Broad-spectrum neutralizing antibodies against tick-borne encephalitis viruses and related viruses

Broad-spectrum anti-TBEV antibodies targeting the EDIII domain of the TBEV envelope protein address the limitations of current vaccines by enhancing neutralization efficacy and providing therapeutic benefits.

JP7847872B2Active Publication Date: 2026-04-20THE ROCKEFELLER UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2023531568
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2020-11-25
Filing Date
2021-11-23
Publication Date
2026-04-20
Estimated Expiration
2041-11-23

AI Technical Summary

Technical Problem

Current vaccines for tick-borne encephalitis virus (TBEV) are not very effective, especially in young people and the elderly, and breakthrough infections occur despite vaccination, with no specific treatment available, leading to long-term complications.

Method used

Development of broad-spectrum neutralizing anti-TBEV antibodies or their antigen-binding fragments that target the lateral ridge of domain III (EDIII) of the TBEV envelope protein, offering improved neutralization efficacy against multiple strains and potential therapeutic applications.

Benefits of technology

The antibodies provide enhanced protection and treatment options for TBEV infections, potentially reducing the incidence of breakthrough infections and long-term complications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007847872000580
    Figure 0007847872000580
  • Figure 0007847872000581
    Figure 0007847872000581
  • Figure 0007847872000582
    Figure 0007847872000582
Patent Text Reader

Abstract

The present disclosure provides novel broadly neutralizing anti-tick-borne encephalitis virus (TBEV) antibodies. Anti-TBEV antibodies are induced by various tick-borne flaviviruses, including TBEV. These represent novel therapeutic strategies for preventing or treating the associated diseases or infections.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Description of Research Funded by the Federal Government This invention was made with government support under grant numbers P01-AI138398 and U19-AI111825 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0002] Cross-reference to Related Applications This application claims the benefit of U.S. Provisional Application No. 63 / 118,461, filed January 25, 2020, the entire disclosure of which is incorporated herein by reference.

[0003] The present invention relates to antibodies against epitopes of tick-borne flaviviruses, including tick-borne encephalitis virus (TBEV).

Background Art

[0004] Tick-borne flaviviruses are the cause of a series of emerging infectious diseases, including lethal encephalitis. Like other flaviviruses, the TBEV envelope (E) is composed of three structural domains, EDI~III. Tick-borne encephalitis virus (TBEV) is one of seven flaviviruses transmitted by ticks that cause human disease. More than 10,000 cases are reported annually, and in recent years, the incidence has increased and the disease has a tendency to appear in new geographical regions.

[0005] Infection by a tick bite or ingestion of unpasteurized milk from an infected animal causes a biphasic illness that begins with a period of influenza-like symptoms, followed by the onset of neurological disease (tick-borne encephalitis, i.e., TBE). There is no specific treatment for TBE, and Treatment is limited to supportive care. Long-term complications are common in surviving individuals. TB EV vaccines are available, but immunity requires regular booster immunizations, and vaccination is It is not very effective in young people and the elderly. Vaccination should be continued for up to two years. Three separate doses administered at intervals are required, and booster doses are recommended at intervals of 3 to 5 years. Furthermore, despite vaccination, a breakthrough TBEV infection occurs.

[0006] Therefore, diseases caused by tick-borne flaviviruses such as TBEV, This is an anti-TBEV antibody with improved neutralizing efficacy and range that is effective in preventing and treating infection. It is indeed strongly needed. [Overview of the project]

[0007] This disclosure provides a broad-spectrum neutralizing anti-TBEV antibody or its antigen-binding fragment, The above needs are addressed in several ways.

[0008] In one embodiment, the disclosure relates to an isolated anti-TBEV antibody that specifically binds to the TBEV antigen. or provides the antigen-binding fragment. In some embodiments, the TBEV antigen is E protein Includes the lateral ridge of domain III (EDIII) of the crystalline structure. In some embodiments, the antibody or its antigen-binding fragment neutralizes multiple TBEV strains. It is possible.

[0009] In some embodiments, the antibody or its antigen-binding fragment is (i) Table 2A-I, 3 and An amino acid sequence having at least 75% identity with one of the four selected from the above. (ii) A heavy chain variable region having, or selected from those in Tables 2A-I, 3 and 4 It includes a light chain variable region having an amino acid sequence with at least 75% identity with the other. In some cases, the antibody or its antigen-binding fragment is (i) Table 2A-I, 3 and 4 The three heavy chain CDRs (HCDR1-3) of the selected one, as well as / or (i i) Three light chain CDRs (LCDR1) selected from Tables 2A-I, 3 and 4 Includes ~3). In some embodiments, the antibody or its antigen-binding fragment is as shown in Tables 2A~I. Includes six CD-Rs, selected from items 3 and 4.

[0010] In some embodiments, the antibody or its antigen-binding fragment is sequence numbers 1, 3, 5, 7. 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35 ,37,39,41,43,45,47,49,51,53,55,57,59,61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 8 9, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111 , Three heavy chain complements of the heavy chain variable region having amino acid sequences 113, 115, or 117 Decision regions (HCDRs) (HCDR1, HCDR2, and HCDR3), and sequence numbers 2 and 4 , 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32 ,34,36,38,40,42,44,46,48,50,52,54,56,58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 8 6, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, Three light chain variable regions having amino acid sequences of 110, 112, 114, 116, or 118 It includes one light chain CDR (LCDR1, LCDR2, and LCDR3).

[0011] In some embodiments, the antibody or its antigen-binding fragment is sequence numbers 1, 3, 5, 7. 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35 ,37,39,41,43,45,47,49,51,53,55,57,59,61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 8 9, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111 , has at least 75% identity with the amino acid sequence of 113, 115, or 117 It has the amino acid sequence, or SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 4 3, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69 , 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115 or It has a heavy chain variable region with a sequence of 117 amino acids, and sequence numbers 2, 4, 6, 8, 10, 12 , 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 6 6, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92 , 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 11 4. Having at least 75% identity with the amino acid sequence of 116 or 118. It has a mino acid sequence, or sequence numbers 2, 4, 6, 8, 10, 12, 14, 16, 18 ,20,22,24,26,28,30,32,34,36,38,40,42,44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 7 2, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98 , 100, 102, 104, 106, 108, 110, 112, 114, 116 or It includes a light chain variable region having a sequence of 118 amino acids.

[0012] In some embodiments, the antibody or its antigen-binding fragment is represented by SEQ ID NOs. 1-2, 3-4. 5-6, 7-8, 9-10, 11-12, 13-14, 15-16, 17-18, 19- 20, 21-22, 23-24, 25-26, 27-28, 29-30, 31-32, 3 3-34, 35-36, 37-38, 39-40, 41-42, 43-44, 45-46 , 47-48, 49-50, 51-52, 53-54, 55-56, 57-58, 59- 60, 61-62, 63-64, 65-66, 67-68, 69-70, 71-72, 7 3-74, 75-76, 77-78, 79-80, 81-82, 83-84, 85-86 , 87-88, 89-90, 91-92, 93-94, 95-96, 97-98, 99- 100, 101-102, 103-104, 105-106, 107-108, 109- 110, 111-112, 113-114, 115-116, or 117-118 It includes heavy chain variable regions and light chain variable regions containing their respective amino acid sequences.

[0013] In some embodiments, the antibody is a polyvalent antibody, for example, a bivalent antibody or a bispecific antibody. In some embodiments, the antibody or its antigen-binding fragment is a mutant Fc constant region. The following are further included. In some embodiments, the antibody is a monoclonal antibody. In this embodiment, the antibody may be a chimeric antibody, a human antibody, a humanized antibody, or a humanized monoclonal antibody. It is an antibody. In some embodiments, the antibody is a single-chain antibody, a Fab fragment, or Fab2 It is a fragment.

[0014] In some embodiments, the antibody or its antigen-binding fragment is a toxin, therapeutic agent, polymer, or receptor. The substance, enzyme, or receptor ligand is detected by labeling or conjugation. In that embodiment, the polymer is polyethylene glycol (PEG).

[0015] In another aspect, the disclosure also relates to the above-mentioned antibody or its antigen-binding fragment, and optionally to pharmaceuticals. The present invention provides a pharmaceutical composition comprising a suitably permissible carrier or excipient.

[0016] In some embodiments, the pharmaceutical composition is one of the antibodies or antigen-binding fragments described above. It contains two or more. In some examples, each antibody or its antigen-binding fragment is (i) Table 2A~ I, 3 and 4 antibodies selected from HCDR1-3 and LCDR1-3, (ii) The amino acid sequences of each antibody selected from Tables 2A-I, 3 and 4 It includes heavy chain variable regions and light chain variable regions.

[0017] In some embodiments, two or more of the antibodies or their antigen-binding fragments are (1)( i) The amino acid sequences of the first antibody selected from Tables 2A-I, 3, and 4. A first antibody or its antigen-binding fragment containing a heavy chain variable region and a light chain variable region, (ii) Each amino acid of the second antibody selected from Tables 2A-I, 3 and 4 A second antibody or its antigen-binding fragment containing a heavy chain variable region and a light chain variable region containing a sequence. A first antibody set including, or (2)(a) Select from Tables 2A-I, 3 and 4. The third region includes the heavy chain variable region and the light chain variable region, each containing the amino acid sequence of the antibody. (b) an antibody or its antigen-binding fragment, and selected from (b) Tables 2A-I, 3 and 4 A fourth antibody comprising a heavy chain variable region and a light chain variable region, each containing the respective amino acid sequences of the antibody The second antibody set comprises the body or its antigen-binding fragment, and the third antibody comprises the fourth antibody It is different from the body.

[0018] In some embodiments, the pharmaceutical composition further comprises a second therapeutic agent. In some embodiments, the second therapeutic agent comprises an anti-inflammatory or antiviral agent. Antiviral agents include nucleoside analogs, peptoids, oligopeptides, and polypeptides. , protease inhibitors, 3C-like protease inhibitors, papain-like protease inhibitors, or include RNA-dependent RNA polymerase inhibitors. In some embodiments, antivirus Rus drugs include acyclovir, ganciclovir, vidarabine, foscarnet, cidofovir, Amantadine, ribavirin, trifluorothymidine, zidovudine, didanosine, zarusita It may contain bin or interferon. In some embodiments, interferon is It is either interferon-α or interferon-β.

[0019] Diagnosis, prevention, and treatment of conditions caused by tick-borne flavivirus (e.g., TBEV) infection. The use of the described pharmaceutical compositions in the preparation of pharmaceuticals for combinations thereof is also permitted. It is within the indicated range.

[0020] In another aspect, the Disclosure also relates to (i) the polypeptide of the antibody or its antigen-binding fragment (ii) a nucleic acid molecule encoding the dot chain, (ii) a vector containing the nucleic acid molecule described, and (ii i) Provide cultured host cells containing the vector described.

[0021] Furthermore, a method for producing polypeptides (e.g., anti-TBEV antibodies), as described in (a). (b) Obtain cultured host cells, (b) polypeptide encoded by the vector Under conditions that allow expression and aggregation of antibodies or their fragments, the cultured host in the culture medium (c) culturing chief cells, and (c) extracting antibodies from the cultured cells or cell culture medium. The method also includes purifying the fragments.

[0022] In another aspect, the present disclosure relates to the drugs of the above-mentioned antibodies or their antigen-binding fragments or pharmaceutical compositions. The kit provides a scientifically acceptable dose unit for tick-borne flavivirus in the target population. A kit for the diagnosis, prognosis, or treatment monitoring of s(e.g., TBEV) The antibody or its antigen-binding fragment described, and specifically the antibody or its antigen-binding fragment A kit comprising at least one binding detection reagent is also within the scope of this disclosure.

[0023] In yet another aspect, this disclosure relates to tick-borne encephalitis viruses (e.g., TBE) in the subject matter. A method for neutralizing V) is further provided. The method involves applying the above antibody to a target that requires it. Alternatively, administering a therapeutically effective amount of the antigen-binding fragment or a therapeutically effective amount of the pharmaceutical composition. include.

[0024] In some embodiments, tick-borne flaviviruses (e.g., TBEV) are present in the target. A method of neutralizing involves applying the first antibody of the above antibody or antigen-binding fragment to the target that requires it. Administer therapeutically effective doses of the body or its antigen-binding fragment and a second antibody or its antigen-binding fragment. The process includes the first antibody or its antigen-binding fragment and the second antibody or its antigen-binding fragment The combined fragment represents the synergistic activity or therapeutically effective amount of the above-mentioned pharmaceutical composition.

[0025] In yet another aspect, the disclosure relates to tick-borne flavivirus (e.g., TBEV) infection. Further, a method of prevention or treatment is provided. The method applies to subjects who require it, as described above. Administering a therapeutically effective amount of an antibody or its antigen-binding fragment, or a therapeutically effective amount of a pharmaceutical composition. This includes.

[0026] In some embodiments, the method applies the above-mentioned antibody or antigen to a target that requires it. The first antibody or its antigen-binding fragment and the second antibody or its antigen-binding fragment The treatment involves administering a therapeutically effective dose of a first antibody or its antigen-binding fragment and a second antibody The body or its antigen-binding fragment exhibits synergistic activity or a therapeutically effective amount of the above-mentioned pharmaceutical composition. In some embodiments, the first antibody or its antigen-binding fragment is a second antibody or its It is administered before, after, or simultaneously with the second antibody or its antigen-binding fragment. .

[0027] In some embodiments, a first antibody or its antigen-binding fragment and a second antibody or The antigen-binding fragment is selected from each of the antibodies listed in Tables 2A-I, 3, and 4. An antibody or its antigen-binding fragment containing a heavy chain variable region and a light chain variable region containing a mino acid sequence Any combination is possible.

[0028] In some embodiments, the second therapeutic agent includes an anti-inflammatory or antiviral agent. In some embodiments, the antiviral agent is a nucleoside analog, peptoid, or oligopeptide. Polypeptides, protease inhibitors, 3C-like protease inhibitors, papain-like protease inhibitors This includes ase inhibitors, or inhibitors of RNA-dependent RNA polymerase. Several implementations In terms of form, antiviral drugs include acyclovir, ganciclovir, vidarabine, and foscarnet. To, cidofovir, amantadine, ribavirin, trifluorothymidine, zidovudine, dida It may contain nosine, zalcitabine, or interferon. In some embodiments, Interferon is either interferon-α or interferon-β.

[0029] In some embodiments, the antibody or its antigen-binding fragment is a second therapeutic agent or therapeutic agent. It is administered before, after, or concurrently with a second therapeutic agent or treatment. In some embodiments, The antibody or its antigen-binding fragment is administered intravenously, subcutaneously, or intraperitoneally to the target. In several embodiments, the antibody or its antigen-binding fragment is administered prophylactically or therapeutically. .

[0030] In another aspect, the present disclosure relates to the presence of mite-borne flaviviruses (e.g., TBEV) in a sample. A method for detecting the presence of (i) a sample being brought into contact with the above antibody or its antigen-binding fragment (ii) the process of developing an antimicrobial agent for one or more tick-borne flavivirus (e.g., TBEV) antigens. The process includes determining the binding of a body or antigen-binding fragment, and comprises one or more tick-borne flaviviruses. The binding of antibodies to the antigen (for example, TBEV) indicates that the tick-borne flavivirus (e.g., The present invention further provides a method for indicating the presence of TBEV. In some embodiments, the sample is blood It is a liquid sample.

[0031] In some embodiments, the antibody or its antigen-binding fragment is conjugated to a label. In some embodiments, the detection step involves a secondary antibody being used to detect the antibody or its antigen-binding fragment. The secondary antibody includes contact with the secondary antibody, and the secondary antibody includes a label. In some embodiments, the label includes: This includes fluorescent labels, chemiluminescent labels, radioactive labels, and enzymes.

[0032] In some embodiments, the detection step includes detecting fluorescence or chemiluminescence. In some embodiments, the detection step includes a competitive binding assay or ELISA. .

[0033] In some embodiments, the method further includes bonding a sample to a solid support. In some embodiments, the solid support may contain microparticles, microbeads, magnetic beads, and It includes a biaffinity purification column.

[0034] The above summary is not intended to define all aspects of this disclosure, and additional information may be provided. The details of the configuration are described in other sections, such as the following detailed explanation. The entire document is unified. It is intended to be relevant as a disclosure, and the combination of features in the same sentence or paragraph of this document is intended to be relevant. Even if not found together in the same section, the special features described herein It should be understood that all combinations of the features are intended. Other features and advantages of the present invention are: This will become clear from the detailed explanation below. However, various aspects of the purpose and scope of this disclosure may differ. Any changes and modifications will be apparent to those skilled in the art from this detailed description, therefore, please refer to the detailed description and special The examples provided illustrate specific embodiments of this disclosure, but are given merely as illustrations. Please understand this. [Brief explanation of the drawing]

[0035] [Figure 1-1] Figures 1A, 1B, 1C, 1D, and 1E are a series of figures showing the results of screening individuals for TBEV antibodies. Figure 1A is a schematic diagram of the clinical course of tick-borne encephalitis. Approximate time of serum collection (yellow). Figure 1B shows the results of TBEV EDIII IgG ELISA. The graph shows optical density measurements (Y axis) compared to negative control serum for samples from 141 TBEV-infected individuals, 10 TBEV-vaccinated individuals, and 168 random blood donors (1:500 dilution). p-values ​​were calculated by one-way ANOVA followed by Tukey's test. The horizontal line shows the mean. Figure 1C shows the results of TBEV RVP neutralization screening. The graph shows ranked serum neutralizing activity (1:600,000 dilution) against TBEV reporter virus particles (RVP; mean of two wells) compared to a serum-free control. The orange box (bottom left) shows the 28 best antidotes out of 141 TBEV-infected individuals and 10 TBEV-vaccinated individuals tested. The p-values ​​are calculated using a two-sided Mann-Whitney U test. Figure 1D shows the TBEV RVP neutralization curves. The plots show representative neutralization curves for each of the 28 most potent serums from Figure 1C. Each is representative of two triplicate experiments. Error bars indicate standard deviation. Figure 1E shows the ranked maximum half-volume serum neutralizing titers (NT50) for the top 28 individuals. The mean of two independent experiments. In Figures 1D and 1E, orange indicates peripheral blood mononuclear cell donors for antibody cloning. [Figure 1-2]Figures 1A, 1B, 1C, 1D, and 1E are a series of figures showing the results of screening individuals for TBEV antibodies. Figure 1A is a schematic diagram of the clinical course of tick-borne encephalitis. Approximate time of serum collection (yellow). Figure 1B shows the results of TBEV EDIII IgG ELISA. The graph shows optical density measurements (Y axis) compared to negative control serum for samples from 141 TBEV-infected individuals, 10 TBEV-vaccinated individuals, and 168 random blood donors (1:500 dilution). p-values ​​were calculated by one-way ANOVA followed by Tukey's test. The horizontal line shows the mean. Figure 1C shows the results of TBEV RVP neutralization screening. The graph shows ranked serum neutralizing activity (1:600,000 dilution) against TBEV reporter virus particles (RVP; mean of two wells) compared to a serum-free control. The orange box (bottom left) shows the 28 best antidotes out of 141 TBEV-infected individuals and 10 TBEV-vaccinated individuals tested. The p-values ​​are calculated using a two-sided Mann-Whitney U test. Figure 1D shows the TBEV RVP neutralization curves. The plots show representative neutralization curves for each of the 28 most potent serums from Figure 1C. Each is representative of two triplicate experiments. Error bars indicate standard deviation. Figure 1E shows the ranked maximum half-volume serum neutralizing titers (NT50) for the top 28 individuals. The mean of two independent experiments. In Figures 1D and 1E, orange indicates peripheral blood mononuclear cell donors for antibody cloning. [Figure 1-3]Figures 1A, 1B, 1C, 1D, and 1E are a series of figures showing the results of screening individuals for TBEV antibodies. Figure 1A is a schematic diagram of the clinical course of tick-borne encephalitis. Approximate time of serum collection (yellow). Figure 1B shows the results of TBEV EDIII IgG ELISA. The graph shows optical density measurements (Y axis) compared to negative control serum for samples from 141 TBEV-infected individuals, 10 TBEV-vaccinated individuals, and 168 random blood donors (1:500 dilution). p-values ​​were calculated by one-way ANOVA followed by Tukey's test. The horizontal line shows the mean. Figure 1C shows the results of TBEV RVP neutralization screening. The graph shows ranked serum neutralizing activity (1:600,000 dilution) against TBEV reporter virus particles (RVP; mean of two wells) compared to a serum-free control. The orange box (bottom left) shows the 28 best antidotes out of 141 TBEV-infected individuals and 10 TBEV-vaccinated individuals tested. The p-values ​​are calculated using a two-sided Mann-Whitney U test. Figure 1D shows the TBEV RVP neutralization curves. The plots show representative neutralization curves for each of the 28 most potent serums from Figure 1C. Each is representative of two triplicate experiments. Error bars indicate standard deviation. Figure 1E shows the ranked maximum half-volume serum neutralizing titers (NT50) for the top 28 individuals. The mean of two independent experiments. In Figures 1D and 1E, orange indicates peripheral blood mononuclear cell donors for antibody cloning. [Figure 2-1]Figures 2A, 2B, 2C, 2D, 2E, 2F, 2G, 2H, 2I, 2J, 2K, 2L, 2M, 2N, and 2O are a series of figures showing clinical correlations and serum neutralization in vaccinated individuals. Figures 2A, 2B, 2C, 2D, 2E, and 2F show serum TBEV EDIII ELISA data (IgG) plotted against background factor information and available clinical information. Figures 2G, 2H, 2I, and 2L show serum TBEV RVP neutralization data plotted against background factor information and available clinical information. Figures 2C and 2I show disease severity. Figures 2D and 2J show IgM titers (IP) measured at admission. Figures 2E and 2K show IgG titers (Vienna units / mL) measured at admission. Statistical significance was calculated using a two-tailed p-test in Figures 2A, 2B, 2D, 2E, 2G, 2H, 2J, and 2K, the Mann-Whitney test in Figures 2L and 2F, and one-way ANOVA with Tukey's test in Figures 2C and 2I. Figure 2M shows the correlation between serum TBEV EDIII ELISA (IgG) and RVP neutralization data. Figure 2N shows the TBEV RVP neutralization curves from serum derived from vaccinated PBMC donors. Representatives from two experiments in triplicates. Mean with standard deviation. Figure 2O is a summary of serum NT50 for all infected and vaccinated PBMC donors. [Figure 2-2]Figures 2A, 2B, 2C, 2D, 2E, 2F, 2G, 2H, 2I, 2J, 2K, 2L, 2M, 2N, and 2O are a series of figures showing clinical correlations and serum neutralization in vaccinated individuals. Figures 2A, 2B, 2C, 2D, 2E, and 2F show serum TBEV EDIII ELISA data (IgG) plotted against background factor information and available clinical information. Figures 2G, 2H, 2I, and 2L show serum TBEV RVP neutralization data plotted against background factor information and available clinical information. Figures 2C and 2I show disease severity. Figures 2D and 2J show IgM titers (IP) measured at admission. Figures 2E and 2K show IgG titers (Vienna units / mL) measured at admission. Statistical significance was calculated using a two-tailed p-test in Figures 2A, 2B, 2D, 2E, 2G, 2H, 2J, and 2K, the Mann-Whitney test in Figures 2L and 2F, and one-way ANOVA with Tukey's test in Figures 2C and 2I. Figure 2M shows the correlation between serum TBEV EDIII ELISA (IgG) and RVP neutralization data. Figure 2N shows the TBEV RVP neutralization curves from serum derived from vaccinated PBMC donors. Representatives from two experiments in triplicates. Mean with standard deviation. Figure 2O is a summary of serum NT50 for all infected and vaccinated PBMC donors. [Figure 2-3]Figures 2A, 2B, 2C, 2D, 2E, 2F, 2G, 2H, 2I, 2J, 2K, 2L, 2M, 2N, and 2O are a series of figures showing clinical correlations and serum neutralization in vaccinated individuals. Figures 2A, 2B, 2C, 2D, 2E, and 2F show serum TBEV EDIII ELISA data (IgG) plotted against background factor information and available clinical information. Figures 2G, 2H, 2I, and 2L show serum TBEV RVP neutralization data plotted against background factor information and available clinical information. Figures 2C and 2I show disease severity. Figures 2D and 2J show IgM titers (IP) measured at admission. Figures 2E and 2K show IgG titers (Vienna units / mL) measured at admission. Statistical significance was calculated using a two-tailed p-test in Figures 2A, 2B, 2D, 2E, 2G, 2H, 2J, and 2K, the Mann-Whitney test in Figures 2L and 2F, and one-way ANOVA with Tukey's test in Figures 2C and 2I. Figure 2M shows the correlation between serum TBEV EDIII ELISA (IgG) and RVP neutralization data. Figure 2N shows the TBEV RVP neutralization curves from serum derived from vaccinated PBMC donors. Representatives from two experiments in triplicates. Mean with standard deviation. Figure 2O is a summary of serum NT50 for all infected and vaccinated PBMC donors. [Figure 3-1]Figures 3A, 3B, 3C, and 3D are a series of figures showing anti-TBEV antibodies obtained from infected and vaccinated individuals. Figure 3A shows the identification of TBEV-specific B cells from infected donors. Representative flow cytometry plots show B cells binding to AF647 and PE-labeled TBEV EDIII in one control and six TBEV-infected donors. The numbers indicate the percentage of double-positive B cells. The gating strategy is shown in Figure 4A. Figure 3B shows the clonal analysis of antibody sequences. The pie chart shows the distribution of antibody sequences. The number in the center represents the total number of antibody sequences obtained. Colored or gray sectors correspond to clone-related sequences, and the size of the sector is proportional to the number of sequences. All blue sectors are IGVH1-69, and all red sectors are IGVH3-48 / IGVK1-5. White sectors correspond to antibody sequences that are not part of a clone (singlet). Figures 3C and 3D are the same as Figures 3A and 3B, but for one healthy control and three vaccinated donors. Figure 3E shows the association of antibody sequences. The Circos plot shows sequences obtained from all donors, color-coded as in Figures 3B and 3D. Connecting lines indicate antibodies sharing the IGH V and J genes, as well as the IGL V and J genes. Purple, green, and gray lines connect related clones to each other, clones to singlets, and singlets to singlets, respectively. [Figure 3-2]Figures 3A, 3B, 3C, and 3D are a series of figures showing anti-TBEV antibodies obtained from infected and vaccinated individuals. Figure 3A shows the identification of TBEV-specific B cells from infected donors. Representative flow cytometry plots show B cells binding to AF647 and PE-labeled TBEV EDIII in one control and six TBEV-infected donors. The numbers indicate the percentage of double-positive B cells. The gating strategy is shown in Figure 4A. Figure 3B shows the clonal analysis of antibody sequences. The pie chart shows the distribution of antibody sequences. The number in the center represents the total number of antibody sequences obtained. Colored or gray sectors correspond to clone-related sequences, and the size of the sector is proportional to the number of sequences. All blue sectors are IGVH1-69, and all red sectors are IGVH3-48 / IGVK1-5. White sectors correspond to antibody sequences that are not part of a clone (singlet). Figures 3C and 3D are the same as Figures 3A and 3B, but for one healthy control and three vaccinated donors. Figure 3E shows the association of antibody sequences. The Circos plot shows sequences obtained from all donors, color-coded as in Figures 3B and 3D. Connecting lines indicate antibodies sharing the IGH V and J genes, as well as the IGL V and J genes. Purple, green, and gray lines connect related clones to each other, clones to singlets, and singlets to singlets, respectively. [Figure 4-1]Figures 4A, 4B, 4C, 4D, 4E, 4F, 4G, 4H, and 4I are a series of figures illustrating the sorting strategy and antibody sequence analysis. Figure 4A shows the sorting strategy. Single lymphocytes were gated using forward and side scattering. Dump channels contained CD3, CD8, CD14, CD16, and survival dyes. CD20+ B cells bound to TBEV EDIII bait, which did not bind to ovalbumin (OVA-) but bound to both PE and AF647 fluorophores, were purified. Figure 4B shows the number of somatic nucleotide mutations in the V gene (left) and the amino acid length of CDR3 (right) for each donor. Figure 4C is similar to Figure 4B but combines all donor cases. In Figures 4B and 4C, the horizontal line represents the mean. Figure 4 shows the distribution of hydrophobic GRAVY scores on IGH CDR3 for antibodies from all combined donors compared to the human repertoire (Briney, B., et al., (2019) Nature 566, 393-397). Figure 4E shows a bar graph showing the frequency of V heavy chain gene use in TBEV antibodies from infected donors compared to the human repertoire (Rubelt, F., et al., (2012) PLoS One 7, e49774). Figures 4F and 4G are similar to Figure 4E, but concern the Vκ and Vλ genes. In Figures 4E, 4F, and 4G, orange indicates anti-TBEV antibodies isolated in this study, and blue indicates the control repertoire. p-values ​​were calculated using a two-tailed t-test with unequal variances. Figure 4H shows the sequence logos of antibody CDR3 from infected donors generated by WebLogo. The height of the stack indicates sequence conservation at a given position, and the height of the letters within the stack indicates the relative frequency of each amino acid at that position. Figure 4I shows an example of extremely similar antibody sequences found across multiple donors. [Figure 4-2]Figures 4A, 4B, 4C, 4D, 4E, 4F, 4G, 4H, and 4I are a series of figures illustrating the sorting strategy and antibody sequence analysis. Figure 4A shows the sorting strategy. Single lymphocytes were gated using forward and side scattering. Dump channels contained CD3, CD8, CD14, CD16, and survival dyes. CD20+ B cells bound to TBEV EDIII bait, which did not bind to ovalbumin (OVA-) but bound to both PE and AF647 fluorophores, were purified. Figure 4B shows the number of somatic nucleotide mutations in the V gene (left) and the amino acid length of CDR3 (right) for each donor. Figure 4C is similar to Figure 4B but combines all donor cases. In Figures 4B and 4C, the horizontal line represents the mean. Figure 4 shows the distribution of hydrophobic GRAVY scores on IGH CDR3 for antibodies from all combined donors compared to the human repertoire (Briney, B., et al., (2019) Nature 566, 393-397). Figure 4E shows a bar graph showing the frequency of V heavy chain gene use in TBEV antibodies from infected donors compared to the human repertoire (Rubelt, F., et al., (2012) PLoS One 7, e49774). Figures 4F and 4G are similar to Figure 4E, but concern the Vκ and Vλ genes. In Figures 4E, 4F, and 4G, orange indicates anti-TBEV antibodies isolated in this study, and blue indicates the control repertoire. p-values ​​were calculated using a two-tailed t-test with unequal variances. Figure 4H shows the sequence logos of antibody CDR3 from infected donors generated by WebLogo. The height of the stack indicates sequence conservation at a given position, and the height of the letters within the stack indicates the relative frequency of each amino acid at that position. Figure 4I shows an example of extremely similar antibody sequences found across multiple donors. [Figure 4-3]Figures 4A, 4B, 4C, 4D, 4E, 4F, 4G, 4H, and 4I are a series of figures illustrating the sorting strategy and antibody sequence analysis. Figure 4A shows the sorting strategy. Single lymphocytes were gated using forward and side scattering. Dump channels contained CD3, CD8, CD14, CD16, and survival dyes. CD20+ B cells bound to TBEV EDIII bait, which did not bind to ovalbumin (OVA-) but bound to both PE and AF647 fluorophores, were purified. Figure 4B shows the number of somatic nucleotide mutations in the V gene (left) and the amino acid length of CDR3 (right) for each donor. Figure 4C is similar to Figure 4B but combines all donor cases. In Figures 4B and 4C, the horizontal line represents the mean. Figure 4 shows the distribution of hydrophobic GRAVY scores on IGH CDR3 for antibodies from all combined donors compared to the human repertoire (Briney, B., et al., (2019) Nature 566, 393-397). Figure 4E shows a bar graph showing the frequency of V heavy chain gene use in TBEV antibodies from infected donors compared to the human repertoire (Rubelt, F., et al., (2012) PLoS One 7, e49774). Figures 4F and 4G are similar to Figure 4E, but concern the Vκ and Vλ genes. In Figures 4E, 4F, and 4G, orange indicates anti-TBEV antibodies isolated in this study, and blue indicates the control repertoire. p-values ​​were calculated using a two-tailed t-test with unequal variances. Figure 4H shows the sequence logos of antibody CDR3 from infected donors generated by WebLogo. The height of the stack indicates sequence conservation at a given position, and the height of the letters within the stack indicates the relative frequency of each amino acid at that position. Figure 4I shows an example of extremely similar antibody sequences found across multiple donors. [Figure 4-4]Figures 4A, 4B, 4C, 4D, 4E, 4F, 4G, 4H, and 4I are a series of figures illustrating the sorting strategy and antibody sequence analysis. Figure 4A shows the sorting strategy. Single lymphocytes were gated using forward and side scattering. Dump channels contained CD3, CD8, CD14, CD16, and survival dyes. CD20+ B cells bound to TBEV EDIII bait, which did not bind to ovalbumin (OVA-) but bound to both PE and AF647 fluorophores, were purified. Figure 4B shows the number of somatic nucleotide mutations in the V gene (left) and the amino acid length of CDR3 (right) for each donor. Figure 4C is similar to Figure 4B but combines all donor cases. In Figures 4B and 4C, the horizontal line represents the mean. Figure 4 shows the distribution of hydrophobic GRAVY scores on IGH CDR3 for antibodies from all combined donors compared to the human repertoire (Briney, B., et al., (2019) Nature 566, 393-397). Figure 4E shows a bar graph showing the frequency of V heavy chain gene use in TBEV antibodies from infected donors compared to the human repertoire (Rubelt, F., et al., (2012) PLoS One 7, e49774). Figures 4F and 4G are similar to Figure 4E, but concern the Vκ and Vλ genes. In Figures 4E, 4F, and 4G, orange indicates anti-TBEV antibodies isolated in this study, and blue indicates the control repertoire. p-values ​​were calculated using a two-tailed t-test with unequal variances. Figure 4H shows the sequence logos of antibody CDR3 from infected donors generated by WebLogo. The height of the stack indicates sequence conservation at a given position, and the height of the letters within the stack indicates the relative frequency of each amino acid at that position. Figure 4I shows an example of extremely similar antibody sequences found across multiple donors. [Figure 4-5]Figures 4A, 4B, 4C, 4D, 4E, 4F, 4G, 4H, and 4I are a series of figures illustrating the sorting strategy and antibody sequence analysis. Figure 4A shows the sorting strategy. Single lymphocytes were gated using forward and side scattering. Dump channels contained CD3, CD8, CD14, CD16, and survival dyes. CD20+ B cells bound to TBEV EDIII bait, which did not bind to ovalbumin (OVA-) but bound to both PE and AF647 fluorophores, were purified. Figure 4B shows the number of somatic nucleotide mutations in the V gene (left) and the amino acid length of CDR3 (right) for each donor. Figure 4C is similar to Figure 4B but combines all donor cases. In Figures 4B and 4C, the horizontal line represents the mean. Figure 4 shows the distribution of hydrophobic GRAVY scores on IGH CDR3 for antibodies from all combined donors compared to the human repertoire (Briney, B., et al., (2019) Nature 566, 393-397). Figure 4E shows a bar graph showing the frequency of V heavy chain gene use in TBEV antibodies from infected donors compared to the human repertoire (Rubelt, F., et al., (2012) PLoS One 7, e49774). Figures 4F and 4G are similar to Figure 4E, but concern the Vκ and Vλ genes. In Figures 4E, 4F, and 4G, orange indicates anti-TBEV antibodies isolated in this study, and blue indicates the control repertoire. p-values ​​were calculated using a two-tailed t-test with unequal variances. Figure 4H shows the sequence logos of antibody CDR3 from infected donors generated by WebLogo. The height of the stack indicates sequence conservation at a given position, and the height of the letters within the stack indicates the relative frequency of each amino acid at that position. Figure 4I shows an example of extremely similar antibody sequences found across multiple donors. [Figure 4-6]Figures 4A, 4B, 4C, 4D, 4E, 4F, 4G, 4H, and 4I are a series of figures illustrating the sorting strategy and antibody sequence analysis. Figure 4A shows the sorting strategy. Single lymphocytes were gated using forward and side scattering. Dump channels contained CD3, CD8, CD14, CD16, and survival dyes. CD20+ B cells bound to TBEV EDIII bait, which did not bind to ovalbumin (OVA-) but bound to both PE and AF647 fluorophores, were purified. Figure 4B shows the number of somatic nucleotide mutations in the V gene (left) and the amino acid length of CDR3 (right) for each donor. Figure 4C is similar to Figure 4B but combines all donor cases. In Figures 4B and 4C, the horizontal line represents the mean. Figure 4 shows the distribution of hydrophobic GRAVY scores on IGH CDR3 for antibodies from all combined donors compared to the human repertoire (Briney, B., et al., (2019) Nature 566, 393-397). Figure 4E shows a bar graph showing the frequency of V heavy chain gene use in TBEV antibodies from infected donors compared to the human repertoire (Rubelt, F., et al., (2012) PLoS One 7, e49774). Figures 4F and 4G are similar to Figure 4E, but concern the Vκ and Vλ genes. In Figures 4E, 4F, and 4G, orange indicates anti-TBEV antibodies isolated in this study, and blue indicates the control repertoire. p-values ​​were calculated using a two-tailed t-test with unequal variances. Figure 4H shows the sequence logos of antibody CDR3 from infected donors generated by WebLogo. The height of the stack indicates sequence conservation at a given position, and the height of the letters within the stack indicates the relative frequency of each amino acid at that position. Figure 4I shows an example of extremely similar antibody sequences found across multiple donors. [Figure 4-7]Figures 4A, 4B, 4C, 4D, 4E, 4F, 4G, 4H, and 4I are a series of figures illustrating the sorting strategy and antibody sequence analysis. Figure 4A shows the sorting strategy. Single lymphocytes were gated using forward and side scattering. Dump channels contained CD3, CD8, CD14, CD16, and survival dyes. CD20+ B cells bound to TBEV EDIII bait, which did not bind to ovalbumin (OVA-) but bound to both PE and AF647 fluorophores, were purified. Figure 4B shows the number of somatic nucleotide mutations in the V gene (left) and the amino acid length of CDR3 (right) for each donor. Figure 4C is similar to Figure 4B but combines all donor cases. In Figures 4B and 4C, the horizontal line represents the mean. Figure 4 shows the distribution of hydrophobic GRAVY scores on IGH CDR3 for antibodies from all combined donors compared to the human repertoire (Briney, B., et al., (2019) Nature 566, 393-397). Figure 4E shows a bar graph showing the frequency of V heavy chain gene use in TBEV antibodies from infected donors compared to the human repertoire (Rubelt, F., et al., (2012) PLoS One 7, e49774). Figures 4F and 4G are similar to Figure 4E, but concern the Vκ and Vλ genes. In Figures 4E, 4F, and 4G, orange indicates anti-TBEV antibodies isolated in this study, and blue indicates the control repertoire. p-values ​​were calculated using a two-tailed t-test with unequal variances. Figure 4H shows the sequence logos of antibody CDR3 from infected donors generated by WebLogo. The height of the stack indicates sequence conservation at a given position, and the height of the letters within the stack indicates the relative frequency of each amino acid at that position. Figure 4I shows an example of extremely similar antibody sequences found across multiple donors. [Figure 4-8]Figures 4A, 4B, 4C, 4D, 4E, 4F, 4G, 4H, and 4I are a series of figures illustrating the sorting strategy and antibody sequence analysis. Figure 4A shows the sorting strategy. Single lymphocytes were gated using forward and side scattering. Dump channels contained CD3, CD8, CD14, CD16, and survival dyes. CD20+ B cells bound to TBEV EDIII bait, which did not bind to ovalbumin (OVA-) but bound to both PE and AF647 fluorophores, were purified. Figure 4B shows the number of somatic nucleotide mutations in the V gene (left) and the amino acid length of CDR3 (right) for each donor. Figure 4C is similar to Figure 4B but combines all donor cases. In Figures 4B and 4C, the horizontal line represents the mean. Figure 4 shows the distribution of hydrophobic GRAVY scores on IGH CDR3 for antibodies from all combined donors compared to the human repertoire (Briney, B., et al., (2019) Nature 566, 393-397). Figure 4E shows a bar graph showing the frequency of V heavy chain gene use in TBEV antibodies from infected donors compared to the human repertoire (Rubelt, F., et al., (2012) PLoS One 7, e49774). Figures 4F and 4G are similar to Figure 4E, but concern the Vκ and Vλ genes. In Figures 4E, 4F, and 4G, orange indicates anti-TBEV antibodies isolated in this study, and blue indicates the control repertoire. p-values ​​were calculated using a two-tailed t-test with unequal variances. Figure 4H shows the sequence logos of antibody CDR3 from infected donors generated by WebLogo. The height of the stack indicates sequence conservation at a given position, and the height of the letters within the stack indicates the relative frequency of each amino acid at that position. Figure 4I shows an example of extremely similar antibody sequences found across multiple donors. [Figure 4-9]Figures 4A, 4B, 4C, 4D, 4E, 4F, 4G, 4H, and 4I are a series of figures illustrating the sorting strategy and antibody sequence analysis. Figure 4A shows the sorting strategy. Single lymphocytes were gated using forward and side scattering. Dump channels contained CD3, CD8, CD14, CD16, and survival dyes. CD20+ B cells bound to TBEV EDIII bait, which did not bind to ovalbumin (OVA-) but bound to both PE and AF647 fluorophores, were purified. Figure 4B shows the number of somatic nucleotide mutations in the V gene (left) and the amino acid length of CDR3 (right) for each donor. Figure 4C is similar to Figure 4B but combines all donor cases. In Figures 4B and 4C, the horizontal line represents the mean. Figure 4 shows the distribution of hydrophobic GRAVY scores on IGH CDR3 for antibodies from all combined donors compared to the human repertoire (Briney, B., et al., (2019) Nature 566, 393-397). Figure 4E shows a bar graph showing the frequency of V heavy chain gene use in TBEV antibodies from infected donors compared to the human repertoire (Rubelt, F., et al., (2012) PLoS One 7, e49774). Figures 4F and 4G are similar to Figure 4E, but concern the Vκ and Vλ genes. In Figures 4E, 4F, and 4G, orange indicates anti-TBEV antibodies isolated in this study, and blue indicates the control repertoire. p-values ​​were calculated using a two-tailed t-test with unequal variances. Figure 4H shows the sequence logos of antibody CDR3 from infected donors generated by WebLogo. The height of the stack indicates sequence conservation at a given position, and the height of the letters within the stack indicates the relative frequency of each amino acid at that position. Figure 4I shows an example of extremely similar antibody sequences found across multiple donors. [Figure 5-1]Figures 5A, 5B, 5C, 5D, 5E, 5F, and 5G are a series of figures illustrating the identification of highly potent and broadly cross-reactive monoclonal antibodies. Figure 5A shows the TBEVWE EDIII ELISA binding curves for 46 and 13 monoclonal antibodies from infected and vaccinated individuals, respectively. The data are representative of two experiments. The dotted line represents the 10-1074 isotype control. Figure 5B shows a dot plot summarizing the EC50 values ​​of the antibodies from Figure 5A against three TBEV strains: TBEVWE, TBEVFE, and TBEVSI. The mean is shown for two experiments. The horizontal line represents the mean. Figure 5C shows the RVP neutralization curve of the antibodies from Figure 5A, normalized against a no-antibody control. The data are representative of two experiments, each performed in triplicate. Error bars represent the standard deviation. Figure 5D shows a dot plot summarizing the mean maximum half-volume inhibitory concentration (IC50) for TBEVWE RVP neutralization by antibodies in the mean of two experiments. The horizontal line represents the mean IC50. No statistically significant difference was observed by the two-sided Mann-Whitney U test. Figures 5E and 5F show TBEV neutralization in vitro. In Figure 5E, the curve represents viral neutralization by serially diluted antibodies. Representative images from two independent experiments performed in octavo. In Figure 5F, representative immunofluorescence microscopy images of PS cells infected in the presence of the indicated antibodies. Green represents viral antigens, and blue represents cell nuclei. The scale bar represents 200 μm. Figure 5G shows cross-neutralization by anti-TBEV antibodies. The graphs show the IC50 of selected antibodies against RVP corresponding to Poissant LB virus (POWV-LB), Poissant DTV virus (POWV-DTV), Kyasanur Forest Disease virus (KFDV), Langat virus (LGTV), Jumping Disease virus (LIV), and Omsk Hemorrhagic Fever virus (OHFV). The average of two independent experiments. The horizontal line indicates the mean IC50. In Figures 5A, 5B, 5C, 5D, and 5E, blue and red represent IGVH1-69 / κ antibodies and IGVH3-48 / IGVK1-5 antibodies from infected donors, and purple represents IGVH1-69 / κ antibodies from vaccinated individuals. Antibodies T036 and T025 are shown in yellow and orange, respectively.In Figures 5B, 5D, and 5G, the black circles and triangles correspond to antibodies derived from infected donors or vaccinated donors, respectively. [Figure 5-2]Figures 5A, 5B, 5C, 5D, 5E, 5F, and 5G are a series of figures illustrating the identification of highly potent and broadly cross-reactive monoclonal antibodies. Figure 5A shows the TBEVWE EDIII ELISA binding curves for 46 and 13 monoclonal antibodies from infected and vaccinated individuals, respectively. The data are representative of two experiments. The dotted line represents the 10-1074 isotype control. Figure 5B shows a dot plot summarizing the EC50 values ​​of the antibodies from Figure 5A against three TBEV strains: TBEVWE, TBEVFE, and TBEVSI. The mean is shown for two experiments. The horizontal line represents the mean. Figure 5C shows the RVP neutralization curve of the antibodies from Figure 5A, normalized against a no-antibody control. The data are representative of two experiments, each performed in triplicate. Error bars represent the standard deviation. Figure 5D shows a dot plot summarizing the mean maximum half-volume inhibitory concentration (IC50) for TBEVWE RVP neutralization by antibodies in the mean of two experiments. The horizontal line represents the mean IC50. No statistically significant difference was observed by the two-sided Mann-Whitney U test. Figures 5E and 5F show TBEV neutralization in vitro. In Figure 5E, the curve represents viral neutralization by serially diluted antibodies. Representative images from two independent experiments performed in octavo. In Figure 5F, representative immunofluorescence microscopy images of PS cells infected in the presence of the indicated antibodies. Green represents viral antigens, and blue represents cell nuclei. The scale bar represents 200 μm. Figure 5G shows cross-neutralization by anti-TBEV antibodies. The graphs show the IC50 of selected antibodies against RVP corresponding to Poissant LB virus (POWV-LB), Poissant DTV virus (POWV-DTV), Kyasanur Forest Disease virus (KFDV), Langat virus (LGTV), Jumping Disease virus (LIV), and Omsk Hemorrhagic Fever virus (OHFV). The average of two independent experiments. The horizontal line indicates the mean IC50. In Figures 5A, 5B, 5C, 5D, and 5E, blue and red represent IGVH1-69 / κ antibodies and IGVH3-48 / IGVK1-5 antibodies from infected donors, and purple represents IGVH1-69 / κ antibodies from vaccinated individuals. Antibodies T036 and T025 are shown in yellow and orange, respectively.In Figures 5B, 5D, and 5G, the black circles and triangles correspond to antibodies derived from infected donors or vaccinated donors, respectively. [Figure 6-1] Figures 6A, 6B, 6C, 6D, 6E, 6F, 6G, 6H, and 6I are a series of figures showing antibody binding and neutralization. Figure 6A shows ELISA binding curves for TBEVFE and TBEVSi EDIII for 59 antibodies. The data are representative of two experiments. Figure 6B shows the screening of antibodies binding to a panel of tick-borne flaviviruses EDIII, including Poissant LB virus (POWV-LB), Poissant deer tick virus (POWV-DTV), Kyasanur forest disease virus (KFDV), Langat virus (LGTV), jumping disease virus (LIV), and Omsk hemorrhagic fever virus (OHFV). Antibodies were screened in double denominations at 1 μg / mL. Gray indicates binding above control. Figure 6C shows the screening for antibody neutralization against RVP, corresponding to the same panel of tick-borne flaviviruses as in Figure 6B. Antibodies were screened in triple denominations at 1 μg / mL. Gray indicates binding superior to the control. Figures 6D, 6E, 6F, 6G, 6H, and 6I show neutralization curves of selected antibodies against tick-borne flaviviruses other than TBEV (Representative of two experiments in triplicate). [Figure 6-2]Figures 6A, 6B, 6C, 6D, 6E, 6F, 6G, 6H, and 6I are a series of figures showing antibody binding and neutralization. Figure 6A shows ELISA binding curves for TBEVFE and TBEVSi EDIII for 59 antibodies. The data are representative of two experiments. Figure 6B shows the screening of antibodies binding to a panel of tick-borne flaviviruses EDIII, including Poissant LB virus (POWV-LB), Poissant deer tick virus (POWV-DTV), Kyasanur forest disease virus (KFDV), Langat virus (LGTV), jumping disease virus (LIV), and Omsk hemorrhagic fever virus (OHFV). Antibodies were screened in double denominations at 1 μg / mL. Gray indicates binding above control. Figure 6C shows the screening for antibody neutralization against RVP, corresponding to the same panel of tick-borne flaviviruses as in Figure 6B. Antibodies were screened in triple denominations at 1 μg / mL. Gray indicates binding superior to the control. Figures 6D, 6E, 6F, 6G, 6H, and 6I show neutralization curves of selected antibodies against tick-borne flaviviruses other than TBEV (Representative of two experiments in triplicate). [Figure 7-1]Figures 7A, 7B, 7C, 7D, and 7E are a series of figures showing that T036 enhances TBEV infection. Figure 7A shows dose-dependent enhancement of TBEV RVP infection in the presence of T036 IgG, F(ab')2, and F(ab). Representative images from two triplicates. Error bars indicate standard deviation. Figure 7B shows enhancement of viral titer. Plots show Hypr-TBEV viral titers after incubation of PS cells for 24 or 48 hours in the presence of neutralizing antibody T038, enhancing antibody T036, or isotype control 10-1074. P-values ​​were calculated using one-way ANOVA and Tukey's test. Dashed lines represent the detection limits of the assay. Figure 7C. Enhancement of viral antigen detection. Representative microscopic images of PS cells infected with Hypr-TBEV in the presence of indicated amounts of T036, T038, or 10-1074 control. Scale bars indicate 200 μm. Figures 7D and 7E. The fusion loop-binding antibody 4G2 blocks the enhancement effect by T036. Figure 7D shows TBEV RVP infection compared to an unantibody control in the presence of antibody 4G2, T036, or 4G2 combined with T036. Representative images from two experiments. Figure 7E shows the number of cell plaques after infection of PS cells with Hypr-TBEV in the presence of 4G2, T036, or a combination of 4G2 and T036. In Figures 7D and 7E, p-values ​​were calculated using one-way ANOVA and Tukey's test. Error bars in D indicate triple standard deviations. [Figure 7-2]Figures 7A, 7B, 7C, 7D, and 7E are a series of figures showing that T036 enhances TBEV infection. Figure 7A shows dose-dependent enhancement of TBEV RVP infection in the presence of T036 IgG, F(ab')2, and F(ab). Representative images from two triplicates. Error bars indicate standard deviation. Figure 7B shows enhancement of viral titer. Plots show Hypr-TBEV viral titers after incubation of PS cells for 24 or 48 hours in the presence of neutralizing antibody T038, enhancing antibody T036, or isotype control 10-1074. P-values ​​were calculated using one-way ANOVA and Tukey's test. Dashed lines represent the detection limits of the assay. Figure 7C. Enhancement of viral antigen detection. Representative microscopic images of PS cells infected with Hypr-TBEV in the presence of indicated amounts of T036, T038, or 10-1074 control. Scale bars indicate 200 μm. Figures 7D and 7E. The fusion loop-binding antibody 4G2 blocks the enhancement effect by T036. Figure 7D shows TBEV RVP infection compared to an unantibody control in the presence of antibody 4G2, T036, or 4G2 combined with T036. Representative images from two experiments. Figure 7E shows the number of cell plaques after infection of PS cells with Hypr-TBEV in the presence of 4G2, T036, or a combination of 4G2 and T036. In Figures 7D and 7E, p-values ​​were calculated using one-way ANOVA and Tukey's test. Error bars in D indicate triple standard deviations. [Figure 7-3]Figures 7A, 7B, 7C, 7D, and 7E are a series of figures showing that T036 enhances TBEV infection. Figure 7A shows dose-dependent enhancement of TBEV RVP infection in the presence of T036 IgG, F(ab')2, and F(ab). Representative images from two triplicates. Error bars indicate standard deviation. Figure 7B shows enhancement of viral titer. Plots show Hypr-TBEV viral titers after incubation of PS cells for 24 or 48 hours in the presence of neutralizing antibody T038, enhancing antibody T036, or isotype control 10-1074. P-values ​​were calculated using one-way ANOVA and Tukey's test. Dashed lines represent the detection limits of the assay. Figure 7C. Enhancement of viral antigen detection. Representative microscopic images of PS cells infected with Hypr-TBEV in the presence of indicated amounts of T036, T038, or 10-1074 control. Scale bars indicate 200 μm. Figures 7D and 7E. The fusion loop-binding antibody 4G2 blocks the enhancement effect by T036. Figure 7D shows TBEV RVP infection compared to an unantibody control in the presence of antibody 4G2, T036, or 4G2 combined with T036. Representative images from two experiments. Figure 7E shows the number of cell plaques after infection of PS cells with Hypr-TBEV in the presence of 4G2, T036, or a combination of 4G2 and T036. In Figures 7D and 7E, p-values ​​were calculated using one-way ANOVA and Tukey's test. Error bars in D indicate triple standard deviations. [Figure 8-1] Figures 8A and 8B are a series of diagrams showing that T036 enhances TBEV infection. Figure 8A is a plot showing TBEV Neudoerfl titers after infecting PS cells and incubating them for 24 or 48 hours in the presence of T036, the neutralizing antibody T038, or the isotype control 10-1074. The p-value was calculated using one-way ANOVA and Tukey's test. Figure 8B shows representative immunofluorescence microscopy images of PS cells with TBEV Neudoerfl in the presence of the indicated antibodies. Green represents the viral antigen, and blue represents the cell nucleus. The scale bar represents 200 μm. [Figure 8-2]Figures 8A and 8B are a series of diagrams showing that T036 enhances TBEV infection. Figure 8A is a plot showing TBEV Neudoerfl titers after infecting PS cells and incubating them for 24 or 48 hours in the presence of T036, the neutralizing antibody T038, or the isotype control 10-1074. The p-value was calculated using one-way ANOVA and Tukey's test. Figure 8B shows representative immunofluorescence microscopy images of PS cells with TBEV Neudoerfl in the presence of the indicated antibodies. Green represents the viral antigen, and blue represents the cell nucleus. The scale bar represents 200 μm. [Figure 9-1]Figures 9A, 9B, 9C, and 9D are a series of diagrams showing that the T025 antibody recognizes the outer raised epitope on TBEV EDIII exposed on the mature viral structure. Figure 9A shows T025 recognition of TBEVWE EDIII. T025 interacts with the N-terminal region of TBEVWE EDIII (EDI-EDIII hinge, BC loop, and DE loop). Figure 9B shows the T025 epitope. TBEVWE EDIII residues with atoms within 4 Å of residues in the T025 Fab are highlighted on the surface representation of the EDIII antigen. CDRH3 and CDRL3 are shown as a ribbon skeleton with a stick side chain. Figure 9C shows that T025 recognizes an epitope similar to that of the anti-TBEV mouse antibody 19 / 1786. The T025 epitope is shown in shades of orange. The 19 / 1786 epitope is surrounded by a blue dashed line. The labeling is performed on residues within the 19 / 1786 epitope, not the T025 epitope. An epitope is defined as a residue containing an atom within 4 Å of an atom within a residue on the antibody. Figure 9D shows the surface representation of the cold EM structure of T025 (PDB 5O6A) indicated by 5, 3, and 2 icosahedral symmetry operators at selected vertices (left), and the inset compares the binding poses of the T025 and 19 / 1786 antibodies (right). Inset: Magnified view of the indicated portion (dotted box) of the cold EM structure on the virus surface interacting with the 19 / 1786 VHVL domain (PDB 5O6V), with the E protein domain labeled in red, yellow, and blue, and the VHVL domain labeled in dark blue-green and cyan. After aligning the EDIII domains, the T025-TBEVWE EDIII crystal structure was docked to a virion EDIII adjacent to the 2x symmetry axis of the icosahedron (RMSD = 0.97 Å, 82 ​​Cα atoms). T025 VHVL binds to EDIII in a similar pose to 19 / 1786 VHVL. [Figure 9-2]Figures 9A, 9B, 9C, and 9D are a series of diagrams showing that the T025 antibody recognizes the outer raised epitope on TBEV EDIII exposed on the mature viral structure. Figure 9A shows T025 recognition of TBEVWE EDIII. T025 interacts with the N-terminal region of TBEVWE EDIII (EDI-EDIII hinge, BC loop, and DE loop). Figure 9B shows the T025 epitope. TBEVWE EDIII residues with atoms within 4 Å of residues in the T025 Fab are highlighted on the surface representation of the EDIII antigen. CDRH3 and CDRL3 are shown as a ribbon skeleton with a stick side chain. Figure 9C shows that T025 recognizes an epitope similar to that of the anti-TBEV mouse antibody 19 / 1786. The T025 epitope is shown in shades of orange. The 19 / 1786 epitope is surrounded by a blue dashed line. The labeling is performed on residues within the 19 / 1786 epitope, not the T025 epitope. An epitope is defined as a residue containing an atom within 4 Å of an atom within a residue on the antibody. Figure 9D shows the surface representation of the cold EM structure of T025 (PDB 5O6A) indicated by 5, 3, and 2 icosahedral symmetry operators at selected vertices (left), and the inset compares the binding poses of the T025 and 19 / 1786 antibodies (right). Inset: Magnified view of the indicated portion (dotted box) of the cold EM structure on the virus surface interacting with the 19 / 1786 VHVL domain (PDB 5O6V), with the E protein domain labeled in red, yellow, and blue, and the VHVL domain labeled in dark blue-green and cyan. After aligning the EDIII domains, the T025-TBEVWE EDIII crystal structure was docked to a virion EDIII adjacent to the 2x symmetry axis of the icosahedron (RMSD = 0.97 Å, 82 ​​Cα atoms). T025 VHVL binds to EDIII in a similar pose to 19 / 1786 VHVL. [Figure 9-3]Figures 9A, 9B, 9C, and 9D are a series of diagrams showing that the T025 antibody recognizes the outer raised epitope on TBEV EDIII exposed on the mature viral structure. Figure 9A shows T025 recognition of TBEVWE EDIII. T025 interacts with the N-terminal region of TBEVWE EDIII (EDI-EDIII hinge, BC loop, and DE loop). Figure 9B shows the T025 epitope. TBEVWE EDIII residues with atoms within 4 Å of residues in the T025 Fab are highlighted on the surface representation of the EDIII antigen. CDRH3 and CDRL3 are shown as a ribbon skeleton with a stick side chain. Figure 9C shows that T025 recognizes an epitope similar to that of the anti-TBEV mouse antibody 19 / 1786. The T025 epitope is shown in shades of orange. The 19 / 1786 epitope is surrounded by a blue dashed line. The labeling is performed on residues within the 19 / 1786 epitope, not the T025 epitope. An epitope is defined as a residue containing an atom within 4 Å of an atom within a residue on the antibody. Figure 9D shows the surface representation of the cold EM structure of T025 (PDB 5O6A) indicated by 5, 3, and 2 icosahedral symmetry operators at selected vertices (left), and the inset compares the binding poses of the T025 and 19 / 1786 antibodies (right). Inset: Magnified view of the indicated portion (dotted box) of the cold EM structure on the virus surface interacting with the 19 / 1786 VHVL domain (PDB 5O6V), with the E protein domain labeled in red, yellow, and blue, and the VHVL domain labeled in dark blue-green and cyan. After aligning the EDIII domains, the T025-TBEVWE EDIII crystal structure was docked to a virion EDIII adjacent to the 2x symmetry axis of the icosahedron (RMSD = 0.97 Å, 82 ​​Cα atoms). T025 VHVL binds to EDIII in a similar pose to 19 / 1786 VHVL. [Figure 10-1]Figures 10A and 10B are a series of figures illustrating prevention and treatment with T025. Figure 10A shows that T025 is effective for pre-exposure prophylaxis. Mice were treated with T025 or 10-1074 (isotype control) 24 hours before infection with a lethal dose of TBEV-Hypr. The histogram at the top shows disease scores over time. Antibody doses are shown on the right. Two independent experiments were combined. Below, Kaplan-Meyer survival curves. The p-value was calculated using the Mantel-Cox test (p<0.0001). Figure 10B shows that T025 protects mice when administered post-infection. Mice were treated with 30 μg of T025 or control 10-1074 1, 3, or 5 days after infection (DPI). Three experiments were combined. For both +1 DPI and +3 DPI, p<0.0001 was calculated using the Mantel-Cox test. [Figure 10-2] Figures 10A and 10B are a series of figures illustrating prevention and treatment with T025. Figure 10A shows that T025 is effective for pre-exposure prophylaxis. Mice were treated with T025 or 10-1074 (isotype control) 24 hours before infection with a lethal dose of TBEV-Hypr. The histogram at the top shows disease scores over time. Antibody doses are shown on the right. Two independent experiments were combined. Below, Kaplan-Meyer survival curves. The p-value was calculated using the Mantel-Cox test (p<0.0001). Figure 10B shows that T025 protects mice when administered post-infection. Mice were treated with 30 μg of T025 or control 10-1074 1, 3, or 5 days after infection (DPI). Three experiments were combined. For both +1 DPI and +3 DPI, p<0.0001 was calculated using the Mantel-Cox test. [Figure 10-3]Figures 10A and 10B are a series of figures illustrating prevention and treatment with T025. Figure 10A shows that T025 is effective for pre-exposure prophylaxis. Mice were treated with T025 or 10-1074 (isotype control) 24 hours before infection with a lethal dose of TBEV-Hypr. The histogram at the top shows disease scores over time. Antibody doses are shown on the right. Two independent experiments were combined. Below, Kaplan-Meyer survival curves. The p-value was calculated using the Mantel-Cox test (p<0.0001). Figure 10B shows that T025 protects mice when administered post-infection. Mice were treated with 30 μg of T025 or control 10-1074 1, 3, or 5 days after infection (DPI). Three experiments were combined. For both +1 DPI and +3 DPI, p<0.0001 was calculated using the Mantel-Cox test. [Modes for carrying out the invention]

[0036] This disclosure describes anti-TBEV antibodies with unexpectedly broad-spectrum neutralizing activity. These antibodies In addition to TBEV, other emerging tick-borne flaviviruses, such as Langatwi, Rus, jumping disease virus, Omsk hemorrhagic fever virus, Kyasanur forest disease virus and Po It neutralizes Wassan virus. Therefore, the disclosed antibody and antigen-binding fragments are TB To prevent diseases or infections caused by various tick-borne flaviviruses, including EV. Alternatively, it represents a novel therapeutic strategy for treating a condition.

[0037] A. Broad-spectrum neutralizing anti-TBEV antibody antibody The inventions disclosed herein include broad-spectrum neutralizing anti-TBEV antibodies or antigen-binding fragments thereof. These antibodies are neutralizing antibodies that neutralize multiple tick-borne flaviviruses and their strains. This refers to the rat. The antibody is a lethal attack against tick-borne flaviviruses (e.g., TBEV). It can provide preventive and therapeutic protection to the target from attacks.

[0038] In one embodiment, the present disclosure specifically relates to tick-borne flavivirus (e.g., TBEV) antigens. Provides isolated anti-TBEV antibodies or their antigen-binding fragments for binding. Several implementations Morphologically, the antigen includes the lateral ridge of EDIII.

[0039] Tables 2A-I, 3, and 4 below list the heavy chains (HC) of exemplary anti-TBEV antibodies. ) Representative amino acid and / or nucleic acid sequences of the variable region and light chain (LC) variable region ru.

[0040] In some embodiments, the antibody or its antigen-binding fragment is (i) Table 2A-I, 3 and For those selected from 4, at least 75% (for example, 75%, 50%, 85%) They have an identity of 90%, 92%, 94%, 95%, 96%, 97%, 98%, and 99%. (ii) A heavy chain variable region having an amino acid sequence, and selected from Tables 2A-I, 3 and 4. At least 75% of the material (for example, 75%, 50%, 85%, 90%, 92%, 9%) It has amino acid sequences that share 4%, 95%, 96%, 97%, 98%, and 99% identity. It includes a light chain variable region. In some embodiments, the antibody or its antigen-binding fragment is ( i) Three heavy chain CDRs (HCDR1) selected from Tables 2A-I, 3, and 4 (ii) (ii) selected from Tables 2A-I, 3 and 4 It contains three light chain CDRs (LCDR1-3). In some embodiments, the antibody or The antigen-binding fragments include six CDRs selected from those listed in Tables 2A-I, 3, and 4. nothing.

[0041] In some embodiments, the antibody or its antigen-binding fragment is sequence numbers 1, 3, 5, 7. 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35 ,37,39,41,43,45,47,49,51,53,55,57,59,61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 8 9, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111 , Three heavy chain complements of the heavy chain variable region having amino acid sequences 113, 115, or 117 Decision regions (HCDRs) (HCDR1, HCDR2, and HCDR3), and sequence numbers 2 and 4 , 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32 ,34,36,38,40,42,44,46,48,50,52,54,56,58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 8 6, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, Three light chain variable regions having amino acid sequences of 110, 112, 114, 116, or 118 It includes one light chain CDR (LCDR1, LCDR2, and LCDR3).

[0042] In some embodiments, the antibody or its antigen-binding fragment is sequence numbers 1, 3, 5, 7. 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35 ,37,39,41,43,45,47,49,51,53,55,57,59,61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 8 9, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111 , has at least 75% identity with the amino acid sequence of 113, 115, or 117 It has the amino acid sequence, or SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 4 3, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69 , 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115 or It has a heavy chain variable region with a sequence of 117 amino acids, and sequence numbers 2, 4, 6, 8, 10, 12 , 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 6 6, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92 , 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 11 4. Having at least 75% identity with the amino acid sequence of 116 or 118. It has a mino acid sequence, or sequence numbers 2, 4, 6, 8, 10, 12, 14, 16, 18 ,20,22,24,26,28,30,32,34,36,38,40,42,44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 7 2, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98 , 100, 102, 104, 106, 108, 110, 112, 114, 116 or It includes a light chain variable region having a sequence of 118 amino acids.

[0043] In some embodiments, the antibody or its antigen-binding fragment is represented by SEQ ID NOs. 1-2, 3-4. 5-6, 7-8, 9-10, 11-12, 13-14, 15-16, 17-18, 19- 20, 21-22, 23-24, 25-26, 27-28, 29-30, 31-32, 3 3-34, 35-36, 37-38, 39-40, 41-42, 43-44, 45-46 , 47-48, 49-50, 51-52, 53-54, 55-56, 57-58, 59- 60, 61-62, 63-64, 65-66, 67-68, 69-70, 71-72, 7 3-74, 75-76, 77-78, 79-80, 81-82, 83-84, 85-86 , 87-88, 89-90, 91-92, 93-94, 95-96, 97-98, 99- 100, 101-102, 103-104, 105-106, 107-108, 109- 110, 111-112, 113-114, 115-116, or 117-118 It includes heavy chain variable regions and light chain variable regions containing their respective amino acid sequences.

[0044] In some embodiments, the antibody or its antigen-binding fragment further modifies the mutant Fc constant region. It is included in some embodiments. In some embodiments, the antibody is a monoclonal antibody. In this context, the antibody is a chimeric antibody, a humanized antibody, or a humanized monoclonal antibody. In some embodiments, the antibody is a single-chain antibody, a Fab fragment, or a Fab2 fragment.

[0045] In some embodiments, the antibody or its antigen-binding fragment further modifies the mutant Fc constant region. It is included in the following. The antibody may be a monoclonal antibody. In some embodiments, the antibody is a texture This may be a RA antibody, a humanized antibody, or a humanized monoclonal antibody. In some embodiments, The antibody may be a single-chain antibody, Fab, or Fab2 fragment.

[0046] In some embodiments, the antibody or its antigen-binding fragment is a toxin, therapeutic agent, polymer (e.g.) For example, detection in polyethylene glycol (PEG), receptors, enzymes, or receptor ligands. They can be labeled or conjugated as possible. For example, the antibody of the present invention may be toxin (e.g., detoxification). Such antibodies can bind to tick-borne flaviviruses (e.g., TB). Used to treat animals, including humans, infected with pathogenically related viruses (EV). It can be used.

[0047] In another example, the antibody of the present invention may be bound to a detectable tag. Such an antibody may be used in Whether animals such as bats are infected with tick-borne flaviviruses (e.g., TBEV) To make a determination, it can be used within a diagnostic assay. Examples of detectable tags include fluorescent proteins. Fluorescent proteins (i.e., green fluorescent protein, red fluorescent protein, yellow fluorescent protein), fireflies Light markers (i.e., fluorescein isothiocyanate, rhodamine, texale) (d), radioactive labels (i.e., 3H, 32P, 125I), enzymes (i.e., β-galactols) Tosidase, horseradish peroxidase, β-glucuronidase, alkaline phosphatase -ase) or affinity tags (i.e., avidin, biotin, streptavidin) are included. Methods for binding antibodies to detectable tags are known in the art. et al., Antibodies: A Laboratory Manual, p. age 319(Cold Spring Harbor Pub.1988). piece In some embodiments, the antibodies provided herein are antibody fragments. While not limited to these, Fab, Fab', Fab'-SH, F(ab')2, Fv and single-stranded Fv(scFv) fragments, as well as other fragments described below, for example, die This includes abody, tribody, tetrabody, and single-domain antibodies. Specific antibody cleavage. For an overview of the topic, see Hudson et al., Nat. Med. 9:129-13. See 4(2003). For an overview of scFv fragments, see, for example, Pluckt. hun,in The Pharmacology of Monoclonal An tibodies,vol.113,Rosenburg and Moore eds .,(Springer-Verlag,New York),pp.269-315( See also International Publication No. 93 / 16185 and U.S. Patent Nos. 5,571,894 and U.S. Patent Nos. 5,587,458 See reference. Contains salvage receptor-binding epitope residues and has an increased in vivo half-life. For a description of the Fab and F(ab')2 fragments, see U.S. Patent No. 5,869,046. Please refer to the detailed document.

[0048] Diabody is an antibody that has two antigen-binding sites, which may be bivalent or bispecific. This is a fragment. For example, European Patent No. 404,097, International Publication No. 1993 / 011. Pamphlet No. 61, Hudson et al., Nat. Med. 9:129-13 4 (2003), and Hollinger et al., Proc. Natl. Ac See ad.Sci.USA 90:6444-6448 (1993). Body and tetrabody are also mentioned in Hudson et al., Nat. Med. 9:12. It is described in 9-134 (2003).

[0049] A single-domain antibody is one in which all or part of the heavy chain variable domain of the antibody or the light chain variable domain An antibody fragment containing all or part of the yin. In some embodiments, a single domain The antibody is a human single-domain antibody (DOMANTIS, Inc., Waltham, M (See, for example, U.S. Patent No. 6,248,516).

[0050] Antibody fragments are, but are not limited to, intact antibodies as described herein. Protein breakdown and digestion in the body, and recombinant host cells (e.g., Escherichia coli (E. coli)) These can be produced by various techniques, including production by phages.

[0051] Chimeric antibodies and humanized antibodies In some embodiments, the antibodies provided herein are chimeric antibodies. For example, the antibody is described in U.S. Patent No. 4,816,567 and Morrison. et al.,Proc.Natl.Acad.Sci.USA,81:6851-68 It is described in 55 (1984). For example, a chimeric antibody has a non-human variable region (for example If derived from mice, rats, hamsters, rabbits, or non-human primates, such as monkeys. It includes a variable region and a human constant region. In further examples, chimeric antibodies are class or s Buclas is a "class-switched" antibody in which the parent antibody's class or subclass has changed. Chimeric antibodies contain the antigen-binding fragment.

[0052] In some embodiments, the chimeric antibody is a humanized antibody. Typically, a non-human antibody is While maintaining the specificity and affinity of the parental non-human antibody, it reduces immunogenicity against humans. Humanized antibodies are used to humanize HVR, for example, CDR (or one of its variants). One or more components (or parts thereof) are derived from a non-human antibody, and FR (or a portion thereof) is derived from a human antibody sequence. It includes the variable domain. Humanized antibodies may also include at least a portion of the human constant region. In some embodiments, certain FR residues within a humanized antibody are, for example, used to determine the specificity of the antibody. Alternatively, to restore or improve affinity, non-human antibodies (e.g., HVR residues) It is substituted with the corresponding residue from the antibody (from which it originates).

[0053] Humanized antibodies and methods for producing them are, for example, those described by Almagro and Fransso This is outlined in n, Front. Biosci. 13:1619-1633 (2008). Furthermore, for example, Riechmann et al., Nature 332:32 3-329(1988);Queen et al.,Proc.Nat'l Acad Sci.USA 86:10029-10033(1989); US 5,821 U.S. Patent No. 337, U.S. Patent No. 7,527,791, U.S. Patent No. 6,982,3 U.S. Patent No. 21 and U.S. Patent No. 7,087,409; Kashmiri et al. al., Methods 36:25-34 (2005) (Specificity Determining Region (SDR) Group Rafting is described in Padlan, Mol.Immunol.28:489-498. (1991) ("Resurfacing" is described); Dall'Acqua et al. Methods 36:43-60 (2005) (described as "FR shuffling"); Also, Osbourn et al., Methods 36:61-68 (2005) ) and Klimka et al., Br.J.Cancer, 83:252-260 (2000) (Describes the "guide selection" method for FR shuffling) ru.

[0054] The human framework domains that can be used for humanization are, but are not limited to, The "best fit" method (e.g., Sims et al. J. Immunol. 151: Framework region selected using 2296 (1993); Light Chain Variable Region Or, a fre derived from the consensus sequence of a specific subgroup of human antibodies in the heavy chain variable region. Homework domain (for example, Carter et al. Proc. Natl. Acad.) Sci.USA, 89:4285 (1992); and Presta et al. J. See Immunol., 151:2623 (1993); Human maturation (somatic mutation) Framework domain or human germline framework domain (e.g., Almagro a nd Fransson,Front.Biosci.13:1619-1633(20 See 08); and framework areas derived from screening the FR library (For example, Baca et al., J. Biol. Chem. 272: 10678- 10684 (1997) and Rosok et al., J. Biol. Chem. 2 This includes 71:22611-22618 (1996).

[0055] Human antibodies In some embodiments, the antibodies provided herein are human antibodies. Human antibodies are, Production using various techniques known in the art, or using the techniques described herein. Human antibodies are generally produced by van Dijk and van de Winke. l,Curr.Opin.Pharmacol.5:368-74(2001) and L onberg,Curr.Opin.Immunol.20:450-459(2008 It is described in ).

[0056] Human antibodies respond to antigen loading by either being intact human antibodies or possessing a human variable region. Immunogens were administered to transgenic animals modified to produce intact antibodies. Such animals can be prepared by the following: Either the gene locus is replaced, or it is located outside the chromosome or randomly on the animal's chromosome. Contains all or part of the incorporated human immunoglobulin gene locus. In immunogenic mice, the endogenous immunoglobulin gene locus is generally inactivated. For a review of methods for obtaining human antibodies from transgenic animals, see London. See erg, Nat. Biotech. 23:1117-1125 (2005). For example, U.S. Patent No. 6,075,18 describes XENOMOUSE technology. U.S. Patent No. 1 and U.S. Patent No. 6,150,584; describing HUMAB technology U.S. Patent No. 5,770,429; describes KM MOUSE technology. Japanese Patent No. 7,041,870, and the VELOCIMOUSE technology are described below. See the specification of U.S. Patent Application Publication No. 2007 / 0061900. Human variable regions derived from intact antibodies produced by animals are, for example, different human variable regions. It can be further modified by combining it with the normal domain.

[0057] Human antibodies can also be produced by hybridoma-based methods. Human monoclonal antibodies. Human myeloma cell lines and mouse-human heteromyeloma cells for producing heteromyeloma antibodies Cell lines are described. (For example, Kozbor J. Immunol., 133:3 001(1984);Brodeur et al., Monoclonal Anti body production techniques and applications ons, pp.51-63 (Marcel Dekker, Inc., New York ,1987); and Boerner et al., J.Immunol.,147: See 86 (1991).) Human antibodies produced via human B cell hybridoma technology. Also, Li et al., Proc. Natl. Acad. Sci. USA, 103:3 It is described in 557-3562 (2006). Additional methods include, for example, the United States Specification No. 7,189,826 (Monoclonal human IgM antibody derived from hybridoma cell lines) (Describes the production of the body) and Ni, Xiandai Mianyixue, 26(4):26 This includes those described in 5-268 (2006) (Human-Human Hybridomas). Human hybridoma technology (trioma technology) is also known as Vollmers and Brandlein,Histology and Histopathology, 20(3):927-937(2005) and Vollmers and Brand lein,Methods and Findings in Experimenta l and Clinical Pharmacology,27(3):185-91 It is described in (2005).

[0058] Human antibodies are also selected from human-derived phage display libraries. It can be generated by isolating the variable domain sequence. Then such variable domain The main sequence may be combined with the desired human constant domain. The techniques for selecting antibodies are described below.

[0059] The antibodies of the present invention are combinatorial antibodies having the desired single or multiple activities. They can be isolated by screening a library. For example, phagedis. A play library is created, and such a library is created for antibodies that have the desired binding characteristics. Various methods for screening Lee are known in the art. For example, Hoogenboom et al., in Methods in Mo lecular Biology 178:1-37(O'Brien et al., An overview is provided in (ed., Human Press, Totowa, NJ, 2001). Furthermore, for example, McCafferty et al., Nature 348:5 52-554;Clackson et al.,Nature 352:624-62 8(1991);Marks et al.,J.Mol.Biol.222:581- 597(1992);Marks and Bradbury,in Methods in Molecular Biology 248:161-175(Lo, ed., Human Press, Totowa, NJ, 2003);Sidhu et a l.,J.Mol.Biol.338(2):299-310(2004);Lee e t al., J.Mol.Biol.340(5):1073-1093(2004); Fellouse,Proc.Natl.Acad.Sci.USA 101(34): 12467-12472 (2004); and Lee et al., J. Immuno It is described in l.Methods 284(1-2):119-132(2004). .

[0060] In certain phage display methods, Winter et al., Ann. Rev. As described in Immunol., 12:433-455 (1994), VH remains The repertoire of genes and VL genes can be separated by polymerase chain reaction (PCR). They are cloned, randomly recombined in a phage library, and then this However, antigen-binding phages can be screened. Phages are typically sc The antibody fragment is presented as either an Fv fragment or a Fab fragment. Immune source The library does not require the construction of hybridomas to produce high-affinity antibodies against immunogens. It provides... or Griffiths et al., EMBO J, 12:72 As described in 5-734 (1993), without immunization, naive reper To clone a tree (e.g., from a human), to target a wide range of non-self and self-antigens. It can provide a single antibody source against this. Finally, Hoogenboom and According to Winter, J.Mol.Biol., 227:381-388 (1992) As described, the V gene segment that has not been rearranged from stem cells is clonin Then, using PCR primers containing random sequences, the highly variable CDR3 region was identified. By coding and achieving in vitro reorganization, the naive library can be synthetically transformed. It can also be produced in the following patent publications: For example, U.S. Patent No. 5,750,373 and U.S. Patent Publication No. 2005 / 00 U.S. Patent Publication No. 79574, U.S. Patent Publication No. 2005 / 0119455, U.S. Patent Publication No. 20 Specifications No. 05 / 0266000, U.S. Patent Publication No. 2007 / 0117126, U.S. Japanese Patent Publication No. 2007 / 0160598, U.S. Patent Publication No. 2007 / 02377 Specification No. 64, U.S. Patent Publication No. 2007 / 0292936 and U.S. Patent Publication No. Specification No. 2009 / 0002360 is included. Antibodies isolated from a human antibody library A body or antibody fragment is considered a human antibody or human antibody fragment in this specification.

[0061] mutant In some embodiments, amino acid sequence variants of the antibodies provided herein are intended. For example, it is desirable to improve the binding affinity and / or other biological properties of antibodies. In some cases, the amino acid sequence variant of the antibody may be appropriate for the nucleotide sequence encoding the antibody. Such can be prepared by introducing modifications or by peptide synthesis. Modifications include, for example, deletions from residues in the amino acid sequence of an antibody, and / or the removal of residues from the antibody's amino acid sequence. This includes insertions into residues within the amino acid sequence and / or substitutions of residues within the amino acid sequence of the antibody. As long as the final construct has the desired properties, for example, antigen binding, the process will reach the final construct. Therefore, any combination of deletion, insertion, and substitution can be performed.

[0062] Substitution, insertion, and deletion variants In some embodiments, antibody variants having one or more amino acid substitutions are provided. Sites of interest for substitutional mutagenesis include HVR and FR. Conservative substitutions are the main focus. Defined in detail. Amino acid substitutions are introduced into the target antibody to achieve the desired activity, for example, retained. Improved antigen binding, reduced immunogenicity, or improved antibody-dependent cell-mediated antibody For cytotoxicity-dependent cell injury (ADCC) and complement-dependent cell injury (CDC), the products are screened. You can do it.

[0063] Therefore, the antibody of the present invention is a CDR, heavy chain variable region or light chain as described herein. The peptides disclosed in this invention may include one or more conservative modifications of the variable region. Conservative modifications or functional equivalents of peptides or proteins refer to the peptides, polypeptides, etc. Plitter or polypeptide derivatives of proteins, e.g., one or more point mutations, insertions, deletions It refers to proteins that have cleavage, fusion, or combinations thereof. The activity of the peptide, parent polypeptide, or parent protein (such as those disclosed in this invention) To preserve qualitatively. Generally, a preservative modification or functional equivalent is at least 60% (e.g., For example, any number between 60% and 100% (including the values ​​at both ends), such as 60%, 70%, 75%. (80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99%) are the same. Therefore, one or more point mutations, insertions, deletions, cleavages, fusion proteins or their Antibodies having a combination of heavy chain variable region or light chain variable region, and mutant region are used in this research. It is within the range of light.

[0064] As used herein, the percentage homology between two sequences is defined as the percentage homology between two amino acid sequences. It is equal to the percentage identity between them. The percentage identity between two arrays is equal to the number of gaps. It is a function of the number of identical positions shared by the array, taking into account the length of each gap. In other words, % homology = number of identical positions / total number of positions × 100), which is the optimal number of positions for two arrays. It needs to be introduced for alignment. Comparison of sequences and percentage between two sequences. The determination of identity is performed using a mathematical algorithm, as described in the non-restrictive example below. It can be achieved.

[0065] The percentage identity between two amino acid sequences is determined by the PAM120 weight residue table, and the gap length. Using NARTY 12 and Gap Penalty 4, the ALIGN program (version E. Meyers and W. Miller (Comp 2.0) are incorporated into this. The algorithm from ut.Appl.Biosci.,4:11-17(1988)) is used. This can be determined. Furthermore, the percentage identity between two amino acid sequences is Bl Either the ossum 62 matrix or the PAM250 matrix, and the gap Weights 16, 14, 12, 10, 8, 6 or 4, and length weights 1, 2, 3, 4, 5 This uses the GCG software package (available at www.gcg.com). Needleman and Wunsch ( ) are incorporated into the GAP program The algorithm used in J.Mol.Biol.48:444-453 (1970) determines It can be determined.

[0066] Additionally or alternatively, the protein sequences of the present invention may, for example, identify related sequences. Furthermore, it can be used as a "query array" for performing searches against public databases. Such searches can be found in Altschul, et al. (1990) J.Mol.Bi. Using the XBLAST program (version 2.0) from ol.215:403-10 This can be done. BLAST protein search can obtain amino acid sequences homologous to the antibody molecule of the present invention. To do this, the XBLAST program can be used with a score of 50 and a word length of 3. To obtain a gapped alignment for the target, Altschul et al. ,(1997)Nucleic Acids Res.25(17):3389-340 As described in section 2, Gapped BLAST can be used. When using the ST and Gapped BLAST programs, each program Using the default parameters (e.g., XBLAST and NBLAST) is possible. Yes, it is possible. (See www.ncbi.nlm.nih.gov).

[0067] As used herein, the term “conservative modification” refers to the binding of an antibody containing an amino acid sequence. This refers to amino acid modifications that do not significantly affect or alter the synthesis properties. Such conservation modifications include amino acid substitutions, additions, and deletions. Modifications are permitted in the art. By known standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis This can be introduced into the antibody of the present invention. Conservative amino acid substitution is when an amino acid residue is replaced with a similar side chain. It is substituted with an amino acid residue having a similar side chain. The families of residues are defined in the art. These families are (i) basic (ii) Amino acids having side chains (e.g., lysine, arginine, histidine), (ii) acidic side chains (e.g., aspartic acid, glutamic acid), (iii) non-charged side chains (e.g., glycan Syn, asparagine, glutamine, serine, threonine, tyrosine, cysteine, trip (iv) Tophan, (iv) Nonpolar side chains (e.g., alanine, valine, leucine, isoleucine) (Proline, phenylalanine, methionine), (v)β-branched side chain (e.g., threonine) (i) valine, isoleucine, and (vi) aromatic side chains (e.g., tyrosine, phenylalanine) Contains ranine, tryptophan, and histidine.

[0068] Non-conservative substitution involves swapping one member of these classes with one of another. .

[0069] Exemplary substitution mutants include, for example, Hoogenboom et al., in Met. hods in Molecular Biology 178:1-37(O'Bri en et al., ed., Human Press, Totowa, NJ, (2 Phage display-based affinity maturation technology, such as that described in 001), is used. This is an affinity-mature antibody that can be easily produced using [a specific method]. For amino acid sequence insertion, one residue is required. Furthermore, amino-terminus fusions and / or peptides of a length extending to polypeptides containing 100 or more residues. This includes carboxyl-terminus fusions, as well as intrasequence insertions of one or more amino acid residues. Examples of terminal insertions include antibodies with an N-terminal methionyl residue. Other insertion mutants include enzymes that increase the serum half-life of antibodies (e.g., for ADEPT), and This involves the fusion of an antibody to the N-terminus or C-terminus of a polypeptide.

[0070] Glycosylated mutants In some embodiments, the antibodies provided herein are glycosylated to the extent that the antibodies are glycosylated. The degree can be changed to increase or decrease. Addition of glycosylation sites to antibodies. A deletion alters the amino acid sequence so that one or more glycosylation sites are created or removed. This can be easily achieved by simplifying the process.

[0071] For example, aglycoslated antibodies can be produced. In other words, antibodies lack glycosylation. Glycosylation is, for example, the glycosylation of antibodies against an antigen. It is possible to modify carbohydrates to increase affinity. Such carbohydrate modifications are, for example, This can be achieved by altering one or more sites of glycosylation within the antibody sequence. Yes, it is possible. For example, it can result in the exclusion of one or more variable region framework glycosylation sites. By performing one or more amino acid substitutions, glycosylation at that site is eliminated. This can be achieved. Such aglycosylation can increase the affinity of the antibody to the antigen. Such methods are described in U.S. Patent No. 5,714,350 by Co et al. This is described in more detail in U.S. Patent No. 6,350,861.

[0072] Glycosylation of the constant region on N297 involves converting the N297 residue to another residue, for example, N297 By mutating A and / or an adjacent amino acid, for example, 298 This can be prevented by reducing glycosylation on N297.

[0073] Additionally or alternatively, antibodies with altered glycosylation types, for example, fucosyl residues To produce antibodies with reduced levels of low fucosylation, or antibodies with increased bipartite GlcNac structures. This can be achieved. Such altered glycosylation patterns increase the ADCC capability of antibodies. It has been demonstrated that such carbohydrate modification can cause, for example, the glycosylation mechanism This can be achieved by expressing antibodies within altered host cells. Cells with altered recombination mechanisms are described in the Art and are subjected to recombinant antibodies as described herein. It is used as a host cell that expresses and thereby produces antibodies with altered glycosylation. For example, see European Patent No. 1,176,195 by Hanai et al. This refers to the hypofucosylation of antibodies expressed within such cell lines. As shown in the ion, a functionally disrupted F encoding fucosyltransferase This document describes cell lines containing the UT8 gene. Presta's PCT Public Publication No. Pamphlet No. 03 / 035835 describes the attachment of fucose to Asn(297) linked carbohydrates. This variant has a reduced ability to induce antibodies and also results in low fucosylation of antibodies expressed in its host cells. This document describes the Chinese hamster ovary cell line Led 3 cells (Shields, R L. et al. (2002) J. Biol. Chem. 277:26733-267 See also 40). PCT Public International Publication No. 99 / 54342 by Umana et al. The pamphlet states that antibodies expressed in manipulated cell lines increase the bifurcation of the GlcNac structure. This indicates that the ADCC activity of the antibody is increased, and the glycoprotein is modified to increase the ADCC activity. Syltransferase (e.g., β(1,4)-N-acetylglucosaminyltrans Describes cell lines engineered to express fucosidase III (GnTIII). (Umana et al. (1999) Nat. Biotech. 17:176 - 18 0, see also).

[0074] Fc region variant The variable regions of the antibodies described herein can be of any allotype or iso - allotype, e.g., in IgG1: G1m, G1m1(a), G1m2(x), G1m3(f), G1m1 7(z); in IgG2: G2m, G2m23(n); in IgG3: G3m, G3m2 1(g1), G3m28(g5), G3m11(b0), G3m5(b1), G3m13 (b3), G3m14(b4), G3m10(b5), G3m15(s), G3m16( t), G3m6(c3), G3m24(c5), G3m26(u), G3m27(v); and in K: Km, Km1, Km2, Km3 and can be Fc, e.g., IgG1 Fc , IgG2 Fc, IgG3 Fc or IgG4 Fc and can be linked (e.g., covalently or by fusion) (e.g., Jefferies et al. (2009) mAbs 1:1, see). In some embodiments, the antibody variable regions described herein can be linked to an Fc that binds to one or more activating Fc receptors (FcγI, Fcγlla or FcγIIIa), thereby stimulating ADCC and causing T - cell depletion. In some embodiments, the antibody variable regions described herein are linked to an Fc that causes depletion. In some embodiments, the antibody variable regions described herein are typically linked to one or more

[0075] functional properties of an antibody, e.g., serum half - life, complement binding, Fc receptor binding and / or antigen binding and / or antigen To alter its dependent cytotoxicity, it can be linked to an Fc containing one or more modifications. Furthermore, the antibodies described herein are chemically modified to alter one or more functional properties of the antibody. Can it be modified in such a way (for example, by attaching one or more chemical parts to the antibody), or it can be modified to change its glycosylation. Numbering of residues within the Fc region "G" is the numbering for Kabat's EU index.

[0076] The Fc region includes fragments, analogs, variants, mutants, or derivatives of the constant region, and is immunoglobulin-based. The brin, preferably a domain derived from the constant region of human immunoglobulin, is preferred. Suitable immunoglobulins include IgG1, IgG2, IgG3, IgG4, and IgA. Other classes include IgD, IgE, and IgM. The constant region of immunoglobulins is , naturally occurring or synthetically produced polypeptides homologous to the C-terminal region of immunoglobulins Defined as a cyd, with CH1 domain, hinge, CH2 domain, CH3 domain or The CH4 domain may be included separately or in combination. In some embodiments, The antibody of the present invention has an Fc region other than the Fc region of wild-type IgA1. The antibody is IgG (For example, IgG1, IgG2, IgG3 and IgG4), or IgA2, IgD, It may have Fc regions derived from Fc regions of other classes such as IgE and IgM. Fc may be a variant of IgA1.

[0077] The constant region of immunoglobulins includes many components, including Fc receptor (FcR) binding and complement binding. They play a crucial role in antibody function. Each isotype has its own characteristic effector. The heavy chain constant region, which is classified as functional IgA, IgG, IgD, IgE, and IgM. There are five main classes. For example, IgG is divided into IgG1, IgG2, and IgG3. It is separated into four subclasses known as IgG4.

[0078] Ig molecules interact with multiple classes of cell receptors. For example, IgG molecules interact with antibodies. Three classes of Fcγ receptors (FcγRs) specific to the IgG class, namely, Fcγ It interacts with RI, FcγRII, and FcγRIIL. IgG interacts with the FcγR receptor. The key sequences for binding have been reported to be located in the CH2 and CH3 domains. The serum half-life of an antibody is influenced by its ability to bind to FcR. ru.

[0079] In some embodiments, the Fc region has desired structural characteristics and / or biological activity To provide a mutant Fc region, for example, the parent Fc sequence (for example, later modified and mutated) Modified (e.g., amino acid substitutions) compared to the unmodified Fc polypeptide that generates the body. , Fc sequences (by deletion and / or insertion). For example, compared to the parent Fc, (a) (a) ADCC is increasing or decreasing, (b) CDC is increasing or decreasing, (c (d) Increased or decreased affinity for C1q, and / or Fc receptor In order to generate Fc mutants in which affinity for is increased or decreased, the Fc region is targeted Modifications may be made in this manner. Such Fc region variants generally have at least the Fc region. It contains one amino acid modification. A combination of amino acid modifications is considered particularly desirable. For example, The mutant Fc region contains, for example, two specific Fc region positions identified herein. may contain 3, 4, 5 or more substitutions.

[0080] The variant Fc region may also contain sequence changes in which amino acids involved in disulfide bond formation are removed or are replaced by other amino acids. Such removals may avoid reactions with other cysteine-containing proteins present in the host cells used to produce the antibodies described herein. Even if cysteine residues are removed, the single-chain Fc domain can still form a dimer Fc domain held together non-covalently. In other embodiments, the Fc region may be modified to be more compatible with the selected host cell. For example, the PA sequence near the N-terminus of a typical native Fc region, which can be recognized by E. coli digestive enzymes such as prolidase, may be removed. In other embodiments, one or more glycosylation sites within the Fc domain may be removed. Typically, glycosylated residues (e.g., asparagine) can confer a cytolytic response. Such residues may be deleted or replaced by non-glycosylated residues (e.g., alanine). In other embodiments, sites involved in interaction with complement, such as the C1q binding site, may be removed from the Fc region. For example, the EKK sequence of human IgG1 may be deleted or replaced. In some embodiments, sites that affect binding to Fc receptors, preferably sites other than the salvage receptor binding site, may be removed. In other embodiments, the Fc region may be modified to remove the ADCC site. The ADCC site is known in the art. For example, with respect to the ADCC site of IgG1, Molec. Immun Even if the cysteine residues are removed, the single-chain Fc domain can still form a dimer Fc domain held together non-covalently. In other embodiments, the Fc region may be modified to be more compatible with the selected host cell. For example, the PA sequence near the N-terminus of a typical native Fc region, which can be recognized by E. coli digestive enzymes such as prolidase, may be removed. In other embodiments, one or more glycosylation sites within the Fc domain may be removed. Typically, glycosylated residues (e.g., asparagine) can confer a cytolytic response. Such residues may be deleted or replaced by non-glycosylated residues (e.g., alanine). In other embodiments, sites involved in interaction with complement, such as the C1q binding site, may be removed from the Fc region. For example, the EKK sequence of human IgG1 may be deleted or replaced. In some embodiments, sites that affect binding to Fc receptors, preferably sites other than the salvage receptor binding site, may be removed. In other embodiments, the Fc region may be modified to remove the ADCC site. The ADCC site is known in the art. For example, with respect to the ADCC site of IgG1, Molec. Immun In other embodiments, the Fc region may be modified to be more compatible with the selected host cell. For example, the PA sequence near the N-terminus of a typical native Fc region, which can be recognized by E. coli digestive enzymes such as prolidase, may be removed. In other embodiments, one or more glycosylation sites within the Fc domain may be removed. Typically, glycosylated residues (e.g., asparagine) can confer a cytolytic response. Such residues may be deleted or replaced by non-glycosylated residues (e.g., alanine). In other embodiments, sites involved in interaction with complement, such as the C1q binding site, may be removed from the Fc region. For example, the EKK sequence of human IgG1 may be deleted or replaced. In some embodiments, sites that affect binding to Fc receptors, preferably sites other than the salvage receptor binding site, may be removed. In other embodiments, the Fc region may be modified to remove the ADCC site. The ADCC site is known in the art. For example, with respect to the ADCC site of IgG1, Molec. Immun In other embodiments, one or more glycosylation sites within the Fc domain may be removed. Typically, glycosylated residues (e.g., asparagine) can confer a cytolytic response. Such residues may be deleted or replaced by non-glycosylated residues (e.g., alanine). In other embodiments, sites involved in interaction with complement, such as the C1q binding site, may be removed from the Fc region. For example, the EKK sequence of human IgG1 may be deleted or replaced. In some embodiments, sites that affect binding to Fc receptors, preferably sites other than the salvage receptor binding site, may be removed. In other embodiments, the Fc region may be modified to remove the ADCC site. The ADCC site is known in the art. For example, with respect to the ADCC site of IgG1, Molec. Immun In other embodiments, the Fc region may be modified to remove the ADCC site. The ADCC site is known in the art. For example, with respect to the ADCC site of IgG1, Molec. Immun See ol.29(5):633-9(1992). Identification of mutant Fc domains. Examples include, for instance, International Publication No. 97 / 34631 and International Publication No. 96 / 3 This information is disclosed in pamphlet number 2478.

[0081] In one embodiment, the hinge region of Fc is modified by changing the number of cysteine ​​residues within the hinge region. It can be modified, for example, to increase or decrease. This technique is Bodmer e Further details are provided in U.S. Patent No. 5,677,425 by t al. Fc The number of cysteine ​​residues within the hinge region, for example, facilitates the assembly of the light and heavy chains. The stability of the sea urchin or antibody can be altered to increase or decrease it. One embodiment So, the Fc hinge region of the antibody is mutated to reduce the antibody's biological half-life. More specifically, the antibody's binding to the natural Fc-hinge domain SpA is impaired compared to that of the natural Fc-hinge domain SpA. The CH2 of the Fc-hinge fragment has a staphylococcal protein A (SpA) bond. - One or more amino acid mutations are introduced into the CH3 domain interface region. This method is used in War Further details are provided in U.S. Patent No. 6,165,745 by d et al. It is.

[0082] In yet another embodiment, the Fc region comprises at least one amino acid residue with a different amino acid It can be altered by substituting acid residues to change the effector function of the antibody. For example, amino acid residues 234, 235, 236, 237, 297, 318, 320 One or more amino acids selected from 322 are used by the antibody against the effector ligand. It has altered affinity, but retains the antigen-binding ability of the parent antibody, using different amino acid residues. It can be substituted by. Effector ligands whose affinity changes include, for example, Fc receptors. It could be the C1 component of the complement. This method is described in Winter et al. U.S. Patent No. 5,624,821 and U.S. Patent No. 5,648,260 Further details are provided in the book.

[0083] In another example, one or more amino acid residues selected from amino acid residues 329, 331, and 322. No acids cause antibodies to alter C1q binding and / or reduce or eliminate CDC. To achieve the desired effect, it can be substituted with different amino acid residues. This technique is used by Idusog Further details are provided in U.S. Patent No. 6,194,551 by ie et al. It is being done.

[0084] In another example, one or more amino acid residues within amino acid positions 231 and 239 are altered. This alters the antibody's ability to fix complement. This technique is used by Bodmer. Further details are available in PCT International Publication No. 94 / 29351 by et al. It is listed.

[0085] In yet another example, the Fc region is located at the following positions: 234, 235, 236, 2 38, 239, 240, 241, 243, 244, 245, 247, 248, 249, 2 52, 254, 255, 256, 258, 262, 263, 264, 265, 267, 2 68, 269, 270, 272, 276, 278, 280, 283, 285, 286, 2 89, 290, 292, 293, 294, 295, 296, 298, 299, 301, 3 03, 305, 307, 309, 312, 313, 315, 320, 322, 324, 3 25, 326, 327, 329, 330, 331, 332, 333, 334, 335, 3 37, 338, 340, 360, 373, 376, 378, 382, ​​388, 389, 3 98, 414, 416, 419, 430, 433, 434, 435, 436, 437, 4 By modifying one or more amino acids at 38 or 439, ADCC can be increased. It may be modified for the purpose of increasing affinity for the Fcγ receptor. Examples of substitutions include 236A, 239D, 239E, 268D, 267E, 268E, 2 This includes 68F, 324T, 332D, and 332E. An exemplary mutant is 239D. / 332E, 236A / 332E, 236A / 239D / 332E, 268F / 324T , 267E / 268F, 267E / 324T, and 267E / 268F7324T are included. This is not limited to other modifications to enhance FcγR and complement interactions. However, 298A, 333A, 334A, 326A, 247I, 339D, 339Q are substituted. , 280H, 290S, 298D, 298V, 243L, 292P, 300L, 396L This includes 305I and 396L. These and other modifications are by Strohl, 200. 9,Current Opinion in Biotechnology 20:68 This is outlined in 5-691.

[0086] Fc modifications that increase binding to the Fcγ receptor involve amino acid positions 238 and 2 in the Fc region. 39, 248, 249, 252, 254, 255, 256, 258, 265, 267, 2 68, 269, 270, 272, 279, 280, 283, 285, 298, 289, 2 90, 292, 293, 294, 295, 296, 298, 301, 303, 305, 3 07, 312, 315, 324, 327, 329, 330, 335, 337, 3338, 340, 360, 373, 376, 379, 382, ​​388, 389, 398, 414, One of the following: 416, 419, 430, 434, 435, 437, 438, or 439 The above amino acid modifications are included, and the numbering of residues within the Fc region is based on abat (International Public This is the EU index numbering, as in pamphlet No. 00 / 42072. .

[0087] Other Fc modifications that can be performed on Fc include those on FcγR and / or complement proteins. It reduces or removes the binding of ADCC, thereby inhibiting antibody-dependent cell phagocytosis. Reduces or eliminates Fc-mediated effector functions such as ADCP and CDC. There is a purpose for this. Exemplary modifications include, but are not limited to, positions 234, 235, This includes substitutions, insertions, and deletions in 236, 237, 267, 269, 325, and 328. The numbering follows the EU index. Exemplary substitutions are not limited to those mentioned above. However, 234G, 235G, 236R, 237K, 267R, 269R, 325L and 3 It includes 28R, and the numbering follows the EU index. The Fc variant is 236R / 3 May contain 28R. Other modifications to reduce FcγR and complement interactions may involve substitution. 297A, 234A, 235A, 237A, 318A, 228P, 236E, 268Q, 309L, 330S, 331S, 220S, 226S, 229S, 238S, 233P and 234V, as well as by mutant or enzymatic means, or by glycosphating proteins This includes the removal of glycosylation at position 297 by production within organisms such as bacteria that do not undergo glycosylation. These and other modifications are permitted under Strohl, 2009, Current Opinion. This is outlined in n in Biotechnology 20:685-691.

[0088] In some cases, the Fc area may be placed in additional and / or alternative locations known to those skilled in the art. May contain natural amino acid residues (e.g., U.S. Patent No. 5,624,821, U.S. Patent). U.S. Patent No. 6,277,375, U.S. Patent No. 6,737,056, U.S. Patent No. 6 U.S. Patent No. 194,551, U.S. Patent No. 7,317,091, U.S. Patent No. 8,1 Specification No. 01,720, International Publication No. 00 / 42072, International Publication No. 01 / Pamphlet No. 58957, International Publication No. 02 / 06919, International Publication No. 0 Pamphlet No. 4 / 016750, International Publication No. 04 / 029207, International Public release pamphlet No. 04 / 035752, International release pamphlet No. 04 / 074455 International Publication No. 04 / 099249 pamphlet, International Publication No. 04 / 063351 pamphlet Brochure, International Publication No. 05 / 070963, International Publication No. 05 / 0402 Pamphlet No. 17, International Publication No. 05 / 092925, and International Publication No. 0 (See the 6 / 020114 issue pamphlet.)

[0089] Fc variants that enhance affinity for the inhibitory receptor FcγRIIb may also be used. Such variants are associated with immunity related to FcγRIIb cells, including B cells and monocytes. This may provide an Fc fusion protein with regulatory activity. In one embodiment, the Fc mutant is 1 A selectively enhanced affinity for FcγRIIb compared to more than one activating receptor Provided. Modifications to alter binding to FcγRIIb are provided according to the EU index. te, 234, 235, 236, 237, 239, 266, 267, 268, 325, 32 Includes one or more modifications at positions selected from the group consisting of 6, 327, 328, and 332. Exemplary substitutions to enhance FcγRIIb affinity include, but are not limited to, 234D, 234E, 234F, 234W, 235D, 235F, 235R, 235Y, 236D, 236N, 237D, 237N, 239D, 239E, 266M, 267D, 267E, 268D, 268E, 327D, 327E, 328F, 328W, 328Y This includes 332E. Exemplary substitutions include 235Y, 236D, 239D, and 266M. This includes 267E, 268D, 268E, 328F, 328W, and 328Y. Other Fc mutants to enhance binding to γRllb include 235Y / 267E, 236 D / 267E, 239D / 268D, 239D / 267E, 267E / 268D, 267 This includes E / 268E and 267E / 328F.

[0090] The affinity and binding characteristics of the Fc region to the ligand are not limited, but Equilibrium methods (e.g., ELISA or radioimmunoassay) or kinetic methods (e.g., BIA) Various in vitro assay methods known in the art (biochemical and) including CORE analysis. This includes immunological-based assays, as well as indirect binding assays, competitive inhibition assays, and fluorescence assays. Energy transfer (FRET), gel electrophoresis and chromatography (e.g., gel This can be determined by other methods such as filtration. These and other methods determine the component being tested. You may use, and / or not be limited to, a mark for one or more of the following: However, various detection methods including colorimetric labels, fluorescent labels, luminescent labels, or isotopic labels are used. This is also good. A detailed description of binding affinity and dynamics focuses on antibody-immunogen interactions. Paul, WE, ed., Fundamental Immunology, 4th h Ed., Lippincott-Raven, Philadelphia (1999 ) can be found in.

[0091] In some embodiments, the antibody is modified to increase its biological half-life. Various methods are possible. For example, this involves determining the binding affinity of the Fc region to FcRn. This can be done by increasing it. For example, U.S. Patent No. 6,277,375 As noted, the following residues, namely 252, 254, 256, 433, 43 5. One or more of the 436 possible substitutions can be made. Specific example substitutions include T Includes one or more of 252L, T254S and / or T256F. To increase the biological half-life, Presta et al. reported in the U.S. 5 As described in U.S. Patent No. 869,046 and U.S. Patent No. 6,121,022 To achieve this, the antibody is modified within the CH1 or CL region of the IgG's Fc region. To include salvage receptor-binding epitopes derived from the two loops of the domain. This can be done. Other examples of increasing binding to FcRn and / or improving pharmacokinetic properties Exemplary mutants include, for example, 259I, 308F, 428L, 428M, 434S, and 434 Positions 259, 308, 428 and 43, including H, 434F, 434Y and 434M Includes substitution at 4. Other variants that increase Fc binding to FcRn include 250E, 25 0Q, 428L, 428F, 250Q / 428L (Hinton et al., 200 4, J. Biol. Chem. 279(8):6213-6216, Hinton et al. al.2006 Journal of Immunology 176:346-3 56), 256A, 272A, 286A, 305A, 307A, 307Q, 311A, 3 12A, 376A, 378Q, 380A, 382A, 434A (Shields et al,Journal of Biological Chemistry,2001, 276(9):6591-6604), 252F, 252T, 252Y, 252W, 25 4T, 256S, 256R, 256Q, 256E, 256D, 256T, 309P, 31 1S, 433R, 433S, 433I, 433P, 433Q, 434H, 434F, 43 4Y, 252Y / 254T / 256E, 433K / 434F / 436H, 308T / 30 9P / 311S(Dall Acqua et al.Journal of Immu nology,2002,169:5171-5180, Dall'Acqua et. al.,2006,Journal of Biological Chemistry (281:23514-23524) is included. Other modifications to modulate FcRn binding. The change is described in Yeung et al., 2010, J Immunol, 182:7663- As described in 7671, in some embodiments, high having specific biological properties Hybrid IgG isotypes may be used. For example, an IgG1 / IgG3 hybrid. The mutants have two isotypes of IgG1 at the CH2 and / or CH3 region. It can be constructed by substituting amino acids derived from IgG3 at different positions. Therefore, one or more substitutions, for example, 274Q, 276K, 300F, 339T, 356E , including 358M, 384S, 392N, 397M, 422I, 435R and 436F Hybrid mutant IgG antibodies can be constructed. In other embodiments described herein, IgG1 / IgG2 hybrid mutants have Ig in the CH2 and / or CH3 regions. The G2 position is substituted by amino acids derived from IgG1 at different positions for the two isotypes. It can be constructed by one or more substitutions, for example, the following amino acid substitutions. Replacement, i.e., 233E, 234L, 235L, 236G (insertion of glycine at position 236) A hybrid mutant IgG antibody containing one or more of the following (referring to input) and 321h was constructed. It is possible.

[0092] Furthermore, human Ig against FcγRl, FcγRII, FcγRIII, and FcRn The binding site on G1 is mapped, and mutants with improved binding are described. Shields, RLet al. (2001) J.Biol.Chem.276: See 6591-6604). Positions 256, 290, 298, 333, 334 and 33 Specific mutations in 9 were shown to improve binding to FcγRIII. Furthermore, the following The combination of mutants, namely those showing enhanced FcγRIIIa binding and ADCC activity. The following models are indicated: T256A / S298A, S298A / E333A, S298A / K22 4A, and S298A / E333A / K334A improve FcγRIII binding. This was shown (Shields et al., 2001). In cynomolgus monkeys, Fcγ Maximum increase in affinity for RIIIa, decreased FcγRIIb binding, and strong cytotoxicity. The S239D / I332E and S239D / I332E / A330L mutations showed activity. Other IgG1 variants with strongly enhanced binding to FcγRIIIa, including variants containing the following: A variant has been identified (Lazar et al., 2006). Alemtuzumab (CD) 52-specific), trastuzumab (HER2 / neu specific), rituximab (CD20 When a triple mutation is introduced into antibodies such as (specific) and cetuximab (EGFR specific), In vitro, the S239D / I332E mutant was converted to significantly enhanced ADCC activity. In monkeys, it showed an enhanced ability to deplete B cells (Lazar et al., 2020). 06). Furthermore, human FcγRIIIa expression is used in B-cell malignancies and breast cancer models. In transgenic mice, there is an enhancement of binding to FcγRIIIa, and consequently an increase in L235V, F243L, R292P, Y300L and others exhibit enhanced ADCC activity. IgG1 mutants containing the P396L mutation have been identified (Stavenhagen et al., 2007; Nordstrom et al., 2011). Used Other Fc variants that can be obtained include S298A / E333A / L334A, S239D / I332 E, S239D / I332E / A330L, L235V / F243L / R292P / Y3 This includes 00L / P396L and M428L / N434S.

[0093] In some embodiments, Fc with reduced binding to FcγR is selected. An example of Fc with reduced compound levels, for example, IgG1 Fc, has the following three amino acid substitutions. That is, L234A, L235E and G237A. In some embodiments, supplement Fc with reduced complement binding is selected. An example of Fc with reduced complement binding is, for example, IgG. 1 Fc has the following two amino acid substitutions, namely A330S and P331S. In some embodiments, the effector does not have an effector function in essence, i.e., Fcγ Fc with reduced binding to R and reduced complement binding is selected. Exemplary Fc, e.g., I gG1 Fc is effectless and has the following five mutations, namely L234A, Includes L235E, G237A, A330S, and P331S. IgG4 constant domain When used, it typically mimics the hinge sequence of IgG1, thereby stabilizing the IgG4 molecule. It is preferable to include the stabilizing substitution S228P.

[0094] Multivalent antibodies In one embodiment, the antibody of the present invention is monovalent or polyvalent (e.g., bivalent, trivalent, etc.). As used herein, the term “bind value” refers to the potential target binding associated with an antibody. This refers to the number of sites. Each target binding site can bind to one target molecule, or a specific location on the target molecule. It binds specifically to a gene locus. When an antibody is monovalent, each binding site on the molecule is single. It specifically binds to the antigen site or epitope. (Polyvalent), each target binding site can specifically bind to the same or different molecules (e.g., different A different ligand or antigen, or a different epitope or position on the same antigen. (They can be combined). See, for example, U.S. Patent No. 2009 / 0130105. In either case, at least one of the binding sites is an epitaxial bond associated with the DLL3 isotype. Includes taupe, motif, or domain.

[0095] In one embodiment, the antibody is described in Millstein et al., 1983, Natur. As described in e,305:537-539, the two strands have different specificities. It is a bispecific antibody. Other embodiments include antibodies with additional specificity, such as tripspecific antibodies. Including the body. Other more sophisticated and compatible multispecific constructs, and methods for their construction. , U.S. Patent No. 2009 / 0155255, and International Publication No. 94 / 04690 Pamphlet No., Suresh et al., 1986, Methods in En Zymology, 121:210, and International Publication No. 96 / 27011 pamphlet. It is described there.

[0096] As described above, polyvalent antibodies bind immunospecifically to different epitopes of the desired target molecule. To obtain, or to obtain, the target molecule and heterologous epitopes, e.g., heterologous polypeptides or solids. It can immunospecifically bind to both support materials. In some embodiments, the polyvalent antibody is two It may contain a bispecific antibody or a trispecific antibody. The bispecific antibody may contain a crosslinked antibody or This also includes "heteroconjugate" antibodies. For example, in heteroconjugate antibodies, one antibody... One end can be bound to avidin and the other to biotin. Such antibodies are, for example, By targeting immune system cells against undesirable cells (U.S. Patent No. 4,676,980) (Detailed text), Treating HIV infection (International Publication No. 91 / 00360, International Publication) Proposed for Brochure No. 92 / 200373 and European Patent No. 03089) Heteroconjugate antibodies can be prepared using any simple cross-linking method. Suitable crosslinking agents are well known in the art and, along with several crosslinking technologies, are covered by U.S. Patents. This is disclosed in Patent No. 4,676,980.

[0097] In some embodiments, an antibody variable domain having a desired binding specificity (antibody-antigen binding The joint area is assembled using a method well known to those skilled in the art, including the hinge, CH2 and / or CH3 region. Immunoglobulin constant domains such as the constant domain of the immunoglobulin heavy chain, which includes at least a portion of these. It is fused into the common domain sequence.

[0098] antibody derivative The antibodies provided herein are known in the art and readily available as additional non-antibodies. It may be further modified to include an protein-rich portion. The portion suitable for antibody derivatization is This includes, but is not limited to, water-soluble polymers.

[0099] Examples of water-soluble polymers, though not limited to them, include PEG and ethylene glycosides. Glycol / propylene glycol copolymer, carboxymethylcellulose, dextran , polyvinyl alcohol, polyvinylpyrrolidone, poly- 1,3-dioxolane, poly- 1,3,6-Trioxane, Ethylene / Maleic Anhydride Copolymer, Polyamino Acid (Homo (either polymer or random copolymer), and dextran or poly(n- Vinylpyrrolidone) polyethylene glycol, propylene glycol homopolymer, Polypropylene oxide / ethylene oxide copolymer, polyoxyethylated polyol Examples include (for example, glycerol), polyvinyl alcohol, and mixtures thereof. Polyethylene glycol propionaldehyde is manufactured with water stability in mind. It may have advantages. The polymer may have any molecular weight and may be branched or not. It is not necessary. The number of polymers that bind to the antibody can vary, and if multiple polymers bind, These may be the same or different molecules. Generally, the number of polymers used in derivatization and / or the type may be, but is not limited to, a specific characteristic or function of the antibody that is improved, anti Based on considerations including whether the derivative is used for treatment under defined conditions. It can be decided.

[0100] In another embodiment, antibodies and non-proteins can be selectively heated by exposure to radiation. A conjugate with a protein portion is provided. In one embodiment, the non-protein portion is car These are Bonn nanotubes (Kam et al., Proc.Natl.Acad.Sc). i.USA 102:11600-11605(2005). Radiation is at any wavelength. It is possible, but not limited to, and does not harm normal cells, but antibody-nonprotein The wavelengths include those that heat the non-proteinaceous portion to a temperature that causes proximal cells to die.

[0101] Another modification of antibodies described herein is pegylation. By pegylation of an antibody, for example, It is possible to increase the biological (e.g., serum) half-life. To pegylate antibodies, Antibodies or their fragments are typically formed by one or more PEG groups binding to the antibody or antibody fragment. Under conditions that enable the following, PEG, for example, a reactive ester or aldehyde derivative of PEG... To react with the body. Preferably, PEGylation is performed on a reactive PEG molecule (or a similar reactive water-soluble molecule). This is carried out via an acylation or alkylation reaction with a polymer. Used herein In this case, the term "polyethylene glycol" is used to derivatize other proteins. Any of the PEG forms that are being used, for example, mono(CI-CIO)alkoxy- This is aryloxy-polyethylene glycol, or polyethylene glycol-maleymi It is intended to include the antibody. In some embodiments, the antibody to be pegylated is the antibody. This is a cosylated antibody. The method for pegyrating proteins is known in the art, and this specification This can be applied to the antibodies described in the book. For example, according to Nishimura et al. Japanese Patent No. 0154316, and the European Patent by Ishikawa et al. Please refer to Specification No. 0401384.

[0102] The present invention also includes therapeutic agents, polymers, detectable labels or enzymes conjugated, This specification includes human monoclonal antibodies. In one embodiment, the therapeutic agent causes cell damage. It is a harmful agent. In one embodiment, the polymer is PEG.

[0103] Nucleic acids, expression cassettes, and vectors The present invention encodes polypeptides, peptide fragments, and bound proteins. The present invention provides isolated nucleic acid segments that perform the genetic code. It contains segments that code for the same amino acid due to degeneracy. For example, amino acid threonine The code is coded by ACU, ACC, ACA, and ACG, and therefore is degenerate. This invention relates to any variation of polynucleotide segments encoding the same amino acid. It is intended to include morphological examples. Such variations are publicly known in the art (Watson). et al.,Molecular Biology of the Gene,Be njamin Cummings 1987). Mutations are also conservative amino acid changes, for example. For example, changes in the nucleic acid segment that encode the substitution of leucine for isoleucine. This includes such mutations, which are also known in the art. Therefore, the gene and The nucleotide sequences include both naturally occurring sequences and variant forms.

[0104] The nucleic acid segment of the present invention may be contained within a vector. The vector is not limited to... However, there are two-stranded or single-stranded linear structures that may or may not be self-transmitting or mobile. or any plasmid, phagemid, F factor, virus, cosmid or f It may contain phags. Vectors can also be incorporated into prokaryotic hosts or other organisms by integration into the cell genome. It can transform a eukaryotic host or may exist outside the chromosome (e.g., the origin of replication). (Possesses autonomously replicating plasmids).

[0105] The nucleic acid segment within the vector can be used in vitro or in host cells, such as eukaryotic cells. Alternatively, a suitable promoter or other regulatory element for transcription within a microorganism, such as bacteria. The vector is under the control of the ment and can be operably linked to them. It may be a functional shuttle vector. The vector is also typically a foreign DNA sequence. It includes one or a few restrictive endonuclease recognition sites that can be inserted in a determinable manner. It may be a cloning vector. Such insertion is a cloning vector. This can occur without losing its essential biological function. Cloning vectors can also be used for cloning. Suitable for use in identifying and selecting cells transformed by transformation vectors. It may contain marker genes. Examples of marker genes include tetracycline resistance or antimicrobial activity. It is resistant to picillin. Many cloning vectors are commercially available (Stratage ne, New England Biolabs, Clonetech).

[0106] The nucleic acid segment of the present invention can also be inserted into an expression vector. Typically, an expression vector The ter is a prokaryotic DNA element that codes for the origin of bacterial replication, and expression within the bacterial host. Antibiotic resistance genes that provide vector amplification and selection; regulatory elements that control transcription initiation. DNA elements that control the processing of transcripts, such as promoters; and DNA elements that control the processing of transcripts. It contains, for example, introns or transcription termination / polyadenylation sequences.

[0107] Methods for introducing nucleic acid segments into vectors are available in the art (Samb rook et al.,Molecular Cloning: A Laborato ry Manual,3rd edition,Cold Spring Harbor Press, Cold Spring Harbor, NY (2001)). summary Then, using one or more restriction enzymes (restriction endonucleases), the nucleic acid segment is inserted. The input vector is processed to have a blunt end and a 5' or 3' overhang. Create a linear vector having a "ticky" end, or any combination of the above. - is treated with restriction enzymes, followed by polymerase, exonuclease, and phosphatase. The nucleic acid segments are processed using another modified enzyme, such as enzyme-mediated enzyme or kinase, to form a vector. Linear vectors with properties useful for ligation may be fabricated. One or more limitations An enzyme is used to process the nucleic acid segment to be inserted into the vector, resulting in a blunt end, 5' or It has a "sticky" end with a 3' overhang, or any combination of the above. A linear segment is prepared. The nucleic acid segment is treated with restriction enzymes, and then another The treatment may also be performed using a DNA-modifying enzyme. Such DNA-modifying enzymes are not limited to those specified. However, nucleic acid segments possess properties useful for ligating nucleic acid segments into vectors. Polymerase, exonuclease, phosphatase or cyanoacrylate for making the compound It contains naphth.

[0108] Next, the processed vector and nucleic acid segment are ligated together, and this technique Form a construct containing nucleic acid segments according to methods available in the field (Samb rook et al.,Molecular Cloning: A Laborato ry Manual,3rd edition,Cold Spring Harbor Press, Cold Spring Harbor, NY (2001). For example Then, the processed nucleic acid fragment and processed vector are subjected to a suitable buffer and ligase. Combine under the following conditions. Then, incubate the mixture under appropriate conditions until the ligase is formed. This enables the ligation of nucleic acid fragments into vectors.

[0109] This disclosure also relates to the ability of certain nucleic acid segments of the present invention to be used in vitro or within host cells. The present invention provides an expression cassette containing a nucleic acid sequence that can induce expression. The acid segment may be inserted into the expression cassette so that an antisense message is generated. The expression cassette is linear in form, and in vitro transcription and translation are performed. These are isolated units that can function for the purpose of performing these assays. The ingredients and instructions are from Promega Corp. (Madison, Wisconsin). It is commercially available. For example, in vitro transcripts contain nucleic acid sequences under the control of the T7 promoter. Next, we will use T7 RNA polymerase to produce an in vitro transcript. Therefore, it can be produced. Next, this transcript can be produced by using rabbit reticulocyte extract. It can be translated in vitro. Alternatively, the expression cassette is a duplicate of the expression cassette in the host cell. Vectors that enable production and amplification, or in vitro transcription and translation of nucleic acid segments. It can be incorporated into.

[0110] Such expression cassettes allow for the controlled placement of nucleic acid segments in regulatory sequences. It may contain one or more restriction sites. The expression cassette is also operable to nucleic acid segments. It contains a termination signal linked to the function, and regulatory sequences necessary for proper translation of nucleic acid segments. It may be possible. An expression cassette containing a nucleic acid segment may be a chimeric, and this is At least one of the components is heterogeneous with respect to at least one of the other components. This means that expression cassettes are also naturally occurring but recombinant ones that are useful for heterologous expression. It may also be obtained in morphological form. Expression of nucleic acid segments within the expression cassette is performed on the host molecule. A constitutive promoter that initiates transcription only when the cell is exposed to some specific external stimulus. Alternatively, it may be under the control of an inductive promoter.

[0111] The expression cassette has a transcription and translation initiation region and a nucleic acid segment in the 5'-3' direction of transcription. It may include a transcription and translation termination region that functions in vivo and / or in vitro. The termination region may be natural along with the transcription initiation region, or may it be natural along with the nucleic acid segment. It may be natural, or it may originate from another source.

[0112] The adjustment sequence is upstream (5' non-coded sequence), internal, or downstream (3' non-coded sequence) of the coded sequence. It is located in the coding sequence and is involved in the transcription, RNA processing, or stability of the related coding sequence. These may be polynucleotide sequences that affect translation. The regulatory sequences are not limited to those that affect translation. However, enhancers, promoters, repressor binding sites, translational reader sequences, These may include introns and polyadenylated signal sequences. They are native sequences and Synthetic sequences, and sequences that may be combinations of synthetic and natural sequences. Regulatory sequences The sequence is not limited to promoters, but some useful regulatory sequences include constitutive promoters. - Inducible promoter, regulatory promoter, tissue-specific promoter, viral promoter This includes promoters and synthetic promoters.

[0113] The promoter provides recognition for RNA polymerase and other factors necessary for proper transcription. This is a nucleotide sequence that controls the expression of a coding sequence by being used as a promoter. This includes all the basic elements necessary to initiate transcription, such as the TATA box, and / or It consists of a TATA box and other sequences that help identify the transcription start site. It includes a minimal promoter consisting only of an initiator, which is a short DNA sequence. —A regulatory element is added to control its expression. The promoter is a naturally occurring gene. It may be entirely derived from the offspring, or from various promoters found in nature. It may consist of elements or synthetic DNA segments. Proteins that regulate the effectiveness of transcription initiation in response to physiological or developmental conditions. It may contain DNA sequences involved in the binding of quality factors.

[0114] This disclosure also provides constructs containing vectors and expression cassettes. This vector may be selected from any of the aforementioned vectors, although this is not an exhaustive list. , methods known in the art and previously described (Sambrook et al., Molecular Cloning:A Laboratory Manual,3r d edition,Cold Spring Harbor Press,Cold According to Spring Harbor, NY (2001), the expression cassette was inserted. In one embodiment, the regulatory sequence of the expression cassette is the vector into which the expression cassette is inserted. —may originate from sources other than. In another embodiment, the nucleic acid segment of the present invention may be itself When inserted into a vector containing a regulatory sequence, the vector and expression cassette are constructed A structure is formed. Therefore, when a nucleic acid segment is inserted into the vector, the expression cassette A vector containing a regulatory sequence is commercially available, and its usage is described in this technique. It is publicly known in the field (Clonetech, Promega, Stratagene).

[0115] In another aspect, the Disclosure also relates to (i) the polypeptide of the antibody or its antigen-binding fragment (ii) a nucleic acid molecule encoding the dot chain, (ii) a vector containing the nucleic acid molecule described, and (ii i) Provide cultured host cells containing the vector described.

[0116] Furthermore, a method for producing polypeptides (e.g., anti-TBEV antibodies), as described in (a). (b) Obtain cultured host cells, (b) polypeptide encoded by the vector Under conditions that allow expression and aggregation of antibodies or their fragments, the cultured host in the culture medium (c) culturing chief cells, and (c) extracting antibodies from the cultured cells or cell culture medium. The method also includes purifying the fragments.

[0117] Production method Antibodies are, for example, as described in U.S. Patent No. 4,816,567, It can be produced using the replacement method and composition. In one embodiment, the antibody described herein An isolated nucleic acid encoding is provided. Such nucleic acid contains amino acids including the VL of the antibody. Amino acid sequences containing acid sequences and / or VH (e.g., light and / or heavy chains of antibodies) ) may encode. In further embodiments, one or more vectors containing such nucleic acids ( For example, an expression vector is provided. Further embodiments include a host containing such nucleic acid. Chief cells are provided. In one such embodiment, the host cells contain (1) a VL of the antibody. A vector containing a nucleic acid encoding an amino acid sequence and an amino acid sequence containing the VH of an antibody, (2) A first vector containing a nucleic acid encoding the amino acid sequence including the VL of the antibody, and A second vector containing a nucleic acid encoding the amino acid sequence containing the VH of the antibody (for example) (and transformed by them). In one embodiment, the host cell is a eukaryotic cell, for example Chinese hamster ovary (CHO) cells or lymphocytes (e.g., Y0, These are NS0 and Sp20 cells. In one embodiment, the method for producing antibodies is as follows: Under conditions suitable for expression, culture host cells containing nucleic acids encoding the antibodies provided above. This involves, and in some cases, recovering antibodies from host cells (or host cell culture medium). A method for including this is provided.

[0118] For recombinant antibody production, for example, nucleic acids encoding antibodies like the ones described above are isolated. , one or more vectors for further cloning and / or expression in host cells Such nucleic acids are inserted using conventional procedures (e.g., the heavy and light chains of antibodies). Using an oligonucleotide probe that can specifically bind to the gene encoding the strand (By using this method) it can be easily isolated and sequenced.

[0119] As described herein, for example in the examples, the RNA encoding the disclosed antibody is It can be isolated from convalescent or vaccinated donors and reverse transcribed into cDNA. Then, the cDNA is modified by recombinant DNA and one is created for expression within the host cell. The above vectors can be cloned. Recombinant expression monoclonal antibodies are isolated, It can be subjected to further purification, at least reverse transcription, PCR amplification, and cloning processes. Each of the recombinant antibodies produced and expressed due to one or more of the following causes is a natural To distinguish it from an antibody, at least one non- They have natural variations or mutations. These mutations are present in the antibodies disclosed herein in nature. To make it significantly different from existing counterparts. Therefore, the antibodies disclosed herein are It does not exist in nature.

[0120] Host cells suitable for cloning or expressing antibody-encoding vectors are specified herein. This includes prokaryotic or eukaryotic cells as described. For example, antibodies are particularly glycosylated and If the Fc effector function is not required, it can be produced within bacteria. Antibody fragments within bacteria For example, regarding the expression of polypeptides, see U.S. Patent No. 5,648,237. U.S. Patent No. 5,789,199 and U.S. Patent No. 5,840,523 See also: (Charlton, Met, which describes the expression of antibody fragments in E. coli) hods in Molecular Biology,Vol.248(BKC Lo, ed., Humana Press, Totowa, NJ, 2003), pp. See also .245-254.) After expression, the antibody is found in the bacterial cell paste within the soluble fraction. It can be isolated and further purified.

[0121] In addition to prokaryotes, eukaryotic microorganisms such as filamentous fungi or yeasts have a glycosylation pathway that is "human It is "modified" and produces antibodies that have a partial or complete human glycosylation pattern. Suitable clonin for antibody-encoding vectors, including fungal and yeast strains. It is a host or expression host. Gerngross, Nat. Biotech. 22:1 409-1414 (2004), and Li et al., Nat. Biotech. See 24:210-215 (2006).

[0122] Host cells suitable for the expression of glycosylated antibodies are also multicellular organisms (invertebrates and vertebrates). Derived from animals. Examples of invertebrate cells include plant cells and insect cells. In relation to insect cells, particularly Spodoptera frugiperda Numerous baculoviruses that can be used for transfection of iperda cells A strain has been identified.

[0123] Plant cell cultures can also be used as hosts. For example, U.S. 5,959 U.S. Patent No. 177, U.S. Patent No. 6,040,498, U.S. Patent No. 6,420,54 U.S. Patent No. 8, U.S. Patent No. 7,125,978 and U.S. Patent No. 6,417,42 Specification No. 9 (PLANTIBOD for antibody production in transgenic plants) Please refer to the section on IES technology.

[0124] Vertebrate cells can also be used as hosts. For example, cells adapted to grow in a suspension state. Mammalian cell lines may be useful. Another example of a useful mammalian host cell line is SV40 (COS-7) transformed monkey kidney CV1 strain; human embryonic kidney strain (e.g., Gr It is described in aham et al., J. Gen Virol. 36:59 (1977). 293 or 293 cells); baby hamster kidney cells (BHK); mouse cells Recells (e.g., Mather, Biol. Reprod. 23:243-251 (19 TM4 cells described in 80); monkey kidney cells (CV1); African green monkey kidney Visceral cells (VERO-76); human cervical cancer cells (HELA); canine kidney cells (MDCK); Buffalo rat hepatocytes (BRL 3A); human lung cells (W138); human hepatocytes (H ep G2); Mouse mammary gland tumor (MMT 060562); For example, Mather et al. al.,Annals NYAcad.Sci.383:44-68(1982) The TRI cells, MRC 5 cells, and FS4 cells are listed. Other useful cells include Mammalian host cell lines include DHFR-CHO cells (Urlaub et al., Proc. CHO details including .Natl.Acad.Sci.USA 77:4216(1980)) This includes cells, as well as myeloma cell lines, such as Y0, NS0, and Sp2 / 0. For an overview of specific mammalian host cell lines suitable for viviparous production, see, for example, Yazaki a nd Wu,Methods in Molecular Biology,Vol.2 48 (BKCLo, ed., Humana Press, Totowa, NJ See pp. 255-268 (2003).

[0125] B. Compositions and Formulations The antibodies of the present invention can be used alone or against human tick-borne flaviviruses (e.g., TBEV). Antiviral therapy is initiated in an antibody cocktail containing additional anti-TBEV antibodies for the treatment of the infection. It will be an excellent way to express it.

[0126] In another aspect, the present invention is formulated with a pharmaceutically acceptable carrier, as described herein. The present invention provides a pharmaceutical composition comprising the antibody described herein. The composition may optionally contain another antibody. Alternatively, it may contain one or more additional pharmaceutically active ingredients, such as therapeutic agents.

[0127] In some embodiments, the pharmaceutical composition is one of the antibodies or antigen-binding fragments described above. Includes two or more, for example, a heavy chain and a light chain containing each of the amino acid sequences described herein. It includes any combination of antibodies or antigen-binding fragments thereof.

[0128] In some cases, each antibody or its antigen-binding fragment is (i) Tables 2A-I, 3 and 4 (ii) Table 2 Heavy chain variable containing the respective amino acid sequences of antibodies selected from A-I, 3, and 4. Includes regions and light chain variable regions.

[0129] The pharmaceutical composition of the present invention may also be, for example, another immunostimulant, antiviral agent or vaccine. It can also be administered in combination therapy with other therapies. In some embodiments, the composition is at least Also 1mg / ml, 5mg / ml, 10mg / ml, 50mg / ml, 100mg / ml, 150 mg / ml, 200 mg / ml, 1-300 mg / ml, or 100-300 mg The antibody of the present invention is contained at a concentration of g / ml.

[0130] In some embodiments, the second therapeutic agent comprises an anti-inflammatory agent or an antiviral compound. In some embodiments, the antiviral compound is a nucleoside analog, peptoid, or oligonucleotide. Gopeptides, polypeptides, protease inhibitors, 3C-like protease inhibitors, papain This includes protease inhibitors or RNA-dependent RNA polymerase inhibitors. In that embodiment, the antiviral compound is acyclovir, ganciclovir, vidarabine, Foscarnet, cidofovir, amantadine, ribavirin, trifluorothymidine, zid May contain budin, didanosine, zalcitabine, or interferon. Several implementations Morphologically, interferons are either interferon-α or interferon-β. ru.

[0131] Infections caused by tick-borne flaviviruses (e.g., TBEV) Pharmaceutical compositions in the preparation of pharmaceuticals for the diagnosis, prevention, treatment, or combination thereof of disease conditions. The use of [the specified element] is also within the scope of this disclosure.

[0132] A pharmaceutical composition may contain any number of excipients. Possible excipients include carriers. , surfactants, thickeners or emulsifiers, solid binders, dispersing aids or suspension aids, solubilizers, Coloring agents, flavoring agents, coatings, disintegrants, lubricants, sweeteners, preservatives, isotonic agents and the like This includes combinations of the above. The selection and use of suitable excipients is disclosed by reference herein. It is incorporated into Gennaro, ed., Remington: The Science and Practice of Pharmacy,20th Ed.(Lippi This is taught by ncott Williams & Wilkins (2003).

[0133] Preferably, the pharmaceutical composition is administered intravenously, intramuscularly, subcutaneously, parenterally, or by spinal injection. Suitable for administration by oral or topical application (e.g., by injection or infusion). Depending on the route of administration, What protects the active compound from the action of acids and other natural conditions that can deactivate it? It may be coated with other materials. The term “parenteral administration” as used herein means This usually refers to administration methods other than enteral and local administration by injection, and is not limited to them. However, it does not occur in veins, muscles, arteries, spinal cavities, capsules, orbits, hearts, skin, abdominal cavities, or via the airways. Injections into the tube, subcutaneously, subepidermally, intra-articularly, subcapsularly, subarachnoidally, intraspinally, epidurally, and intrasternally. This includes injection. Alternatively, the antibodies of the present invention described herein may be administered via routes other than parenteral administration, e.g. For example, it can be administered via local, epidermal, or mucosal routes, such as intranasal, oral, vaginal, rectal, or tongue. It can be administered intravenously or topically.

[0134] The pharmaceutical compositions of the present invention include tablets, hard or soft gelatin capsules, aqueous solutions, suspensions, and Prepared in many forms, including liposomes and other sustained-release formulations, such as molded polymer gels. It is possible. Oral dosage forms can be formulated so that the antibody is released into the intestines after passing through the stomach. Such formulations are described in U.S. Patent No. 6,306,434 and the references contained herein. It is documented in the literature.

[0135] Oral liquid pharmaceutical compositions include, for example, aqueous or oily suspensions, solutions, emulsions, and silicones. It may be in the form of a sip or elixir, or before use, water or other suitable beverage. It may be provided as a dry product for composition using hycle. Such liquid pharmaceutical mixture The finished product may contain suspending agents, emulsifiers, non-aqueous vehicles (which may contain edible oils), or preservatives. It may contain conventional additives.

[0136] Antibodies are administered parenterally (e.g., by injection, e.g., by bolus injection or serial infusion). It may be formulated as an ampoule, pre-filled syringe, small-volume injector, or preservative. It may be provided in a unit dosage form of a multi-dose container to which the compound is added. The pharmaceutical composition may be oily or aqueous. It may take the form of a suspension in a vehicle, a solution or emulsion, and may contain a suspending agent, an antimicrobial agent. It may contain compounding agents such as stabilizing agents and / or dispersing agents. Pharmaceutical composition suitable for rectal administration. The substance can be prepared as a unit dose suppository. Suitable carriers include physiological saline and the technical component. It includes other materials commonly used in the wild.

[0137] When administered by inhalation, the antibody is delivered via an injector, nebulizer, or pressure pack, or via an inhaler. Allosol spray can be delivered conveniently by other convenient means of delivery. Pressurized packs are preferred. Suitable propellants include, for example, dichlorodifluoromethane, trichlorofluoromethane, and dichloro It may contain tetrafluoroethane, carbon dioxide, or other suitable gases. Pressurized aerozo In the case of [unclear], the dosage unit is determined by providing a valve for delivering the measured amount. It is possible.

[0138] Alternatively, in administration by inhalation or blowing, the antibody is administered as a dry powder composition, for example, a modified product. It may take the form of a powder mixture of the substance and a suitable powder base such as lactose or starch. The powder composition can be, for example, in the form of capsules or cartridges, or, for example, gelatin. Alternatively, it may be provided in a single dosage form in a blister pack, from which an inhaler or injector is used. The powder may be administered. In the case of intranasal administration, the antibody is delivered via a liquid spray, for example, It can be administered via a plastic bottle atomizer.

[0139] The pharmaceutical composition of the present invention also contains other components such as flavorings, colorings, antimicrobial agents, or preservatives. It may contain. The amount of antibody needed for therapeutic use is not only the selected specific carrier, but also It also varies depending on the route of administration, the nature of the condition being treated, and the patient's age and condition. It will be understood that, ultimately, the accompanying healthcare provider will determine the appropriate dosage. Furthermore, the pharmaceutical composition can be formulated as a single unit dosage form.

[0140] The pharmaceutical composition of the present invention may be in the form of a sterile aqueous solution or dispersion. The material also contains microemulsions, liposomes, or other ordered structures suitable for high drug concentrations. It can be formulated using manufacturing methods.

[0141] The antibodies of the present invention described herein may be administered as sustained-release formulations, in which case necessary The frequency of administration will decrease. The dosage and frequency will depend on the half-life of the antibody in the patient. It varies. Generally, human antibodies have the longest half-lives, followed by humanized antibodies and then chimeric antibodies. and non-human antibodies follow. Dosage and frequency of administration depend on whether the treatment is prophylactic or therapeutic. It can vary depending on the circumstances. For preventive purposes, a relatively low dose is used over a long period of time. It is administered at relatively infrequent intervals. Some patients continue treatment for life. In use, the patient is preferably able to manage the symptoms of the disease until the progression of the disease is reduced or stopped. Relatively high doses are required at relatively short intervals until target or complete improvement is observed. There is a prophylactic regimen that can then be administered to the patient.

[0142] The amount of active ingredient that can be combined with a carrier material to produce a single dosage form is therapeutic. The composition that produces the therapeutic effect varies depending on the target and the specific mode of administration, and generally. This is the amount. Generally, out of 100 percent, this amount is combined with a pharmaceutically acceptable carrier. In total, approximately 0.01% to approximately 99% of the active ingredient, preferably approximately 0.1% to approximately 70%, most preferably in the range of about 1% to about 30%.

[0143] The dosage regimen is adjusted to produce the optimal desired response (e.g., therapeutic response). To obtain, for example, a single bolus can be administered, or several divided doses can be administered over time. It may be administered, or the dose may be proportional as indicated by the urgency of the treatment situation. It can be reduced or increased. For ease of administration and uniformity of dosage. It is particularly advantageous to formulate parenteral compositions into unit dosage forms. A dosage form refers to a physically distinct unit that is suitable as a unit dose for the target being treated. Each unit is calculated to produce the desired therapeutic effect in conjunction with the required pharmaceutical carrier. It contains a certain amount of the active compound. Alternatively, the antibody may be administered as a sustained-release formulation, in this case. Therefore, the required administration frequency will decrease. For antibody administration, the dose is approximately 0% of the host's body weight. The range is 0.0001 to 800 mg / kg, and more typically, 0.01 to 5 mg / kg. Example For example, the dosages are 0.3 mg / kg body weight, 1 mg / kg body weight, 3 mg / kg body weight, and 5 mg. / kg body weight or 10 mg / kg body weight, or within the range of 1 to 10 mg / kg An example treatment regimen is once a week, once every two weeks, once every three weeks, once every four weeks. The antibody of the present invention is administered once a month, once every three months, or once every three to six months. Preferred dosage regimens include intravenous administration of 1 mg / kg body weight or 3 mg / kg body weight. The antibody is administered using one of the following dosing schedules: (i ) Six doses every four weeks, then every three months; (ii) every three weeks; (iii) ) 3 mg / kg body weight once, followed by 1 mg / kg body weight every 3 weeks. The dosage is approximately 1-1000 μg / ml, and in some methods, approximately 25-300 μg / ml. It is adjusted to achieve the plasma antibody concentration. The "therapeutic effective dose" of the antibody of the present invention is Furthermore, there is a decrease in the severity of disease symptoms, an increase in the frequency and duration of periods without disease symptoms, Or it brings about the prevention of functional impairment or disability caused by the suffering of the disease. For example, the target For the treatment of dipole-borne flavivirus (e.g., TBEV) infection, the "therapeutic effective dose" is Preferably, compared to untreated subjects, tick-borne flaviviruses (e.g., TBEV) Replication or uptake by host cells of at least about 20%, more preferably at least Approximately 40%, more preferably at least about 60%, and even more preferably at least It inhibits approximately 80%. A therapeutically effective dose of the therapeutic compound is used to target tick-borne flaviviruses (e.g., T11). Neutralize BEV or otherwise, typically human or other mammalian It can improve the symptoms of an object.

[0144] The pharmaceutical composition includes controlled implants, transdermal patches, and microencapsulation delivery systems. It may be a release formulation. Ethylene vinyl acetate, polyanhydride, polyglycolic acid, cholangiopanic acid Uses biodegradable and biocompatible polymers such as alpha-based polymers, poly-orthoesters, and polylactic acid. It is possible. For example, Sustained and Controlled Reel ase Drug Delivery Systems,JRRobinson,e See d., Marcel Dekker, Inc., New York, 1978. sea ​​bream.

[0145] Therapeutic compositions are medical devices, for example, the disclosure of which is incorporated herein by reference. 1) Needle-free subcutaneous injection device (e.g., U.S. Patent No. 5,399,163, U.S. Patent No. 5 U.S. Patent No. 383,851, U.S. Patent No. 5,312,335, U.S. Patent No. 5,0 U.S. Patent No. 64,413, U.S. Patent No. 4,941,880, U.S. Patent No. 4,790 (2) Microinjection Pump (U.S. Patent No. 4,487,603); (3) Transdermal device (U.S. Patent No. 4,487,603); (4) (4) Injection device (U.S. Patent No. 86,194); (5) Injection device (U.S. Patent No. 4,447,233 and (5) Osmotic apparatus (U.S. Patent No. 4,447,224); and (5) Osmotic apparatus (U.S. Patent No. 4, Administered via U.S. Patent No. 439,196 and U.S. Patent No. 4,475,196) It is possible.

[0146] In some embodiments, the human monoclonal antibodies described herein are used in vivo. It can be formulated to ensure proper distribution in the field. For example, the therapeutic compound of the present invention may be To ensure crossing the blood-brain barrier, selective transport to specific cells or organs is necessary. It can be formulated into liposomes that may further contain targeted moieties for enhancement. For example, in the United States Japanese Patent No. 4,522,811; U.S. Patent No. 5,374,548; U.S. Patent Patent No. 5,416,016; and Patent No. 5,399,331; VV .Ranade(1989)Clin.Pharmacol.29:685;Umeza wa et al.,(1988)Biochem.Biophys.Res.Comm un.153:1038;Bloeman et al.(1995)FEBS Let t.357:140;M.Owais et al. (1995) Antimicrob .Agents Chemother.39:180;Briscoe et al.( 1995)Am.Physiol.1233:134;Schreier et al. (1994).Biol.Chem.269:9090;Keinanen and L aukkanen (1994) FEBS Lett. 346:123; and Kill Ion and Fidler (1994) Immunomethods 4:273 Please refer to this.

[0147] In some embodiments, a second dose of the antibody or its antigen-binding fragment is administered after the initial dose. Alternatively, multiple subsequent doses may be approximately the same as the initial dose, or less than the initial dose. It may be administered in any amount that is possible, and the subsequent dose should be at least 1 to 3 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, At least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, and at least The intervals between doses should be 10 weeks, at least 12 weeks, or at least 14 weeks.

[0148] Various delivery systems, such as liposomes, microparticles, microcapsules, and mutant viruses. Recombinant cells that can express this, encapsulation into receptor-mediated endocytosis, are known. The present invention may be used to administer the pharmaceutical composition (for example, Wu et al. (See (1987) J. Biol. Chem. 262:4429-4432). Introduction The law does not limit itself to intradermal, transdermal, intramuscular, intraperitoneal, intravenous, subcutaneous, and nasal cavity procedures. This includes epidural and oral routes. The composition can be administered by any convenient route, for example, by injection. By injection or bolus injection, the epithelium or mucosal lining (e.g., oral mucosa, direct injection) It can be administered by absorption via the intestinal mucosa and other cellular media, and other biologically active drugs It may be administered together with [another substance]. Administration may be systemic or topical. The pharmaceutical composition contains vesicles. In particular, it can be delivered by liposomes (e.g., Langer (1990) Science). See 249:1527-1533).

[0149] This specification also intends to use nanoparticles for delivering the antibody of the present invention. Jugate nanoparticles can be used for both therapeutic and diagnostic applications. Antibody conjugate The nanoparticles, as well as the methods for their preparation and use, are incorporated herein by reference. rruebo, M., et al.2009(“Antibody-conjugate d nanoparticles for biomedical applicati ons“ in J.Nanomat.Volume 2009,Article ID This is described in detail by (439389). Developing nanoparticles and incorporating them into pharmaceutical compositions. The target may be an antibody conjugated with the nanoparticles for drug delivery. For example, each of the children is incorporated in its entirety by U.S. Patent No. 8,257,740. It is also described in the specification or in U.S. Patent No. 8,246,995.

[0150] In certain circumstances, pharmaceutical compositions may be delivered by a controlled-release system. In one embodiment, a pump It can be used. In another embodiment, polymer materials can be used. In the application configuration, the controlled release system is placed near the target of the composition, and therefore all that is required is Only a portion of the body weight may be used.

[0151] Injectable drugs include those for intravenous, subcutaneous, intradermal, intracranial, intraperitoneal, intramuscular, and intravenous infusion injections. Forms may be included. These injectables can be prepared by known methods. For example, injectables For example, the above-mentioned antibody in a sterile aqueous or oily medium conventionally used for injection. It can be prepared by dissolving, suspending, or emulsifying its salt as an aqueous medium for injection. Examples include physiological saline, alcohol (e.g., ethanol), and polyhydric alcohol (e.g., , propylene glycol, polyethylene glycol), nonionic surfactants [for example, Polysorbate 80, HCO-50 (Polyoxyethylene (50 mol) from hydrogenated castor oil) Glucose and other substances can be used in combination with appropriate solubilizers such as adducts. Examples include isotonic solutions containing additives, etc. Examples of oily media include benzyl benzoate. Sesame oil, soybean oil, etc., which can be used in combination with solubilizers such as benzyl alcohol. It is used. The injection solution prepared in this way is preferably filled into an appropriate ampoule. It seems so.

[0152] The pharmaceutical composition of the present invention is delivered subcutaneously or intravenously using a standard needle and syringe. Furthermore, with respect to subcutaneous delivery, the pen delivery device delivers the pharmaceutical composition of the present invention in terms of It has easy applications. Such pen-type delivery devices are reusable or disposable. Reusable pen delivery devices generally have replaceable cartridges that contain pharmaceutical compositions. Use the cartridge. The pharmaceutical composition in the cartridge is administered completely, and the cartridge is empty. This allows for easy disposal of empty cartridges and replacement with new cartridges containing the pharmaceutical composition. It can be replaced. Then the pen delivery device can be reused. Disposable In pen-based delivery devices, there are no replaceable cartridges. Rather, they are disposable pens. The delivery device is pre-filled with the pharmaceutical composition held in a reservoir within the device. When the pharmaceutical composition is depleted from the device, the entire apparatus is discarded.

[0153] Numerous reusable pens and automated injection devices deliver the pharmaceutical composition of the present invention subcutaneously. It has applications for various purposes. To give just a few examples, AUTOPEN (trademark) (Owen Mumford, Inc. (Woodstock, UK), DISETRONIC (trademark) Penn (Disetronic Medical Systems, Burgdorf, Switzerland) ), HUMALOG MIX 75 / 25 (trademark) pen, HUMALOG (trademark) pen, HUMALIN 70 / 30 (trademark) pen (Eli Lilly and Co., Ltd.) (Indianapolis, Diana), NOVOPEN (trademark) I, II and III (No vo Nordisk (Copenhagen, Denmark), NOVOPEN JUNIOR (Trademark) (Novo Nordisk, Copenhagen, Denmark), BD (Trademark) Becton Dickinson (Franklin Lakes, New Jersey) , OPTIPEN(TM), OPTIPEN PRO(TM), OPTIPEN STA RLET (trademark) and OPTICLIK (trademark) (Sanofi-Aventis, Frankfurt, Germany is one example, but it is certainly not limited to these. An example of a disposable pen delivery device used for subcutaneous delivery of the pharmaceutical composition of the invention is this To give a few examples, SOLOSTAR (trademark) pen (Sanofi-Aventis), FLEXPEN (trademark) (Novo Nordisk) and KWIKPEN (trademark) Eli Lilly), SURECLICK(TM) Autoinjector(Amg (en, Thousand Oaks, California), PENLET (trademark) (Haselme ier, Stuttgart, Germany), EPIPEN (Dey, LP) and HU MIRA(trademark)Pen (Abbott Labs, Abbott Park, Illinois) was cited. While these are possible, they are certainly not limited to these.

[0154] Advantageously, the above-mentioned pharmaceutical compositions for oral or parenteral use are adapted to the dosage of the active ingredient. It is prepared into a dosage form of a unit dose suitable for that purpose. Such dosage forms in a unit dose include, for example, For example, this includes tablets, pills, capsules, injections (ampoules), suppositories, etc. The contained antibacterial agent The amount of substance is generally about 5 to 500 mg per unit dose of the dosage form, especially in injectable solutions. In this form, the antibody is administered in doses of approximately 5 to 300 mg and approximately 10 to 300 mg for other dosage forms. It is preferable that it be contained in mg.

[0155] C. How to use Treatment method The antibodies, compositions, and formulations described herein are tick-borne flaviviruses (e.g., TB) It neutralizes EV, thereby eliminating various tick-borne flaviviruses, including TBEV. It may be used to treat or prevent the disease or infection it causes.

[0156] Therefore, in one aspect, this disclosure relates to tick-borne flaviviruses (e.g., Further, a method for neutralizing TBEV is provided. The method provides the above to the target that requires it. Administer a therapeutically effective amount of the antibody or its antigen-binding fragment, or a therapeutically effective amount of the pharmaceutical composition. This includes the following.

[0157] In another aspect, this disclosure helps prevent tick-borne flavivirus (e.g., TBEV) infection. The method further provides a treatment method. The method also provides the above-mentioned antibodies to the target that needs it. This includes administering a therapeutically effective amount of the antigen-binding fragment or a therapeutically effective amount of the pharmaceutical composition. nothing.

[0158] For example, neutralizing TBEV involves (i) inhibiting TBEV binding to target cells, (ii) (iii) inhibiting TBEV uptake by target cells, and inhibiting TBEV replication. (iv) by inhibiting the release of TBEV virus particles from infected cells. It is possible. Those skilled in the art will be able to perform any assay to evaluate the neutralization of TBEV. To possess power.

[0159] In particular, the neutralizing properties of antibodies can be evaluated by various tests, and all of these tests are ( i) Inhibition of TBEV binding to target cells, (ii) Inhibition of TBEV uptake by target cells, (iii) Inhibition of TBEV replication, and (iv) Release of TBEV virus particles from infected cells. The results of inhibition of output can be evaluated. In other words, if various tests are conducted, the same results will be obtained, that is, This can lead to the observation of loss of infectivity of TBEV. Therefore, in one embodiment Therefore, the present invention is a method for neutralizing TBEV in a subject, as described herein. The present invention provides a method that includes administering a therapeutically effective dose of the antibody to a target.

[0160] Another aspect of the present invention relates to the treatment of tick-borne flavivirus (e.g., TBEV) related diseases. The method provides a way to treat (e.g., after TBEV infection) and prophylactic. (For example, prior to TBEV exposure, infection, or illness.) For example, regarding TBEV infection Therapeutic and prophylactic methods for treating individuals may include those with TBEV infection or disease. Treatment of individuals at risk, treatment of individuals with TBEV infection, and TBEV Methods to protect individuals from infection, and methods to reduce or decrease the probability of TBEV infection in individuals. Methods to reduce or decrease an individual's susceptibility to TBEV infection, or the TB of an individual Methods to inhibit or prevent TBEV infection, and transmission of TBEV from infected individuals to uninfected individuals. This includes methods to reduce, decrease, inhibit, or suppress the growth. Such a method involves administering the antibody of the present invention or a composition containing the antibody disclosed herein. , individuals who have or are at risk of having TBEV infection or disease are treated or prophylactic This includes treating (vaccinating or immunizing). Therefore, the method is T It can treat BEV infection or the disease, or protect individuals from infection (e.g.) For example, preventative protection.

[0161] In one embodiment, a method for treating tick-borne flavivirus (e.g., TBEV) related diseases. The law requires that individuals that need it be protected from tick-borne flavivirus (e.g., TBEV) infection. This specification states that the amount is sufficient to reduce one or more physiological conditions or symptoms related to the disease. Administering the antibody or therapeutic composition disclosed herein, thereby treating tick-borne flavivirus This includes treating (for example, TBEV) related diseases.

[0162] In one embodiment, the antibody or therapeutic composition disclosed herein is used for tick-borne flaviceps Used to treat diseases associated with viruses (e.g., TBEV). Several embodiments Therefore, the use of the antibodies or therapeutic compositions disclosed herein is for TBEV infection or disease By reducing one or more physiological conditions or symptoms related to TBEV-related disease, To treat the disease. In aspects of this embodiment, the antibody or therapeutic composition disclosed herein Administration of this drug reduces one or more physiological conditions or symptoms associated with TBEV infection or the disease. This is a sufficient amount to treat TBEV-based diseases. In other embodiments, administration of the antibodies or therapeutic compositions disclosed herein is a TBEV Increase, induce, enhance, amplify, or promote clearance or removal. To either stimulate or reduce the transmission of TBEV to another individual, or to decrease it. Sufficient to inhibit, suppress, prevent, control, or limit It is a large quantity.

[0163] One or more live ticks associated with tick-borne flavivirus (e.g., TBEV) infection or illness. Physical pathology or symptoms respond to the therapeutic methods disclosed herein. Tick-borne flavipes The symptoms of a viral (e.g., TBEV) infection or illness vary depending on the stage of infection.

[0164] In some embodiments, tick-borne flaviviruses (e.g., TBEV) are present in the target. A method of neutralizing involves applying the first antibody of the above antibody or antigen-binding fragment to the target that requires it. Administer therapeutically effective doses of the body or its antigen-binding fragment and a second antibody or its antigen-binding fragment. The process includes the first antibody or its antigen-binding fragment and the second antibody or its antigen-binding fragment The combined fragment represents the synergistic activity or therapeutically effective amount of the above-mentioned pharmaceutical composition.

[0165] In some embodiments, tick-borne flavivirus (e.g., TBEV) infections are prevented. Alternatively, the treatment method involves applying the first antibody or antigen-binding fragment to the target that requires it. A therapeutically effective dose of an antibody or its antigen-binding fragment and a second antibody or its antigen-binding fragment is administered. This includes donating a first antibody or its antigen-binding fragment and a second antibody or its antigen The binding fragments represent the synergistic activity or therapeutically effective amount of the above pharmaceutical composition. Several embodiments So, the first antibody or its antigen-binding fragment is in front of the second antibody or its antigen-binding fragment. It is administered later, or simultaneously with a second antibody or its antigen-binding fragment.

[0166] In some embodiments, a first antibody or its antigen-binding fragment, and a second antibody or The antigen-binding fragments consist of heavy and light chains containing the respective amino acid sequences described herein. This could be any combination of antibodies containing or antigen-binding fragments of antibodies.

[0167] In some embodiments, the second therapeutic agent comprises an anti-inflammatory agent or an antiviral compound. In some embodiments, the antiviral compound is a nucleoside analog, peptoid, or oligonucleotide. Gopeptides, polypeptides, protease inhibitors, 3C-like protease inhibitors, papain This includes protease inhibitors or RNA-dependent RNA polymerase inhibitors. In that embodiment, the antiviral compound is acyclovir, ganciclovir, vidarabine, Foscarnet, cidofovir, amantadine, ribavirin, trifluorothymidine, zid May contain budin, didanosine, zalcitabine, or interferon. Several implementations Morphologically, interferons are either interferon-α or interferon-β. ru.

[0168] In some embodiments, the antibody or its antigen-binding fragment is a second therapeutic agent or therapeutic agent. It is administered before, after, or concurrently with a second therapeutic agent or treatment. In some embodiments, The antibody or its antigen-binding fragment is administered intravenously, subcutaneously, or intraperitoneally to the target. In several embodiments, the antibody or its antigen-binding fragment is administered prophylactically or therapeutically. .

[0169] The antibodies described herein neutralize tick-borne flaviviruses (e.g., TBEV). Therefore, in order to treat tick-borne flavivirus (e.g., TBEV) infections, It can be used in conjunction with one or more other anti-TBEV virus antibodies.

[0170] Combination therapy Combination therapy involves an anti-TBEV antibody as described, and an antibody as described, or an antibody It may include any additional therapeutic agents that can be advantageously combined with the biologically active fragment of the substance. Antibodies are associated with viral infections such as tick-borne flavivirus (TBEV) infections. It is used synergistically with one or more drugs or therapies used to treat a disease or disorder. They can be combined. In some embodiments, the antibodies of the present invention are used to treat one or more symptoms of the above-mentioned diseases. To improve this, it can be combined with a second therapeutic agent. In some embodiments, an antibody Therefore, to provide synergistic activity in improving one or more symptoms of the above-mentioned disease, a second antibody and They can be combined. In some embodiments, the first antibody or its antigen-binding fragment is Before, after, or binding of the second antibody or its antigen-binding fragment, or binding of the second antibody or its antigen. It is administered simultaneously with the fragment.

[0171] For example, the antibodies described herein are, for example, tick-borne flaviviruses (e.g., T1). Monitoring the progression of BEV infections and monitoring the patient's response to treatment for such infections. It can be used in various detection methods for applications such as rings.

[0172] In some embodiments, the second therapeutic agent is a tick-borne flavivirus (e.g., TBE). V) Another antibody against the protein or a fragment thereof. In this specification, tick-borne flavi A combination of antibodies having broad-spectrum neutralizing or inhibitory activity against viruses (e.g., TBEV) The use of a "cocktail" is intended. In some embodiments, a non-competitive antibody is combined. They may be combined and administered to the target that requires them. In some embodiments, the combination is The antibodies contained bind to different, non-overlapping epitopes on the protein. Several implementations In this state, the second antibody may have an even longer half-life in human serum.

[0173] As used herein, the term "in combination with" means that an additional therapeutic active ingredient is present in this invention. This means that it can be administered before, simultaneously with, or after the administration of the anti-TBEV antibody. The term "in combination with" also refers to the sequential or simultaneous use of an anti-TBEV antibody and a second therapeutic agent. Including administration.

[0174] Additional therapeutic active ingredients may be administered to the subject prior to administration of the anti-TBEV antibody of the present invention. For example. If the first component is administered one week, 72 hours, 60 hours, and 48 hours before the administration of the second component, 36 hours ago, 24 hours ago, 12 hours ago, 6 hours ago, 5 hours ago, 4 hours ago, 3 hours ago, 2 hours ago It is administered at the following times: 1 hour, 30 minutes, 15 minutes, 10 minutes, 5 minutes, or less than 1 minute before. In this case, the first component may be considered to be administered "before" the second component. Other embodiments Therefore, additional therapeutic active ingredients may be administered to the subject after administration of the anti-TBEV antibody of the present invention. For example, the first component is administered 1 minute, 5 minutes, 10 minutes, 15 minutes, and 30 minutes after the administration of the second component. Later, 1 hour later, 2 hours later, 3 hours later, 4 hours later, 5 hours later, 6 hours later, 12 hours later, 24 hours later If administered at 1 hour, 36 hours, 48 ​​hours, 60 hours, and 72 hours later, the first dose The second component may be considered to be administered "after" the second component. In yet another embodiment, additional The therapeutic active ingredient can be administered to the subject simultaneously with the administration of the anti-TBEV antibody of the present invention. "Simultaneous" administration for this purpose can be, for example, in a single dosage form or within approximately 30 minutes of each other. In a separate dosage form administered to the target, anti-TBEV antibody and additional therapeutic active ingredients are administered to the target. This includes, if administered in separate dosage forms, each dosage form may be administered via the same route. (For example, both the anti-TBEV antibody and the additional therapeutic active ingredient are administered intravenously, etc.) (to obtain). Alternatively, each dosage form may be administered via a different route (e.g., anti-TBEV anti). The body may be administered intravenously, and additional therapeutic active ingredients may be administered orally. In some cases, for the purposes of this disclosure, the component may be administered in a single dosage form, or in different dosage forms via the same route. Administering drugs in different dosage forms via different routes is considered "simultaneous administration." For the purposes of this disclosure, the administration of additional therapeutic active ingredients "before" and "at the same time as" the administration of additional therapeutic active ingredients, The following (these terms are defined above in this specification): administer an anti-TBEV antibody. This is considered to be administering anti-TBEV antibodies "in combination" with additional therapeutic active ingredients. It can be done.

[0175] The present invention relates to the anti-TBEV antibody of the present invention, which is further described elsewhere in this specification. The pharmaceutical composition contains one or more therapeutically active ingredients co-formulated with the pharmaceutical composition.

[0176] Administration regimen According to a particular embodiment, an anti-TBEV antibody (or anti-TBEV antibody and A single dose of a pharmaceutical composition (including a combination with any of the additional therapeutic agents described herein). The dosage can be administered to the target that needs it. According to a particular embodiment of the present invention, anti-T BEV antibody (or anti-TBEV antibody and any additional therapeutic agent described herein) Multiple doses of a pharmaceutical composition (including combinations thereof) are administered to a subject over a defined period of time. This method according to this aspect of the present invention is used for multiple doses of anti-TBEV antibody, in succession. This includes administering. As used herein, “sequentially administer” means anti-TBEV antibody Each dose can be taken at different times, for example, at predetermined intervals (e.g., several hours, several days, several weeks, or several months). This means administering the drug to the subject on different days separated by only a month. This disclosure is for anti-TBEV anti A single initial dose of the body, followed by one or more secondary doses of anti-TBEV antibodies, and, if applicable, anti-TB The present invention provides a method comprising administering one or more tertiary doses of EV antibodies to a patient in succession.

[0177] The terms "initial dose," "secondary dose," and "tertiary dose" refer to the administration of the anti-TBEV antibody of the present invention. This refers to the chronological order in which doses are administered. Therefore, the "initial dose" is administered at the start of the treatment regimen. The initial dose (also called the "baseline dose") is the first dose, and the "secondary dose" is the second dose administered after the initial dose. The dose administered is the "tertiary dose," which is the dose administered after the secondary dose. The dose, secondary dose, and tertiary dose may all contain the same amount of anti-TBEV antibody, but generally The frequency of administration may differ from one another. However, in some embodiments, the initial dose, The amount of anti-TBEV antibody contained in the secondary and / or tertiary doses varies during the course of treatment. They differ (for example, they are adjusted up or down if appropriate). In some embodiments, two The above (for example, 2, 3, 4, or 5) doses are considered the "loading dose" at the start of the treatment regimen. It is administered as a subsequent dose, followed by a subsequent dose administered on a less frequent basis (e.g., " The "maintenance dose" is administered.

[0178] In certain exemplary embodiments of the present invention, each secondary and / or tertiary dose is the preceding Dosage intervals of 1 to 48 hours (e.g., 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 1 1.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 1 6.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 2 1.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 2 6.5 or more doses are administered afterward. The term “immediate dose” as used herein refers to the dose immediately preceding the dose. The phrase refers to a series of multiple doses, without an intervening dose, and the dose immediately following the next dose in that sequence. This refers to the dose of anti-TBEV antibody previously administered to the patient.

[0179] The method according to this aspect of the present invention involves any number of secondary doses of anti-TBEV antibodies and / or This may include administering a tertiary dose to the patient. For example, in some embodiments, a single two Only the following dose is administered to the patient. In other embodiments, two or more (e.g., 2, 3, 4, 5) are administered. A secondary dose (6, 7, 8 or more) is administered to the patient. Similarly, several implementations In one embodiment, only a single tertiary dose is administered to the patient. In other embodiments, two or more (for example) Then, a tertiary dose (2, 3, 4, 5, 6, 7, 8 or more) is administered to the patient.

[0180] In some embodiments of the present invention, a secondary dose and / or a tertiary dose is administered to the patient. The frequency may vary throughout the course of the treatment regimen. The frequency of administration may also vary after clinical examinations. Treatment may be adjusted by the physician during the course of treatment, depending on the individual patient's needs.

[0181] Diagnostic applications of antibodies The disclosed anti-TBEV antibodies are, for example, used for diagnostic purposes to detect tick-borne flaviviruses in samples. It can be used to detect and / or measure some (e.g., TBEV). The embodiment detects tick-borne flavivirus (e.g., TBEV) related diseases or disorders. The use of one or more antibodies of the present invention in an assay for TBEV is intended. A diagnostic assay involves, for example, contacting a sample obtained from a patient with an anti-TBEV antibody. The anti-TBEV antibody may be labeled with a detectable label or reporter molecule. Alternatively, it can be used as a capture ligand for selectively isolating TBEV from patient samples. Alternatively, an unlabeled anti-TBEV antibody is a secondary antibody that is itself labeled to be detectable. It can be used in combination with other diagnostic applications. Detectable labels or reporter molecules emit Sex isotopes, e.g., H, C, P, S, or I; fluorescent or chemiluminescent moieties, e.g. fluorescein isothiocyanate or rhodamine; or enzymes, for example, alka Rephosphatase, β-galactosidase, horseradish peroxidase, or Lucif It may be an enzyme. It can detect mite-borne flaviviruses (e.g., TBEV) in a sample. Specific example assays that can be used for measurement include enzyme-linked immunosorbent assays. (ELISA), radioimmunoassay (RIA), and fluorescent cell sorting (FACS) It includes.

[0182] In another aspect, the present disclosure relates to the presence of mite-borne flaviviruses (e.g., TBEV) in a sample. A method for detecting the presence of (i) a sample being brought into contact with the above antibody or its antigen-binding fragment (ii) the process of developing an antimicrobial agent for one or more tick-borne flavivirus (e.g., TBEV) antigens. The process includes determining the binding of a body or antigen-binding fragment, and comprises one or more tick-borne flaviviruses. The binding of antibodies to the antigen (for example, TBEV) indicates that the tick-borne flavivirus (e.g., This further provides a method to demonstrate the presence of TBEV.

[0183] In some embodiments, the antibody or its antigen-binding fragment is conjugated to a label. In some embodiments, the detection step involves a secondary antibody being used to detect the antibody or its antigen-binding fragment. The secondary antibody includes contact with the secondary antibody, and the secondary antibody includes a label. In some embodiments, the label includes: This includes fluorescent labels, chemiluminescent labels, radioactive labels, and enzymes.

[0184] In some embodiments, the detection step includes detecting fluorescence or chemiluminescence. In some embodiments, the detection step includes a competitive binding assay or ELISA. .

[0185] In some embodiments, the method further includes bonding a sample to a solid support. In some embodiments, the solid support may contain microparticles, microbeads, magnetic beads, and It includes a biaffinity purification column.

[0186] Samples that can be used in a diagnostic assay for tick-borne flaviviruses (e.g., TBEV) include: A detectable amount of tick-borne flavivirus (e.g., TBEV) under normal or pathological conditions. ) Any tissue obtained from a patient that contains either protein or a fragment thereof Body fluid samples are included. Generally, healthy patients (e.g., tick-borne flaviviruses (e.g., TBEV in specific samples obtained from patients who do not have diseases related to TBEV By measuring protein levels, the baseline for tick-borne flaviviruses (e.g., TBEV) First, establish a line level or standard level. Then, tick-borne flaviviruses (e.g.) For example, this baseline level of TBEV and tick-borne flavivirus (e.g., TBEV) Obtained from individuals suspected of having EV-related conditions or symptoms associated with such conditions. The levels of mite-borne flaviviruses (e.g., TBEV) measured in the sample were compared with those levels. It is possible.

[0187] Antibodies specific to tick-borne flavivirus (e.g., TBEV) proteins are additional targets. It is not necessary to include a label or part, or the label or part of the N-terminus or C-terminus is not required. It may contain a portion. In one embodiment, the label or portion is biotin. Binding assay So, the position of the label (if present) is relative to the surface to which the peptide is bound. The orientation can be determined. For example, if the surface is coated with avidin, the N-terminus Peptides containing terminal biotin are configured such that the C-terminal portion of the peptide is distal to the surface. It is oriented to that position.

[0188] D. Kit In another aspect, the present disclosure relates to the drugs of the above-mentioned antibodies or their antigen-binding fragments or pharmaceutical compositions. The kit provides a scientifically acceptable dose unit for target tick-borne flaviviruses (e.g. For example, for the diagnosis, prognosis, or monitoring of TBEV-related infections or diseases. A kit comprising the antibody or its antigen-binding fragment described, and the antibody or its antigen binding A kit comprising at least one detection reagent that specifically binds to the fragment is also within the scope of this disclosure. ru.

[0189] In some embodiments, the kit also contains a container for the composition and, optionally, informational materials. Includes the vessel. The informational material is for the methods and / or therapeutic benefits of the agents described herein. This could be descriptive, instructional, marketing, or other material relating to its use. In one embodiment, as described above, the kit also includes additional therapeutic agents. For example, the kit includes a set It includes a first container for containing the product and a second container for additional therapeutic agents.

[0190] The information materials in the kit are not limited in form. In some embodiments, the information materials are This includes information regarding the composition's production, concentration, expiration date, batch or manufacturing location information, etc. This is possible. In one embodiment, the information material is used to treat a subject that needs it, for example. For example, a suitable dose, dosage form or mode of administration (for example, the dose, dosage form or This invention relates to a method of administering a composition (by administration method). In one embodiment, the description describes a composition or It provides additional therapeutic agent administration regimens, administration schedules, and / or routes of administration. Information may be in printed text, computer-readable materials, video recordings, or audio. The information is provided in various forms, including links or addresses to records or substantive materials. It can be provided.

[0191] The kit may include one or more containers for the composition. In some embodiments, The kit includes separate containers, dividers, or compartments for the composition and informational materials. For example. The composition may be contained in a bottle or vial, and the information material may be in a plastic sleeve. Alternatively, they can be contained in a packet. In other embodiments, separate elements of the kit are a single divided It is contained in a container that does not contain any other materials. For example, the composition may have information attached in the form of a label. They are housed in bottles or vials. In some embodiments, each kit is Multiple (e.g.) containing one or more unit dosage forms of a drug (e.g., dosage forms described herein) This includes the individual containers of the pack.

[0192] The kit may include, if applicable, a device suitable for administering the composition, or other suitable delivery device. The device may be supplied with one or both of the drugs pre-filled, or empty. It is also acceptable to use a kit that is suitable for filling. Such kits may, in some cases, contain It may also include a syringe to allow injection of the antibodies into animals such as humans. stomach.

[0193] E. Definition To aid in understanding the detailed description of compositions and methods in this disclosure, several explicit statements are provided. Definitions are provided to facilitate the clear disclosure of various aspects of this disclosure. Unless otherwise defined, Furthermore, all technical and scientific terms used herein belong to the technical field to which this disclosure pertains. It has the same meaning as that which is commonly understood by those skilled in the art.

[0194] As used herein, the term “antibody” refers to the entire antibody and any antigen-binding fragment thereof or It contains single-stranded antibodies. The entire antibody consists of at least two interconnected by disulfide bonds. It is a glycoprotein containing a heavy (H) chain and two light (L) chains. Each heavy chain has a variable heavy chain region. It consists of a heavy chain steady region (abbreviated as VH in this specification) and a heavy chain steady region. It consists of three domains, CH1, CH2, and CH3. Each light chain is a variable light chain region. It consists of a (abbreviated as VL in this specification) and a light chain steady region. The light chain steady region is It consists of one domain, CL. The VH and VL areas are framework areas. The Complementarity Determination Region (CDR) is a region that contains scattered areas of high conservation, known as (FR). It can be further subdivided into hypervariable regions. Each VH and VL is from the amino terminus to the carboxyl terminus. Towards that point, in the order of FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 It consists of three positioned CDRs and four FRs. Heavy chain variable region CDR and F R stands for HFR1, HCDR1, HFR2, HCDR2, HFR3, HCDR3, HFR4 The light chain variable regions CDR and FR are LFR1, LCDR1, LFR2, and LCDR 2. LFR3, LCDR3, and LFR4. The variable regions of the heavy and light chains interact with the antigen. It contains a binding domain that acts on the body. The constant region of the antibody is connected to various cells of the immune system (e.g., E A host tissue or factor containing a factor cell and the first component of the classical complement system (C1q). It can mediate the binding of immunoglobulins to [the target].

[0195] The “antigen-binding fragment or portion” of the antibody used herein (or simply “antibody fragment or The term "part" refers to one or more cleavages of an antibody that retain the ability to specifically bind to an antigen. It refers to a fragment. It has been shown that the antigen-binding function of antibodies can be performed by fragments of full-length antibodies. Examples of binding fragments included in the term “antigen-binding fragment or portion” of an antibody include (i ) Consists of Fab fragment, VL domain, VH domain, CL domain and CH1 domain (ii) Monovalent fragment; (ii) F(ab')2 fragment, linked by disulfide bridges in the hinge region. (iii) a bivalent fragment containing two Fab fragments; (iii) essentially having part of a hinge region Fab is Fab' fragment (FUNDAMENTAL IMMUNOLOGY(Paul See (ed., 3rd ed. 1993); (iv) VH domain and CH1 domain Fd fragment consisting of (v) from the VL domain and VH domain of a single arm of the antibody; (v) from the VL domain and VH domain of the antibody. A dAb fragment consisting of an Fv fragment and a (vi)VH domain (Ward et al., ( 1989) Nature 341:544-546); (vii) Isolated CDR; The rabini (viii) nanobody contains a single variable domain and two constant domains. One example is the heavy chain variable region. Furthermore, there are two domains of the Fv fragment, and VL and VH are separate. Encoded by individual genes, they use recombination methods to modify the VL region and These are constructed as single protein chains where the VH region pairs to form a monovalent molecule. It can be linked by a synthetic linker that enables this (known as single-strand Fv or scFv). (This is possible). For example, Bird et al. (1988) Science 242:42 3-426; and Huston et al. (1988) Proc. Natl. Ac See ad.Sci.USA 85:5879-5883). Such single strands Antibodies are also intended to be encompassed by the term "antigen-binding fragment or portion" of an antibody. These antibody fragments are obtained using conventional techniques known to those skilled in the art, and the fragments are inter Its usefulness is screened using the same methods as for other antibodies.

[0196] As used herein, "isolated antibodies" refers to other antibodies with various antigen specificities. This is intended to refer to antibodies that are not qualitatively present. Isolated antibodies are used with other cellular materials and / Alternatively, it may be substantially free of chemical substances.

[0197] The terms "monoclonal antibody" or "monoclonal antibody composition" as used herein "Monoclonal antibody composition" refers to a preparation of an antibody molecule with a single molecular composition. It exhibits a single binding specificity and affinity for the pitope.

[0198] The term "human antibody" refers to the fact that both the framework region and the CDR region are human germline immunity. It is intended to include an antibody having a variable region derived from the globulin sequence. Furthermore, the antibody If it contains a constant region, that constant region is also derived from a human germline immunoglobulin sequence. The human antibody of the present invention is an amino acid not encoded by a human germline immunoglobulin sequence. Acid residues (for example, by random or site-directed mutagenesis in vitro, or This may include mutations introduced by somatic mutations in vivo. However, this specification does not apply to mutations introduced by somatic mutations. The term "human antibody" refers to CDR antibodies derived from the germline of another mammalian species, such as mice. The column is not intended to contain antibodies grafted onto human framework sequences. stomach.

[0199] The term "human monoclonal antibody" refers to an antibody in which both the framework region and the CDR region are human A single binding-specific antibody having a variable region derived from germline immunoglobulin sequences. It refers to the body. In one embodiment, the human monoclonal antibody is a human heavy chain fused to immortalized cells. Transgenic non-human animals having genomes containing transgenes and human light chain transgenes For example, by a hybridoma containing B cells obtained from a transgenic mouse. It can be produced.

[0200] As used herein, the term "recombinant human antibody" refers to an antibody prepared, expressed, and processed by recombinant means. Any human antibody produced or isolated, for example, (a) human immunoglobulin gene transgenic or transchromosomal Animals (e.g., mice) that are al, or hybridomas prepared therefrom (b) Detached antibodies (as further described below), (b) transformed to express human antibodies From host cells, for example, antibodies isolated from transfectomas, (c) recombinant Antibodies isolated from a natrial human antibody library, and (d) other DNA sequences Prepared by any other means involving splicing of human immunoglobulin gene sequences. This includes antibodies that have been expressed, produced, or isolated. Such recombinant human antibodies are flamewright The CDR region and CDR region have variable regions derived from human germline immunoglobulin sequences. However, in some embodiments, such recombinant human antibodies are used for in vitro mutagenesis. (Alternatively, if using a transgenic animal for the human Ig sequence, in vivo...) (Can be subjected to cell mutagenesis), therefore, the amino acids in the VH and VL regions of recombinant antibodies The acid sequence is derived from and related to the human germline VH and VL sequences, but in vivo, it is human This sequence does not naturally exist within the antibody germline repertoire.

[0201] The term "isotype" refers to an antibody class encoded by a heavy chain constant region gene (for example) This refers to IgM or IgG1. "Antibodies that recognize an antigen" and "antibodies specific to an antigen." In this specification, the term "body" is used interchangeably with the term "antibody that specifically binds to an antigen." It will be done.

[0202] The term "human antibody derivative" refers to any modified form of a human antibody, for example, an antibody combined with another drug or This refers to a conjugate with an antibody. The term "humanized antibody" refers to a conjugate with another mammal species such as a mouse. An antibody in which a CDR sequence derived from the germline is grafted onto a human framework sequence. It is intended to refer to additional framework region modifications within the human framework sequence. It is possible.

[0203] The term "chimeric antibody" refers to an antibody in which the variable region sequence originates from one species and the constant region sequence originates from another species. The resulting antibody, for example, one in which the variable region sequence is derived from a mouse antibody and the constant region sequence is derived from a human antibody. The term is intended to refer to antibodies that result from a variable region sequence or CDR. Derived from one source (e.g., IgA1 antibody), with different constant region sequences or Fc values ​​from different sources. (For example, IgG antibodies, IgA2 antibodies, IgD antibodies, IgE antibodies or IgM antibodies, etc.) It can refer to antibodies derived from different antibodies.

[0204] The present invention relates to isolated or substantially purified nucleic acids, peptides, polypeptides or It includes proteins. In relation to the present invention, "isolated" nucleic acids, DNA molecules or R NA molecules or "isolated" polypeptides exist away from their natural environment, however These are nucleic acids, DNA molecules, RNA molecules, or polypeptides that are not naturally occurring products. The separated nucleic acids, DNA molecules, RNA molecules, or polypeptides exist in a purified form. It may be, or for example, it may exist in a non-natural environment such as a transgenic host cell. Good. A "purified" nucleic acid molecule, peptide, polypeptide or protein or If the fragments are produced by recombinant technology, they substantially replace other cell material or culture medium. If it does not contain, or if it is chemically synthesized, it substantially contains chemical precursors or other chemical substances. No. In one embodiment, the "isolated" nucleic acid is within the genomic DNA of the organism from which the nucleic acid originates. Nucleic acids (i.e., sequences located at the 5' and 3' ends of nucleic acids) have naturally adjacent sequences It does not include columns. For example, in various embodiments, isolated nucleic acid molecules are derived from the nucleic acid. Nucleic acid molecules within the genomic DNA of cells are naturally adjacent to approximately 5kb, approximately 4kb, and approximately 3kb. Nuclei less than approximately 2kb, less than approximately 1kb, less than approximately 0.5kb, or less than approximately 0.1kb It may contain an ocidal sequence. A protein, peptide, or poly that is substantially free of cellular material. Peptides make up less than approximately 30%, less than approximately 20%, less than approximately 10%, or less than approximately 5% (by dry weight). This includes preparations of proteins, peptides, or polypeptides containing a full amount of contaminating proteins. When the protein of the present invention or its biologically active portion is recombinantly produced, preferably The culture medium is less than approximately 30%, less than approximately 20%, less than approximately 10%, or about 5% (by dry weight). This term represents chemical precursors less than a certain value, or chemical substances other than the target protein.

[0205] The terms "polypeptide," "peptide," and "protein" are used interchangeably in this specification. Used to refer to a polymer of amino acids of any length. Polymers can be linear or branched. This often includes modified amino acids and may be interrupted by non-amino acid compounds. The term also refers to modified amino acid polymers, such as disulfide bond formation and glycosylation. Lipid addition, acetylation, phosphorylation, pegylation, or conjugation with a labeled component This includes any other operations. As used herein, the term "amino acid" means glycerin. Syn, and both D or L optical isomers, as well as amino acid analogs and peptide mimics. Contains natural and / or non-natural or synthetic amino acids.

[0206] The peptide "fragment" or polypeptide "fragment" used herein refers to a peptide less than its full length. Refers to peptides, polypeptides, or proteins. For example, peptide fragments or polypeptides. The fragments are at least approximately 3, at least approximately 4, at least approximately 5, at least approximately 10, and less At least about 20, at least about 30, at least about 40 amino acid lengths, or the length of a single unit thereof. It may have 6, 7, 8, 9, 10, 11, 12, 13, 1 The amino acid length can be 4, 15, 16, 17 or more. There is no upper limit. However, in some embodiments, the peptide fragment is less than approximately 500 amino acids. , with a length of less than approximately 400 amino acids, less than approximately 300 amino acids, or less than approximately 250 amino acids. It is possible. Preferably, when the peptide fragment is used for inoculation into an animal, it may trigger an immune response. It can induce this. The peptide fragment is a peptide fragment combined with an adjuvant. Peptide fragments bound to an adjuvant, or arsanilic acid, sulfanilic acid, acetyl By inoculating animals with peptide fragments bound to a picric group or a picric group, an immune response is triggered. It can be used to induce [something]. The peptide fragment can contain a non-amide bond, and the peptide It could be a Chid imitation.

[0207] When used herein, the term "conjugate" or "conjugate" as used herein refers to the term "conjugate" as used herein. "Conjugation" or "concatenated" refers to two or more entities that form one entity. It refers to the binding of molecules. Conjugates include peptide-small molecule conjugates and peptide- It includes both protein and peptide conjugates.

[0208] As used herein, the term “recombinant” refers to, for example, DNA splicing and transmutation. Recombinant DNA technology including sgenic expression is known in the art or by methods. The antibody of the present invention is produced, expressed, isolated, or obtained by... This refers to the antigen-binding fragment. The term is used in reference to non-human mammals (transgenic non-human mammals). A substance (e.g., including a transgenic mouse) or a cell (e.g., a CHO cell) Either expressed in the viticultural system or isolated from recombinant combinatorial human antibody libraries. It refers to antibodies that are produced.

[0209] "Nucleic acid" or "polynucleotide" refers to a DNA molecule (for example, not limited to DNA molecules). However, cDNA or genomic DNA) or RNA molecules (for example, but not limited to) This refers to mRNA, and includes DNA analogues or RNA analogues. A analog can be synthesized from nucleotide analogs. DNA molecules or RNA molecules are naturally Parts that do not naturally exist, such as modified bases, modified backbones, and deoxyribonucleotypes within RNA. It may contain substances such as d. Nucleic acid molecules can be single-stranded or double-stranded.

[0210] The term "substantial identity" or "substantially identical" when referring to nucleic acids or fragments thereof. This is optimally achieved through appropriate nucleotide insertion or deletion with another nucleic acid (or its complementary strand). If inmented, any well-known algorithm for sequence identity can be used as described below. For example, when measured by FASTA, BLAST, or GAP, nucleotides At least about 90% of the base, more preferably at least about 95%, 96%, 97%, and 9%. This indicates 8% or 99% nucleotide sequence identity compared to a reference nucleic acid molecule. Nucleic acid molecules that have qualitative identity are, in certain cases, encoded by a reference nucleic acid molecule. It may encode polypeptides having the same or substantially similar amino acid sequence as the lipeptide. ru.

[0211] When applied to polypeptides, the term “substantial similarity” or “substantially similar” The program GAP, which uses the default gap weights, also has two peptide sequences. When optimally aligned by BESTFIT, etc., at least 90% of the alignment Column identity, and more preferably at least 95%, 98%, or 99% sequence identity This means sharing. Preferably, non-identical residue positions are replaced by conservative amino acid substitutions. That's different. "Conservative amino acid substitution" is when a certain amino acid residue has similar chemical properties (for example) If, it is substituted by another amino acid residue having a side chain (R group) that has charge or hydrophobicity. This is what is being done. Generally, conservative amino acid substitutions substantially alter the functional properties of a protein. Do not change it. If two or more amino acid sequences differ from each other by conservative substitution, then similar The percentage or degree of sex may be adjusted upward to compensate for the conservative nature of substitution. Means for making this adjustment are well known to those skilled in the art. For example, as incorporated herein by reference. Pearson (1994) Methods Mol. Biol. 24:307 See -331. Examples of groups of amino acids with side chains having similar chemical properties include: 1) Aliphatic side chains: glycine, alanine, valine, leucine, and isoleucine; 2) Lipids Aliphatic-hydroxyl side chains: serine and threonine; 3) Amide-containing side chain: asparagine and glutamine; 4) Aromatic side chains: phenylalanine, tyrosine and tryptophan 5) Basic side chains: lysine, arginine, and histidine; 6) Acidic side chain: aspartate Examples include t and glutamate, as well as 7) sulfur-containing side chains: cysteine ​​and methionine. The preferred group of conserved amino acid substitutions is valine-leucine-isoleucine, phenyl Alanine-tyrosine, lysine-arginine, alanine-valine, glutamate-aspar These are tate and asparagine-glutamine. Alternatively, conservative substitutions are by reference. Gonnet et al. (1992) Science 25 is incorporated herein. The PAM250 log-likelihood matrix (log-likelihood) disclosed at 6:1443 45 Any change that has a positive value in the hood matrix. "Moderately conservative" The "na" permutation is any change that has a non-negative value in the PAM250 log-likelihood matrix. .

[0212] Polypeptide sequence similarity is typically measured using sequence analysis software. The protein analysis software analyzes various substitutions, deletions, and conserved amino acid substitutions. Match similar sequences using the similarity measure assigned to other modifications. For example, GCG software includes programs such as GAP and BESTFIT, and this is Used with fault parameters to distinguish between closely related polypeptides, for example, different ones. Sequences between homologous polypeptides from different species, or between wild-type proteins and their mutaines. Homology or sequence identity can be determined. For example, GCG Version 6 See .1. The polypeptide sequence is also a pro for GCG Version 6.1. Use FASTA, which is a gram, to compare with the default or recommended parameters. It is possible. FASTA (e.g., FASTA2 and FASTA3) is a query array and a query Provides the best alignment of overlapping regions and percent sequence identity between string sequences. (Pearson (2000) above). The sequence of the present invention and numerous sequences of different biological origins. Another preferred algorithm when comparing with a database that includes default parameters is Computer programs that use data include BLAST, particularly BLASTP or TBLAS TN. For example, Altschul et al., incorporated herein by reference, respectively. al. (1990) J.Mol.Biol.215:403-410 and (1997) Please refer to Nucleic Acids Res. 25:3389-3402.

[0213] As used herein, the term "affinity" refers to a single binding site of a molecule (e.g., antibody). ) and the sum of the strength of non-covalent interactions between it and its binding partner (e.g., antigen). Unless otherwise specified, as used herein, "binding affinity" refers to the relationship between the binding pairs. This refers to the intrinsic binding affinity that reflects the 1:1 interaction between molecules (e.g., antibody and antigen). The affinity of molecule X for its partner Y is generally expressed by the dissociation constant (KD). It is possible. Affinity is a general one known in the art, including those described herein. It can be measured by law.

[0214] The terms "specifically bind" or "specifically bind to" are used, for example, in physiological conditions. This refers to an antibody that binds to a single epitope but not to multiple epitopes. Antibodies that specifically bind to polypeptides are present on that polypeptide, but other polypeptides It binds to epitopes that are not present on the lipeptide. Specific binding is at least approximately 1 × 1 0 -8 It can be characterized by an equilibrium dissociation constant less than or equal to M (for example, the smaller KD, the denser the bonding). (This demonstrates that...). Methods for determining whether two molecules specifically bind are relevant to this technology. These are well known, and include, for example, equilibrium dialysis and surface plasmon resonance.

[0215] For example, antibodies are determined by surface plasmon resonance, such as BIACORE. In total, with "high affinity," that is, 1 × 10 -7 M or less, more preferably 5 × 10 -8 M or less, more preferably 3 × 10 -8 M or less, more preferably 1 × 10 -8 M and below, More preferably 5 × 10 -9 M or less, or more preferably 1 × 10 -9 M or less It binds to epitopes via KD. It "does not substantially bind" to proteins or cells. As used herein, the term does not bind or binds with low affinity to a protein or cell, i.e., with a KD of 1×10 M or greater, more preferably 1×10 -6 M or greater, still more preferably 1×10 -5 M or greater, still more preferably 1×10 -4 M or greater, still more preferably 1×10 -3 M or greater, and yet more preferably 1×10 -2 M or greater, and is intended to bind to a protein or cell with a KD such that it does not significantly compete with other antibodies for binding to the target.

[0216] As used herein, the term "Kassoc" or "Ka" is intended to refer to the association rate of a particular antibody-antigen interaction, whereas the term "Kdiss" or "Kd" as used herein is intended to refer to the dissociation rate of a particular antibody-antigen interaction. As used herein, the term "KD" is intended to refer to the dissociation constant obtained from the ratio of Kd to Ka (i.e., Kd / Ka) and expressed as a molar concentration (M). The KD value of an antibody can be determined using methods well established in the art. A preferred method for determining the KD of an antibody is by using surface plasmon resonance, preferably using a biosensor system such as a BIACORE system.

[0217] [[ID=四十]]An antibody that "competes with another antibody for binding to the target" refers to an antibody that inhibits (partially or completely) the binding of another antibody to the target. Whether two antibodies compete with each other for binding to the target, i.e., whether one antibody inhibits the binding of the other antibody to the target and to what extent, can be determined using known competition assays. Some In this embodiment, the antibody competes with another antibody against the target, and the binding of the other antibody to the target is blocked. At least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% Or it inhibits 100%. The level of inhibition or competition indicates which antibody is a "blocking antibody". It can vary depending on whether it is the target and the cold antibody that is initially incubated with it. Competitive assays include, for example, Ed Harlow and David Lane, Col. d Spring Harb Protoc; 2006, or Chapter 11 of “Using Antibodies” by Ed Harlow and D avid Lane,Cold Spring Harbor Laboratory Published in Press, Cold Spring Harbor, NY, USA, 1999. This can be done as follows: Competitive antibodies may target the same epitope, overlapping epitopes, or It binds to adjacent epitopes (for example, as demonstrated by steric hindrance). Combination assays include solid-phase direct or indirect radioimmunoassays (RIA), and solid-phase direct This is an indirect enzyme immunoassay (EIA), a sandwich competition assay (Stahli e et al., Methods in Enzymology 9:242 (1983) Reference); Solid-phase direct biotin-avidin EIA (Kirkland et al., JI See mmunol.137:3614(1986); solid-phase direct labeling assay, solid-phase direct Labeled sandwich assay (Harlow and Lane, Antibodies :A Laboratory Manual,Cold Spring Harbor See Press (1988); 1-125 Solid-phase direct labeling RIA using labeling (Mo (See rel et al., Mol.Immunol.25(1):7(1988)) Solid-phase direct biotin-avidin EIA (Cheung et al., Virology) 176:546(1990)); and directly labeled RIAs are included. (Moldenh auer et al.,Scand.J.Immunol.32:77(1990)) .

[0218] As used herein, the term "epitope" refers to the morphological characteristics of an antibody molecule known as a paratope. This refers to antigenic determinants that interact with specific antigen-binding sites within a variable region. It may have epitopes. Therefore, various antibodies can bind to various regions on the antigen, It can have various biological effects. The term "epitope" also refers to B cells and / or T cells. It refers to the site on the antigen to which the antibody responds. It also refers to the region of the antigen to which the antibody binds. Epitopes can be defined as structural or functional. Functional epitopes are generally... It contains a subset of structural epitopes and residues that directly contribute to the affinity of the interaction. Epitopes may also be three-dimensional, that is, composed of non-linear amino acids. In some embodiments, the epitope is a chemically active surface group of a molecule, for example. It may contain several determinants, such as amino acids, sugar side chains, phosphoryl groups, or sulfonyl groups. In the embodiment, it may have specific three-dimensional structural properties and / or specific charge properties. Taupes typically have at least 3, 4, 5, 6, 7, 8, 9 in their intrinsic spatial structure. , containing 10, 11, 12, 13, 14 or 15 amino acids. A given antibody contains which epi The method for determining whether something is bound to a tope (i.e., epitope mapping) is the technique used in this technology. It is well known in the field. Methods for determining the spatial three-dimensional structure of an epitope are available in this technical field. The techniques described herein, such as X-ray crystallography and two-dimensional nuclear magnetism Includes sounds (for example, Epitope Mapping Protocols in Methods in Molecular Biology,Vol.66,GE See Morris, Ed. (1996).

[0219] The term "epitope mapping" refers to the process of identifying molecular determinants for antibody-antigen recognition. It refers to.

[0220] Regarding antibodies or antibody fragments, the terms "binding to an epitope" or "recognizing an epitope" "To recognize" refers to a continuous or discontinuous segment of amino acids within an antigen. Those skilled in the art will understand this. The term refers to a situation where an antibody or antibody fragment is in direct contact with any amino acid in the epitope sequence. I understand that this doesn't necessarily mean that.

[0221] Regarding two or more antibodies, the term "binding to the same epitope" means that the antibodies bind to the same amino acid. This means joining consecutive or discontinuous segments that overlap or contain each other. To anyone skilled in the art, the phrase "binding to the same epitope" means that the antibody is binding to exactly the same amino acid. I understand that this does not necessarily mean that the antibody binds to or comes into contact with an acid. The exact amino acids that come into contact may differ. For example, the first antibody may be bound by the second antibody. Completely enclosed by the amino acid segment, bound to the amino acid segment In another example, the first antibody is bound to one or more cells by the second antibody. It binds to one or more segments of an amino acid, which significantly overlap with the ligation. For the purpose of targeting, such antibodies are considered to "bind to the same epitope."

[0222] As used herein, the term “immune response” refers to the biological response within a vertebrate to an exogenous factor. This refers to a medical response, which is caused by these factors and the diseases they trigger. To protect organisms from harm. The immune response involves immune system cells (e.g., T lymphocytes, B lymphocytes, etc.). Natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells, or neutrophils Spheres) and soluble macromolecules (antibodies) produced by either these cells or the liver. The invading pathogens are mediated by the action of cytokines and complements. Infected cells or tissues in the body, cancerous or other abnormal cells, or autoimmune or In the case of pathological inflammation, selective targeting of normal human cells or tissues, binding to them, and damage are observed. This results in injury, destruction of those injuries, and / or their removal from the body of a vertebrate. In response, for example, T cells, for example, effector T cells or Th cells, for example, CD This includes activation or inhibition of 4+ or CD8+ T cells, or inhibition of Treg cells. ru.

[0223] As used herein, the term "detectable label" refers to, but is not limited to, radioactive labels. Topography, phosphor, chemiluminescent material, chromophore, enzyme, enzyme group Quality, enzyme cofactor, enzyme inhibitor, chromophore, dye, metal ion, metal sol, ligand (for example) (biotin, avidin, streptavidin or hapten), intercalator color This refers to detectable molecules, including elements. The term "phosphor" refers to a substance that exhibits fluorescence within a detectable range. This refers to a substance or part thereof that can produce [a certain substance].

[0224] In many embodiments, the terms “subject” and “patient” refer to a subject receiving any form of treatment. Used without distinction, regardless of whether it is currently being received or not. Used herein In this case, the terms "subject" and "subjects" are limited It is not something that should be done, but mammals (for example, cows, pigs, camels, llamas, horses, goats, rabbits) Geckos, sheep, hamsters, guinea pigs, cats, dogs, rats and mice, non-human primates Any vertebrate, including monkeys (such as crab-eating macaques and chimpanzees) and humans This may refer to a human or non-human. In a more exemplary embodiment, a mammal. is a human. When used herein, "the subject that needs it" or "the subject that needs it" The phrase "patients requiring treatment" refers to those with disabilities (for example, neuronal disorders, autoimmune diseases, and cardiovascular disorders). Having one or more symptoms or signs of a vascular disease, and / or being diagnosed with an inflammatory disorder This refers to humans or non-human mammals. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0225] As used herein, the term “disease” means a condition in which normal function is impaired, affecting humans as well. Alternatively, it reflects an abnormal condition in the animal's body or a part of it (e.g., an inflammatory disorder), and is typical It is expressed by distinguishing between signs and symptoms, and is related to the lifespan or living conditions of humans or animals. In terms of degrading quality, the terms "disorder" and "pathology" (as in medical conditions) and generally They are intended to be synonymous and are used interchangeably.

[0226] As used herein, the term "to treat" or "to cure" any disease or disorder means to "cure" or "cure" any disease or disorder. In one embodiment, the term "treatment" means improving a disease or disorder (i.e., disease, (or stopping or reducing the onset of at least one of its clinical symptoms) In another embodiment, “to treat” or “to treat” may be unrecognizable to the patient. This refers to improving at least one physical parameter. In yet another embodiment, "To treat" or "to cure" can mean physically (e.g., stabilizing recognizable symptoms) or physiologically. Specifically, modulate the disease or disorder by (for example, stabilizing physical parameters) or both. It refers to doing. In yet another embodiment, “to treat” or “to treat” a disease or This refers to preventing or delaying the onset, development, or progression of a disorder.

[0227] The terms "prevent", "preventing", and "prevent "prevention", "prophylactic treat" "ment)" etc. refers to individuals who do not have a disability or condition, but who are at risk of developing a disability or condition. To reduce the probability of developing a disability or condition in a person who is or is prone to developing one. It refers to.

[0228] The terms "decrease", "reduced", "decrease" "reduction", "decrease", or "inhibit". In this specification, "ibit" generally refers to a statistically significant decrease. It is used for "reduced" or "decrease". However, to avoid misunderstanding, use "reduced" or "decrease". (reduction) or "decrease" or "inhibit" "Inhibit" means a decrease of at least 10% compared to the reference level, for example, less Approximately 20%, or at least approximately 30%, or at least approximately 40%, or a small At least 50%, or at least 60%, or at least 70%, or This represents a decrease of at least approximately 80%, or at least approximately 90%, or less than 100% (example). For example, levels that do not exist compared to the reference sample, or levels 10 to 10 compared to the reference level. This means any decrease of 0%.

[0229] As used herein, the term “drug” means a chemical compound, a mixture of chemical compounds, or an organism. Macromolecules (e.g., nucleic acids, antibodies, proteins or parts thereof, e.g., peptides), or organisms such as bacteria, plants, fungi, or animal (especially mammals) cells or tissues. It means an extract made from scientific materials. Due to the activity of such drugs, Drugs have biological, physiological, or pharmacological effects that act locally or systemically on the target. It can be suitable as a "therapeutic agent," which is an active substance (or a combination of substances).

[0230] As used herein, the term “therapeutic agent” "therapeutic capable agent" or The term "treatment agent" is used without distinction, and when administered to the target... This refers to a molecule or compound that has some beneficial effect on something. Beneficial effects include the ability to make a diagnosis. Efficacy; improvement of disease, symptoms, disorder, or pathological condition; manifestation of disease, symptoms, disorder, or pathological condition To reduce or prevent; and generally to fight against disease, symptoms, disorders or pathological conditions. It includes doing.

[0231] The term "therapeutic effect" is recognized in this field and refers to the effect of a pharmacologically active substance. This is caused in animals, especially mammals, and more specifically in humans, locally or systemically It refers to a specific effect.

[0232] The terms "effective dose," "effective dosage," or "effective administration" refer to the amount required to achieve the desired effect, It is defined as an amount sufficient to achieve, at least partially, the "cure" of a drug or therapeutic agent. The "therapeutic dose" or "therapeutic effective dosage" refers to the amount used alone or in combination with another therapeutic agent. In such cases, the severity of disease symptoms decreases, and the frequency and duration of periods without disease symptoms increase. or regression of the disease as demonstrated by the prevention of functional impairment or disability resulting from the suffering caused by the disease. It is any amount of the drug that promotes [something]. The "prophylactic effective dose" or "prophylactic effective dosage" of a drug is To subjects at risk of developing the disease or at risk of disease recurrence, either alone or separately. When administered in combination with other therapeutic agents, the drug is administered in amounts that inhibit the onset or recurrence of the disease. Therapeutic agents or prophylaxis that promote disease regression or inhibit the onset or recurrence of the disease. The ability of an inhibitor can predict its effectiveness in humans, for example, in human subjects during clinical trials. By assaying the activity of drugs in animal model systems or in vitro assays... This can be evaluated using various methods known to those skilled in the art.

[0233] Dosage is often expressed in relation to body weight. Therefore, [g, mg or other units] Doses expressed as ] / kg (or g, mg, etc.) are used when the term "body weight" is explicitly mentioned. Even if not specified, it is usually [g, mg or other units] " / kg (or g, mg, etc.) It refers to "heavy".

[0234] As used herein, the terms “composition” or “pharmaceutical composition” are useful within the present invention. at least one component, and a carrier, stabilizer, diluent, dispersant, suspending agent, thickener and / Or it refers to a mixture with other components such as excipients. A pharmaceutical composition is a biological product that contains one or more of the present inventions. This facilitates the administration of the components.

[0235] As used herein, the term “pharmaceutically acceptable” means the biological activity of the composition. This refers to materials such as carriers or diluents that do not negate the properties and are relatively non-toxic, in other words, Furthermore, the materials do not cause undesirable biological effects, or contain them. It can be administered to an individual without any harmful interaction with any of the components of the composition.

[0236] As used herein, the term “pharmaceutically acceptable carrier” means its intended function. The present invention relates to transporting or delivering the compound into or to a target in order to achieve this purpose. A pharmaceutically acceptable salt, pharmaceutically acceptable material, composition or carrier, for example, Includes liquid or solid fillers, diluents, excipients, solvents, or encapsulating materials. Typically Such compounds can be transferred from one organ or part of the body to another organ or part of the body. Partially carried or transported. Each salt or carrier is compatible with the other components of the formulation. It must be "acceptable" in the sense that it is not harmful to the subject. Pharmaceutically acceptable. Some examples of materials that can function as carriers include sugars, such as lactose and glucose. and sucrose; starch, for example, corn starch and potato starch; Cellulose and its derivatives, such as sodium carboxymethylcellulose and ethyl cellulose. Cellulose and cellulose acetate; tragacanth powder; malt; gelatin; talc; excipients, For example, cocoa butter and suppository waxes; oils, for example, peanut oil, cottonseed oil, safflower oil Sesame oil, olive oil, corn oil and soybean oil; glycols, e.g., propylene glycol Polyols; for example, glycerin, sorbitol, mannitol and polyethylene Glycols; esters, e.g., ethyl oleate and ethyl laurate; agar; slow Auxiliary agents, e.g., magnesium hydroxide and aluminum hydroxide; alginate; pyrolytic agents Free water; isotonic saline solution; Ringer's solution; ethyl alcohol; phosphate buffer; diluent; granulation Agents; lubricants; binders; disintegrants; wetting agents; emulsifiers; colorants; release agents; coating agents; sweeteners Agents; flavoring agents; fragrances; preservatives; antioxidants; plasticizers; gelling agents; thickeners; hardening agents; solidifying agents; Suspensioning agents; surfactants; water-retaining agents; carriers; stabilizers; and other non-toxic substances used in pharmaceutical formulations. Examples include compatible substances, or any combination thereof. When used herein, "Pharmacologically acceptable carrier" also refers to the activity and compatibility of one or more components of the present invention, and Any coating, antibacterial agent, and antifungal agent that is physiologically tolerable for elephants This includes agents, as well as absorption retarders. Auxiliary active compounds may also be incorporated into the composition.

[0237] As used herein, “combination” therapies are, unless otherwise indicated by the context, in a coordinated manner. This means, but does not limit, the administration of two or more therapeutic agents, but does not include simultaneous administration. Includes. Specifically, combination therapy involves the administration of one therapeutic agent having some effect on the administration of another therapeutic agent. Subject to adjustment by method, simultaneous administration (e.g., administration of co-formulations or separate therapeutic agents) This includes both simultaneous administration of the composition and sequential or continuous administration. For example, a certain therapeutic agent It can only be administered after a different therapeutic agent has been administered and acted upon for a predetermined period of time. For example, see Kohrt et al. (2011) Blood 117:2423. I want to be treated that way.

[0238] As used herein, the terms “concurrent administration” or “concurrently administered” mean “to the subject.” This refers to the administration of at least two drugs or therapies. In some embodiments, it refers to two or more drugs. The simultaneous administration of the drug / therapy is simultaneous. In other embodiments, the first drug / therapy is administered simultaneously with the second drug. / Administered before therapy. Those skilled in the art will know the formulation of the various drugs / therapies used and / or they understand that the route of administration may vary.

[0239] As used herein, the term “to bring into contact” is used with respect to any set of components. In such cases, the components to be brought into contact are mixed in the same mixture (for example, in the same compartment or solution). (This may include any process) and does not necessarily require actual physical contact between the enumerated components. The listed components may be in any order or any combination (or partial combination) It can come into contact with one or more of the listed components, and depending on the circumstances, other This may include situations in which the listed components are subsequently removed from the mixture before being added. For example, "to bring A into contact with B and C" includes any and all of the following situations: (i (ii) Mix A with C, then add B to the mixture; (ii) Mix A and B into the mixture (iii) Remove B from the mixture, then add C to the mixture; and (iii) Add A to B and C Add to the mixture.

[0240] The terms "sample," "test sample," and "patient sample" may be used interchangeably in this specification. The sample may be serum, urinary plasma, amniotic fluid, cerebrospinal fluid, or a sample of cells or tissue. The sample is prepared in any way as described herein or as known in the art. To modify the properties of the sample, it may be used directly as if it were obtained from a patient, or Pretreatment by filtration, distillation, extraction, concentration, centrifugation, inactivation of interfering components, and addition of reagents. It may be understood. The terms “sample” and “biological sample” as used herein generally refer to anti Testing on and / or suspected of containing the target analyte, such as the human body. This refers to biological material. The sample can be any tissue sample originating from the subject. It may contain proteins.

[0241] As used herein, the term “in vitro” means not within a multicellular organism but artificially. This refers to events that occur in an environment, such as inside a test tube or reaction vessel, or within a cell culture.

[0242] As used herein, the term "in vivo" refers to events occurring within multicellular organisms such as non-human animals. This refers to the phenomenon.

[0243] As used herein, the singular forms "a," "and," and "the" are used only when the context is clear. Unless otherwise specified, it includes multiple references.

[0244] As used herein, the terms "including" and "comp" are used to mean "including" or "comp "rising"), "contains", or "having" g) and its variations are, unless otherwise specified, the items and their averages listed thereafter. It means to include equivalents and additional subjects.

[0245] When used herein, "in one embodiment," "in various embodiments," and "how many" Phrases such as "In that embodiment" are used repeatedly. Such phrases are not necessarily the same. This does not necessarily refer to the same embodiment, but unless otherwise indicated in the context, it may refer to the same embodiment. ru.

[0246] As used herein, the terms "and / or" or " / " are used in relation to this term. This means any one of the items, any combination of items, or all of the items.

[0247] As used herein, the term “substantially” does not preclude “completely.” For example, a composition that "substantially" "does not" contain Y does not have to contain Y at all. Accordingly, the term "substantially" may be omitted from the definition of this invention.

[0248] As used herein, the term “each” means, when used in reference to a set of items, a set It is intended to identify individual items within a set, but does not necessarily refer to all items within the set. Not necessarily. Exceptions apply when explicit disclosure or context clearly indicates otherwise. It is possible that this could happen.

[0249] As used herein, the terms “approximately” or “about” refer to one or more values ​​of the subject. When used, it refers to a value similar to the stated reference value. In some embodiments, the term "o Unless otherwise specified or it is clear from the context, use "yoso" or "yaku" (that way) (Except when the number of eels exceeds 100% of the possible value) in either direction of the stated reference value (Greater than or less than) 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14% 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% This refers to the range of values ​​that fall within 1% or less. Unless otherwise specified herein, the term " "Approximately" means close to the equivalent enumerated range with respect to the functionality of individual components, compositions, or embodiments. It is intended to include values, such as weight percentages.

[0250] As disclosed herein, several ranges of values ​​are provided. Unless otherwise clearly stated in the context. Unless otherwise specified, each unit between the upper and lower limits of that range, up to one-tenth of the lower limit. It is understood that the intervening values ​​are also specifically disclosed. Any description within the stated range. The value or intervening value and any other value or intervening value within the specified range. Each smaller range between the values ​​is included in the present invention. The upper and lower limits may independently be included in or excluded from the range, either limit or the other. Each range that falls within the range of either the limit or the range of the smaller of both limits is also included in this The invention is encompassed within its scope and subject to any specifically excluded limits within the described scope. If the defined range includes one or both of the limits, then either of the limits that include them The present invention also includes the range excluding both of the above.

[0251] Any use of any example or illustrative language (e.g., "etc.") provided herein The use of this invention is merely intended to further clarify the present invention and is not otherwise claimed. Unless otherwise specified, this does not limit the scope of the present invention. Any language used herein is particularly limited. It should not be interpreted as indicating that elements not claimed are essential for carrying out the invention.

[0252] All methods described herein, unless otherwise specified herein, or in context of The order may be any preferred order, as long as it does not clearly contradict the provided method. In relation to this, the steps of the method may be performed simultaneously or sequentially. If the process is performed in any order, unless otherwise specified, the process may be carried out in any order. Where combinations are involved, unless otherwise specified herein, any combination or part of the process is not permitted. The partial combination is included within the scope of this disclosure.

[0253] Any publications, patent applications, patents, and other references cited herein are not inconsistent with this disclosure. Unless otherwise specified, the entirety is incorporated by reference. Publications disclosed herein are the same as those disclosed herein. This is provided only for disclosures prior to the filing date of the Ming Dynasty. Nothing in this specification is provided prior to the filing date. This is interpreted as an acknowledgment that the present invention has no prior rights in such publications by the present invention. It should not be done. Furthermore, the publication date provided may differ from the actual publication date, and in reality The publication date may need to be checked independently.

[0254] The examples and embodiments described herein are for illustrative purposes only and in light of them Various modifications or changes are shown to those skilled in the art, and the purpose and scope of this application and the attached patent application It is understood that it should be included within the scope of the request. [Examples]

[0255] F. Examples [Example 1] This embodiment illustrates the materials and methods used in the following subsequent embodiments.

[0256] Human subjects and clinical information From individuals previously hospitalized with confirmed TBEV infection, or from hospital in Ceske Budejovice (Approval Number 103 / 19), Biology Center ter of the Czech Academy of Sciences (approval number) Issue 1 / 2018) and Rockefeller University (IRB DR) Under the protocol approved by the Ethics Committee of O-0984) in the Czech Republic, České - Obtaining consent from individuals previously vaccinated against TBEV in Budějovice Peripheral blood samples were obtained. Clinical data were collected at the treatment hospital, and the severity of the disease was assessed according to the following scale. The severity was assessed as follows: mild, fever, fatigue, nausea, headache, back pain, joint / muscle pain, and neck pain. It is defined as meningitis, characterized by rigidity of the back, and is influenza-like with meningeal irritation. Symptoms: Moderate, defined as meningoencephalitis, with previous symptoms accompanied by tremor, dizziness, somnolence, and photophobia. Symptoms; severe, manifested as encephalitis, encephalomyelitis or cerebrospinal radiculitis, ataxia, oscillating motion Long-term neurological symptoms include changes in mental state, memory loss, quantitative impairment of consciousness, and paralysis. (Bogovic, P., and Strle, F., (2015) World J Clin Cases 3,430-441;Ruzek,D.,et al.,(20 19) Antiviral Res 164,23-51).

[0257] Processing and storage of blood samples Peripheral blood mononuclear cells (PBMCs) were obtained by gradient centrifugation using Ficoll, and frozen. The samples were stored in liquid nitrogen in a culture medium (90% FCS, 10% DMSO). Before the experiment, serum was used. Aliquotes (infected blood bank donors, vaccinated blood bank donors and random blood The fluid (derived from a liquid bank donor) was heat-inactivated at 56°C for 1 hour, and then stored at 4°C.

[0258] Protein expression and purification The EDIII antigen was expressed in E. coli and purified from inclusion bodies as previously reported. Robbiani,DF,et al.,(2017)Cell 169,597- 609 e511);Sapparapu,G.,et al.,(2016)Natu re 540,443-447). TBEV strain Neudoerfl(TBEV) WE NC _001672.1) residues 299-397, or Sofjin strain (TBEV FE ;U niProtKB P07720) and Vasilchenko strain (TBEV Si ;A Expression vector containing a codon-optimized sequence encoding residues 301-397 of F069066) Using a marker, untagged EDIII protein, or C-terminal 6XHis-Avit It produced an EDIII protein containing ag. Unlike other tick-borne flaviviruses, it did not have a tag. Similarly, constructs encoding EDIII were constructed (POWV stock LB, GenBank). L04636.1; POWV isolate DTV; KFDV strain W-377, JF416960. 1; LGTV strain TP21-636, NC_003690.1; LIV isolate LI3 / 1, KP144331.1; OHFV strain Bogoluvovska (NC_005062). The expression plasmid was transformed into BL21(DE3) E. coli, and 1 mM isopropyl β-D- Cells were induced with 1-thiogalactopyranoside (IPTG) at 37°C for 4 hours. Then, the insoluble fraction containing the inclusion bodies is solubilized, and 400 mM L-arginine is added at 4°C. 0 mM Tris base pH 8.0, 2 mM EDTA, 0.2 mM phenylmethylsulfate Honylfluoride, 5 mM reduced and 0.5 mM oxidized glutathione, and 10% Refolded in glycerol. 20 mM Tris pH 8.0, 150 ml Size exclusion chromatography in M ​​NaCl and 0.02% NaN3 (Superde The refolded protein was purified using x 75 (Cytiva). DIII was concentrated to 10-20 mg / mL.

[0259] As described in previous tests, generate T025 F(ab) for structural testing. (Keeffe, JR, et al., (2018) Cell Rep 25,1385-1394.e1387;Robbiani,DF,et al. ,(2017)Cell 169,597-609 e511;Robbiani,D. F.,et al.,(2020)Nature 584,437-442;Wang, Q.,et al.,(2020)Cell Host Microbe 28,335 -349.e336). In summary, using appropriate heavy chain plasmids and light chain plasmids The Expi293 cells (Life Technologies) were transiently transferred. By performing this action, F(ab) containing a 6XHis purified tag is expressed at the C-terminus of the heavy chain. This was done using Ni-NTA affinity chromatography (Cytiva), followed by 2 Size in 0mM Tris pH8.0, 150mM NaCl, and 0.02% NaN3 Expression using exclusion chromatography (Superdex 200; Cytiva) His-tagged F(ab) was purified from the supernatant. Fab was concentrated to approximately 15 mg / mL.

[0260] Sequence analysis As previously described, the antibody sequence was analyzed (Robbiani, DF, et a l., (2020) Nature 584, 437-442). In particular, trimming the sequence Igblastn v.1.14.0 (Ye, J., et al., (2013)N ucleic Acids Research 41, W34-W40) and Chan ge-O toolkit v.0.4.5(Gupta,NT,et al.,( Using Bioinformatics 31,3356-3358 (2015), an The sequences were paired using sequences from the same cell, and GitHub (https: / / git The organization (hub.com / stratust / igpipeline) was available at Using the R and Perl scripts within the system, we divide the clones based on the V and J genes. They found it. Nucleotide somatic high-frequency mutations and CDR3 length, as previously described. The analysis was performed using R and Perl scripts within the organization (Robbiani, DF). ., et al., (2020) Nature 584, 437-442). High-frequency mutations. The analysis was based on the closest germline of Igblastn. 7 from this study A public database of 76 IGH CDR3 sequences and memory B cell receptor sequences. Based on 22,654,256 IGH CDR3 sequences (DeWitt, WS) .,et al.,(2016)PLOS ONE 11,e0160853),Guy HR Hydrophobic Scale (Guy, HR (1985) Biophysical J) ournal 47,61-70;Kyte, J., and Doolittle, R. F., (1982) J Mol Biol 157, 105-132) and R pac kage Peptides(https: / / journal.r-project. org / archive / 2015 / RJ-2015-001 / RJ-2015-001 The hydrophobic GRAVY score was calculated using the .pdf file. All CDR3 from this study Sequence GRAVY score, and 5,000 randomly selected from public databases. The distribution was determined using the Shapiro-Wilk test with GRAVY scores. We used Wilcoxon's nonparametric test to examine the significant difference in hydrophobicity.

[0261] Frequency distribution of the V gene in anti-TBEV antibodies derived from 6 infected donors, and Sequenc e Read Archive accession SRP010970 was compared (Rub elt,F.,et al.,(2012)PLoS One 7,e49774). V The gene assignment is based on the above analysis and uses sequences that have a unique CDR3. The frequency was calculated for 6 infected donors. A two-tailed t-test with unequal variances was used for statistical analysis. The significance was determined. WebLogo(Crooks,GE,et al.,(20 04) Using Genome Res 14,1188-1190), each antibody set or A sequence logo was generated from the left alignment CDR3 sequence.

[0262] Protein biotinylation Follow the manufacturer's instructions (Avidity) for Biotin-Protein Ligas Using the e BIRA kit, TBEV with AVI tags FE Biotinylation of EDIII and streptavidin-PE (BD Biosciences, 554061) and Streptoavidin-Alexa Fluor 647 (Biolegend, 4052) Conjugated to 37). Follow manufacturer's instructions for EZ Sulfo-NHS-LC- Biotinylation kit (Thermo Scientific, A3925) 7) Use to biotinylate ovalbumin (Sigma, A5503-1G) and Leptavidin BV711 (BD Biosciences, 563262) contains conjugate The sample was gated. Biotinylation was confirmed by ELISA before use in flow cytometry. did.

[0263] Single cell sorting CD19 microbeads (Miltenyi Biotec, 130-050-301) PBMCs derived from sample 111 were enriched for B cells by positive selection using ). Negative selection (Miltenyi Biotec, 130-101-638) PBMCs derived from all donors were enriched for B cells. All selection protocols were the manufacturer's. The procedure was carried out according to the instructions. Anti-human antibody anti-CD3-APC-eFluro 780 (Invi trogen, 47-0037-41), anti-CD8-APC-eFluro 780(I nvitrogen, 47-0086-42), anti-CD14-APC-eFluro 7 80 (Invitrogen, 47-0149-42), anti-CD16-APC-eFlu ro 780 (Invitrogen, 47-0168-41), anti-CD20-PECy 7 (BD Biosciences, 335793) and Zombie NIR (Bi In the presence of oLegend (423105), fluorophor-labeled EDIII and ovo Albumin-containing FACS buffer (1x phosphate-buffered saline (PBS), 2% calf blood) Concentrated B cells were incubated on ice for 30 minutes in pure 1 mM EDTA. FA Using CS Aria III (Becton Dickinson), 96 wells A single CD3 in each well of the plate. - CD8 - CD14 - CD16 - Zombie NIR - CD20 + Ova - EDIII-PE + EDIII-AF647 + B cell selection Each well was treated with 0.5×PBS, 10mM DTT, and 3000 units / mL RN. Dissolve 4 μL containing an ASIN ribonuclease inhibitor (Promega, N2615). A buffer solution was added. The selected cells were flash-frozen on dry ice, and then at -80°C. Saved. The antibody sequence is a small CD20 + Because it is derived from cells, it is derived from memory B cells. The antibody gene was PCR amplified using IgG-specific primers.

[0264] Antibody sequencing, cloning, and expression SuperScript III Reverse Transcriptase(I Using nvitrogen (18080-044), reverse transcription of single-cell derived RNA. Nested PCR and subsequent Sanger sequencing revealed the variable IGH gene, The obtained cDNA was stored at -20°C until the variant IGL gene and variable IGK gene were amplified. Saved. Nested PCR amplification to antibody expression vector and S as previously described. sequence-and ligation-independent cloning As a template for (SLIC), the amplicon obtained from the first PCR reaction was used. (Robbiani, DF, et al., (2020) Nature 584, 437-442). As previously detailed, recombinant monoclonal antibodies are produced and purified. (Klein, F., et al., (2014) J Exp Med 211, 2) 361-2372). Pierce(trademark) Fab Preparation Kit (T Hermo Scientific (44988) used T036 F(ab) The second F(ab')2 was generated.

[0265] Plasmid for generating reporter virus particles (RVPs) West Nile virus subgenome replica encoding sea lice ciferase REN expression plasmid (pWNVII-Rep-REN-IB) and ZIKV CprME The expression plasmid had been obtained in advance from Ted Pierson (NIH) (Pi erson, TC, et al., (2006) Virology 346,53- 65;Robbiani,DF,et al.,(2017)Cell 169,5 97-609 e511). ZIKV CprME expression plasmid digested with restriction enzymes and By ligation, the following CprME expression of other flaviviruses is achieved: I made him do it: TBEV: Tick-borne encephalitis virus, Western European subtype strain N CprME code corresponding to eudoerfl (GenBank NC_001672) Sequence (5': Polylinker and Kosack sequence GGATTCGCGGCCGCCTC) AGG (sequence number 237) is adjacent, and at 3' are the stop codon and polylinker TAATA. GTTAATTAACTCGAGCCGCGG are adjacent; ("CprME adjacent") The synthetic DNA possessed by primer DFRp1532(5-GGAATTCGCGGCCGC CTCAGG) (Sequence ID 238) and DFRp1533 (5-GCGGCTCGAG After amplification using TTAATTAA) (SEQ ID NO: 239), plasmid pPOWV-L Cloning was performed at the NotI and PacI sites of B-CprME (see below), and p We obtained TBEV-WE-CprME.

[0266] POWV-LB: POWV LB strain (GenBank: L06436.1, low complexity) To reduce the number of occurrences, the four synonymous variations are shown in lowercase and bold;

[0267] [ka]

[0268] [ka]

[0269] Synthetic DNA containing the CprME sequence (underlined) is used with primer DFRp1511(5-A TCTACGTATTAGTCATCGCTATTA) (Sequence No. 241) and DFR p1514(5-ACCGCGGCTCGAGTTAATTAA)(Sequence ID 242) PCR amplification was performed using the plasmid pZIKV-HPF-CprME(Robbiani, DF, et al., (2017) 169, 597-609 e511) Eco1 Cloning was performed at sites 05I and SacII to obtain pPOWV-LB-CprME. Ta.

[0270] POWV-DTV: Utilized a 3-piece assembly PCR strategy. pZIKV-HFP- From upstream of the CMV promoter within CprME to just downstream of the start of the C code region, D NA,

[0271] [ka]

[0272] PCR amplification was performed using the POWV-DTV C coding sequence (Pry A fragment fused with (in bold) within RU-O-26690 was obtained. Aaron Brault The mold DTVp1 (Kenney, JL, et al., (2 018)Vector Borne Zoonotic Dis 18,371-381 Using ) and based on DTV's Spooner stock,

[0273] [ka]

[0274] PCR using this method can be used to target CM to the region immediately downstream of the SacII site in the DTV genome. A fragment overlapping with the V promoter-DTV C fusion was generated. The nucleotides in bold are: This shows synonymous mutations introduced to remove the SacII site. DTVp1 as the template. Furthermore

[0275] [ka]

[0276] DNA is amplified using this method, and envelope proteins are coagulated from the dead SacII sites. A fragment overlapping to the end of the d region, followed by the SacII region, was generated. Three DNA sections were obtained. Anneal the piece, stretch it, and then apply primer RU-O-24611 and RU- PCR amplification was performed using O-26688. The resulting DNA fragments were analyzed using SnaBI and Sa Digestion with cII and cloning into similarly digested pZIKV-HPF-CprME Then, pPOWV-DTV-CprME was generated.

[0277] KFDV: Kyasanur fever disease virus W-377 strain (GenBank JF41) Synthetic DNA with a CprME flanking sequence of 6960.1) is used with primer DFRp1532 And after amplification using DFRp1533, plasmid pPOWV-LB-CprME (See above) Cloning was performed at the NotI and PacI sites, and pKFDV-W- We obtained 377-CprME.

[0278] LGTV: Primer DFRp1563 (5-GGAATTCGCGGCCGCCTC AGGATGGCCGGGAAGGCCGTTCTA) (Sequence No. 249) and DFR p1566(5-CCGCGGCTCGAGTTAATTAACTATTAGGCTCC Using AACCCCCAGAGTCAT) (Sequence ID 250), Sonja Best Ph.D.(Rocky Mountain Laboratories of NIH / NI Rangat virus isolate TP21-6 from plasmid provided courtesy of AID. After amplifying 36 CprMEs, the NotI region of plasmid pPOWV-LB-CprME was selected. Cloning was performed at the site and PacI site, and pLGTV-TP21-636-CprME was obtained. Obtained. Two nucleotide mutations (A590G) from GenBank NC_003690. (and A1893C).

[0279] LIV: C of the jumping disease virus isolate LI3 / 1 (GenBank KP144331) Synthetic DNA with prME flanking sequences is used with primers DFRp1532 and DFRp15 After amplification using 33, the NotI site of plasmid pPOWV-LB-CprME and We cloned the PacI site and obtained pLIV-LI3 / 1-CprME.

[0280] OHFV: Omsc hemorrhagic fever virus Bogoluvovska strain (GenBank N) Synthetic DNA with a CprME flanking sequence (C_005062) is used with primer DFRp15 After amplification using 32 and DFRp1533, plasmid pPOWV-LB-Cpr Cloning was performed at the NotI and PacI sites of ME to obtain pOHFV-CprME. Ta.

[0281] To confirm that there are no PCR induction errors, the entire PCR-derived region is added to the final plasmid. The arrangement was determined by placing it there.

[0282] RVP production Follow the manufacturer's instructions for Lipofectamine 2000 (Invitrogen) Using (1166803), 1 μg of pWNVII-Rep-REN-IB plasmid The Lenti cell line tolerates 3 μg of the optimal flavivirus CprME plasmid. RVP was produced by co-transfecting with -X 293T. A 6-well plate coated with 1 x 10 6 Cells / well 24 hours prior to cell Sowing was performed. After transfection and incubation at 37°C for 6 hours, Excess DNA-lipid complexes were removed by aspiration, and the culture medium was treated with 20 mM HEPES and 1 It was replaced with DMEM (Gibco) containing 0% FBS. Over the next 72 hours, 2 At 4-hour intervals, the RVP-containing supernatant was collected and filtered through a 0.45 micron filter. Freeze at -80°C and add the culture medium to DMEM containing 20 mM HEPES and 10% FBS. It was exchanged for this. The frozen RVP was later thawed and titrated using Huh-7.5 cells, and the cells were found to be blood 1 × 10⁻⁶ in the absence of clean water or antibody 6 The dilution of RVP expressing RLU was determined.

[0283] RVP neutralization assay 50 μL of DMEM supplemented with 10% FBS and 1% non-essential amino acids (NEAAs) In Gibco, 7,500 Huh-7.5 cells / well were seeded into a 96-well plate. After 24 hours, 100 μL of diluted RVP was mixed with 100 μL of diluted serum or antibody. Combined with the mixture, incubate at 37°C for 1 hour, then add 50 μL of the mixture to the seeded cells. Three units were added. RVP was added to BA-1 diluent (1% BSA and 100 units / mL penicillin / Dilute appropriately with Medium 199 (Lonza) supplemented with streptomycin. This achieves the desired RLU expression. After incubation at 37°C for a further 24 hours, the culture medium is then used. Aspirate from the cells and replace with 35 μL of lysis buffer (Promega, E2810), then pre- The sample was frozen at -80°C. Renilla Luciferase Assay Sy Sea lizard luciferase expression using stem (Promega, E2810) For the measurement, 15 μL of thawed lysis buffer was used. Serum was neutralized with TBEV RVP. Dilute to a final concentration of 1:600,000 for screening, or serially dilute. A curve was created. Recombinant monoclonal antibody was used at a final concentration of 10 μg / mL for neutralization. The assay was serially diluted 1:3 for the assay. (Prism software (GraphPad)) By nonlinear regression analysis using the maximum half-neutralization titer (NT), 50 ) and maximum half-dose inhibition Concentration (IC 50 ) was determined. Cross-neutralization screen for flavivirus RVP on the panel. In the training, recombinant antibody was administered at a final concentration of 1 μg / mL using the protocol described above. The results were then compared to a control without antibody. In experiments using antibody fragments, equimolar concentrations of antibodies were used. Fragments and immunoglobulins were used. In RVP experiments using antibody combinations, T03 Use 6 at 1 μg / mL, 4G2 (clone D1-4G2-4-15; Sigma Catalog Log MAB10216) was used at a final concentration of 10 μg / mL.

[0284] ELISA assay Standard ELISA can determine whether serum IgG antibodies or combinations of antibodies are used against the EDIII protein. The binding of the replacement IgG antibody was measured. 250 ng of EDIII protein / well in PBS. This allows a highly binding 96-well plate (Costar, 07-200-721) to be heated at room temperature. It was coated overnight. Then the plate was 0.1 mM EDTA in PBS, 0.0 The samples were blocked at room temperature for 2 hours using 5% Tween and 2% BSA. Diluted with ST, added to a plate, and incubated at room temperature for another hour. Injugated secondary goat anti-human IgG F(ab')2 fragment (Jackson Immuno) unoresearch (109-036-088) is diluted to 1:5,000 with PBS-T. The mixture was then added to a plate and incubated again at room temperature for 1 hour. Between each step, PBS was used. The plate was washed four times with -T. TMB substrate (ThermoScientific The plates were finally developed using (34021). The reaction was stopped using 1M sulfuric acid. The plate was then read at 450 nm. Serum was diluted 1:500 and screened for binding. The recombinant monoclonal antibody was diluted to 10 μg / mL and then serially diluted in a 1:3 ratio. This was done. By nonlinear regression analysis using Prism 8 (GraphPad), semi-effective Concentration (EC 50 ) was determined. For cross-binding assays, flavivirus EDIII Using an protein panel, recombinant antibody was administered at a concentration of 1 μg / mL according to the protocol described above. The study was conducted using the anti-HIV monoclonal antibody 10-1074 as an isotype control. (Mouquet, H., et al., (2012) Proc Natl Aca (d Sci USA 109, E3268-3277). Isotype control signal Antibodies with an optical density greater than 2.5 times that of the test line were considered to be cross-reactive. EIA TBE virus IgG (TBG0) in Clinical Diagnostics 96) Using the kit and the EIA TBE virus IgM (TBM096) kit, A TBEV clinical trial was conducted (Tables 1A and 1B).

[0285] Viruses and cells The low-passage TBEV strain Hypr is from České Budějovice, Czech Republic. ection of Arboviruses,Institute of Paras itology,Biology Center of the Czech Acad emy of Sciences(http: / / www.arboviruscoll Provided by (ection.cz / index.php?lang=en). Ils was contracted in 1953 in Brno, Czech Republic (formerly Czechoslovakia). It was first isolated from the blood of a 0-year-old child. The low-passage TBEV strain Neudoerfl is F. Provided courtesy of Professor X. Heinz (Medical University of Vienna, Austria). The virus was discovered in Austria in 1971 by Dani Ixodes lysinus (Ixodes r It was first isolated from *Icinus*. Before use in in vitro experiments, the virus strain was bred. The cells were grown in the brains of milk mice and / or in BHK-21 cells.

[0286] 3% fetal bovine serum, 100 U / mL penicillin, 100 μg / mL streptomycin and Leibovitz (L-15) medium supplemented with 1% L-glutamine (Sigma -Aldrich, Prague, Czech Republic) PS cells (porcine kidney stable) at 37°C ( Kozuch, O. and Mayer, V., (1975) Acta Virol 1 9,498) were cultured.

[0287] Plaque assay To determine the viral titer in cell culture supernatant, a slight modification was made (Forma nova,PP,et al.,(2019)J Neuroinflammati (on 16,205), as previously noted (De Madrid, AT, an d Porterfield, JS (1969) Bull World Healt (h Organ 40,113-121) Plaque assays were performed. In summary, 10 1.3 × 10⁻¹ 20⁻¹⁰ virus + PS cell suspension 5 Cells / well) in 24-well tissue culture The solution was added to the culture plate. After incubation at 0.5% CO2, 37°C for 4 hours, each well was... Carboxymethylcellulose (1.5% in L-15 medium) was layered on top. 37°C and 0. After incubation in 5% CO2 for 5 days, the cell monolayer can be made using naphthalene black. The data was visualized. Viral titer was expressed as plaque-forming units (pfu) / milliliter.

[0288] Virus neutralization test (VNT) With some modifications, as previously described (Sirmarova, J., et al.) al.,(2014)Ticks Tick Borne Dis 5,523-52 7) VNT was performed. In summary, monoclonal antibodies (T025, T028, T034) were used. Dilute T038) to 2.5 μg / ml in L-15 medium, then in a 96-well plate. The antibody was serially diluted 1:2 in a tub. The diluted monoclonal antibody was then placed in a tub at a rate of 50 pfu / well. With BEV-Hypr (sufficient to induce 90-95% cell lysis) at 37°C for 9 Incubated for 0 minutes. Then, 5 x 10 per well. 4 Individual PS cells were added. After incubation at 37°C for 4 days, cytopathic effects (CPE) were monitored under a microscope. Install and follow the manufacturer's instructions for Cell Counting Kit-8 (Dojind (Molecular Technologies, Inc., Munich, Germany) Cell viability was measured using GraphPad Prism (version 7.04). (GraphPad Software, San Diego, California, USA) From two independent experiments conducted in eight consecutive units, the maximum half-dose inhibitory concentration (IC) was determined. 50 ) was calculated.

[0289] The effect of antibodies on viral replication Monoclonal antibodies (T036, T038 and 10-1074) were mixed in L-15 medium. Dilute to 0.5 or 0.05 μg / ml and in a 96-well plate, TBEV-Hypr( 50 pfu / well) or TBEV-Neudoerfl (500 pfu / well or The solution was incubated with 2,500 pfu / well at 37°C for 90 minutes. After vaping, 5 x 10 per well 4 Individual PS cells were added. 37°C and 0.5% After incubation with CO2 for 24 and 48 hours, the culture medium is collected and processed as described above. The viral titer was determined by the Lark assay, and the cell monolayer was cooled with cold acetone-methanol (1 :1) Fixation, blocking with 10% fetal bovine serum, previously described (Stefanik, M., et al., (2020) Microorganisms sms 8) Mouse anti-flavivirus antibody (1:250 dilution, D1-4G2-4-15; The cells were incubated with Sigma catalog MAB10216. After washing, the cells were f Luorecein isothiocyanate (FITC; 1:500 dilution, Sigma catalog AP) Labeled with a secondary goat anti-mouse antibody conjugated to 181F), 4',6-dia Counterstaining was performed using midino-2-phenylindole (DAPI, diluted to 1 μg / mL). The cell nucleus was then visualized. Fluorescence signals were detected using an Olympus IX71 epifluorescence microscope. The images were recorded and processed using ImageJ software.

[0290] Virus-cell binding assay TBEV (Hypr strain; 100 PFU) in 3% fetal bovine serum and 100 U / mL penicillin. L-1 supplemented with phosphorus, 100 μg / mL streptomycin, and 1% L-glutamine Monoclonal antibodies in 5 culture medium (Sigma-Aldrich, Prague, Czech Republic) or pre-incubated with the combined antibody at 37°C for 1.5 hours (T03 Use 6 and 10-1074 at 0.5 μg / ml, D1-4G2-4-15[4G2 (The solution was used at a final concentration of 10 μg / ml). Then, the pre-cooled solution was placed in a 6-well plate. A TBEV-antibody complex was added to a confluent PS cell monolayer (1 well). (mL). After 1 hour at 4°C, remove the inoculum and wash the cells three times with PBS to remove any unbound cells. The virus was removed. 3% fetal bovine serum, 100 U / mL penicillin, 100 μg / mL L-15 medium supplemented with streptomycin and 1% L-glutamine and 1.5% CM C was added (4.5 ml / well), and the temperature was changed to 37°C to infect the cells. 37 After incubation at °C and 0.5% CO2 for 5 days, the cell monolayer was removed using naphthalene black. Staining was performed using [a specific method] to visualize and count the plaques and the cells during the incubation process. The number of virus particles bound to the target was determined.

[0291] statistical analysis In all live virus experiments, logarithmic transformed data was used, followed by ANOVA and then Tuke. Multiple comparison tests and Student's t-tests were performed on y. (GraphPad Prism) m(version 7.04, GraphPad Software, San Francisco, California) Diego (USA) was used for the analysis. Otherwise, as specified, Mann-W Use Hitney's test or ANOVA and Tukey's multiple comparison test to compare data Analyze and use GraphPad Prism (version 8.4.3, GraphPad S Log-rank calculated by oftware (San Diego, California, USA) The Mantel-Cox test was used to analyze the comparison of survival curves. A p-value < 0.05 was considered statistically significant. They considered it to be.

[0292] Crystallization, structure determination, and refinement Mix the Fab and antigen in a 1:1 molar ratio and incubate at room temperature for 1-2 hours. A complex for crystallization was generated by this process. 0.2 μm in a sitting drop at 22°C. Crystallized complex of L and 0.2 μL of 0.1 M sodium citrate tribase dihydrate, pH 5.0 By combining it with 10% PEG 6000, T025 Fab-TBEV-W E EDIII-His-Avitag complex (space group P21; a=55.5Å, b=6 6.7 Å, c = 91.2 Å, α = 90°, β = 94.6°, γ = 90°; per asymmetric unit A crystal of one molecule was obtained. 0.2 μL of the crystalline complex was collected in a sitting drop at 22°C. 0.2 μL of 0.1 M sodium citrate tribase dihydrate, pH 5.0, 10% PEG-6 By combining with 000, T025 Fab-TBEV-FE EDIII-H is-Avitag complex (space group P21212; a=56.96Å, b=69.72Å c=180.20Å, α=90°, β=90°, γ=90°; 1 molecule per asymmetric unit Crystals of ) were obtained. 0.2 μL of the crystallized complex and 0.2 μL were obtained in a sitting drop at 22°C. 5% (+ / -)-2-methyl-2,4-pentanediol of L, 0.1M HEPES By combining pH 7.5 and 10% PEG 10,000, T025 Fab -TBEV-Si EDIII complex (space group P21; a=55.4Å, b=67.2Å c=91.2 Å, α=90°, β=94.8°, γ=90°; 1 molecule per asymmetric unit Crystals of ) were obtained. The crystals were cryoprotected with 25% glycerol. Sitting drop 0.2 μL of crystalline complex and 0.2 μL of 0.15 M lithium sulfate monohydrate in a container at 22°C By combining 0.1M citric acid pH 3.5 and 18% PEG 6,000 , T036 Fab-LIV EDIII complex (space group P1; a=67.0Å, b=6 7.9Å, c=82.4Å, α=88.0°, β=73.2°, γ=70.6°; asymmetric Crystals (2 molecules per unit) were obtained. After stepwise cryoprotecting the crystals in 25% glycerol... They were then frozen and stored in liquid nitrogen.

[0293] Using the Dectris Pilatus 6M detector, Stanford Syn chromotron Radiation Lightsource(SSRL) Beamra X-ray diffraction data (Table 6) was collected using In-12-2. The data was then processed using Mosflm(Batt). ye,TG,et al.,(2011)Acta Crystallogr D Integrated using Biol Crystallogr 67,271-281) and CCP 4(Winn,MD,et al.,(2011)Acta Crystallog Using r D Biol Crystallogr 67,235-242) The ring was created. Four 180° datasets obtained from the same crystal were linked using the T036-LIV method. For each crystal, data was collected using different detector distances, and then merged using CCP4. It was scaled. PHASER(McCoy,A.,et al.,(2007)J As a search model in Appl Crystallogr 40,658-674), P DB 2GHW-derived V H V L Domain and C derived from PDB 4OGX H C L Domain and By molecular substitution using TBEV EDIII derived from PDB 6J5F, T02 The structure of the 5-TBEV-WE EDIII complex was elucidated. Phenix(Adams,P .D.,et al.,(2010)Acta Crystallogr D Biol Refinement in Crystallogr 66, 213-221) and Coot (Em sley, P., and Cowtan, K., (2004) Acta Crystal Use logr D (Biol Crystallogr 60, 2126-2132). Using an iterative method involving manual reconstruction to a simulated annealing composite omission map, The Dell model was refined to a resolution of 2.24 Å. Residues that were not included in the model and were disordered were H C residues 214-219 and 6X His tag; LC residue 214; and residues 299- 302, 397, and 6X His tags in the TBEV-WE EDIII domain It was an AVI tag. Partially refined T025-TBEV-WE EDIII structure Using the structure as a molecular substitution model, T025-TBEV-FE EDIII and T0 The structure of the 25-TBEV-Si EDIII complex was similarly elucidated. T025-TBEV- The FE EDIII model was refined to a resolution of 2.35 Å, and T025-TBEV-WE E Using the iterative method described for DIII, T025-TBEV-Si EDIII model The Dell image was refined to a resolution of 1.86 Å. PHASER(McCoy, A., et al.) .,(2007)J Appl Crystallogr 40,658-674) The search model is derived from PDB 4OB5. H V L Domain and partially refined T 025-TBEV-WE EDIII structure-derived C H C L Domain and PDB 6J5F Molecular substitution using derived TBEV EDIII results in T036-LIV EDI The structure of complex II was elucidated. During the initial stages of refinement, the above counter-reactions, including noncrystallographic symmetry constraints, were identified. Using a recalculation strategy, the model was refined to 2.4 Å. The model was not included in the disordered area. The residues are HC residues 128-133, 188-190 (chain A), 214-219, and 6X His tag; residues 212-214 (chain L) or 213-214 (chain B) of LC; Furthermore, residues 301 and 397 (chain C) of the LIV EDIII domain were identified. Residue E98 in both copies of Fab within the asymmetric unit was not modeled. HC and S 94 LC In the nearby simulated annealing omission map (Phenix), extra density exists. We used the Kabat numbering scheme for Fab numbering. We superimposed the structure. Then, RMSD was calculated and a figure was created using PyMOL. PDBePISA(Kr issinel, E., and Henrick, K., (2007) J Mol Bi The buried surface area and hydrogen bonding were determined using ol 372,774-797). Fab antigen contact residues are defined as residues where the desired atom is within 4 Å of an atom on another protein. Identified. The distance and shape criteria used to assign hydrogen bonds were <4.0 Å. The distance and hydrogen bond angles were 90-270°. For van der Waals interactions... The maximum allowable distance was 4.0 Å.

[0294] Statement on animal ethics This research complies with all relevant European Union guidelines regarding animal handling work. Furthermore, Czech National Law Guidelines on the Use and Protection of Animals from Abuse in Laboratory Animals (A In accordance with the Animal Welfare Act No. 246 / 1992 Coll.) The protocol was established by the Committee on the Ethics of Animal Experimentation of the Institute of Parasitology and Departmental Expert Co mmitte for the Approval of Projects of Experiments on Animals of the Czech Acad Approved by the emy of sciences (license number 4253 / 2019).

[0295] Mouse and virus inoculation ENVIGO RMS BV (Horst, Netherlands) is free of specific pathogens. I obtained BALB / c mice. I gave them free access to a diet of sterile pellets and water. In this experiment as well, female mice aged 6-8 weeks were used. The mice were kept at a constant temperature of 22°C and 65% humidity. Under relative humidity and a 12-hour light-dark cycle, the rooms are individually ventilated and covered with wood chips. They were housed in a provided plastic cage (Techniplast). 3 mice per group. Mice were used in the experiment. The mice were given 200 µl of PBS one day before or one day after infection. Intraperitoneal inoculation with noclonal antibody T025 or 10-1074, followed by 100 pfu of TBE. V-Hypr was subcutaneously infected (and proliferated 8 times in the brains of suckling mice). The mice showed symptoms. We monitor their survival over time and euthanize them when they reach a humane endpoint. Ta.

[0296] [Example 2] Serological responses in TBEV infection cohorts Hospitalized with TBE during outbreaks in the Czech Republic in 2011 and 2018. Serum samples from 141 individuals were analyzed. Samples were obtained at the time of admission and during the encephalitis phase of the disease (Figure 1A). Holzmann, H., (2003) Vaccine 21, S36-S40). Previously Report (Bogovic, P., et al., (2018) Travel Med I nfect Dis 26,25-31;Bogovic,P.,and Strle, F., (2015) World J Clin Cases 3 430-441) and Therefore, the cohort consisted of males (61.1%) and older individuals (mean age = 49 years; Table 1A) Table 1B) was characterized by a higher incidence rate. In addition, randomly selected blood bandages were used. Control serum was collected from 168 donor cases and 10 individuals vaccinated against TBEV. The results obtained (Tables 1A and 1B) regarding the presence of IgG antibodies that bind to EDIII of TBEV. Then, the whole serum was screened by ELISA at a dilution of 1:500 (Figure 1B). The signal in stained individuals was significantly higher than in the vaccinated group and the blood donor group. ANOVA using Tukey correction yielded p=0.0159 and p<0, respectively. .0001; Figure 1B). TBEV EDIII ELISA reactivity and age or length of hospital stay. There was no correlation between the two (Figures 2A-O).

[0297] To evaluate serum neutralizing activity, luciferase-expressing TBEV reporter virus particles are used. Using (RVP; see "Methods"), samples obtained from recovered vaccinated individuals were processed. 1:6 × 10 for neutralization 5 Screened by dilution (Pierson, TC, e t al., (2006) Virology 346 53-65). Completely undetectable. Neutralizing activity in the range up to [value] was significantly lower in vaccinated individuals (p<0.0001; Figure 1C). This correlated with EDIII binding in ELISA (p=0.0004; Figure 2M). The maximum half-neutralizing titer (NT) of 28 infected individuals. 50 ) is 0.37~6.7×10 6 to It fluctuated (Figures 1D-E). In contrast, vaccinated individuals had a ratio of 0.32 to 1.0 × 10⁻⁶. 4 N T 50 This was shown (Figure 2N~O). In this cohort, individuals hospitalized due to TBEV infection. These individuals generally exhibit a higher and more widespread distribution of EDIII binding and neutralizing activity than vaccinated individuals. That was the conclusion I reached.

[0298] B-cell memory converges on specific antibody genes. To characterize anti-TBEV antibodies, six infected individuals were used (orange in Figures 1D and 1E). TBEV-specific B cells were purified from the peripheral blood of three vaccinated individuals (Figure 3A~). (D and Figure 4A). Circulating CD20 + In B cells, the frequency of TBEV EDIII-specific B cells The degree is for vaccinated individuals (1.28~5.95 x 10 -3 %) is more than the infected group (0.067~ 0.31% was higher. A total of 776 IgG antibody heavy chain genes and light chain genes. The pairs were amplified by RT-PCR and sequenced (Example 1, Figures 3B and 5D). (Tables 2A-2J). In IGVH and IGVL, the average somatic high-frequency mutation was 1, respectively. It consists of 8 and 9 nucleotides, and the length of CDR3 is normal (average CDRH3 length 13). .5, and average CDRL3 length 9.4), hydrophobicity is slightly increased compared to the control. (p<0.0001; Figures 4B~D) (Briney, B., et al., (2019) )Nature 566,393-397;Rock,EP,et al.,(19 94) J Exp Med 179, 323-328). HIV-1, Zika, Hepatitis B And like other viral pathogens, including SARS-CoV-2 (Robbiani, D. F.,et al.,(2017)Cell 169,597-609 e511;Ro bbiani,DF,et al.,(2020)Nature 584,437- 442;Scheid,JF,et al.,(2011)Science(New York, NY)333,1633-1637;Wang,Q.,et al.,(2 020)Cell Host Microbe 28,335-349.e336;We st,AP,et al.,(2012)Proc Natl Acad Sci (USA 109, E2083-20990), many of the sequences are from expanding B cell clones. This was found in (37.9%, Figures 3B and D).

[0299] Sequence analysis revealed antibodies with similar characteristics within and between individuals (Figure). 3B, Figures 3D and 3E, Tables 2A to 2J and 3). For example, VH1-69 and VH3-48 accounted for 59.2% and 7.5% of the total clonal sequence, respectively (Figure 3B). (and the shades of blue and red in Figure 3D). Furthermore, related gene combinations containing these VH genes The row was found in multiple donors (purple line in Figure 3E). In infected donors, VH1-69, The use of the VK2-28, VK1-33, and VL4-69 genes accounts for a significantly larger proportion. (p<0.01). The VH3-48, VK1-5, and VL2-14 genes were also enriched. However, this was not statistically significant (Figures 4E-G). Clonal expansion and propagation of IGVH1-69 / I In some cases, including GVK2-28 antibody and IGVK3-48 / IGVK1-5 antibody Therefore, sequence similarity between individual donors extends to IGH CDR3 and IGL CDR3. (Table 3, Figure 4H and Figure 4I). Memory B cell response to TBEV EDIII. They concluded that the results converge on a specific antibody gene.

[0300] A potent and broadly cross-reactive anti-TBEV antibody 59 antibodies (46 from the convalescent period, 13 from vaccine donors, Table 4) were cross-referenced. They were modified using recombinant DNA, expressed, and all three TBEV subtypes were tested. :Western European (TBEV) WE ), Far Eastern (TB EV FE ) and Siberian (TBEV Si (Figures 5A and 6A, and Table 5) The binding of 59 antibodies to the corresponding EDIII protein was tested using ELISA. All but one of them have similar maximum half-volume effective concentrations in the range of 0.2 to 12 ng / mL. EC 50 All three were then combined into EDIII (Figure 5B, Table 5).

[0301] When testing the neutralizing activity against TBEV RVP, 4 were obtained from infected donors. Of the 6 antibodies, 43 neutralized IC. 50 The level was low at 0.02 ng / mL (Figure 5C). (See Figure 5D and Table 5). In contrast, the best antibodies obtained from vaccine-vaccinated donors were 8.3 IC for ng / mL 50 The seven antibodies isolated from infected donors were all TB. It is a powerful neutralizing agent for EVs and ICs. 50 The value was less than 1 ng / mL (Figure 5D). True T Four of these antibodies were also evaluated for their ability to neutralize BEV (Figures 5E and 5F). All four antibodies showed potent activity, and IC 50 The range is 35.9-268.8 ng / mL This was within the range (Table 5).

[0302] To determine whether TBEV antibodies cross-react with the associated virus, Langatto Virus (LGTV), Jumping Disease Virus (LIV), Omsk Hemorrhagic Fever Virus (OHFV) , Kasanur Forest Disease Virus (KFDV), and Poissant lineages I and II Lus (POWV-DTV and POWV-LB; “Method” and Figures 6B and 6C) Regarding the binding of (see reference) to EDIII, TBEV antibody was used at a single concentration (1 μg / mL) The results were lean. Widespread cross-reactivity was observed in many of the antibodies tested (Figure 6B). Furthermore, to determine whether the antibodies are broadly neutralizing, the same panel of tick-borne viruses... Antibodies were screened against RVP corresponding to the drug. Tests were performed at a concentration of 1 μg / ml. In most cases, IGHV1-69 antibodies are LGTV, LIV, POWV-LB, and PO WV-DTV is neutralized, and one of the IGVH3-48 / IGVK1-5 antibodies is POWV-LB All RVPs except for [specific RVP] were neutralized (Figures 6B and 6C). [The text then describes the process for the flavivirus RVP panel.] IC 50 For some cross-reactive antibodies, the levels were in the single-digit ng / mL range (Figure 5G). (See Figures 6D-I; Table 5). For example, the IGVH3-48 / IGVK1-5 antibody T056 is It is a powerful neutralizing agent for LGTV, LIV, and OHFV, and IC 50 The value is 1 ng / mL or less. Several TBEV neutralizing antibodies are broadly active against tick-borne flaviviruses. They concluded that this was the case.

[0303] The antibody T036 promotes TBEV infection. In contrast to other antibodies, T036 is effective against TBEV infection and POWV-LB RVP infection. This showed dose-dependent enhancement (Figures 7A and 6D). The enhancement was due to T036 F(ab')2 This was also observed in F(ab), indicating that neither the divalent bond nor the Fc domain is necessary for enhancement. This was done (Figure 7A). To determine whether T036 enhances true TBEV infection A plaque reduction assay was then performed. When T036 was added, T038 (neutralizing antibody) or Compared to isotype controls, viral replication was increased (Figures 7B and 7C; Figure 8). A and Figure 8B).

[0304] A5 is a mouse monoclonal antibody against envelope domain II (EDII). This enhances viral fusion by exposing the E protein fusion loop. Activity can be inhibited by 4G2, fusion loop-specific mouse monoclonal (Has lwanter,D.,et al.,(2017)PLoS Pathog 13,e 1006643-e1006643. Infection caused by T036, a human anti-EDIII antibody. To determine whether augmentation can be hindered by 4G2, either alone or in combination, TBEV RVP infection was measured in the presence of T036 or 4G2 (Figure 7D). Consistent with the role of T036 in loop epitope exposure, the presence of both antibodies increases. Strong inhibition occurred, but 4G2 alone did not show a detectable effect (Figure 7D). Virus binding Similar results were obtained in the assay using genuine TBEV (Figure 7E). The results were T O36 enhances TBEV infection through a mechanism that requires exposure of the E protein fusion loop. This indicates strengthening.

[0305] The antibody T025 structure reveals its binding to the epitope in the outer ridge. To gain insight into the mechanism of neutralization by human anti-TBEV antibodies, all three types of TBEV are being studied. T025 is a broad-spectrum and potent antibody that forms a complex with the EDIII domain of type b. The crystal structure of Fab was elucidated (Figures 9A-D and 10A-B). T025 Fab- TBEV WE Based on the structure of the EDIII complex, the antibody is located in the EDI-EDIII hinge region. It binds to the vicinity of the outer ridge of nearby EDIII, and both the heavy and light chains are connected to EDI-EDII. Make contact with the I hinge and BC loop, and make contact with the DE loop of EDIII. This was revealed (Figure 9A). The antibodies were CDRH2, CDRH3, CDRL1 and CD Using RL3, contact EDIII, 598 Å 2The surface area is embedded on EDIII. (V H 333 Å 2 , and V L 265 Å 2 ). T025 is Asp100 H C and Trp94 LC Insert into the EDIII fissure and bridge the salt bridge (As p100 HC -Lys311 EDIII ) and form hydrogen bonds (Figure 9B). TBEV F E EDIII and TBEV Si T025 Fab that formed a complex with EDIII The crystal structure is T025-TBEV WE It is similar to the EDIII structure (RMSD = that 0.53 Å for 519 Cα atoms and 0.2 Å for 516 Cα atoms. 5 Å), 100% sequence conservation and one sequence among these three viral strains at the epitope residue. I did it (Figures 10A-B).

[0306] T025 Fab-TBEV WE Structure and mouse monochromatic cells bound to TBEV virion The 3.9 Å low-temperature EM structure of the 19 / 1786 antibody was compared with that of Fuzik, T. , et al., (2018) Nat Commun 9, 436). T025 and 1 9 / 1786 is V H V L So, <65% amino acid sequence identity, 47% in CDR. Although related by the identity of the no-acid sequence, the structural alignment of the structure due to the Cα atom of EDIII The comment states that the two antibodies recognize similar epitopes (Figure 9C) and take similar poses. This shows how T025 binds to the virus. To estimate the details regarding the neutralization of Russ, we used a lower-resolution low-temperature EM structure. It can be used. In addition to contact with EDIII, 19 / 1786 is adjacent to the subunit. It interacted with either EDI or EDII (Fuzik, T., et al.). (2018) Nat Commun 9,436). This is EDII by T025. Relatively low buried surface area on I (approximately 1100 Å) 2 Approximately 600 Å compared to typical values. 2 )and (Ramaraj, T., et al., (2012) Biochim Bio Phys Acta 1824, 520-532), T025, adjacent to natural vilion. This indicates contact with the domain. Similar to the recognition of billions by 19 / 1786, Of the 180 EDIII on the network, 120 may be combined by T025. It also has a sex.

[0307] The antibody T025 prevents and treats infections in mice. To determine whether anti-EDIII antibodies can provide protection from infection in vivo. Preventive experiments were conducted using BALB / c mice. 10 2 TBEV (Lethal Dose) of pfu 24 hours prior to the load, mice were given a graded dose of T025 (100-0.1 μg / m They administered (a substance). All mice treated with the isotype control antibody were on day 10. They died by [time] (n=6). In contrast, T025 was protective even at the lowest dose. Of the 24 mice administered the antibody, all but one survived (p<0.0001, figure). 10A). To test the potential of T025 treatment, 10 BALB / c mice were given 2 pf Infect with TBEV, then administer 30 μg of T025 or I after 1, 3, or 5 days. The sotype control was injected (Figure 10B). All 12 control mice were infected by day 13. In contrast, 12 of the 13 mice treated with T025 on day 1, and 12 of them were affected. Of the 13 mice treated on the third day after infection, 4 survived. Five days after infection, T025... None of the mice treated with this method responded. Therefore, with a broad-spectrum neutralizing human anti-TBEV antibody... In BALB / c mice, a certain T025 is effective in preventing and treating TBEV infection. .

[0308] Consideration Tick-borne flaviviruses can cause fulminant encephalitis for which there is no effective treatment. In Europe, Asia, and North America, public health concerns about this group of viruses are growing. Among the tick-borne flaviviruses that cause disease, TBEV is found in Central Europe. And it is prevalent in Russia. Regarding the polyclonal humoral immune response to TBEV. Although a lot of information exists (Albinsson, B., et al., (2018) Eu ro Surveill 23,pii=17-00838;Holzmann,H., (2003)Vaccine 21 S36-S40;Matveeva,VA,e t al.,(1995)Immunol 46,1-4;McAuley,AJ, et al.,(2017)NPJ Vaccines 2,5;Remoli,ME ., et al., (2014) Pathog Dis 73, 1-3), natural infection or The molecular properties of the neutralizing antibody response induced by vaccination are largely or completely unrelated. It is not understood. This example is a memo of 6 recovered individuals and 3 vaccinated individuals. This paper describes 776 antibodies obtained from Lee B cells, including those for tick-borne flaviviruses. There are several broad-spectrum and potent antidotes. Data shows that against TBEV and related pathogens... This pr...

Claims

1. An isolated antibody or its antigen-binding fragment that specifically binds to the tick-borne encephalitis virus (TBEV) antigen, comprising heavy chain variable regions and light chain variable regions, each containing the respective amino acid sequences of SEQ ID NOs. 19-20, 23-24, 29-30, 33-34, or 35-36.

2. The antibody or its antigen-binding fragment according to claim 1, wherein the antibody is a bivalent antibody or a bispecific antibody.

3. The antibody or its antigen-binding fragment according to claim 1 or 2, wherein the antibody is a monoclonal antibody.

4. The antibody or its antigen-binding fragment according to any one of claims 1 to 3, wherein the antibody is a chimeric antibody, a humanized antibody, or a humanized monoclonal antibody.

5. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, wherein the antibody is a single-chain antibody, a Fab fragment, or a Fab2 fragment.

6. The antibody or antigen-binding fragment according to any one of claims 1 to 5, wherein the antibody or antigen-binding fragment is detectably labeled or conjugated to a toxin, therapeutic agent, polymer, receptor, enzyme, or receptor ligand.

7. The antibody or antigen-binding fragment according to claim 6, wherein the polymer is polyethylene glycol (PEG).

8. A pharmaceutical composition comprising an antibody or antigen-binding fragment according to any one of claims 1 to 7, and optionally a pharmaceutically acceptable carrier or excipient.

9. The pharmaceutical composition according to claim 8, wherein the pharmaceutical composition comprises an antibody or antigen-binding fragment according to any one of two or more claims 1 to 7.

10. The pharmaceutical composition according to claim 8 or 9, wherein the pharmaceutical composition further comprises a second therapeutic agent.

11. The pharmaceutical composition according to claim 10, wherein the second therapeutic agent comprises an anti-inflammatory agent or an antiviral agent.

12. The pharmaceutical composition according to claim 11, wherein the antiviral agent comprises a nucleoside analog, a peptoid, an oligopeptide, a polypeptide, a protease inhibitor, a 3C-like protease inhibitor, a papain-like protease inhibitor, or an RNA-dependent RNA polymerase inhibitor.

13. The pharmaceutical composition according to claim 12, wherein the antiviral agent is selected from the group consisting of acyclovir, ganciclovir, vidarabine, foscarnet, cidofovir, amantadine, ribavirin, trifluorothymidine, zidovudine, didanosine, zalcitabine, and interferon.

14. The pharmaceutical composition according to claim 13, wherein the interferon is interferon-α or interferon-β.

15. Use of the pharmaceutical composition according to any one of claims 8 to 14 in the preparation of a pharmaceutical for the diagnosis, prevention, treatment, or combination thereof of conditions caused by tick-borne flavivirus infection.

16. A nucleic acid molecule encoding a polypeptide chain of an antibody or its antigen-binding fragment according to any one of claims 1 to 7.

17. A vector comprising the nucleic acid molecule described in claim 16.

18. A cultured host cell comprising the vector according to claim 17.

19. A method for preparing an antibody or its antigen-binding portion, To obtain the cultured host cells described in claim 18, The cultured host cells are cultured in a culture medium under conditions that express the polypeptide encoded by the vector and assemble the antibody or its fragments, and A method comprising purifying the antibody or fragment from the cultured cells or the culture medium of the cells.

20. A kit for monitoring the diagnosis, prognosis, or treatment of a target tick-borne flavivirus infection, comprising an antibody or antigen-binding fragment according to any one of claims 1 to 7, and at least one detection reagent that specifically binds to the antibody or antigen-binding fragment.

21. A composition for use in a method for neutralizing tick-borne flaviviruses in a target, The composition comprises a therapeutically effective amount of the first antibody or its antigen-binding fragment according to any one of claims 1 to 7, or a therapeutically effective amount of the pharmaceutical composition according to any one of claims 8 to 14. The method comprises administering the composition to a subject requiring it.

22. A composition for use in methods for preventing or treating tick-borne flavivirus infections, The composition comprises a therapeutically effective amount of the first antibody or its antigen-binding fragment according to any one of claims 1 to 7, or a therapeutically effective amount of the pharmaceutical composition according to any one of claims 8 to 14. The method comprises administering the composition to a subject requiring it.

23. The composition according to claim 21, further comprising administering a therapeutically effective amount of the second antibody or its antigen-binding fragment to the subject, wherein the first antibody or its antigen-binding fragment and the second antibody or its antigen-binding fragment exhibit synergistic activity.

24. The composition according to claim 22, further comprising administering a therapeutically effective amount of the second antibody or its antigen-binding fragment to the subject, wherein the first antibody or its antigen-binding fragment and the second antibody or its antigen-binding fragment exhibit synergistic activity.

25. The composition according to claim 23 or 24, wherein, in the method, the first antibody or its antigen-binding fragment is administered before, after, or simultaneously with the second antibody or its antigen-binding fragment.

26. The composition according to any one of claims 21 to 25, further comprising administering a therapeutically effective amount of the second therapeutic agent or therapy to the subject.

27. The composition according to claim 26, wherein the second therapeutic agent comprises an anti-inflammatory agent or an antiviral agent.

28. The composition according to claim 27, wherein the antiviral agent comprises a nucleoside analog, a peptoid, an oligopeptide, a polypeptide, a protease inhibitor, a 3C-like protease inhibitor, a papain-like protease inhibitor, or an RNA-dependent RNA polymerase inhibitor.

29. The composition according to claim 27, wherein the antiviral agent is selected from the group consisting of acyclovir, ganciclovir, vidarabine, foscarnet, cidofovir, amantadine, ribavirin, trifluorothymidine, zidovudine, didanosine, zalcitabine, and interferon.

30. The composition according to claim 29, wherein the interferon is interferon-α or interferon-β.

31. The composition according to any one of claims 26 to 30, wherein the antibody or its antigen-binding fragment is administered before, after, or simultaneously with the second therapeutic agent or treatment.

32. The composition according to any one of claims 21 to 31, wherein the antibody or its antigen-binding fragment is administered intravenously, subcutaneously, or intraperitoneally to the subject in the method described above.

33. The composition according to any one of claims 21 to 32, wherein the antibody or its antigen-binding fragment is administered prophylactically or therapeutically in the method described above.

34. A method for detecting the presence of mite-borne flaviviruses in a sample, A step of contacting a sample in vitro with an antibody or antigen-binding fragment according to any one of claims 1 to 7, The step includes determining the binding of the antibody or antigen-binding fragment to one or more tick-borne flavivirus antigens, A method wherein the binding of the antibody to one or more tick-borne flavivirus antigens indicates the presence of the tick-borne flavivirus in the sample.