Powdered exosomes isolated from bovine milk, nutritional compositions and methods

Abstract

The powdered exosomes isolated from bovine milk contain intact exosomes. The nutritional composition contains protein, carbohydrates, and / or fat, and exosomes isolated from bovine milk. A method for preparing the powdered exosomes includes centrifuging bovine milk to form a first precipitate of an upper lipid fraction, a middle whey fraction, and cells and cell debris; separating the whey fraction and centrifuging the separated whey fraction to further remove fat, casein aggregates, and cell debris to form a substantially clear whey fraction; microfiltering the substantially clear whey fraction to remove remaining cell debris; centrifuging the microfiltered whey fraction to obtain a precipitate containing exosomes; incubating the exosome-containing precipitate in an aqueous medium to dissolve the precipitate without disrupting the exosome membranes and provide an exosome suspension; and drying the suspension to obtain the powdered exosomes. A method for reducing the risk of developing or treating insulin resistance, prediabetes, or diabetes in a subject utilizes exosomes isolated from bovine milk.

Description

[Technical Field]

[0001] The present invention relates to powdered exosomes isolated from bovine milk, and to nutritional compositions comprising protein, carbohydrates, and / or fat, and exosomes isolated from bovine milk. The present invention also relates to methods for preparing the powdered exosomes isolated from bovine milk, methods for preparing the nutritional compositions, and methods for reducing the risk of developing or treating insulin resistance, prediabetes, or diabetes in a subject by administering the powdered exosomes or the powdered nutritional compositions. [Background technology]

[0002] Bovine milk contains exosomes, extracellular double-membrane vesicles. Bovine milk exosomes contain bioactive compounds known to play roles in health and disease regulation, including enzymatic and nonenzymatic proteins (e.g., CD9, CD63, MHC class II, lactadherin, TSG101, and Hsc70), nucleic acids (including abundant microRNAs (miRNAs) and messenger RNAs (mRNAs)), and lipids (e.g., phosphatidylethanolamine, phosphatidylserine, phosphatidylcholine, and sphingomyelin). Milk exosomes can be actively internalized by cells for delivery of their contents, but internalization requires the integrity of the milk exosome bilayer. Although the exosome structure protects bioactive compounds, known methods for isolating exosomes from milk can damage the exosome membrane, thereby impairing exosome internalization, resulting in the release of bioactive compounds and reduced bioactivity. For example, chemicals contained in exosomes, such as miRNAs and other bioactive compounds, are extremely unstable and degrade within seconds of exposure if the bilayer membrane is damaged. Similarly, processing of milk and / or isolated exosomes and / or long-term storage of isolated exosomes can damage the exosome membrane or reduce its biological activity. Therefore, improved isolation methods for bovine milk exosomes and exosomes with improved stability are desirable.

[0003] Insulin resistance, prediabetes, and diabetes are conditions of glucose dysregulation. Lifestyle modifications and insulin sensitizers are among the available treatment strategies, but these are often ineffective, and insulin therapy may be necessary. Dietary management can improve metabolic health and lead to weight loss. Long-term weight maintenance strategies, maintaining and improving muscle mass, and vitamin and mineral intake can improve quality of life. Unfortunately, in many cases, lifestyle modifications are not adequate to completely treat these conditions. Therefore, new compositions and methods for improving insulin sensitivity are needed. Summary of the Invention

[0004] In one embodiment, the present invention is directed to powdered exosomes isolated from bovine milk, comprising intact exosomes, i.e., exosomes with an intact bilayer membrane and whose contents are retained within the exosome.

[0005] In another embodiment, the present invention is directed to a nutritional composition comprising protein, carbohydrates, and / or fat, and exosomes isolated from bovine milk, wherein the exosomes are provided by adding the powdered exosomes of the present invention. In a specific embodiment, the nutritional composition is in powder form, while in another specific embodiment, the nutritional composition is in liquid form. In a further embodiment, the nutritional composition comprises protein, carbohydrates, fat, and exosomes isolated from bovine milk, wherein the exosomes are provided by adding the powdered exosomes of the present invention.

[0006] In another embodiment, the present invention is directed to a method for preparing powdered exosomes, comprising centrifuging bovine milk to form a top lipid fraction, a middle whey fraction, and a first precipitate of cells and cell debris; separating the whey fraction and centrifuging the separated whey fraction to further remove fat, casein aggregates, and cell debris to form a substantially clear whey fraction; microfiltering the substantially clear whey fraction to remove remaining cell debris; centrifuging the microfiltered whey fraction to obtain a precipitate containing exosomes; incubating the exosome-containing precipitate in an aqueous medium to dissolve the precipitate without disrupting the exosome bilayer membrane to provide an exosome suspension; and drying the suspension to obtain powdered exosomes.

[0007] In another embodiment, the present invention is directed to a method for preparing a powdered nutritional composition, the method comprising dry-mixing a powdered composition comprising protein, fat, and carbohydrates with powdered exosomes isolated from bovine milk.

[0008] In a further embodiment, the present invention is directed to a method for reducing the risk of developing insulin resistance, prediabetes, or diabetes in a subject, or treating insulin resistance, prediabetes, or diabetes in a subject, comprising administering to a subject at risk of developing or having insulin resistance, prediabetes, or diabetes the exosomes of the present invention or the nutritional composition of the present invention, wherein the exosomes are administered in an amount effective to reduce the risk of developing or treat insulin resistance, prediabetes, or diabetes, respectively.

[0009] The bovine milk-isolated exosomes of the present invention are advantageous in that they provide bioactive agents in an accessible, stable form, and in certain embodiments, in nutritional compositions, thereby facilitating the availability of therapeutically beneficial bioactive agents. These and other objects and advantages of the present invention will be more fully understood from the detailed description that follows.

[0010] The embodiments described in the drawings are illustrative of certain aspects of the invention and are intended to be exemplary in nature and not to limit the invention as defined in the claims. [Brief explanation of the drawings]

[0011] [Figures 1A-1I] Transmission electron microscope (TEM) images at 880x magnification (Figures 1A-1C), 10,000x magnification (Figures 1D-1F), and 25,000x magnification (Figures 1G-1I) are shown. Figures 1A, 1D, and 1G show fresh exosomes according to embodiments of the present invention, Figures 1B, 1E, and 1H show frozen-thawed exosomes, and Figures 1C, 1F, and 1I show powdered exosomes; all were stained with uranyl acetate as described in Example 1. [Figure 2A] 1 shows the relative expression of microRNAs (miRNAs) in fresh exosomes and powdered exosomes according to an embodiment of the present invention, as described in Example 1. [Figure 2B] 1 shows the content of multiple microRNAs (miRNAs) associated with insulin regulation in nutritional compositions comprising freeze-dried raw milk and freeze-dried powdered exosomes according to embodiments of the present invention, as described in Example 1. [Figure 3] FIG. 1 shows glucose uptake in muscle cells incubated with increasing concentrations of lyophilized or sonicated exosomes for 24 hours, as described in Example 2. [Figure 4]1 shows the levels of GLUT-4 transporter protein in muscle cells incubated for 24 hours with lyophilized or sonicated exosomes, respectively, as described in Example 2. [Figure 5] 1 shows GLUT-4 mRNA levels in muscle cells incubated for 24 hours with lyophilized or sonicated exosomes, respectively, as described in Example 2. [Figure 6] Figure 1 shows GLUT-4 gene promoter activity in muscle cells incubated with increasing concentrations of lyophilized or sonicated exosomes for 24 hours, as described in Example 2. DETAILED DESCRIPTION OF THE INVENTION

[0012] Specific embodiments of the present invention are described herein. However, because the present invention may be embodied in different forms, the present invention should not be construed as being limited to only the embodiments described herein. Rather, these embodiments are provided for the purpose of illustrating more specific features of certain aspects of the present invention to those skilled in the art.

[0013] The terminology used herein is for the purpose of describing embodiments only and should not be construed as limiting the disclosure as a whole. All references to singular features or limitations in this disclosure include the corresponding plural features or limitations, and vice versa, unless otherwise specified or clearly indicated otherwise by the context in which the reference is made. Unless otherwise expressly stated, the terms "a," "an," "the," and "at least one" are used synonymously. Furthermore, as used in the description herein and in the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0014] Whenever the term "includes" or "including" is used in the description or claims herein, it is intended to include additional elements or steps, just as the term "comprising" is interpreted when the term "comprising" is used as a transitional part of a claim. Furthermore, when the term "or" (e.g., A or B) is used, it is intended to mean "A or B, or both." When "A or B only, but not both" is intended, the phrase "A or B only, but not both" is used. Thus, the use of the term "or" herein is inclusive but not exclusive. When the terms "and" and "or" are used together, such as "A and / or B," it means A or B as well as A and B.

[0015] The powdered exosomes, nutritional compositions, and methods described herein may comprise, consist of, or consist essentially of any of the elements and steps described herein.

[0016] All ranges and parameters disclosed herein (including, but not limited to, percentages (%), portions, and ratios) should be understood to include any and all subranges subsumed therein, and all numbers between the endpoints. For example, reference to a range of "1 to 10" should be considered to include any and all subranges beginning with a minimum of 1 or greater and ending with a maximum of 10 or less (e.g., 1 to 6.1, or 2.3 to 9.4), as well as each integer subsumed within that range (1, 2, 3, 4, 5, 6, 7, 8, 9, and 10).

[0017] Any combination of method or process steps described herein can be performed in any order unless otherwise specified or unless the context in which the combination is mentioned clearly indicates otherwise.

[0018] Unless otherwise specified, all percentages are percentages by weight.

[0019] As used herein, the term "bovine milk-isolated exosomes," unless otherwise specified, refers to exosomes that have been substantially separated from other bovine milk components (e.g., lipids, cells, and cell debris) and concentrated to a greater amount than they would be in bovine milk. Milk exosomes are small, solid particles "dissolved" in bovine milk and account for a minor proportion of the total solids. Isolation of exosomes as described herein produces a liquid enriched in exosomes originally present in the milk. Notably, the powdered exosomes may also contain other milk solids (i.e., casein and other whey proteins) that are the same size as the milk exosomes and are co-isolated with the exosomes.

[0020] As used herein, the term "powdered exosomes," unless otherwise specified, refers to a dry powder containing exosomes isolated from bovine milk. The exosomes are dried to form a dry powder. Specific examples of isolated exosomes include lyophilization. As noted above, if the exosome-containing isolation liquid also contains co-isolated milk solids, the powdered exosomes will also contain such other milk solids in the resulting powder.

[0021] Importantly, the powdered exosomes of the present invention contain intact exosomes, which are those in which the bilayer membrane is intact and the exosomal contents are retained within the exosome.

[0022] As described above, milk contains exosomes containing bioactive substances that may improve health. More specifically, bovine milk contains multiple miRNAs that promote the healthy function of various organs, tissues, and systems, from muscle, bone, and fat to skin, brain, liver, gastrointestinal tract, and vasculature. However, factors such as miRNAs tend to degrade rapidly, resulting in the loss of such beneficial functions. While milk exosomes provide a protective environment for miRNAs, current techniques for isolating exosomes often damage the exosome membrane. In contrast, the present invention provides intact, isolated exosomes in powder form.

[0023] Generally, bovine milk-isolated powdered exosomes are obtained from bovine milk using mild treatments that do not disrupt the exosome bilayer, thereby leaving the exosomes intact and the bioactive substances contained within the exosome structure. In one embodiment, isolated and concentrated exosomes are provided in the form of a suspension, and the powdered exosomes are obtained by drying the suspension. Various methods can also be used to isolate exosomes, taking care not to disrupt the bilayer. Fresh bovine milk and / or thawed frozen bovine milk can be used as an exosome source. In certain embodiments, the step of isolating exosomes involves isolating the exosomes immediately after obtaining the milk from the bovine. In other embodiments, the step of isolating the exosomes involves isolating the exosomes within about 1 day, or within about 2 days, or within about 3 days, or within about 4 days, or within about 5 days, or within about 6 days, or within about 7 days after obtaining the milk from the bovine. In certain embodiments, exosomes are isolated within about 10 days or about 14 days after the milk is obtained from the cow. In other embodiments, the bovine milk may be frozen and then thawed for exosome isolation processing as described herein, preferably within about 1 day, or within about 2 days, or within about 3 days, or within about 4 days, or within about 5 days, or within about 6 days, or within about 7 days after the milk is obtained from the cow. The thawed milk is preferably processed immediately after thawing. In certain embodiments, fresh bovine milk is subjected to processing as described herein within about 5 days after the milk is obtained from the cow, or thawed bovine milk that is subjected to processing as described herein is thawed bovine milk that was frozen within about 5 days after the milk was obtained from the cow.

[0024] In one embodiment, exosomes are isolated from bovine milk by centrifuging the milk to form a top lipid fraction, a middle whey fraction, and a first precipitate of cells and cell debris. The whey fraction is separated from the lipid fraction and the first precipitate and further centrifuged to obtain a substantially clear whey fraction. For example, fat, casein aggregates, and cell debris are further removed to obtain a substantially clear whey fraction. The substantially clear whey fraction is then microfiltered to remove any remaining cell debris. The microfiltered whey fraction is then centrifuged again to obtain a second precipitate containing exosomes. This second precipitate is then suspended in an aqueous medium and dissolved without disrupting the exosome bilayer membranes contained therein, yielding an exosome suspension. It is important to suspend the second precipitate gently so as not to disrupt the exosome membranes. In a specific embodiment, the second precipitate is incubated in an aqueous medium such as sterile phosphate-buffered saline (PBS) or molecular biology grade sterile water for a long time, for example, at least 6 hours, at least 8 hours, at least 10 hours, or at least 12 hours, and up to 18 hours, 24 hours, 30 hours, or 36 hours or more.For example, a low-speed, i.e., gyratory shaker of 500 rpm or less may be used.Once the precipitate is completely suspended, the suspension is dried to obtain powdered exosomes.This drying process must also be carried out with care not to destroy the exosome bilayer membrane.In a specific embodiment, the drying process comprises lyophilization.

[0025] In certain embodiments of the present invention, exosome isolation involves centrifugation at a specific speed, time, and / or temperature. Although centrifugation can damage exosome membranes if performed at too high a force, centrifugation times and speeds as described herein isolate intact exosomes. In certain embodiments, bovine milk is centrifuged at a speed of less than about 15,000 G, e.g., about 12,000 G, for about 15 minutes at about 4°C to obtain a whey layer formed between an upper layer of fat (lipid) and cellular debris precipitate. In certain embodiments, this whey fraction is centrifuged two more times, again under conditions that maintain the exosomes in an intact form, e.g., each time at about 12,000 G and about 4°C for about 30 minutes, to further remove fat and / or cellular debris. A substantially clear whey fraction is obtained. The substantially clear whey fraction is microfiltered, for example, using a 0.22 μm filter made of a hydrophilic material (e.g., polyethersulfone with low protein retention), and the microfiltered whey is then centrifuged at 100,000 G at 4°C for about 60 minutes to form a precipitate containing exosomes. In certain embodiments, the exosome-containing precipitate is lysed by incubation on an orbital shaker for at least about 12 hours, or from about 12 to about 36 hours, or from about 15 to about 30 hours, or from about 18 to about 24 hours. This lysis is performed under conditions that maintain the intact form of the exosomes (i.e., the bilayer membrane is intact and the exosome contents are maintained within).

[0026] The exosomes are then dried under conditions that also maintain the exosomes in their intact form. In certain embodiments of the invention, the isolated exosomes are dried by lyophilization to form powdered exosomes under conditions that maintain the exosomes in their intact form. In certain embodiments of the invention, the lyophilization step involves exposing the exosome suspension to a temperature of -80°C and a vacuum of less than 0.3 mbar for a sufficient period of time. In certain embodiments, this period can vary from about 5 hours to about 40 hours, more specifically, from about 10 hours to about 30 hours, or from about 15 hours to about 25 hours, depending on the amount of liquid to be lyophilized and the nature of the lyophilization equipment. Importantly, this process must completely dry the exosomes. In certain embodiments, as illustrated in the Examples, the lyophilization period was 24 hours or longer at a temperature of -80°C and a vacuum of less than 0.3 mbar.

[0027] Another embodiment of the method involves variations in the time, temperature and pressure of lyophilization. In another embodiment of the method, milk exosomes are lyophilized by: maintained at a temperature of at least about -50°C, or at least about -60°C, or at least about -70°C, or at least about -80°C; maintaining a vacuum of less than about 0.3 millibars, or less than about 0.2 millibars, or less than about 0.1 millibars; and These conditions are maintained for at least about 5, 10, 15, 20, 25, 30, 35, or 40 hours.

[0028] Powdered exosomes produced by such methods contain intact exosomes, i.e., exosomes in which the bilayer membrane is not ruptured and / or degraded, and the exosomal contents are maintained intact. In certain embodiments, at least about 50 wt% of the exosomes in the powder are intact. In further embodiments, at least about 55, 60, 65, 70, 75, 80, 85, 90, or 95 wt% of the exosomes in the powder are intact. In certain embodiments, at least 50 wt% of the exosomes in the powder remain intact even after the composition is stored at 20°C for at least two months. In further embodiments, at least about 55, 60, 65, 70, 75, 80, 85, 90, or 95 wt% of the exosomes in the powder remain intact even after the composition is stored at 20°C for at least two months. Furthermore, in certain embodiments, powdered exosomes exhibit good stability at higher temperatures. For example, in certain embodiments, powdered exosomes isolated from bovine milk after three weeks of storage at 37°C contain higher amounts of miRNA than fresh milk exosomes stored at 37°C for three weeks, demonstrating that they are more resistant to membrane rupture and / or other degradation under such storage conditions compared to fresh milk exosomes. In another specific embodiment, powdered exosomes isolated from bovine milk after one week of storage at 55°C contain higher amounts of miRNA than fresh milk exosomes stored at 55°C for one week, further demonstrating that they are more resistant to membrane rupture and / or other degradation under such storage conditions compared to fresh milk exosomes. With respect to consumer distribution and consumption, this stability of powdered exosomes is a significant improvement in providing the benefits of the active agent(s) in the exosomes contained in the product.

[0029] In certain embodiments, greater than 90% of the isolated exosomes are between about 10 nanometers and about 250 nanometers in diameter, or between about 20 and 200 nm in diameter, or between about 50 and 150 nm in diameter.

[0030] The powdered exosomes of the present invention are particularly suitable for use as a component of nutritional compositions. The nutritional compositions may be in powdered or liquid form and may contain bovine milk-isolated exosomes provided by adding the powdered exosomes of the present invention as described herein. In one embodiment of the powdered nutritional composition, the powdered exosomes are dry-mixed with one or more dry ingredients of the nutritional composition. In another embodiment of the nutritional composition of the present invention, a liquid nutritional composition comprises a liquid reconstituted from a powdered nutritional composition as described herein. In another embodiment, the liquid nutritional composition is produced in a ready-to-drink form, e.g., an emulsion, containing the powdered exosomes in combination with one or more other nutritional composition components during the manufacturing process. Such compositions, in powder or liquid form, can be easily administered orally to obtain the benefits of the bioactive agent(s) in the exosomes.

[0031] Certain embodiments of the nutritional compositions described herein comprise protein, carbohydrate, and / or fat, and bovine milk-isolated exosomes, wherein the exosomes are provided by adding the powdered exosomes of the present invention. The bovine milk-isolated exosomes can be included in the nutritional composition in an effective amount as desired to provide a nutritional or therapeutic benefit. In certain embodiments, the nutritional composition comprises about 0.001 to about 10 wt% bovine milk-isolated exosomes, or more specifically, about 0.1 to about 5 wt% bovine milk-isolated exosomes, based on the weight of the composition.

[0032] A wide variety of sources and types of proteins, carbohydrates, and fats can be used in the embodiments of the nutritional compositions described herein.

[0033] In certain embodiments of the nutritional composition, the protein comprises about 1 wt% to about 30 wt% of the nutritional composition. In more specific embodiments, the protein comprises about 1 wt% to about 25 wt% of the nutritional composition, about 1 wt% to about 20 wt%, about 1 wt% to about 15 wt%, about 1 wt% to about 10 wt%, about 5 wt% to about 10 wt%, or about 10 wt% to about 20 wt% of the nutritional composition. In another specific embodiment, the protein comprises about 1 wt% to about 5 wt% of the nutritional composition. In further specific embodiments, the protein comprises about 20 wt% to about 30 wt% of the nutritional composition.

[0034] In certain embodiments, the nutritional compositions utilize one or more protein sources, including but not limited to, intact, hydrolyzed, and / or partially hydrolyzed proteins, which may be derived from suitable sources such as milk (e.g., casein, whey), animal (e.g., meat, fish), grain (e.g., rice, corn), vegetable (e.g., soy, pea), and combinations thereof. More specific examples of protein sources used in certain embodiments of the nutritional compositions include, but are not limited to, whey protein concentrate, whey protein isolate, whey protein hydrolysate, acid casein, sodium caseinate, calcium caseinate, potassium caseinate, casein hydrolysate, milk protein concentrate, milk protein isolate, milk protein hydrolysate, skim milk powder, concentrated skim milk powder, soy protein concentrate, soy protein isolate, soy protein hydrolysate, pea protein concentrate, pea protein isolate, pea protein hydrolysate, collagen protein, collagen protein isolate, rice protein, potato protein, earthworm protein, and / or insect protein, and combinations of two or more thereof. More specific embodiments include milk protein concentrate and / or soy protein isolate.

[0035] The protein source may also include mixtures of amino acids (often referred to as free amino acids) known for use in nutritional products, or combinations of such amino acids with the intact, hydrolyzed, and / or partially hydrolyzed proteins described herein, which may be naturally occurring or synthetic.

[0036] In certain embodiments, the nutritional composition contains β-hydroxy-β-methylbutyric acid (HMB). HMB is a natural short-chain fatty acid metabolite of leucine and is known for its use in various nutritional products and supplements. Any HMB source is suitable for the uses described herein, including, but not limited to, the free acid, salts, including anhydrous salts, esters, lactones, or other product forms that provide a bioavailable form of HMB in the nutritional composition. Non-limiting examples of HMB salts suitable for the uses described herein include hydrated or anhydrous sodium, potassium, magnesium, chromium, calcium, or other non-toxic salt forms of HMB. In certain embodiments, HMB is provided as calcium HMB monohydrate. In certain embodiments, the nutritional composition may contain about 0.01 to about 10 wt% HMB. In more specific embodiments, the nutritional composition contains about 0.1% to about 7.0%, or more specifically, about 0.1% to about 5.0% HMB. In further embodiments, the nutritional composition provides about 1-3 grams, or more specifically, about 1.5-3 grams, of HMB per 237 ml serving.

[0037] In certain embodiments of the nutritional composition, carbohydrates are present in the nutritional composition in an amount of about 5 wt% to about 75 wt%. In more specific embodiments, carbohydrates are present in the nutritional composition in an amount of about 5 wt% to about 70 wt% (including about 5 wt% to about 65 wt%, about 5 wt% to about 50 wt%, about 5 wt% to about 40 wt%, about 5 wt% to about 30 wt%, about 5 wt% to about 25 wt%, about 10 wt% to about 65 wt%, about 20 wt% to about 65 wt%, about 30 wt% to about 65 wt%, about 40 wt% to about 65 wt%, or about 15 wt% to about 25 wt%).

[0038] Carbohydrates used in particular embodiments of the nutritional compositions can be simple carbohydrates, complex carbohydrates, or combinations thereof. Non-limiting examples of suitable carbohydrate sources for use in particular embodiments of the nutritional compositions described herein include human milk oligosaccharides (HMOs), maltodextrin, hydrolyzed starch, glucose polymers, corn syrup, corn syrup solids, rice-derived carbohydrates, sucrose, glucose, lactose, honey, sugar alcohols, isomaltulose, sucromalt, pullulan, potato starch, galactooligosaccharides, oat fiber, soy fiber, corn fiber, gum arabic, sodium carboxymethylcellulose, and methylcellulose. , guar gum, gellan gum, locust bean gum, konjac flour, hydroxypropyl methylcellulose, tragacanth gum, karaya gum, acacia gum, chitosan, arabinogalactans, glucomannan, xanthan gum, alginic acid, pectin, low methoxy pectin, high methoxy pectin, cereal beta-glucans, carrageenan, psyllium, digestion-resistant carbohydrates (such as digestion-resistant maltodextrins, digestion-resistant starch, slowly digestible carbohydrates), inulin, fructooligosaccharides, and combinations of two or more thereof.

[0039] In certain embodiments, the nutritional composition comprises fat in an amount of about 0.5% to about 30% by weight of the nutritional composition. In certain embodiments, fat comprises about 1% to about 30% by weight of the nutritional composition (including about 1% to about 20% by weight, about 1% to about 15% by weight, about 1% to about 10% by weight, about 1% to about 5% by weight, about 3% to about 30% by weight, about 5% to about 30% by weight, about 5% to about 25% by weight, about 5% to about 20% by weight, about 5% to about 10% by weight, or about 10% to about 20% by weight of the nutritional composition).

[0040] In certain embodiments, the fat of the nutritional composition is selected from the group consisting of coconut oil, fractionated coconut oil, soybean oil (e.g., high oleic soybean oil), corn oil, olive oil, safflower oil (e.g., high oleic safflower oil), medium chain triglyceride oils (MCT oils), high gamma linolenic (GLA) safflower oil, sunflower oil (e.g., high oleic sunflower oil), palm oil, palm kernel oil, palm olein, canola oil (e.g., high oleic canola oil), marine oil, fish oil (e.g., tuna oil), algae oil, borage oil, cottonseed oil, fungal oil, eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), arachidonic acid (ARA), conjugated linoleic acid (CLA), alpha-linolenic acid, interesterified oils, and the like. The fat source may include one or more of the following: fatty acids, such as glycerides, sorbitol, sorbitol, sorbitol-based fatty acids ... More specific embodiments include canola oil, high oleic sunflower oil, medium chain triglycerides and / or one or more fatty acids such as linoleic acid, alpha-linolenic acid, ARA, EPA, and / or DHA.

[0041] Another specific embodiment of the nutritional composition includes one or more ingredients that improve the physical, chemical, aesthetic, or processing characteristics of the nutritional composition or that act as additional nutritional ingredients. Non-limiting examples of additional ingredients include preservatives, emulsifiers (e.g., lecithin), buffers, sweeteners, including artificial sweeteners (e.g., saccharin, aspartame, acesulfame K, sucralose), colorants, flavors, thickeners, stabilizers, etc.

[0042] Certain embodiments of the nutritional compositions optionally include one or more prebiotics and / or probiotics. The term "prebiotic," as used herein, unless otherwise specified, refers to a non-digestible food ingredient that provides a beneficial effect to a subject by selectively stimulating the growth and / or activity of bacteria in the subject's gastrointestinal (GI) tract. Non-digestible fermentable polysaccharides are examples of prebiotics that can be included in the nutritional compositions described herein. The term "probiotic," as used herein, unless otherwise specified, refers to microorganisms such as bacteria or yeast that survive the digestive process and provide health benefits to the host. Examples of probiotics that can be included in the nutritional compositions described herein include any one of the following, alone or in combination: Bifidobacterium breve (B. breve) M-16V, Bifidobacterium infantis (Bb02), Bifidobacterium infantis (B. infantis) M-63, Bifidobacterium infantis (B. infantis) 35624, Bifidobacterium lactis (B. lactis) HN019, Bifidobacterium lactis (B. lactis) Bi07, Bifidobacterium bifidum (B. bifidum), Bifidobacterium longum (B. longum) BB536, Bifidobacterium longum (B. longum) AH1205, Bifidobacterium longum (B. longum) AH1206, and Bifidobacterium animalis (B. Bifidobacterium (B.) such as Lactobacillus animalis; and Lactobacillus (L.) such as Lactobacillus rhamnosus GG, Lactobacillus rhamnosus HN001, Lactobacillus acidophilus (LA-5), Lactobacillus acidophilus NCFM, Lactobacillus fermentum CECT5716, Lactobacillus reuteri ATCC55730, Lactobacillus reuteri ATCC PTA-6475, and Lactobacillus reuteri DSM 17938; Streptococcus thermophilus thermophilus (Th4), Akkermansia, Bacteroides, Enterococcus, Eubacterium, Fecalibacterium, Roseburia, and / or Saccharomyces.

[0043] Certain embodiments of the nutritional compositions may include vitamins and / or related nutrients, non-limiting examples of which include vitamin A, vitamin B12, vitamin C, vitamin D, vitamin E, vitamin K, thiamine, riboflavin, pyridoxine, niacin, folic acid, pantothenic acid, biotin, choline, inositol, and / or salts and derivatives thereof, and combinations thereof.

[0044] Certain embodiments of the nutritional composition include minerals, non-limiting examples of which include calcium, phosphorus, magnesium, zinc, manganese, sodium, potassium, molybdenum, chromium, iron, copper, and / or chlorine, and combinations thereof.

[0045] Other specific embodiments of the nutritional compositions of the present invention include milk protein concentrate and / or soy protein isolate as the protein, canola oil, sunflower oil, medium-chain triglycerides and / or DHA as the fat, and hydrolyzed corn starch, sucrose and / or maltodextrin as the carbohydrate. In further specific embodiments, these nutritional compositions also include oligofructose, mixed tocopherols, and / or Lactobacillus acidophilus.

[0046] In another specific embodiment, the nutritional composition comprises: milk protein concentrate, sodium caseinate, calcium caseinate, and / or soy protein isolate as protein; corn syrup, corn maltodextrin, and / or sugar as carbohydrate; and corn oil and / or canola oil as fat. In another specific embodiment, the nutritional composition comprises: milk protein concentrate as protein; corn maltodextrin, fructose, and / or glycerin as carbohydrate; and high oleic safflower oil as fat.

[0047] In certain embodiments, when the nutritional composition is in liquid form, e.g., reconstituted from a powder as described herein or manufactured as a ready-to-drink product, the serving size ranges from about 1 ml to about 500 ml (including about 110 ml to about 500 ml, about 110 ml to about 417 ml, about 120 ml to about 500 ml, about 120 ml to about 417 ml, about 177 ml to about 417 ml, about 207 ml to about 296 ml, about 230 ml to about 245 ml, about 110 ml to about 237 ml, about 120 ml to about 245 ml, about 110 ml to about 150 ml, and about 120 ml to about 150 ml). In certain embodiments, the serving size is about 1 ml, or about 100 ml, or about 225 ml, or about 237 ml, or about 500 ml.

[0048] In certain embodiments, when the nutritional composition is a powder, for example, the serving weight is about 40 g to about 60 g (e.g., 45 g, or 48.6 g, or 50 g) administered as a powder or reconstituted as about 1 ml to about 500 ml (e.g., about 225 ml, or about 230 ml to about 245 ml) of liquid.

[0049] In certain embodiments, the nutritional composition provides up to about 500 kcal of energy per serving of the nutritional composition (including from about 20 kcal to about 500 kcal, from about 75 kcal to about 500 kcal, from about 150 kcal to about 500 kcal, from about 250 kcal to about 500 kcal, from about 300 kcal to about 500 kcal, or from about 400 kcal to about 500 kcal per serving of the nutritional composition).

[0050] In certain embodiments, the nutritional composition has a caloric density of about 0.5 kcal / ml to about 3 kcal / ml. In certain embodiments, the nutritional composition has a caloric density of about 0.5 kcal / ml to about 2.5 kcal / ml (including about 0.5 kcal / ml to about 2 kcal / ml, about 0.5 kcal / ml to about 1.5 kcal / ml, about 0.5 kcal / ml to about 1 kcal / ml, or about 0.5 kcal / ml to about 0.8 kcal / ml). In certain embodiments, the nutritional composition has a caloric density of about 1 kcal / ml to about 3 kcal / ml (including about 1.5 kcal / ml to about 3 kcal / ml, about 2 kcal / ml to about 3 kcal / ml, or about 2.5 kcal / ml to about 3 kcal / ml).

[0051] In certain embodiments, the nutritional composition has a caloric density of about 1 kcal / g to about 10 kcal / g, such as about 4.6 kcal / g. In certain embodiments, the nutritional composition has a caloric density of about 2 kcal / g to about 8 kcal / g, or about 3 kcal / g to about 6 kcal / g.

[0052] In certain embodiments, the nutritional composition is in liquid form, is reconstituted from a powdered nutritional composition, and has a pH of about 3 to about 9, or about 6 to about 8.

[0053] In certain embodiments of the methods described herein, a shelf-stable powdered nutritional composition is prepared by dry-mixing the powdered exosomes with a powder comprising one or more of protein, fat, and carbohydrate to form the powdered nutritional composition, which may be administered in powder form or may be reconstituted with an aqueous liquid to form a liquid nutritional composition.

[0054] Because exosomes in powdered form are intact, the exosomes and compositions containing the powdered exosomes are suitable for applications that provide nutritional or therapeutic benefits due to the bioactive substances contained in the exosomes (including various miRNAs contained in intact exosomes). In certain embodiments, the powdered exosomes and compositions containing the powdered exosomes are suitable for applications that reduce the risk of and / or treat insulin resistance, prediabetes, or diabetes. Risk factors for developing insulin resistance, prediabetes, or diabetes include being overweight, being physically inactive or exercising less than three times a week, having previously had gestational diabetes, or having an immune disorder. Subjects with insulin resistance, prediabetes, or diabetes often also have obesity, hypertension, dyslipidemia, and / or sarcopenia (muscle wasting).

[0055] In certain embodiments of the methods described herein, the nutritional composition is administered orally or by tube feeding. In certain embodiments, when the administration is by tube feeding, the tube feeding is performed by injecting into the subject's nose or directly into the subject's stomach or small intestine through an incision in the subject's abdomen.

[0056] In certain embodiments, a method for reducing the risk of, or treating, insulin resistance, prediabetes, or diabetes comprises administering to a subject bovine milk isolated powdered exosomes as described herein or a nutritional composition supplemented with bovine milk isolated powdered exosomes as described herein. The nutritional composition may be administered in powder or liquid form, as desired. In certain embodiments, the bovine milk isolated powdered exosomes or the nutritional composition supplemented with bovine milk isolated powdered exosomes as described herein are administered to a subject one or more times daily or weekly. In certain embodiments, the nutritional composition is administered to a subject about once to about six times per day or week, or about once to about five times per day or week, or about once to about four times per day or week, or about once to about three times per day or week.

[0057] In certain embodiments, the powdered exosomes of the present invention are administered directly or by addition to a nutritional composition in an amount effective to reduce the risk of one or more of insulin resistance, prediabetes, and / or diabetes in a subject at risk of developing such conditions. In another specific embodiment, the powdered exosomes of the present invention are administered directly or by addition to a nutritional composition in an amount effective to treat one or more of insulin resistance, prediabetes, and / or diabetes in a subject diagnosed with such conditions. In certain embodiments of the methods described herein, a dose of about 0.01 to about 10 g of powdered exosomes is administered to a subject directly or by addition to a nutritional composition. In other embodiments, a dose of about 0.1 to about 10 g, or about 1 to about 5 g of powdered exosomes is administered to a subject directly or by addition to a nutritional composition.

[0058] The following examples illustrate various aspects of the present invention.

[0059] Example Example 1: Preparation of powdered exosomes This example describes the preparation of powdered exosomes and powdered nutritional compositions containing exosomes. Exosomes were isolated from bovine milk and then dried. The following process was used to isolate exosomes from bovine milk: Untreated raw bovine milk was aliquoted and immediately frozen at -80°C. The aliquots were thawed on ice and centrifuged initially at approximately 12,000 G at approximately 4°C for approximately 15 minutes to obtain a whey layer between the upper layer of fat (lipids) and the cell debris precipitate. The whey fraction was transferred to a clean tube and centrifuged twice more, each time at approximately 12,000 G at approximately 4°C for approximately 30 minutes, under conditions that maintained the intact morphology of exosomes and further removed fat and cell debris. A substantially clear whey fraction was obtained. This substantially clear whey fraction was microfiltered using a 0.22 μm hydrophilic polyethersulfone filter. The microfiltered whey was then centrifuged at 100,000 xg for approximately 60 minutes at 4°C to obtain a pellet containing exosomes. The exosome-containing pellet was suspended in sterile PBS (137 mM NaCl, 2.7 mM KCl, 8 mM Na2HP04, and 2 mM KH2P04; pH 7.4) or molecular biology-grade sterile water in a centrifuge tube and then incubated at 150 rpm for 12–36 hours at 4°C on an orbital shaker. Notably, without the orbital shaking step, clumping occurred, requiring vigorous pipetting to disaggregate the exosomes, which resulted in damage to the exosome bilayer.

[0060] The exosomes were first frozen at -80°C for at least 2 hours, and then lyophilized under conditions that maintained the exosomes in their intact form. Specifically, the lyophilization process involved subjecting the frozen exosomes to a temperature of -80°C and a vacuum of less than 0.3 mbar for a sufficient time (approximately 24 hours) to achieve a low water content.

[0061] Importantly, thawing exosomes before the vacuum stage of lyophilization resulted in membrane damage to milk exosomes. Therefore, embodiments of the methods described herein include freezing milk exosomes and maintaining them frozen until lyophilization is complete, yielding powdered milk exosomes. The isolation and drying conditions described herein maintain the integrity of the exosome bilayer and the exosome content.

[0062] Milk exosome samples were visualized by TEM at 800x magnification (Figures 1A-1C), 10,000x magnification (Figures 1D-1F), and 25,000x magnification (Figures 1G-1I). For comparison, fresh milk exosomes (Figures 1A, 1D, and 1G), milk exosomes frozen at -80°C for 2 hours and thawed on ice (Figures 1B, 1E, and 1H), and lyophilized milk exosomes powdered according to certain embodiments of the present invention (Figures 1C, 1F, and 1I) were analyzed by TEM. To obtain TEM images, each sample was stained with uranyl acetate, an electron-dense compound. If the exosome membrane is damaged, uranyl acetate will penetrate and stain the internal compartment. As can be easily seen by comparing Figures 1G and 1I, the exosome structure (morphology, size, or membrane integrity) of powdered exosomes (Figure 1I) was not altered by lyophilization compared to fresh exosomes (Figure 1G). These images clearly show that membrane integrity was not lost, as uranyl acetate coats the exosomes, highlighting the outline of the vesicles with a dark shadow, while the interior of the vesicles remains light-colored. However, freezing and thawing exosomes severely damages the exosome membrane (Figure 1H), allowing uranyl acetate to penetrate the damaged membrane and stain the internal compartment of the exosomes. Thus, powdered exosomes provide a product in which the membrane structure of milk exosomes is preserved.

[0063] The lyophilized exosomes also retained miRNA. To analyze miRNA content, fresh milk exosomes and the powdered exosomes of the present invention were resuspended in sterile PBS, and 60 microliters of each sample was used for miRNA isolation and quantification. miRNA isolation was performed using a commercially available kit (Invitrogen™ mirVana™ miRNA Isolation Kit, reference number AM 1560) according to the manufacturer's protocol and technical recommendations. miRNA quantification was performed by microfluidic electrophoresis on an Agilent 2100 Bioanalyzer System using small RNA chips. Figure 2A shows the levels of miRNA-200c in fresh milk exosomes and powdered exosomes. This RNA (miRNA-200c) is abundant in bovine milk and is mostly present in the whey fraction, which contains exosomes. Regarding miRNA-200c levels, there was no statistical difference between the levels in fresh exosomes and those in powdered exosomes (p>0.05, ns in Figure 2A). The miRNA-200c levels in exosomes subjected to freeze / thaw are not shown due to the severe damage already recognized and shown in Figure 1H.

[0064] Furthermore, we measured the levels of specific miRNAs by adding lyophilized raw milk and the powdered exosomes of the present invention to liquid nutritional products. Specifically, 20 mg of lyophilized raw milk or the powdered exosomes of the present invention were added to 1 mL of commercially available PediaSure® TripleSure™ nutritional composition. The levels of miR-26a and miR-26b were analyzed. These miRNAs are particularly related to glucose metabolism. The results are shown in Figure 2B, which demonstrates that the levels of these miRNAs were increased in nutritional compositions supplemented with powdered exosomes. These results demonstrate that powdered exosomes are suitable for increasing miRNA levels in liquid nutritional products because they retain the structure and content of milk exosomes. Furthermore, the addition of powdered exosomes provides higher levels of miRNAs than the addition of lyophilized raw milk.

[0065] In further experiments, the thermal stability of the powdered exosomes of the present invention was evaluated. Both powdered exosomes prepared as described above and fresh milk exosomes were stored in vacuum-packaged containers at either 25°C, 37°C, or 55°C for four weeks. Samples were analyzed at 1, 2, 3, and 4 weeks and compared with their corresponding unheat-treated controls. The levels of a specific exosome-derived miRNA (miR-200c) in exosomes were measured. miRNAs are particularly sensitive to high temperatures and degradative enzymes. After confirming that the addition of sodium azide would not interfere with subsequent sample analysis or disrupt the milk exosome structure, fresh milk exosomes were treated with sodium azide (final concentration = 0.15% w / v) to prevent microbial growth during the experimental time course. Total small RNAs were extracted using the mirVana™ miRNA Isolation Kit according to the manufacturer's instructions. To monitor RNA extraction efficiency, an external control spike-in oligonucleotide (cel-miR-39, AGCUGAUUUCGUCUUGGUAAUA) was added during sample preparation. Additionally, cel-miR-39 was utilized to normalize for potential inter-sample and technical variations.

[0066] The results are shown in Table 1; the miRNAs contained in powdered exosomes were preserved regardless of the temperature tested. In contrast, when fresh milk exosomes were stored at 37°C and 55°C, the miR-200c levels were statistically reduced. The reduction was particularly pronounced at 55°C, where only small amounts of miR-200c were detected after 1 week and no miR-200c was detected after 2 weeks. This attenuation of the miR-200c signal may be due to exosome breakdown caused by heat damage.

[0067] [Table 1] Asterisks (*) indicate statistical significance relative to week 0 (p<0.05).

[0068] The results in Table 1 show that the powdered exosomes of the present invention exhibit good stability under high temperature conditions, making the powdered exosomes favorable for convenient oral administration either directly or by adding them to nutritional compositions.

[0069] Example 2: Treatment Results This example demonstrates that powdered exosomes, prepared as described above and shown to be intact, are taken up by muscle cells. This was demonstrated by labeling the exosomes with a red dye, incubating the exosomes with L6.C11 muscle cells, and observing the cells microscopically. A control, involving L6.C11 muscle cells incubated with BSA labeled with the same red dye, confirmed that the uptake was not promoted by the dye itself.

[0070] Powdered exosomes increased glucose uptake by muscle cells. Powdered exosomes were added to L6.C11 muscle cell cultures until milk exosome concentrations reached 0, 2.8, 5.6, and 14 μg / ml, respectively, and the cultures were incubated for 24 hours. Radiolabeled glucose uptake was then assessed. The results of these incubations are shown in Figure 3 (white bars). A concentration of 0 μg / ml (absence of exosomes) served as the control, with 100% glucose uptake. Powdered exosome concentrations of 5.6 and 14 μg / ml, respectively, resulted in statistically significant increases in glucose uptake by muscle cells compared to the control (p<0.05). A comparative experiment was also performed in which powdered exosomes were sonicated before incubation. The black bars in Figure 3 show the results of this comparative experiment. Sonication caused physical membrane disruption. In both cases, sonication disrupted the exosome membrane, negating the beneficial effects of powdered exosomes.

[0071] The increased glucose uptake was partially attributed to increased GLUT-4 transporter expression. In a separate experiment, powdered exosomes were added to L6.C11 muscle cell cultures at a concentration of 14 μg / ml and the cell cultures were incubated for 24 hours. Control cultures were treated with powdered exosomes at 14 μg / ml after sonication before addition to the cultures, as well as control cultures without powdered exosomes. Western blotting was used to assess GLUT-4 transporter protein expression. Glyceraldehyde-3-phosphate dehydrogenase (GADPH), one of the key enzymes involved in glycolysis, was used as a control for loading, and the relative intensity of expression (GLUT-4 / GADPH value) in the control culture (0 μg / ml) was set to 100%. The results are shown in Figure 4. GLUT-4 transporter expression was significantly increased in cultures containing powdered exosomes, with a statistically significant difference between control cultures and cultures containing powdered exosomes, and was also significantly different between cultures containing sonicated exosomes and cultures containing powdered exosomes, indicating that this effect was abolished by sonication.

[0072] Using the same experimental design, we evaluated whether powdered exosomes induce an increase in GLUT-4 RNA, as assessed by PCR, and whether powdered milk exosomes affect translation and protein levels. The results are shown in Figure 5. The normalized relative expression of GLUT-4 mRNA in cultures containing powdered exosomes was significantly stronger than that in control cultures, and there was a statistically significant difference between cultures containing powdered exosomes and control cultures. Sonication of exosomes appears to partially negate this favorable effect, although there is no statistically significant difference between cultures containing powdered exosomes and cultures containing sonicated exosomes.

[0073] Powdered milk exosomes also increase GLUT-4 promoter activity, leading to increased overall GLUT-4 expression in muscle cells and providing a mechanism for increasing overall glucose uptake by muscle cells. This was demonstrated in the following experiment. Muscle cells were transformed with the pGL3-GLUT-4 plasmid, which expresses luciferase (a fluorescent protein) under the control of the native GLUT-4 promoter. Cells were then incubated for 24 hours in the presence of 0, 2.8, 5.6, or 14 μg / ml powdered or sonicated exosomes. After the incubation period, fluorescence, which correlates with GLUT-4 promoter activity, was measured. The results are shown in Figure 6. The relative values ​​(Pgl3-glut4 / control reporter plasmid Prl-tk / GADPH) in control cultures (0 μg / ml) were set to 100%. Powdered exosomes at 14 μg / ml significantly increased GLUT-4 promoter activity, with a statistically significant difference between cultures containing powdered exosomes (14 μg / ml) and control cultures, and a statistically significant difference between cultures containing powdered exosomes (14 μg / ml) and the corresponding cultures containing sonicated exosomes.

[0074] In summary, the powdered exosomes of the present invention, prepared by gentle processing and drying without disrupting the milk exosome bilayer structure, are superior to isolated exosomes that have been subjected to freeze / thaw treatment, which damages the exosome membrane. Sonication also abolishes the beneficial effects of powdered exosomes on muscle cells. Preserving the exosome structure is important for achieving biological effects. Powdered milk exosomes are taken up by muscle cells and increase glucose uptake by muscle cells by promoting GLUT-4 gene transcription. Furthermore, increasing glucose uptake in muscle cells provides a method for improving glucose control and muscle function in insulin-resistant subjects through improved insulin sensitivity. Therefore, in certain embodiments, powdered milk exosomes and / or nutritional compositions containing powdered milk exosomes are administered to increase GLUT-4 transporter expression in the muscles of a subject. Furthermore, in certain embodiments, powdered exosomes and / or nutritional compositions supplemented with powdered exosomes are administered to a subject to reduce the risk of developing insulin resistance, prediabetes, or diabetes, or to treat insulin resistance, prediabetes, or diabetes in a subject.

[0075] The specific embodiments and examples described herein are for illustrative purposes only and are not intended to limit the invention as defined by the claims.

Claims

1. 1. A composition comprising bovine milk isolated powdered exosomes comprising intact exosomes, wherein at least 50 wt% of the bovine milk isolated powdered exosomes are intact in the composition.

2. The composition of claim 1, wherein the intact exosomes comprise miRNA.

3. 3. The composition of claim 2, wherein the powdered exosomes isolated from bovine milk after storage at 37°C for 3 weeks contain more miRNA than fresh milk exosomes stored at 37°C for 3 weeks.

4. 2. The composition of claim 1, wherein the powdered bovine milk isolated exosomes comprise lyophilized, intact exosomes.

5. 2. The composition of claim 1, wherein greater than 90% of the exosomes in the composition are between 10 nanometers and 250 nanometers in diameter.

6. 10. A nutritional composition comprising protein, carbohydrate, and / or fat, and bovine milk isolated exosomes, wherein the exosomes are provided by the addition of a composition according to any one of claims 1 to 5.

7. 7. The nutritional composition of claim 6, comprising 0.001 to 10 wt % of bovine milk isolated exosomes based on the weight of the nutritional composition.

8. 7. The nutritional composition of claim 6, wherein said protein comprises milk protein and / or soy protein.

9. 7. The nutritional composition of claim 6, wherein the carbohydrate comprises fiber.

10. 7. The nutritional composition of claim 6, wherein the fat comprises at least one omega-3 fatty acid.

11. 11. The nutritional composition of claim 10, wherein the at least one omega-3 fatty acid of the composition is selected from the group consisting of eicosapentaenoic acid, docosahexaenoic acid, arachidonic acid, and alpha-linolenic acid.

12. 7. The nutritional composition of claim 6, wherein the nutritional composition is in powder form.

13. 7. The nutritional composition of claim 6, wherein the nutritional composition is in liquid form.

14. Centrifuging bovine milk to form a top lipid fraction, a middle whey fraction, and a first sediment of cells and cell debris; separating the whey fraction and further removing fat, casein aggregates and cellular debris by centrifuging the separated whey fraction to form a substantially clear whey fraction; microfiltering the substantially clarified whey fraction to remove residual cellular debris; obtaining a precipitate containing exosomes by centrifuging the microfiltered whey fraction; by incubating the exosome-containing precipitate in an aqueous medium, dissolving the precipitate without disrupting the exosome membrane, to provide an exosome suspension; and obtaining the powdered exosomes by drying the suspension; 2. A composition comprising the powdered exosomes isolated from bovine milk of claim 1, obtained by a method comprising:

15. 14. A nutritional composition according to any one of claims 6 to 13, or a composition according to any one of claims 1 to 5, for reducing the risk of developing insulin resistance, pre-diabetes or diabetes in a subject, or for treating insulin resistance, pre-diabetes or diabetes in a subject.

16. 16. The nutritional composition or composition of claim 15, wherein the subject is obese or has sarcopenia (muscle wasting).

Images