyne-1-yl)methyl.

2. The pharmaceutical combination according to claim 1, wherein the therapeutic oligonucleotide is an RNAi oligonucleotide.

3. The pharmaceutical combination according to claim 2, wherein the RNAi oligonucleotide is an oligonucleotide that targets HBV (RNAi number 1).

4. The pharmaceutical combination according to claim 2 or 3, wherein the RNAi oligonucleotide is an oligonucleotide that targets HBsAg mRNA (RNAi number 2).

5. The pharmaceutical combination according to any one of claims 2 to 4, wherein the RNAi oligonucleotide is an oligonucleotide that reduces the expression of HBsAg mRNA (RNAi number 3).

6. The pharmaceutical combination according to any one of claims 2 to 5, wherein the RNAi oligonucleotide is an oligonucleotide comprising an antisense strand of 19 to 30 nucleotides in length, and the antisense strand includes a region complementary to the sequence of HBsAg mRNA (RNAi number 4) described in ACAANAAUCCUCACAAUA (SEQ ID NO: 33).

7. The pharmaceutical combination according to any one of claims 2 to 5, wherein the RNAi oligonucleotide is an oligonucleotide for reducing the expression of hepatitis B virus surface antigen (HBsAg) mRNA, the oligonucleotide is an oligonucleotide comprising an antisense strand of 19 to 30 nucleotides in length, and the antisense strand includes a region complementary to the sequence of HBsAg mRNA (RNAi number 5) described in ACAANAAUCCUCACAAUA (SEQ ID NO: 33).

8. The RNAi oligonucleotide further comprises a sense strand having a length of 19 to 50 nucleotides, wherein the sense strand forms a double-stranded region with the antisense strand, as described in claim 6 or 7. Listed combinations of medicines.

9. The pharmaceutical combination according to claim 8, wherein the sense strand includes a region complementary to the sequence described in UUNUUGUGAGGAUGAUUN (SEQ ID NO: 34).

10. The pharmaceutical combination according to claim 8 or 9, wherein the sense chain includes a region complementary to the sequence described in 5'-UUAUUGUGAGGAUUNUUGUC (SEQ ID NO: 35).

11. The pharmaceutical combination according to claim 9, wherein the antisense chain includes the sequence described in UUAUUGUGAGGAAUUNUUGUCGG (Sequence ID 36).

12. The pharmaceutical combination according to claim 9, wherein the antisense chain consists of the sequence described in UUAUUGUGAGGAAUUCUUGUCGG (Sequence ID 37).

13. The pharmaceutical combination according to claim 9, wherein the antisense chain consists of the sequence described in UUAUUGUGAGGAAUUUUUGUCGG (Sequence ID 38).

14. The pharmaceutical combination according to any one of claims 8 to 12, wherein the sense chain comprises the sequence described in ACAANAAUCCUCACAAUAA (Sequence ID 39).

15. The pharmaceutical combination according to any one of claims 8 to 14, wherein the sense chain comprises the sequence described in GACAANAAUCCUCACACAAUAAGCAGCCGAAAGCUGC (Sequence ID 40).

16. The pharmaceutical combination according to any one of claims 8 to 14, wherein the sense chain consists of the sequence described in GACAAAAAUCCUCACAAUAAGCAGCCGAAAAGGCUGC (Sequence ID 41).

17. The pharmaceutical combination according to any one of claims 8 to 14, wherein the sense chain consists of the sequence described in GACAAGAAUCCUCACAAUAAGCAGCCGGAAAAGGCUGC (Sequence ID 42).

18. The RNAi oligonucleotide is an oligonucleotide for reducing the expression of hepatitis B virus surface antigen (HBsAg) mRNA, and the oligonucleotide comprises an antisense strand and a sense strand forming a double-stranded region, the sense strand comprises the sequence described in GACAAAAAUCCUCACACAAUAAGCCGAAAAGGCUGC (SEQ ID NO: 41), and the antisense strand comprises the sequence described in UUAUUGUGAGGAAUUUUUGUCGG (SEQ ID NO: 38). The pharmaceutical combination according to any one of claims 2 to 5, wherein each of the antisense chain and the sense chain comprises one or more 2'-fluoro and 2'-O-methyl modified nucleotides and at least one phosphorothioate bond, the 4'-carbon of the sugar of the 5'-nucleotide of the antisense chain comprises a phosphate analog, and the sense chain is conjugated to one or more N-acetylgalactosamine (GalNAc) moieties.

19. The RNAi oligonucleotide is an oligonucleotide for reducing the expression of hepatitis B virus surface antigen (HBsAg) mRNA, and the oligonucleotide comprises an antisense strand and a sense strand that forms a double-stranded region. The sense strand is the sequence described in GACAAAAAUCCUCACAAUAAGCAGCCGGAAAAGGCUGC (SEQ ID NO: 41), with 2'-fluoromodified nucleotides at positions 3, 8-10, 12, 13 and 17, and positions 1, 2, 4-7, 11, 14- The sequence comprises 2'-O-methyl modified nucleotides at positions 16, 18-26 and 31-36, and at least one phosphorothioate nucleotide interbond, wherein the sense strand is conjugated to one or more N-acetylgalactosamine (GalNAc) moieties. The pharmaceutical combination according to any one of claims 2 to 5, wherein the antisense chain comprises the sequence described in UUAUUGUGAGGAAUUUUUGUCGG (SEQ ID NO: 38), which includes 2'-fluoromodified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O-methylmodified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22, and at least three interphosphothioate nucleotide bonds, and the 4'-carbon of the sugar of the 5'-nucleotide of the antisense chain comprises a phosphate analog.

20. The pharmaceutical combination according to claim 19, wherein the sense strand includes a phosphorothioate bond between the nucleotides at position 1 and position 2.

21. The pharmaceutical combination according to claim 19 or 20, wherein the antisense chain contains five phosphorothioate bonds between nucleotides 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22.

22. The 5'-nucleotide of the antisense strand has the following structure: 【Chemistry 2】 A pharmaceutical combination according to any one of claims 19 to 21, having the following characteristics.

23. The pharmaceutical combination according to any one of claims 19 to 22, wherein one or more nucleotides of the -GAAAA- sequence on the sense strand are conjugated to a monovalent GalNAc portion.

24. The pharmaceutical combination according to claim 23, wherein each nucleotide of the -GAAAA- sequence on the sense strand is conjugated to a monovalent GalNAc portion.

25. The aforementioned -GAAAA- motif has the following structure: 【Transformation 3】 Includes, During the ceremony, L represents a bond, a click chemistry handle, or a linker of 1 to 20 consecutive covalent atoms selected from the group consisting of substituted and unsubstituted alkylenes, substituted and unsubstituted alkenylenes, substituted and unsubstituted alkylenes, substituted and unsubstituted heteroalkylenes, substituted and unsubstituted heteroalkenylenes, substituted and unsubstituted heteroalkylenes, and combinations thereof. The pharmaceutical combination according to claim 24, wherein X is O, S, or N.

26. The pharmaceutical combination according to claim 25, wherein L is an acetal linker.

27. The pharmaceutical combination according to claim 25 or 26, wherein X is O.

28. The -GAAAA- sequence has the following structure: 【Chemistry 4】 The pharmaceutical combination according to claim 20, including the above.

29. The sense strand has, at its 3' end, a stem-loop: S 1 -L-S 2 comprising, wherein S 1 is complementary to S 2 , and L forms a loop with a maximum length of 6 nucleotides between S 1 and S 2 The pharmaceutical combination according to claim 8.

30. The pharmaceutical combination according to claim 29, wherein L is a tetraloop.

31. L is S 1 and S 2 The pharmaceutical combination according to claim 29 or 30, wherein a four-nucleotide loop is formed between the two.

32. The pharmaceutical combination according to any one of claims 29 to 31, wherein L includes the sequence described as GAAA.

33. The L of up to four nucleotides in the aforementioned stem loop is conjugated to separate GalNAcs. A pharmacopoeia combination according to any one of claims 29 to 32, which is gated.

34. The pharmaceutical combination according to any one of claims 6 to 16, wherein the RNAi oligonucleotide comprises at least one modified nucleotide.

35. The pharmaceutical combination according to claim 34, wherein the modified nucleotide includes a 2'-modification.

36. The pharmaceutical combination according to claim 35, wherein the 2'-modification is selected from 2'-aminoethyl, 2'-fluoro, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-deoxy-2'-fluoro-β-d-arabinonucleotide.

37. The pharmaceutical combination according to any one of claims 6 to 16, wherein all nucleotides of the RNAi oligonucleotide are modified nucleotides.

38. The pharmaceutical combination according to any one of claims 6 to 16, wherein the RNAi oligonucleotide comprises at least one modified nucleotide bond.

39. The pharmaceutical combination according to claim 38, wherein the at least one modified nucleotide bond is a phosphorothioate bond.

40. The pharmaceutical combination according to any one of claims 6 to 16, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense chain contains a phosphate analog.

41. The pharmaceutical combination according to any one of claims 6 to 16, wherein at least one nucleotide of the oligonucleotide is conjugated to a targeted ligand.

42. The pharmaceutical combination according to claim 41, wherein the targeted ligand is the N-acetylgalactosamine (GalNAc) moiety.

43. The RNAi oligonucleotide is an oligonucleotide for reducing the expression of hepatitis B virus surface antigen (HBsAg) mRNA, and the oligonucleotide comprises an antisense strand and a sense strand that forms a double-stranded region. The sense strand is the sequence described in GACAAAAAUCCUCACAAUAAGCCGAAAAGGCUGC (SEQ ID NO: 41), comprising a sequence including 2'-fluoromodified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methylmodified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36, and a phosphorothioate bond between the nucleotides at positions 1 and 2, wherein each nucleotide in the -GAAAA- sequence on the sense strand is conjugated to a monovalent GalNac portion. The antisense chain is the sequence described in UUAUUGUGAGGAAUUUUUGUCGG (SEQ ID NO: 38), comprising a sequence including 2'-fluoromodified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O-methylmodified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22, and phosphorothioate bonds between the nucleotides at positions 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22. The pharmaceutical combination according to any one of claims 2 to 5, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense chain contains methoxyphosphonate (MOP) (RNAi number 6).

44. The RNAi oligonucleotide is the hepatitis B virus surface antigen (HBsAg) mRN An oligonucleotide for reducing the expression of A, wherein the oligonucleotide includes an antisense strand and a sense strand that forms a double-stranded region. The sense strand comprises the sequence described in GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 41), which includes 2'-fluoromodified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methylmodified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36, and one phosphorothioate nucleotide bond between the nucleotides at positions 1 and 2, wherein each nucleotide of the -GAAAA- sequence on the sense strand is conjugated to a monovalent GalNAc portion, and the -GAAAA- sequence has the following structure: 【Transformation 5】 Includes, The antisense chain is the sequence described in UUAUUGUGAGGAAUUUUUGUCGG (SEQ ID NO: 38), comprising a sequence including 2'-fluoromodified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O-methylmodified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22, and five phosphorothioate nucleotide interlinks between nucleotides 1 and 2, 2 and 3, 3 and 4, 20 and 21 and 22, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense chain has the following structure: 【Transformation 6】 A pharmaceutical combination according to any one of claims 2 to 5, having the following characteristics.

45. The pharmaceutical combination according to any one of claims 2 to 5, wherein the RNAi oligonucleotide has the structure shown in Figure 29A (RNAi number 8).

46. The pharmaceutical combination according to any one of claims 2 to 5, wherein the RNAi oligonucleotide is oligonucleotide HBV(s)-219 (RNAi number 9).

47. The pharmaceutical combination according to claim 1, wherein the therapeutic oligonucleotide is a 13-22 nucleotide length GalNAc conjugate antisense oligonucleotide having a continuous nucleotide sequence of at least 12 nucleotides that is 100% complementary to the continuous sequence from position 1530 to 1602 of Sequence ID No.

1.

48. The pharmaceutical combination according to claim 47, wherein the continuous nucleotide sequence is 100% complementary to a target sequence selected from the group consisting of positions 1530-1598; 1530-1543; 1530-1544; 1531-1543; 1551-1565; 1551-1566; 1577-1589; 1577-1591; 1577-1592; 1578-1590; 1578-1592; 1583-1598; 1584-1598; 1585-1598 and 1583-1602 of SEQ ID NO:

1.

49. The pharmaceutical combination according to claim 47 or 48, wherein the continuous nucleotide sequence is 12 to 16 nucleotides long.

50. The continuous nucleotide sequence of the GalNAc conjugate antisense oligonucleotide is, gcgtaaagagag (SEQ ID NO: 2); gcgtaaagaggt(sequence number 3); cgcgtaaagagggt(sequence number 4); agaaggcacagacgg (SEQ ID NO: 5); gagaaggcacagacgg (SEQ ID NO: 6); agcgaagtgcacacgg (SEQ ID NO: 7); gaagtgcacacgg (SEQ ID NO: 8); gcgaagtgcacacgg (SEQ ID NO: 9); agcgaagtgcacacg(SEQ ID NO: 10); cgaagtgcacacg (SEQ ID NO: 11); aggtgaagcgaagtgc (SEQ ID NO: 12) aggtgaagcgaagtg (SEQ ID NO: 13); aggtgaagcgaagt (SEQ ID NO: 14); and gca ggt ga gc ga gt gc (SEQ ID NO: 29) A pharmaceutical combination according to any one of claims 47 to 49, or a pharmaceutically acceptable salt thereof, selected from the group consisting of the above.

51. The pharmaceutical combination according to any one of claims 47 to 50, wherein the continuous nucleotide sequence of the GalNAc conjugate antisense oligonucleotide is a gapmer of formula 5'-F-G-F'-3', regions F and F' independently consist of 2 to 5 2'-sugar-modified nucleotides defining the 5' and 3' ends of regions F and F', and G is 6 to 10 DNA nucleoside regions capable of recruiting RNase H.

52. The pharmaceutical combination according to claim 51, wherein the 2'-sugar-modified nucleoside is independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, 2'-fluoro-ANA, and LNA nucleosides.

53. The pharmaceutical combination according to claim 51 or 52, wherein one or more 2'-saccharide modified nucleosides are MOE nucleosides.

54. The pharmaceutical combination according to claim 51 or 52, wherein one or more 2'-saccharide modified nucleosides are LNA nucleosides.

55. The pharmaceutical combination according to claim 54, wherein the modified LNA nucleoside is selected from oxyLNA, aminoLNA, thioLNA, cET, and ENA.

56. The modified LNA nucleoside is followed by a 2'-4' bridged-O-CH 2 The pharmaceutical combination according to claim 54 or 55, wherein the oxy LNA has -.

57. The pharmaceutical combination according to claim 56, wherein the oxy LNA is beta-D-oxy LNA.

58. The modified LNA nucleoside is followed by a 2'-4' bridged-O-CH(CH) 3 The pharmaceutical combination according to claim 54 or 55, which is a cET having )-.

59. The pharmaceutical combination according to claim 58, wherein the cET is (S)cET, i.e., 6'(S)methyl-beta-D-oxy LNA.

60. The aforementioned LNA is ENA, followed by a 2'-4' bridged-O-CH 2 -CH 2 A pharmaceutical combination according to claim 54 or 55, having -

61. The continuous nucleotide sequence of the GalNAc conjugate antisense oligonucleotide is, GCGtaaagagaGG (SEQ ID NO: 2); GCGtaaagagAGG (SEQ ID NO: 2); GCGtaaagagaGGT (SEQ ID NO: 3); CGCgtaaagagaGGT (Sequence ID 4); AGAaggcacagaCGG (SEQ ID NO: 5); GAGAaggcacagaCGG (SEQ ID NO: 6); AGCgaagtgcacaCGG (Sequence ID 7); GAAgtgcacacGG (Sequence ID 8); GAAgtgcacaCGG (Sequence ID 8); GCGaagtgcacaCGG (Sequence ID 9); AGCgaagtgcacACG (SEQ ID NO: 10); CGAagtgcacaCG (Sequence ID 11); AGGtgaagcgaagTGC (Sequence ID 12); AGGtgaagcgaaGTG (Sequence ID 13) AGgtgaagcgaAGTG (Sequence ID 13); AGGtgaagcgaAGT (SEQ ID NO: 14); and GCAGAGgtgaagcgaAGTGC (Sequence ID 29) A pharmaceutical combination according to any one of claims 47 to 60, selected from the group consisting of the above, where uppercase letters indicate LNA or MOE nucleoside and lowercase letters indicate DNA nucleoside.

62. The pharmaceutical combination according to any one of claims 47 to 61, wherein at least 50% of the nucleoside bonds in the continuous nucleotide sequence are phosphorothioate nucleoside bonds.

63. The pharmaceutical combination according to any one of claims 47 to 62, wherein all nucleoside bonds in the continuous nucleotide sequence of the GalNAc conjugate antisense oligonucleotide are phosphorothioate nucleoside bonds.

64. The pharmaceutical combination according to any one of claims 47 to 63, wherein the GalNAc conjugate of the GalNAc conjugate antisense oligonucleotide is a divalent, trivalent, or tetravalent GalNAc cluster.

65. The pharmaceutical combination according to claim 64, wherein the GalNAc conjugate is selected from Figure 1B, Figure 1D, or Figure 1J.

66. The pharmaceutical combination according to any one of claims 47 to 65, wherein the continuous nucleotide sequences of the GalNAc conjugate and the GalNAc conjugate antisense oligonucleotide are covalently linked by a PO linker containing two, three, four, or five phosphodiester-linked DNA nucleosides.

67. The pharmaceutical combination according to claim 66, wherein the PO linker is part of the antisense oligonucleotide and consists of a cytosine and adenine (CA) dinucleotide sequence having at least two phosphodiester bonds, one of which is between C and A and the other is toward the GalNAc cluster.

68. The pharmaceutical combination according to any one of claims 47 to 67, wherein the GalNAc conjugate antisense oligonucleotide is 12 to 18 nucleotides long.

69. The GalNAc conjugate antisense oligonucleotide is Table 1 Selected from the group consisting of the following, in the formula, uppercase bold letters represent beta-D-oxy LNA units, lowercase letters represent DNA units, the subscript "o" represents a phosphodiester bond, the subscript "s" represents a phosphorothioate bond, the superscript "m" represents DNA or a beta-D-oxy LNA unit containing a 5-methylcytosine base, and GN2-C6 represents a GalNAc2 conjugate having a C6 linker. or a pharmaceutically acceptable salt thereof The pharmaceutical combination according to any one of claims 47 to 68.

70. The aforementioned GalNAc conjugate antisense oligonucleotide is 5'-Figure 1J- o G s C s A s G s A s g s g s t s g s a s a s g s c s g s a s A s G s T s G s The pharmaceutical combination according to any one of claims 47 to 69, wherein C-3' (Figure 2), in which underlined uppercase letters represent MOE units, lowercase letters represent DNA units, the subscript "o" represents a phosphodiester bond, and the subscript "s" represents a phosphorothioate bond.

71. The TLR7 agonist is given by equation (III): 【Transformation 7】 And, In the formula, R 1 R is -OH or acetoxy, 2 It is 1-acetoxypropyl, 1-hydroxypropyl, or 1-hydroxymethyl. or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof A combination of pharmaceuticals according to any one of claims 1 to 70.

72. The TLR7 agonist is given by equation (IV): 【Transformation 8】 And, In the formula, R 1 The pharmaceutical combination according to any one of claims 1 to 70, wherein is acetoxy(cyclopropyl)methyl or acetoxy(propyne-1-yl)methyl.

73. The TLR7 agonist is given by equation (V): 【Chemistry 9】 And, In the formula, R 1 is -OH, and R 2 is 1-hydroxypropyl or hydroxymethyl, or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof. A combination of pharmaceuticals according to any one of claims 1 to 70.

74. The aforementioned TLR7 agonist, [(1S)-1-[(2S,4R,5R)-5-(5-amino-2-oxothiazolo[4,5-d]pyrimidine-3-yl)-4-hydroxytetrahydrofuran-2-yl]propyl]acetate (CMP number VI); 5-amino-3-[(2R,3R,5S)-3-hydroxy-5-[(1S)-1-hydroxypropyl]tetrahydrofuran-2-yl]-6H-thiazolo[4,5-d]pyrimidine-2,7-dione (CMP number VII); 5-amino-3-[(2R,3R,5S)-3-hydroxy-5-[(1S)-1-hydroxypropyl]tetrahydrofuran-2-yl]thiazolo[4,5-d]pyrimidine-2-one (CMP number VIII); 5-amino-3-(3'-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidine-2-one (CMP number IX); 5-amino-3-(2'-O-acetyl-3'-deoxy-β-D-ribofuranosyl)-3H-thiazolo[4,5-d]pyrimidine-2-one (CMP number X); 5-amino-3-(3'-deoxy-β-D-ribofuranosyl)-3H,6H-thiazolo[4,5-d]pyrimidine-2,7-dione (CMP number XI); [(S)-[(2S,5R)-5-(5-amino-2-oxo-thiazolo[4,5-d ]pyrimidine-3-yl)-1,3-oxathiolan-2-yl]cyclopropyl-methyl]acetate (CMP number XII); and (1S)-1-[(2S,5R)-5-(5-amino-2-oxo-thiazolo[4,5-d]pyrimidine-3-yl)-1,3-oxathiolan-2-yl]buta-2-inyl]acetate (CMP number XIII); Selected from the group consisting of, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof A combination of pharmaceuticals according to any one of claims 1 to 73.

75. The following combinations include RNAi oligonucleotides and TLR7 agonists: RNAi number 1 and CMP number VI; RNAi number 2 and CMP number VI; RNAi number 3 and CMP number VI; RNAi number 4 and CMP number VI; RNAi number 5 and CMP number VI; RNAi number 6 and CMP number VI; RNAi number 7 and CMP number VI; RNAi number 8 and CMP number VI; RNAi number 9 and CMP number VI; RNAi number 1 and CMP number VII; RNAi number 2 and CMP number VII; RNAi number 3 and CMP number VII; RNAi number 4 and CMP number VII; RNAi number 5 and CMP number VII; RNAi number 6 and CMP number VII; RNAi number 7 and CMP number VII; RNAi number 8 and CMP number VII; RNAi number 9 and CMP number VII; RNAi number 1 and CMP number VIII; RNAi number 2 and CMP number VIII; RNAi number 3 and CMP number VIII; RNAi number 4 and CMP number VIII; RNAi number 5 and CMP number VIII; RNAi number 6 and CMP number VIII; RNAi number 7 and CMP number VIII; RNAi number 8 and CMP number VIII; RNAi number 9 and CMP number VIII; RNAi number 1 and CMP number XIII; RNAi number 2 and CMP number XIII; RNAi number 3 and CMP number XIII; RNAi number 4 and CMP number XIII; RNAi number 5 and CMP number XIII; RNAi number 6 and CMP number XIII; RNAi number 7 and CMP number XIII; RNAi number 8 and CMP number XIII; RNAi number 9 and CMP number XIII; Selected from the group consisting of, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof, A combination of pharmaceuticals according to any one of claims 2 to 46 and 71 to 74.

76. The RNAi oligonucleotide is RNAi number 7, It is an oligonucleotide containing an antisense strand and a sense strand that forms a double-stranded region. The sense strand comprises the sequence described in GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC (SEQ ID NO: 41), which includes 2'-fluoromodified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methylmodified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36, and one phosphorothioate nucleotide bond between the nucleotides at positions 1 and 2, wherein each nucleotide of the -GAAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety, and the -GAAAA- sequence has the following structure: 【Chemistry 10】 Includes, The antisense chain is the sequence described in UUAUUGUGAGGAAUUUUUGUCGG (SEQ ID NO: 38), comprising a sequence including 2'-fluoromodified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O-methylmodified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22, and five phosphorothioate nucleotide interlinks between nucleotides 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense chain has the following structure: 【Chemistry 11】 It has, TLR7 agonist is CMP number VI: 【Chemistry 12】 is, or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof. A combination of pharmaceuticals according to any one of claims 2 to 46 and 71 to 74.

77. The following combinations include GalNAc conjugate antisense oligonucleotides and TLR7 agonists: CMP number 15_1 and VI, CMP number 15_2 and VI; CMP number 16_1 and VI; CMP number 20_1 and VI; CMP number 23_1 and VI; CMP number 26_1 and VI; CMP number 29_1 and VI; CMP number 15_1 and VII, CMP number 15_2 and VII; CMP number 16_1 and VII; CMP number 20_1 and VII; CMP number 23_1 and VII; CMP number 26_1 and V II; CMP numbers 29_1 and VII; CMP numbers 15_1 and VIII, CMP numbers 15_2 and VIII; CMP numbers 16_1 and VIII; CMP numbers 20_1 and VIII; CMP numbers 23_1 and VII; CMP numbers 26_1 and VIII; CMP numbers 29_1 and VIII; CMP numbers 15_1 and XIII, CMP numbers 15_2 and XIII; CMP numbers 16_1 and XIII; CMP numbers 20_1 and XIII; CMP numbers 23_1 and XIII; CMP numbers 26_1 and XIII; and CMP numbers 29_1 and XIII Selected from the group consisting of, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof The pharmaceutical combination according to any one of claims 47 to 74.

78. The GalNAc conjugate antisense oligonucleotide is CMP number 15_1 shown in Figure 5, and the TLR7 agonist is CMP number VI: 【Chemistry 13】 That is, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof The pharmaceutical combination according to any one of claims 47 to 74.

79. The pharmaceutical combination according to any one of claims 1 to 78, wherein the therapeutic oligonucleotide is formulated with a pharmaceutically acceptable salt.

80. The pharmaceutically acceptable salt is a metal cation, and preferably the pharmaceutically acceptable salt is Na + or K + The pharmaceutical combination according to claim 79.

81. The pharmaceutical combination according to any one of claims 1 to 80, wherein the therapeutic oligonucleotide and TLR7 agonist according to any one of claims 1 to 80 are formulated together with a pharmaceutically acceptable carrier.

82. The pharmaceutical combination according to claim 81, wherein the pharmaceutically acceptable carrier is water.

83. The pharmaceutical combination according to any one of claims 1 to 82, wherein the therapeutic oligonucleotide is formulated in phosphate-buffered saline.

84. The pharmaceutical combination according to any one of claims 1 to 83, wherein the therapeutic oligonucleotide is formulated for subcutaneous injection and the TLR7 agonist is formulated for oral administration.

85. The pharmaceutical combination according to any one of claims 1 to 83, wherein the therapeutic oligonucleotide is formulated for intravenous injection and the TLR7 agonist is formulated for oral administration.

86. The pharmaceutical combination according to any one of claims 2 to 46, 75, 76, and 79 to 83, wherein the therapeutic oligonucleotide is an siRNA formulated for subcutaneous injection, and the TLR7 agonist is formulated for oral administration.

87. A pharmaceutical combination according to any one of claims 1 to 86, comprising an RNAi oligonucleotide and a TLR7 agonist, and further comprising a CpAM (core protein allosteric modulator).

88. The aforementioned CpAM is the compound shown below (CpAM1): 【Chemistry 14】 The formula is as follows: During the ceremony, R 1 is hydrogen, halogen or C 1-6 It is alkyl, R 2 is hydrogen or halogen, R 3 is hydrogen or halogen, R 4 is C 1-6 It is alkyl, R 5 is hydrogen, hydroxyl C 1-6 Alkyl, aminocarbonyl, C 1-6 It is an alkoxycarbonyl or carboxyl, R 6 is hydrogen, C 1-6 Alkoxycarbonyl or carboxy-C m H 2m - and X is a carbonyl or sulfonyl, Y is -CH 2 -, -O- or -N(R 7 ) - and In the formula, R 7 is hydrogen, C 1-6 Alkyl, Halo C 1-6 Alkyl, C 3-7 Cycloalkyl-C m H 2m -, C 1-6 Alkoxycarbonyl-C m H 2m -, -C t H 2t -COOH, -HALOC 1-6 Alkyl-COOH,-(C 1-6 Alkoxy) C 1-6 Alkyl-COOH, -C 1-6 Alkyl-O-C 1-6 Alkyl-COOH, -C 3-7 Cycloalkyl-C m H 2m -COOH, -C m H 2m -C 3-7 Cycloalkyl-COOH, hydroxy-C t H 2t -, carboxyspiro[3,3]heptyl or carboxyphenyl-C m H 2m -, carboxypyridinyl-C m H 2m - and W is -CH 2 -, -C(C 1-6 alkyl)- 2 -, -O- or carbonyl, and n is either 0 or 1, m is between 0 and 7. t is between 1 and 7. or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof, The pharmaceutical combination according to claim 87.

89. The aforementioned CpAM is compound (CpAM2) 【Chemistry 15】 is, or a pharmaceutically acceptable salt, enantiomer or diastereomer thereof. The pharmaceutical combination according to claim 87 or 88.

90. A pharmaceutical combination comprising an RNAi oligonucleotide, a TLR7 agonist, and a CpAM, wherein the RNAi oligonucleotide has RNAi number 7. It is an oligonucleotide containing an antisense strand and a sense strand that forms a double-stranded region. The sense strand is the sequence described in GACAAAAAUCCUCACAAUAAGCAGCCGAAGGCUGC (SEQ ID NO: 41), and includes 2'-fluoromodified nucleotides at positions 3, 8-10, 12, 13 and 17, 2'-O-methylmodified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26 and 31-36, and one phosphorothioate nucleotide bond between the nucleotides at positions 1 and 2. The sense strand contains, and each nucleotide of the -GAAAA- sequence is conjugated to a monovalent GalNac moiety, and the -GAAAA- sequence has the following structure: 【Chemistry 16】 Includes, The antisense chain is the sequence described in UUAUUGUGAGGAAUUUUUGUCGG (SEQ ID NO: 38), comprising a sequence including 2'-fluoromodified nucleotides at positions 2, 3, 5, 7, 8, 10, 12, 14, 16 and 19, 2'-O-methylmodified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18 and 20-22, and five phosphorothioate nucleotide interlinks between nucleotides 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22, wherein the 4'-carbon of the sugar of the 5'-nucleotide of the antisense chain has the following structure: 【Chemistry 17】 It has, The aforementioned TLR7 agonist is CMP number VI: [Chemistry 18] That is, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof; The aforementioned CpAM is compound (CpAM2): 【Chemistry 19】 That is, or a pharmaceutically acceptable salt, enantiomer, or diastereomer thereof Combinations of pharmaceuticals.

91. A pharmaceutical composition comprising the pharmaceutical combination described in any one of claims 1 to 90.

92. A kit of parts comprising a therapeutic oligonucleotide according to any one of claims 1 to 90, and a package insert containing instructions for administering a TLR7 agonist for treating hepatitis B virus infection.

93. The kit of parts according to claim 92, wherein the TLR7 agonist described in the attached document is the TLR7 agonist described in any one of claims 1 to 90.

94. The kit of parts according to claim 92 or 93, comprising a therapeutic oligonucleotide according to any one of claims 1 to 90 and a TLR7 agonist according to any one of claims 1 to 90.

95. The kit of parts according to any one of claims 91 to 94, wherein the therapeutic oligonucleotide is formulated for subcutaneous injection and the TLR7 agonist is formulated for oral administration.

96. The kit of parts according to any one of claims 92 to 95, wherein the accompanying document describes the treatment of chronic hepatitis B virus infection.

97. The pharmaceutical combination, composition, or kit according to any one of claims 1 to 96, wherein the therapeutic oligonucleotide is in the form of a transgene manipulated to express the oligonucleotide in a cell.

98. Use of a pharmaceutical combination, composition, or kit according to any one of claims 1 to 97 for treating hepatitis B virus infection.

99. The use according to claim 98, wherein the hepatitis B virus infection being treated is a chronic hepatitis B virus infection.

100. The use according to claim 98 or 99, wherein the therapeutic oligonucleotide and the TLR7 agonist are administered in a pharmaceutically effective amount.

101. The use according to any one of claims 98 to 100, wherein the therapeutic oligonucleotide is administered weekly and the TLR7 agonist is administered every other day.

102. The use according to any one of claims 98 to 101, wherein the therapeutic oligonucleotide is administered at a dose of 1 to 4 mg / kg pr. and the TLR7 agonist is administered at a dose of 150 to 170 mg pr.

103. The use according to any one of claims 98 to 102, comprising administering the therapeutic oligonucleotide for 48 weeks and administering 84 doses of a TLR7 agonist.

104. The use according to any one of claims 98 to 103, wherein the administration of the therapeutic oligonucleotide and the TLR7 agonist is initiated in the same week.

105. The use according to any one of claims 98 to 104, wherein the therapeutic oligonucleotide is in a dosage form for subcutaneous administration, and the TLR7 agonist is in a dosage form for oral administration.

106. The use according to any one of claims 98 to 105, wherein the dose of the therapeutic oligonucleotide is 100 to 150 mg / ml and the dose of the TLR7 agonist is 150 to 170 mg.

107. The use according to any one of claims 98 to 106, wherein the therapeutic oligonucleotide is administered in the absence of treatment with an RNAi oligonucleotide targeting a non-surface antigen encoding an HBV mRNA transcript.

108. The use according to any one of claims 98 to 107, wherein the subject is not administered an RNAi oligonucleotide that selectively targets HBxAg mRNA transcripts.

109. The use according to any one of claims 98 to 108, further comprising administering an effective amount of entecavir to the subject.

110. The use according to any one of claims 98 to 109, wherein the therapeutic oligonucleotide is delivered in the form of a transgene manipulated to express the oligonucleotide within a cell.

111. A pharmaceutical combination, composition, or kit according to any one of claims 1 to 97, for use in pharmaceuticals.

112. A pharmaceutical combination, composition, or kit according to any one of claims 1 to 97, for use in the treatment of hepatitis B virus infection.

113. The pharmaceutical combination, composition, or kit for use according to claim 111 or 112, wherein the hepatitis B virus infection to be treated is a chronic hepatitis B virus infection.

114. A pharmaceutical combination, composition, or kit for use according to any one of claims 111 to 113, wherein the therapeutic oligonucleotide and the TLR7 agonist are administered in a pharmaceutically effective amount.

115. A pharmaceutical combination, composition, or kit for use according to any one of claims 111 to 114, comprising administering the therapeutic oligonucleotide weekly and the TLR7 agonist every other day.

116. A pharmaceutical combination, composition, or kit for use according to any one of claims 111 to 115, comprising administering the therapeutic oligonucleotide at a dose of 1 to 4 mg / kg pr. and administering the TLR7 agonist at a dose of 150 to 170 mg pr.

117. A pharmaceutical combination, composition, or kit for use according to any one of claims 111 to 116, comprising administering the therapeutic oligonucleotide for 48 weeks and administering 84 doses of a TLR7 agonist.

118. A pharmaceutical combination, composition, or kit for use according to any one of claims 111 to 117, wherein administration of the therapeutic oligonucleotide and the TLR7 agonist is initiated in the same week.

119. A pharmaceutical combination, composition, or kit for use according to any one of claims 111 to 118, wherein the therapeutic oligonucleotide is in a dosage form for subcutaneous administration, and the TLR7 agonist is in a dosage form for oral administration.

120. A pharmaceutical combination, composition, or kit for use according to any one of claims 107 to 115, wherein the dose of the therapeutic oligonucleotide is 100 to 150 mg / ml and the dose of the TLR7 agonist is 150 to 170 mg.

121. A pharmaceutical combination, composition, or kit for use according to any one of claims 111 to 120, wherein the therapeutic oligonucleotide is administered in the absence of treatment with an RNAi oligonucleotide targeting a nonsurface antigen encoding an HBV mRNA transcript.

122. A pharmaceutical combination, composition, or kit for use according to any one of claims 111 to 121, wherein the subject is not administered an RNAi oligonucleotide that selectively targets HBxAg mRNA transcripts.

123. A pharmaceutical combination, composition, or kit for use according to any one of claims 111 to 122, further comprising administering an effective amount of entecavir to the subject.

124. The therapeutic oligonucleotide expresses itself within the cell. A pharmaceutical combination, composition, or kit for use according to any one of claims 111 to 123, delivered in the form of an engineered transgene.

125. Use of a therapeutic oligonucleotide in the manufacture of a first pharmaceutical product for treating hepatitis B virus infection, wherein the first pharmaceutical product is a therapeutic oligonucleotide according to any one of claims 1 to 97, the first pharmaceutical product is administered in combination with a second pharmaceutical product, and the second pharmaceutical product is a TLR7 agonist according to any one of claims 1 to 97.

126. Use of a pharmaceutical combination, composition, or kit according to any one of claims 1 to 97 in the manufacture of a pharmaceutical.

127. Use of a pharmaceutical combination, composition, or kit according to any one of claims 1 to 97 in the manufacture of a pharmaceutical for treating hepatitis B virus infection.

128. The use according to any one of claims 125 to 127, wherein the hepatitis B virus infection being treated is a chronic hepatitis B virus infection.

129. The use according to any one of claims 125 to 128, wherein the therapeutic oligonucleotide and the TLR7 agonist are administered in a pharmaceutically effective amount.

130. The use according to any one of claims 125 to 129, wherein the therapeutic oligonucleotide is administered weekly and the TLR7 agonist is administered every other day.

131. The use according to any one of claims 125 to 130, wherein the therapeutic oligonucleotide is administered at a dose of 1 to 4 mg / kg pr. and the TLR7 agonist is administered at a dose of 150 to 170 mg pr.

132. The use according to any one of claims 125 to 131, comprising administering the therapeutic oligonucleotide for 48 weeks and administering 84 doses of a TLR7 agonist.

133. The use according to any one of claims 125 to 132, wherein the administration of the therapeutic oligonucleotide and the TLR7 agonist is initiated in the same week.

134. The use according to any one of claims 125 to 133, wherein the therapeutic oligonucleotide is in a dosage form for subcutaneous administration, and the TLR7 agonist is in a dosage form for oral administration.

135. The use according to any one of claims 125 to 134, wherein the dose of the therapeutic oligonucleotide is 100 to 150 mg / ml and the dose of the TLR7 agonist is 150 to 170 mg.

136. The use according to any one of claims 125 to 135, wherein the therapeutic oligonucleotide is administered in the absence of treatment with an RNAi oligonucleotide targeting a non-surface antigen encoding an HBV mRNA transcript.

137. The use according to any one of claims 125 to 136, wherein the subject is not administered an RNAi oligonucleotide that selectively targets HBxAg mRNA transcripts.

138. The use according to any one of claims 125 to 137, further comprising administering an effective amount of entecavir to the subject.

139. The use according to any one of claims 125 to 138, wherein the therapeutic oligonucleotide is delivered in the form of a transgene manipulated to express the oligonucleotide in a cell.

140. A method for treating hepatitis B virus infection, comprising administering to a subject infected with hepatitis B virus infection a therapeutically effective amount of a therapeutic oligonucleotide according to any one of claims 1 to 97 in combination with a therapeutically effective amount of a TLR7 agonist according to any one of claims 1 to 91 or 94 to 97.

141. A method for treating hepatitis B virus infection, comprising administering a therapeutically effective amount of a pharmaceutical combination, composition, or kit described in any one of claims 1 to 97 to a subject infected with hepatitis B virus infection.

142. The method according to claim 140 or 141, wherein the hepatitis B virus infection to be treated is a chronic hepatitis B virus infection.

143. The method according to any one of claims 140 to 142, wherein the therapeutic oligonucleotide and the TLR7 agonist are administered in a pharmaceutically effective amount.

144. The method according to any one of claims 140 to 143, comprising administering the therapeutic oligonucleotide weekly and administering the TLR7 agonist every other day.

145. The method according to any one of claims 140 to 144, wherein the therapeutic oligonucleotide is administered at a dose of 1 to 4 mg / kg pr. and the TLR7 agonist is administered at a dose of 150 to 170 mg pr.

146. The method according to any one of claims 140 to 145, comprising administering the therapeutic oligonucleotide for 48 weeks and administering 84 doses of a TLR7 agonist.

147. The method according to any one of claims 140 to 146, wherein the administration of the therapeutic oligonucleotide and the TLR7 agonist is initiated in the same week.

148. The method according to any one of claims 140 to 147, wherein the therapeutic oligonucleotide is in a dosage form for subcutaneous administration, and the TLR7 agonist is in a dosage form for oral administration.

149. The method according to any one of claims 140 to 148, wherein the dose of the therapeutic oligonucleotide is 100 to 150 mg / ml and the dose of the TLR7 agonist is 150 to 170 mg.

150. The method according to any one of claims 140 to 149, wherein the therapeutic oligonucleotide is administered in the absence of treatment with an RNAi oligonucleotide targeting a non-surface antigen encoding an HBV mRNA transcript.

151. The method according to any one of claims 140 to 150, wherein the subject is not administered an RNAi oligonucleotide that selectively targets HBxAg mRNA transcripts.

152. The method according to any one of claims 140 to 151, further comprising administering an effective amount of entecavir to the subject.

153. The method according to any one of claims 140 to 152, wherein the therapeutic oligonucleotide is delivered in the form of a transgene manipulated to express the oligonucleotide in a cell.

154. A method for reducing the expression of hepatitis B virus surface antigen in cells, comprising delivering a pharmaceutical combination or composition according to any one of claims 1 to 91 to the cells.

155. The method according to claim 154, wherein the cells are hepatocytes.

156. The method according to claim 154 or 155, wherein the cells are in vivo.

157. The method according to claim 154 or 155, wherein the cells are in vitro.

158. The method according to any one of claims 154 to 157, wherein the therapeutic oligonucleotide is delivered in the form of a transgene manipulated to express the oligonucleotide within the cell.

159. Pharmaceutical combinations, compositions, kits, uses, or methods substantially described herein with reference to the accompanying drawings.