Genetically modified meganucleases that target the human mitochondrial genome
Engineered MTEMs provide precise editing of mitochondrial genes, addressing inefficiencies in current editing methods by targeting and cleaving specific sequences, enhancing wild-type mtDNA levels and improving cellular function.
Patent Information
- Application Number
- JP2023564421
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2022-03-09
- Filing Date
- 2022-04-22
- Publication Date
- 2026-04-22
- Estimated Expiration
- 2042-04-22
AI Technical Summary
Current methods for mitochondrial genome editing are inefficient and unpredictable, leading to large-scale deletions and rearrangements, making precise editing of mitochondrial DNA (mtDNA) challenging, particularly in targeting specific genes without affecting surrounding regions.
Engineered mitochondrial-targeted meganucleases (MTEMs) that bind to and cleave specific recognition sequences in the mitochondrial genome, utilizing a combination of engineered meganucleases with mitochondrial translocation peptides and export sequences to achieve precise editing of mtDNA, allowing for targeted gene modification.
The MTEMs enable precise editing of mitochondrial genes, shifting the balance towards wild-type mtDNA, thereby reducing mutant mtDNA levels and improving cellular respiration, with potential therapeutic applications in treating mitochondrial disorders.
Smart Images

Figure 0007849677000027 
Figure 0007849677000028 
Figure 0007849677000029
Abstract
Description
[Technical Field]
[0001] This disclosure relates to the fields of molecular biology and recombinant nucleic acid technology. In particular, this disclosure relates to recombinant meganucleases genetically engineered to recognize and cleave recognition sequences found in the human mitochondrial genome. This disclosure further relates to the use of such recombinant meganucleases in methods for producing genetically modified eukaryotic cells, and to a population of genetically modified eukaryotic cells in which mitochondrial DNA has been modified.
[0002] Reference to sequence listings submitted as text files via EFS-WEB This application includes a sequence listing submitted via EFS-Web in ASCII format, the entire listing of which is incorporated herein by reference. The ASCII copy, created on April 21, 2022, is named P89339_0139_5_SeqList_4-21-22.txt and has a size of 80.6kb. [Background technology]
[0003] In all living organisms, mitochondria regulate cellular energy and metabolism under normal growth and development, as well as in response to stress. Many of the proteins that function in these roles are encoded in the mitochondrial genome. Therefore, mitochondrial genome editing has diverse applications in both animals and plants. In humans, harmful mitochondrial mutations are the cause of several disorders to which gene editing therapy can be applied.
[0004] Pathogenic mitochondrial DNA (mtDNA) mutations include large-scale rearrangements and point mutations in protein-coding, transfer RNA (tRNA), or ribosomal RNA (rRNA) genes. While the prevalence of mtDNA-related disease diagnosis is approximately 1 in 5,000, the population frequencies of the 10 most common pathogenic mtDNA mutations are much higher, approaching 1 in 200, meaning that many "normal" individuals carry low levels of mutant genomes (Non-Patent Literature 1).
[0005] Mutant mtDNA coexists with wild-type mtDNA in most cases (mtDNA heteroplasmy) in the patient's cells. Several studies have shown that wild-type mtDNA has a strong protective effect, and biochemical abnormalities were only observed when the level of mutant mtDNA was higher than 80-90% (Non-Patent Literature 2). It has been shown that muscle fibers develop OXPHOS deficiency only when the mutational load exceeds 80% (Non-Patent Literature 3). Therefore, any approach that can shift this balance even by a small percentage towards wild-type has strong therapeutic potential.
[0006] However, mtDNA manipulation remains an unexplored area of science because it is not possible to target mtDNA with high efficiency and produce precise edits. The mitochondrial genome is difficult to edit because it requires predictable repair mechanisms and the delivery of editing techniques to this organelle. Given the difficulties and unpredictability associated with mitochondrial genome editing, there is an unmet need for precise mtDNA editing that would open up an entire field of research and opportunity in life sciences. The ability to target and edit a defined region of the mitochondrial genome (preferably limited to just one gene) in a more predictable manner is a clear advantage over currently available systems. [Prior art documents] [Non-patent literature]
[0007] [Non-Patent Document 1] Schon et al., Nat Rev Gen 13:878-890 (2012) [Non-Patent Document 2] Schon et al., Nature Reviews Genetics 13:878-890 (2012) [Non-Patent Document 3] Sciacco et al., Hum Mol Genet, 3:13-19 (1994) [Overview of the Initiative]
Problems to be Solved by the Invention
[0008]
Means for Solving the Problems
[0009] Compositions and methods for the precise editing of mitochondrial genomes are provided herein. Until now, attempts at mitochondrial genome editing have resulted in large-scale and unpredictable deletions / rearrangements. The present invention demonstrates that engineered megonucleases can effect precise editing of mitochondrial DNA (mtDNA), thereby opening up an entire field of investigation and opportunity in the life sciences. The compositions and methods provided herein can be used to edit one specific mitochondrial gene without affecting surrounding regions.
[0010] In one aspect, the invention provides a mitochondrial-targeted engineered meg nuclease (MTEM) that binds to and cleaves a recognition sequence comprising SEQ ID NO: 1 in the mitochondrial genome of a eukaryotic cell, wherein the MTEM comprises an engineered meg nuclease bound to a mitochondrial translocation peptide (MTP), the engineered meg nuclease comprises a first subunit and a second subunit, the first subunit binds to a first recognition half-site of the recognition sequence and comprises a first hypervariable (HVR1) region, and the second subunit binds to a second recognition half-site of the recognition sequence and comprises a second hypervariable (HVR2) region.
[0011] In some embodiments, the HVR1 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the amino acid sequence corresponding to residues 24-79 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR1 region includes one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR1 region includes residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR1 region includes Y, R, K, or D in the residue corresponding to any one residue 66 of SEQ ID NOs: 3-12. In some embodiments, the HVR1 region includes any one residue 24-79 of SEQ ID NOs: 3-12 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region includes any one residue 24-79 of SEQ ID NOs: 3-12.
[0012] In some embodiments, the first subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with any one residue 7-153 of SEQ ID NOs: 3-12. In some embodiments, the first subunit includes a residue corresponding to any one residue 19 of SEQ ID NOs: 3-12. In some embodiments, the first subunit includes a residue corresponding to any one residue 80 of SEQ ID NOs: 3, 5, 7, 9, 11, or 12. In some embodiments, the first subunit includes G, S, or A in the residue corresponding to any one residue 19 of SEQ ID NOs: 3-12. In some embodiments, the first subunit includes E, Q, or K in the residue corresponding to any one residue 80 of SEQ ID NOs: 3-12. In some embodiments, the first subunit comprises any one residue 7-153 of SEQ ID NOs: 3-12, having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0013] In some embodiments, the HVR2 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region includes one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region includes residues corresponding to any one of the residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region includes a residue corresponding to any one of the residues 241 of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region includes a residue corresponding to any one of the residues 263 of SEQ ID NOs: 3 or 5-12. In some embodiments, the HVR2 region includes a residue corresponding to any one of the residues 264 of SEQ ID NOs: 3-6 or 8-12. In some embodiments, the HVR2 region includes a residue corresponding to residue 265 of SEQ ID NO: 6. In some embodiments, the HVR2 region includes Y, R, K, or D in the residue corresponding to any one of the residues 257 of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region includes one of the residues 215-270 of SEQ ID NOs: 3-12, which have up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions.
[0014] In some embodiments, the second subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with any one residue 198-344 of SEQ ID NOs: 3-12. In some embodiments, the second subunit includes a residue corresponding to any one residue 276 of SEQ ID NOs: 4. In some embodiments, the second subunit includes a residue corresponding to any one residue 330 of SEQ ID NOs: 3-12. In some embodiments, the second subunit includes G, S, or A in the residue corresponding to any one residue 210 of SEQ ID NOs: 3-12. In some embodiments, the second subunit includes E, Q, or K in the residue corresponding to any one residue 271 of SEQ ID NOs: 3-12. In some embodiments, the second subunit comprises one residue 198-344 of SEQ ID NOs: 3-12, having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0015] In some embodiments, the genetically engineered meganuclease is a single-stranded meganuclease containing a linker, the linker covalently bonding a first subunit to a second subunit. In some embodiments, the genetically engineered meganuclease contains an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to any one of SEQ ID NOs: 3-12. In some embodiments, the genetically engineered meganuclease contains an amino acid sequence of any one of SEQ ID NOs: 3-12. In some embodiments, the genetically engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to any one of SEQ ID NOs: 33-42. In some embodiments, the genetically modified meganuclease is encoded by one of the nucleic acid sequences SEQ ID NOs: 33-42.
[0016] In some embodiments, the MTP comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the sequence described in any one of SEQ ID NOs. In some embodiments, the MTP comprises an amino acid sequence described in any one of SEQ ID NOs. In some embodiments, the MTP is bound to the C-terminus of a genetically engineered meganuclease. In some embodiments, the MTP is bound to the N-terminus of a genetically engineered meganuclease. In some embodiments, the MTP is fused to the genetically engineered meganuclease. In some embodiments, the MTP is bound to the genetically engineered meganuclease by a polypeptide linker. In some embodiments, the genetically engineered meganuclease is bound to a first MTP and a second MTP. In some embodiments, the first MTP and / or the second MTP contain an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the sequence described in any one of SEQ ID NOs.43-45. In some embodiments, the first MTP and / or the second MTP contain an amino acid sequence described in any one of SEQ ID NOs.43-45. In some embodiments, the first MTP and the second MTP are identical. In some embodiments, the first MTP and the second MTP are not identical. In some embodiments, the first MTP and / or the second MTP are fused to a genetically modified meganuclease. In some embodiments, the first MTP and / or the second MTP are bound to the genetically modified meganuclease by a polypeptide linker.
[0017] In some embodiments, the MTEM is bound to an export sequence (NES). In some embodiments, the NES contains an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the sequence shown in SEQ ID NO: 46 or 47. In some embodiments, the NES contains the amino acid sequence shown in SEQ ID NO: 46 or 47. In some embodiments, the NES is bound to the N-terminus of the MTEM. In some embodiments, the NES is bound to the C-terminus of the MTEM. In some embodiments, the NES is fused to the MTEM. In some embodiments, the NES is bound to the MTEM by a polypeptide linker. In some embodiments, the MTEM is bound to a first NES and a second NES. In some embodiments, the first NES is bound to the N-terminus of the MTEM and the second NES is bound to the C-terminus of the MTEM. In some embodiments, the first NES and / or the second NES include an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the sequence shown in SEQ ID NO: 46 or 47. In some embodiments, the first NES and / or the second NES include an amino acid sequence shown in SEQ ID NO: 46 or 47. In some embodiments, the first NES and the second NES are identical. In some embodiments, the first NES and the second NES are not identical. In some embodiments, the first NES and / or the second NES are fused to the MTEM. In some embodiments, the first NES and / or the second NES are linked to the MTEM by a polypeptide linker.
[0018] In another embodiment, the present invention provides a polynucleotide comprising a nucleic acid sequence encoding the MTEM described herein. In some embodiments, the polynucleotide is mRNA.
[0019] In another embodiment, the present invention provides a recombinant DNA construct comprising a polynucleotide comprising a nucleic acid sequence encoding the MTEM described herein. In some embodiments, the recombinant DNA construct encodes a recombinant virus comprising a polynucleotide. In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adeno-associated virus (AAV). In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the polynucleotide comprises a promoter operably ligated to the nucleic acid sequence encoding the MTEM. In some embodiments, the promoter is a constitutive promoter, or the promoter is a myocyte-specific promoter, a skeletal muscle-specific promoter, a myotube-specific promoter, a muscle satellite cell-specific promoter, a neuron-specific promoter, an astrocyte-specific promoter, a microglia-specific promoter, an ophthalmocyte-specific promoter, a retinal cell-specific promoter, a retinal ganglion cell-specific promoter, a retinal pigment epithelium-specific promoter, a pancreatic cell-specific promoter, or a pancreatic beta cell-specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter.
[0020] In another embodiment, the present invention provides a plasmid comprising any recombinant DNA construct described herein. In another embodiment, the present invention provides a recombinant virus comprising a polynucleotide comprising a nucleic acid sequence encoding the MTEM described herein. In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adeno-associated virus (AAV). In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the polynucleotide comprises a promoter operably ligated to the nucleic acid sequence encoding the MTEM. In some embodiments, the promoter is a constitutive promoter, or the promoter is a myocyte-specific promoter, a skeletal muscle-specific promoter, a myotube-specific promoter, a muscle satellite cell-specific promoter, a neuron-specific promoter, an astrocyte-specific promoter, a microglia-specific promoter, an ophthalmocyte-specific promoter, a retinal cell-specific promoter, a retinal ganglion cell-specific promoter, a retinal pigment epithelium-specific promoter, a pancreatic cell-specific promoter, or a pancreatic beta cell-specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter.
[0021] In another embodiment, the present invention provides a lipid nanoparticle composition comprising lipid nanoparticles containing a polynucleotide, wherein the polynucleotide contains a nucleic acid sequence encoding an MTEM as described herein. In some embodiments, the polynucleotide is mRNA.
[0022] In another embodiment, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and the MTEM described herein.
[0023] In another embodiment, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier, a polynucleotide as described herein.
[0024] In another embodiment, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a recombinant DNA construct described herein.
[0025] In another embodiment, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a recombinant virus as described herein.
[0026] In another embodiment, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a lipid nanoparticle composition described herein.
[0027] In another embodiment, the present invention provides gene-modified eukaryotic cells comprising any polynucleotide described herein. In some embodiments, the gene-modified eukaryotic cells are gene-modified mammalian cells. In some embodiments, the gene-modified eukaryotic cells are gene-modified human cells.
[0028] In another embodiment, the present invention provides a method for producing a genetically modified eukaryotic cell, the method comprising introducing into a eukaryotic cell (a) a polynucleotide comprising a nucleic acid sequence encoding the MTEM described herein, wherein the MTEM is expressed in the eukaryotic cell, or (b) the MTEM described herein, wherein the MTEM creates a cleavage site in a recognition sequence comprising Sequence ID No. 1 in the mutant mitochondrial genome of the eukaryotic cell. In some embodiments, the cleavage site is repaired by non-homologous end joining so that the recognition sequence includes an insertion or deletion. In some embodiments, the mutant mitochondrial genome containing the recognition sequence is degraded in the genetically modified eukaryotic cell. In some embodiments, approximately 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the mutant mitochondrial genome containing the recognition sequence is degraded in gene-modified eukaryotic cells. In some embodiments, the ratio of wild-type mitochondrial genome to mutant mitochondrial genome containing the recognition sequence is increased in gene-modified eukaryotic cells. In some embodiments, the ratios are approximately 5:95, 10:90, 15:85, 20:80, 25:75, 30:70, 35:65, 40:60, 45:55, 50:50, 55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85:15, 90:10, 95:5, 20:1, and It increases to 50:1, approximately 100:1, approximately 150:1, approximately 200:1, approximately 250:1, approximately 300:1, approximately 350:1, approximately 400:1, approximately 450:1, approximately 500:1, approximately 550:1, approximately 600:1, approximately 650:1, approximately 700:1, approximately 750:1, approximately 800:1, approximately 850:1, approximately 900:1, approximately 950:1, approximately 1000:1, or more. In some embodiments, the percentage of wild-type mitochondrial genome in genetically modified eukaryotic cells is approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more of the total mitochondrial genome in genetically modified eukaryotic cells.In some embodiments, the percentage of mutant mitochondrial genomes containing recognition sequences in gene-modified eukaryotic cells is reduced by approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more. In some embodiments, cellular respiration in gene-modified eukaryotic cells is increased by approximately 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more. In some embodiments, cellular respiration in genetically modified eukaryotic cells increases by approximately 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, 90-100%, or more.
[0029] In another embodiment, the present invention provides a method for producing a population of eukaryotic cells comprising a plurality of genetically modified cells, the method comprising introducing into the plurality of eukaryotic cells in the population (a) a polynucleotide comprising a nucleic acid sequence encoding the MTEM described herein, wherein the MTEM is expressed in the plurality of eukaryotic cells, or (b) the MTEM described herein, wherein the MTEM creates a cleavage site in the recognition sequence comprising Sequence ID No. 1 in the mutant mitochondrial genome of the plurality of eukaryotic cells. In some embodiments, the cleavage site is repaired by non-homologous end joining so that the recognition sequence includes an insertion or deletion. In some embodiments, the mutant mitochondrial genome comprising the recognition sequence is degraded in the plurality of genetically modified eukaryotic cells. In some embodiments, approximately 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the mutant mitochondrial genome containing the recognition sequence is degraded in multiple gene-modified eukaryotic cells. In some embodiments, the ratio of wild-type mitochondrial genome to mutant mitochondrial genome containing the recognition sequence increases in multiple gene-modified eukaryotic cells. In some embodiments, the ratio of wild-type mitochondrial genome to mutant mitochondrial genome containing the recognition sequence increases in populations of eukaryotic cells. In some embodiments, the ratios are approximately 5:95, 10:90, 15:85, 20:80, 25:75, 30:70, 35:65, 40:60, 45:55, 50:50, 55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85:15, 90:10, 95:5, 20:1, and It increases to 50:1, approximately 100:1, approximately 150:1, approximately 200:1, approximately 250:1, approximately 300:1, approximately 350:1, approximately 400:1, approximately 450:1, approximately 500:1, approximately 550:1, approximately 600:1, approximately 650:1, approximately 700:1, approximately 750:1, approximately 800:1, approximately 850:1, approximately 900:1, approximately 950:1, approximately 1000:1, or more.In some embodiments, the percentage of wild-type mitochondrial genome in multiple gene-modified eukaryotic cells increases by approximately 5%, approximately 10%, approximately 15%, approximately 20%, approximately 25%, approximately 30%, approximately 35%, approximately 40%, approximately 45%, approximately 50%, approximately 55%, approximately 60%, approximately 65%, approximately 70%, approximately 75%, approximately 80%, approximately 85%, approximately 90%, approximately 95%, or more. In some embodiments, the percentage of wild-type mitochondrial genome in a population of eukaryotic cells increases by approximately 5%, approximately 10%, approximately 15%, approximately 20%, approximately 25%, approximately 30%, approximately 35%, approximately 40%, approximately 45%, approximately 50%, approximately 55%, approximately 60%, approximately 65%, approximately 70%, approximately 75%, approximately 80%, approximately 85%, approximately 90%, approximately 95%, or more. In some embodiments, the percentage of mutant mitochondrial genomes containing recognition sequences in multiple gene-modified eukaryotic cells decreases by approximately 5%, approximately 10%, approximately 15%, approximately 20%, approximately 25%, approximately 30%, approximately 35%, approximately 40%, approximately 45%, approximately 50%, approximately 55%, approximately 60%, approximately 65%, approximately 70%, approximately 75%, approximately 80%, approximately 85%, approximately 90%, approximately 95%, or more. In some embodiments, the percentage of mutant mitochondrial genomes containing recognition sequences in a population of eukaryotic cells decreases by approximately 5%, approximately 10%, approximately 15%, approximately 20%, approximately 25%, approximately 30%, approximately 35%, approximately 40%, approximately 45%, approximately 50%, approximately 55%, approximately 60%, approximately 65%, approximately 70%, approximately 75%, approximately 80%, approximately 85%, approximately 90%, approximately 95%, or more. In some embodiments, cellular respiration in multiple gene-modified eukaryotic cells increases by approximately 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more. In some embodiments, cellular respiration in multiple gene-modified eukaryotic cells increases by approximately 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, 90-100%, or more. In some embodiments, cellular respiration in a population of eukaryotic cells increases by about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, or more.In some embodiments, cellular respiration in a population of eukaryotic cells increases by approximately 30–40%, 40–50%, 50–60%, 60–70%, 70–80%, 80–90%, 90–100%, or more.
[0030] In some embodiments, the recognition sequence is located within a region of the mutant mitochondrial genome associated with mitochondrial dysfunction. In some embodiments, the mitochondrial dysfunction is mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS). In some embodiments, the recognition sequence is located in a region of the mutant mitochondrial genome corresponding to nucleotide positions 3000–3500 of the wild-type mitochondrial genome. In some embodiments, the MTEM targets the A3243G mutation in the mutant mitochondrial genome. In some embodiments, the method is performed in vivo. In some embodiments, the method is performed in vitro. In some embodiments, the polynucleotide is mRNA. In some embodiments, the polynucleotide is any mRNA described herein. In some embodiments, the polynucleotide is a recombinant DNA construct. In some embodiments, the polynucleotide is any recombinant DNA construct described herein. In some embodiments, the polynucleotide is introduced into eukaryotic cells by lipid nanoparticles. In some embodiments, the polynucleotide is introduced into eukaryotic cells by a recombinant virus. In some embodiments, the recombinant virus is any recombinant virus described herein. In some embodiments, the recombinant virus is recombinant AAV. In some embodiments, recombinant AAV has an AAV9 capsid. In some embodiments, the polynucleotide includes a promoter operably linked to a nucleic acid sequence encoding MTEM. In some embodiments, the promoter is a myocyte-specific promoter, a skeletal muscle-specific promoter, a myotube-specific promoter, a muscle satellite cell-specific promoter, a neuron-specific promoter, an astrocyte-specific promoter, a microglia-specific promoter, an ophthalmocyte-specific promoter, a retinal cell-specific promoter, a retinal ganglion cell-specific promoter, a retinal pigment epithelium-specific promoter, a pancreatic cell-specific promoter, or a pancreatic beta cell-specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter. In some embodiments, the eukaryotic cell is a mammalian cell.In some embodiments, eukaryotic cells are human cells. In some embodiments, eukaryotic cells are muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells.
[0031] In another aspect, the present invention provides genetically modified eukaryotic cells or a population of genetically modified eukaryotic cells produced by any method for producing genetically modified eukaryotic cells, or by any method for producing a population of eukaryotic cells comprising a plurality of genetically modified cells.
[0032] In another embodiment, the present invention provides a method for degrading a mutant mitochondrial genome in target cells or a population of target cells, the method comprising delivering to the target cells or population of target cells: (a) a polynucleotide comprising a nucleic acid sequence encoding the MTEM described herein, wherein the MTEM is expressed in the target cells or population of target cells, or (b) the MTEM described herein, wherein the MTEM creates a cleavage site in the mutant mitochondrial genome at a recognition sequence comprising SEQ ID NO: 1, thereby degrading the mutant mitochondrial genome. In some embodiments, the recognition sequence is located in a region of the mutant mitochondrial genome corresponding to nucleotide positions 3000–3500 of the wild-type mitochondrial genome. In some embodiments, the MTEM targets the A3243G mutation in the mutant mitochondrial genome. In some embodiments, the subjects are mammals. In some embodiments, the subjects are humans. In some embodiments, the target cells are muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the population of the target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells. Or, the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells. In some embodiments, the polynucleotide is mRNA. In some embodiments, the polynucleotide is any mRNA described herein. In some embodiments, the polynucleotide is a recombinant DNA construct.In some embodiments, the polynucleotide is any recombinant DNA construct as described herein. In some embodiments, the polynucleotide is delivered to target cells or populations of target cells by lipid nanoparticles. In some embodiments, the polynucleotide is delivered to target cells or populations of target cells by a recombinant virus. In some embodiments, the recombinant virus is any recombinant virus as described herein. In some embodiments, the recombinant virus is recombinant AAV. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the polynucleotide includes a promoter operably ligated to a nucleic acid sequence encoding MTEM. In some embodiments, the promoter is a constitutive promoter, or the promoter is a myocyte-specific promoter, skeletal muscle-specific promoter, myotube-specific promoter, muscle satellite cell-specific promoter, neuron-specific promoter, astrocyte-specific promoter, microglia-specific promoter, ophthalmocyte-specific promoter, retinal cell-specific promoter, retinal ganglion cell-specific promoter, retinal pigment epithelium-specific promoter, pancreatic cell-specific promoter, or pancreatic beta cell-specific promoter. In some embodiments, the constitutive promoter is the CMV promoter, CAG promoter, EF1 alpha promoter, or UbC promoter. In some embodiments, about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the mutant mitochondrial genome containing the recognition sequence is degraded in the target cells or population of target cells. In some embodiments, the ratio of the wild-type mitochondrial genome to the mutant mitochondrial genome containing the recognition sequence is increased in the target cells or population of target cells.In some embodiments, the ratios are approximately 5:95, 10:90, 15:85, 20:80, 25:75, 30:70, 35:65, 40:60, 45:55, 50:50, 55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85:15, 90:10, 95:5, 20:1, and It increases to 50:1, approximately 100:1, approximately 150:1, approximately 200:1, approximately 250:1, approximately 300:1, approximately 350:1, approximately 400:1, approximately 450:1, approximately 500:1, approximately 550:1, approximately 600:1, approximately 650:1, approximately 700:1, approximately 750:1, approximately 800:1, approximately 850:1, approximately 900:1, approximately 950:1, approximately 1000:1, or more. In some embodiments, the percentage of wild-type mitochondrial genome in the target cells or population of target cells is approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more of the total mitochondrial genome in the target cells or population of target cells. In some embodiments, the percentage of mutant mitochondrial genomes containing recognition sequences in gene-modified eukaryotic cells is reduced by approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more. In some embodiments, cellular respiration in target cells or populations of target cells is increased by approximately 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more. In some embodiments, cellular respiration in target cells or populations of target cells increases by approximately 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, 90-100%, or more.
[0033] In another embodiment, the present invention provides a method for treating a condition associated with MELAS in a subject, the method comprising administering to a subject (a) a polynucleotide comprising a nucleic acid sequence encoding a therapeutically effective amount of the MTEM described herein, the polynucleotide being delivered to a target cell or population of target cells in the subject, and the MTEM being expressed in the target cell or population of target cells, or (b) a therapeutically effective amount of the MTEM described herein, the MTEM being delivered to a target cell or population of target cells, wherein the MTEM creates a cleavage site in the mutant mitochondrial genome at a recognition sequence comprising SEQ ID NO: 1, and the mutant mitochondrial genome is degraded. In some embodiments, the recognition sequence is located in a region of the mutant mitochondrial genome corresponding to nucleotide positions 3000-3500 of the wild-type mitochondrial genome. In some embodiments, the MTEM targets the A3243G mutation in the mutant mitochondrial genome. In some embodiments, the method reduces or improves one or more symptoms associated with MELAS. In some embodiments, the method comprises administering any pharmaceutical composition described herein. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the target cells are muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells. The target cell population is either muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the target cell population is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells.In some embodiments, the symptoms are conditions of the muscles, brain, central nervous system, pancreas, or retina. In some embodiments, the conditions are mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS), progressive extraocular palsy, maternal diabetes mellitus, migraine, or ocular myopathy. In some embodiments, the polynucleotide is mRNA. In some embodiments, the polynucleotide is any mRNA described herein. In some embodiments, the polynucleotide is a recombinant DNA construct. In some embodiments, the polynucleotide is any recombinant DNA construct described herein. In some embodiments, the polynucleotide is delivered to target cells or populations of target cells by lipid nanoparticles. In some embodiments, the polynucleotide is delivered to target cells or populations of target cells by a recombinant virus. In some embodiments, the recombinant virus is any recombinant virus described herein. In some embodiments, the recombinant virus is recombinant AAV. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the polynucleotide includes a promoter operably ligated to a nucleic acid sequence encoding MTEM. In some embodiments, the promoter is a constitutive promoter, or the promoter is a myocyte-specific promoter, skeletal muscle-specific promoter, myotube-specific promoter, muscle satellite cell-specific promoter, neuron-specific promoter, astrocyte-specific promoter, microglia-specific promoter, ophthalmocyte-specific promoter, retinal cell-specific promoter, retinal ganglion cell-specific promoter, retinal pigment epithelium-specific promoter, pancreatic cell-specific promoter, or pancreatic beta cell-specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter.In some embodiments, approximately 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the mutant mitochondrial genome containing the recognition sequence is degraded in target cells or populations of target cells. In some embodiments, the ratio of wild-type mitochondrial genome to mutant mitochondrial genome containing the recognition sequence is increased in target cells or populations of target cells. In some embodiments, the ratios are approximately 5:95, 10:90, 15:85, 20:80, 25:75, 30:70, 35:65, 40:60, 45:55, 50:50, 55:45, 60:40, 65:35, 70:30, 75:25, 80:20, 85:15, 90:10, 95:5, 20:1, and It increases to 50:1, approximately 100:1, approximately 150:1, approximately 200:1, approximately 250:1, approximately 300:1, approximately 350:1, approximately 400:1, approximately 450:1, approximately 500:1, approximately 550:1, approximately 600:1, approximately 650:1, approximately 700:1, approximately 750:1, approximately 800:1, approximately 850:1, approximately 900:1, approximately 950:1, approximately 1000:1, or more. In some embodiments, the percentage of wild-type mitochondrial genome in the target cells or population of target cells is approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more of the total mitochondrial genome in the target cells or population of target cells. In some embodiments, the percentage of mutant mitochondrial genomes containing recognition sequences in gene-modified eukaryotic cells is reduced by approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more.In some embodiments, cellular respiration in target cells or populations of target cells increases by about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, or more. In some embodiments, cellular respiration in target cells or populations of target cells increases by about 30-40%, about 40-50%, about 50-60%, about 60-70%, about 70-80%, about 80-90%, about 90-100%, or more.
[0034] In one embodiment, the present invention relates to a genetically modified meganuclease that binds to and cleaves a recognition sequence including SEQ ID NO: 1, wherein the genetically modified meganuclease comprises a first subunit and a second subunit, the first subunit binding to a first recognition half-site of the recognition sequence and comprising a first hypervariable (HVR1) region, the second subunit binding to a second recognition half-site of the recognition sequence and comprising a second hypervariable (HVR2) region, and the HVR1 region having a small number of amino acid sequences corresponding to residues 24-79 of any one of SEQ ID NOs: 3-12 The present invention provides a genetically modified meganuclease containing an amino acid sequence having at least 80%, 85%, 90%, 80%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity, wherein the HVR2 region contains an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the amino acid sequence corresponding to residues 215-270 of any one of sequence numbers 3-12.
[0035] In some embodiments, the HVR1 region includes one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR1 region includes residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR1 region includes Y, R, K, or D in the residue corresponding to residue 66 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR1 region includes residues 24-79 of any one of SEQ ID NOs: 3-12 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region includes residues 24-79 of any one of sequence numbers 3-12.
[0036] In some embodiments, the first subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to any one residue 7-153 of SEQ ID NOs: 3-12. In some embodiments, the first subunit includes a residue corresponding to any one residue 19 of SEQ ID NOs: 3-12. In some embodiments, the first subunit includes a residue corresponding to any one residue 80 of SEQ ID NOs: 3-12. In some embodiments, the first subunit includes G, S, or A in the residue corresponding to any one residue 19 of SEQ ID NOs: 3-12. In some embodiments, the first subunit includes E, Q, or K in the residue corresponding to any one residue 80 of SEQ ID NOs: 3-12. In some embodiments, the first subunit comprises any one residue 7-153 of SEQ ID NOs: 3-12, having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0037] In some embodiments, the HVR2 region includes one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region includes residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region includes a residue corresponding to residue 241 of any one of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region includes a residue corresponding to residue 263 of any one of SEQ ID NOs: 3 or 5-12. In some embodiments, the HVR2 region includes a residue corresponding to residue 264 of any one of SEQ ID NOs: 3 or 8-12. In some embodiments, the HVR2 region includes a residue corresponding to residue 265 of SEQ ID NO: 6. In some embodiments, the HVR2 region includes Y, R, K, or D in the residue corresponding to any one residue 257 of SEQ ID NOs: 3-12. In some embodiments, the HVR2 region includes any one residue 215-270 of SEQ ID NOs: 3-12 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region includes any one residue 215-270 of SEQ ID NOs: 3-12.
[0038] In some embodiments, the second subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with any one residue 198-344 of SEQ ID NOs: 3-12. In some embodiments, the second subunit includes a residue corresponding to any one residue 276 of SEQ ID NOs: 4. In some embodiments, the second subunit includes a residue corresponding to any one residue 330 of SEQ ID NOs: 3-12. In some embodiments, the second subunit includes G, S, or A in the residue corresponding to any one residue 210 of SEQ ID NOs: 3-12. In some embodiments, the second subunit includes E, Q, or K in the residue corresponding to any one residue 271 of SEQ ID NOs: 3-12. In some embodiments, the second subunit comprises one residue 198-344 of SEQ ID NOs: 3-12, having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0039] In some embodiments, the genetically engineered meganuclease is a single-stranded meganuclease containing a linker, the linker covalently bonding a first subunit to a second subunit. In some embodiments, the genetically engineered meganuclease contains an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to any one of SEQ ID NOs: 3-12. In some embodiments, the genetically engineered meganuclease contains an amino acid sequence of any one of SEQ ID NOs: 3-12. In some embodiments, the genetically engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to any one of SEQ ID NOs: 33-42. In some embodiments, the genetically modified meganuclease is encoded by one of the nucleic acid sequences SEQ ID NOs: 33-42.
[0040] In some embodiments, the genetically engineered meganuclease is bound to an export sequence (NES). In some embodiments, the NES comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the sequence shown in SEQ ID NO: 46 or 47. In some embodiments, the NES comprises the amino acid sequence shown in SEQ ID NO: 46 or 47. In some embodiments, the NES is bound to the N-terminus of the genetically engineered meganuclease. In some embodiments, the NES is bound to the C-terminus of the genetically engineered meganuclease. In some embodiments, the NES is fused to the genetically engineered meganuclease. In some embodiments, the NES is bound to the genetically engineered meganuclease by a polypeptide linker. In some embodiments, the genetically engineered meganuclease comprises a first NES and a second NES. In some embodiments, the first NES is bound to the N-terminus of the genetically engineered meganuclease, and the second NES is bound to the C-terminus of the genetically engineered meganuclease. In some embodiments, the first NES and / or the second NES contain an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the sequence shown in SEQ ID NO: 46 or 47. In some embodiments, the first NES and / or the second NES contain an amino acid sequence shown in SEQ ID NO: 46 or 47. In some embodiments, the first NES and the second NES are identical. In some embodiments, the first NES and the second NES are not identical. In some embodiments, the first NES and / or the second NES are fused to the genetically engineered meganuclease. In some embodiments, the first NES and / or the second NES are linked to the genetically modified meganuclease by a polypeptide linker.
[0041] In another embodiment, the present invention provides a polynucleotide comprising a nucleic acid sequence encoding a genetically modified meganuclease described herein. In some embodiments, the polynucleotide is mRNA.
[0042] In another embodiment, the present invention provides a recombinant DNA construct comprising a polynucleotide comprising a nucleic acid sequence encoding a genetically modified meganuclease described herein. In some embodiments, the recombinant DNA construct encodes a recombinant virus comprising a polynucleotide. In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adeno-associated virus (AAV). In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the polynucleotide comprises a promoter operably ligated to the nucleic acid sequence encoding the genetically modified meganuclease. In some embodiments, the promoter is a constitutive promoter, or the promoter is a myocyte-specific promoter, a skeletal muscle-specific promoter, a myotube-specific promoter, a muscle satellite cell-specific promoter, a neuron-specific promoter, an astrocyte-specific promoter, a microglia-specific promoter, an ophthalmocyte-specific promoter, a retinal cell-specific promoter, a retinal ganglion cell-specific promoter, a retinal pigment epithelium-specific promoter, a pancreatic cell-specific promoter, or a pancreatic beta cell-specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter.
[0043] In another embodiment, the present invention provides a recombinant virus comprising a polynucleotide containing a nucleic acid sequence encoding a genetically modified meganuclease described herein. In some embodiments, the recombinant virus is a recombinant adenovirus, a recombinant lentivirus, a recombinant retrovirus, or a recombinant adeno-associated virus (AAV). In some embodiments, the recombinant virus is a recombinant AAV. In some embodiments, the recombinant AAV has an AAV9 capsid. In some embodiments, the polynucleotide comprises a promoter operably ligated to a nucleic acid sequence encoding a genetically modified meganuclease. In some embodiments, the promoter is a constitutive promoter, or the promoter is a myocyte-specific promoter, a skeletal muscle-specific promoter, a myotube-specific promoter, a muscle satellite cell-specific promoter, a neuron-specific promoter, an astrocyte-specific promoter, a microglia-specific promoter, an ophthalmocyte-specific promoter, a retinal cell-specific promoter, a retinal ganglion cell-specific promoter, a retinal pigment epithelium-specific promoter, a pancreatic cell-specific promoter, or a pancreatic beta cell-specific promoter. In some embodiments, the constitutive promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or a UbC promoter.
[0044] In another embodiment, the present invention provides a lipid nanoparticle composition comprising lipid nanoparticles containing a polynucleotide, wherein the polynucleotide comprises a nucleic acid sequence encoding a genetically modified meganuclease described herein. In some embodiments, the polynucleotide is mRNA.
[0045] In another embodiment, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a genetically modified meganuclease described herein.
[0046] In another embodiment, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier, any polynucleotide as described herein.
[0047] In another embodiment, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and any recombinant DNA construct described herein.
[0048] In another embodiment, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and any recombinant virus as described herein.
[0049] In another embodiment, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and any lipid nanoparticle composition described herein.
[0050] In another embodiment, the present invention provides gene-modified eukaryotic cells comprising any polynucleotide described herein. In some embodiments, the gene-modified eukaryotic cells are gene-modified mammalian cells. In some embodiments, the gene-modified eukaryotic cells are gene-modified human cells.
[0051] In another embodiment, the present invention provides a method for producing genetically modified eukaryotic cells, the method comprising introducing a polynucleotide comprising a nucleic acid sequence encoding a genetically modified meganuclease described herein into eukaryotic cells, wherein the genetically modified meganuclease is expressed in the eukaryotic cells and the genetically modified meganuclease creates a cleavage site in a recognition sequence comprising SEQ ID NO: 1. In some embodiments, the cleavage site is repaired by non-homologous end joining such that the recognition sequence includes an insertion or deletion. In some embodiments, the eukaryotic cells are mammalian cells. In some embodiments, the mammalian cells are human cells. In some embodiments, the polynucleotide is mRNA. In some embodiments, the polynucleotide is introduced into eukaryotic cells by lipid nanoparticles or recombinant virus. In some embodiments, the recombinant virus is recombinant AAV.
[0052] In another embodiment, the present invention provides a method for producing genetically modified eukaryotic cells, the method comprising introducing a genetically modified meganuclease described herein into a eukaryotic cell, wherein the genetically modified meganuclease is expressed in the eukaryotic cell, and the genetically modified meganuclease creates a cleavage site in a recognition sequence comprising SEQ ID NO: 1. In some embodiments, the cleavage site is repaired by non-homologous end joining such that the recognition sequence includes an insertion or deletion. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell.
[0053] In another embodiment, the present invention provides a method for producing a genetically modified eukaryotic cell containing an exogenous sequence of interest inserted into its genome, the method comprising introducing one or more polynucleotides into a eukaryotic cell, the first nucleic acid sequence encoding a genetically modified meganuclease described herein, the genetically modified meganuclease being expressed in the eukaryotic cell, and a second nucleic acid sequence containing the sequence of interest, wherein the genetically modified meganuclease creates a cleavage site at a recognition sequence containing Sequence ID No. 1, and the sequence of interest is inserted into the genome at the cleavage site. In some embodiments, the second nucleic acid sequence further comprises a nucleic acid sequence homologous to a nucleic acid sequence adjacent to the cleavage site, and the sequence of interest is inserted into the cleavage site by homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the first nucleic acid sequence is introduced into the eukaryotic cell as mRNA. In some embodiments, the second nucleic acid sequence is introduced into the eukaryotic cell as double-stranded DNA (dsDNA). In some embodiments, a first nucleic acid sequence is introduced into eukaryotic cells by a recombinant virus. In some embodiments, a second nucleic acid sequence is introduced into eukaryotic cells by a recombinant virus. In some embodiments, the recombinant virus is recombinant AAV.
[0054] In another embodiment, the present invention provides a method for producing a genetically modified eukaryotic cell containing an exogenous sequence of interest inserted into its genome, the method comprising introducing a genetically engineered meganuclease described herein and a polynucleotide comprising a nucleic acid sequence containing the sequence of interest into the eukaryotic cell, wherein the genetically engineered meganuclease creates a cleavage site in a recognition sequence containing SEQ ID NO: 1, and the sequence of interest is inserted into the genome at the cleavage site. In some embodiments, the polynucleotide sequence further comprises a nucleic acid sequence homologous to a nucleic acid sequence adjacent to the cleavage site, and the sequence of interest is inserted into the cleavage site by homologous recombination. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell. In some embodiments, the polynucleotide is introduced into the eukaryotic cell as double-stranded DNA (dsDNA). In some embodiments, the polynucleotide is introduced into the eukaryotic cell by a recombinant virus. In some embodiments, the recombinant virus is recombinant AAV.
[0055] In another aspect, the present invention provides gene-modified eukaryotic cells prepared by the method described herein.
[0056] The aforementioned and other aspects and embodiments of this disclosure can be better understood by referring to the following detailed description and claims. Certain features of this disclosure described in the context of separate embodiments for clarity may also be provided in combination in a single embodiment. All combinations of embodiments are specifically covered by this disclosure and are disclosed herein as if each and all combinations were explicitly disclosed individually. Conversely, various features of this disclosure described in the context of a single embodiment for brevity may also be provided individually or in any suitable partial combination. All partial combinations of features enumerated in embodiments are also specifically covered by this disclosure and are disclosed herein as if each and all such partial combinations were explicitly disclosed herein individually. Embodiments of each aspect of this disclosure disclosed herein may be applied to other aspects of this disclosure with necessary modifications. [Brief explanation of the drawing]
[0057] [Figure 1] This figure shows flow cytometry results for CHO reporter cells transfected with mRNA encoding various MIT 25-26 genetically modified meganucleases or CHO 23-24 meganucleases (control), and assayed for the percentage of GFP+ cells 48 hours after transfection. The data are presented as an activity index, the sum of the activity score and toxicity score. [Figure 2] This figure demonstrates the ability to distinguish the MIT 25-26L.35 genetically modified meganuclease from the wild-type sequence. Flow cytometry results are shown for CHO reporter cells transfected with mRNA encoding either MIT 25-26x.91 or MIT 25-26L.35 genetically modified meganuclease, or CHO 23-24 meganuclease (control), and assayed for the percentage of GFP+ cells 48 hours after transfection. Data are presented as an activity index, the sum of activity score and toxicity score. [Figure 3] This figure shows indel formation for various MIT 25-26 genetically modified meganucleases in FlpIn CHO cells containing a portion of the human mitochondrial genome in which either the wild-type or mutant MIT 25-26 binding site is integrated onto the nuclear chromosome. FlpIn CHO cells were nucleofected with MIT 25-26 genetically modified meganucleases, and the indel frequencies in both the mutant and wild-type MIT 25-26 sites were analyzed two days later. [Figure 4]This figure shows indel formation of optimized MIT 25-26L.35 genetically modified meganuclease compared to MIT 25-26x.91 genetically modified meganuclease in FlpIn CHO cells containing a portion of the human mitochondrial genome in which either the wild-type or mutant MIT 25-26 binding site is integrated on the nuclear chromosome. FlpIn CHO cells were nucleofected with MIT 25-26 genetically modified meganuclease, and the indel frequencies in both the mutant and wild-type MIT 25-26 sites were analyzed 2 days later. [Figure 5] This figure demonstrates nuclear targeting of genetically modified meganucleases. MRC-5 cells were transfected with a plasmid encoding a genetically modified meganuclease with a nuclear localization sequence. Immunocytological staining was performed using DAPI and monoclonal genetically modified meganuclease antibodies, as well as Mitotracker Red to stain mitochondria. Cells were observed at 20x magnification using a Zeiss LSM710 confocal microscope. The upper left image shows a superposition of all stains. The upper right image shows the location of the genetically modified meganuclease. The lower left image shows nuclear staining with DAPI, and the lower right image shows mitochondria. [Figure 6] This figure demonstrates the mitochondrial targeting of genetically modified meganucleases. MRC-5 cells were transfected with a plasmid encoding a genetically modified meganuclease containing a mitochondrial localization peptide (MTP). Immunocytological staining was performed using DAPI and monoclonal genetically modified meganuclease antibodies, as well as Mitotracker Red to stain mitochondria. Cells were observed at 20x magnification using a Zeiss LSM710 confocal microscope. The upper left image shows a superposition of all stains. The upper right image shows the location of the genetically modified meganuclease. The lower left image shows nuclear staining with DAPI, and the lower right image shows mitochondria. [Figure 7]This figure shows indel formation by genetically modified meganucleases fused to nuclear localization signals (NLS) or mitochondrial localization peptides (MTPs). MRC-5 cells were nucleofected with genetically modified meganuclease constructs, and indel formation at the APC 11-12 binding site was analyzed after 2 days. [Figure 8] This figure shows indel formation by genetically modified meganucleases fused to nuclear localization signals (NLS), mitochondrial localization peptides (MTP), or the nuclear export sequence (NES) of sequence number 47. MRC-5 cells were nucleofected with genetically modified meganuclease constructs, and indel formation at the APC 11-12 binding site was analyzed after 2 days. [Figure 9] This figure shows indel formation induced by a genetically modified meganuclease fused to a nuclear localization signal (NLS), a mitochondrial localization peptide (MTP), or the MVMp NS2 nuclear export sequence (NES) of Sequence ID No. 46. MRC-5 cells were nucleofected with the genetically modified meganuclease construct, and indel formation at the APC 11-12 binding site was analyzed after 2 days. [Figure 10] This figure shows indel formation induced by a genetically modified MIT 25-26x.91 meganuclease fused to a nuclear localization signal (NLS), a mitochondrial-transfer peptide (MTP), or the MVMp NS2 nuclear export sequence (NES) of sequence number 46. MRC-5 cells were nucleofected with the genetically modified meganuclease construct, and indel formation at each of the three MIT 25-26x.91 binding sites was analyzed after 2 days. [Figure 11] This figure shows the efficacy of mitochondrial targeted gene-modified meganuclease (MTEM) MIT 25-26x.91 in heteroplasmic MELAS mutation-containing cybrid cell lines 1 day after nucleofection. These data are expressed as mtDNA loss compared to MTS-GFP cells. [Figure 12]This figure shows the efficacy of mitochondrial targeted gene-modified meganuclease (MTEM) MIT 25-26x.91 in heteroplasmic MELAS mutation-containing cybrid cell lines 4 days after nucleofection. These data are expressed as mtDNA loss compared to MTS-GFP cells. [Figure 13] This figure shows the efficacy of mitochondrial targeted gene-modified meganuclease (MTEM) MIT 25-26x.91 in heteroplasmic MELAS mutation-containing cybrid cell lines 7 days after nucleofection. These data are expressed as mtDNA loss compared to MTS-GFP cells. [Figure 14] This figure shows the efficacy of mitochondrial targeted gene-modified meganuclease (MTEM) MIT 25-26x.91 in cybrid cell lines with heteroplasmic MELAS mutations 11 days after nucleofection. These data are expressed as mtDNA loss compared to MTS-GFP cells. [Figure 15] This figure shows the mitochondrial stress test of MELAS cybrid cells 11 days after transfection with mitochondrial-targeting gene-modified meganuclease (MTEM) MIT 25-26x.91. [Figure 16] This figure shows ATP production in MELSA cybrid cells 11 days after transfection with mitochondrial-targeted gene-modified meganuclease (MTEM) MIT 25-26x.91. [Figure 17] This figure shows ATP production in MELSA cybrid cells 11 days after transfection with mitochondrial-targeted gene-modified meganuclease (MTEM) MIT 25-26x.91. [Figure 18] This figure shows the energy map of MELAS cybrid cells 11 days after transfection with mitochondrial-targeted gene-modified meganuclease (MTEM) MIT 25-26x.91, illustrating the relative contributions of glycolysis and OXPHOS to ATP production. [Figure 19]This image shows immunofluorescence staining demonstrating the cellular localization of genetically modified meganucleases lacking intracellular targeting sequences. Cells were transfected with a plasmid encoding a genetically modified meganuclease fused with a green fluorescent protein (GFP) peptide sequence. Immunocytological staining was achieved using DAPI and Mitotracker Red to stain mitochondria. Cells were observed at 63x magnification using a Zeiss LSM710 confocal microscope. The upper left image shows a superposition of all stains. The upper right image shows the location of the genetically modified meganuclease. The lower left image shows nuclear staining with DAPI, and the lower right image shows mitochondrial staining. [Figure 20] This image shows immunofluorescence staining indicating the cellular localization of genetically modified meganucleases containing mitochondrial-targeting peptides (MTPs). Cells were transfected with a plasmid encoding a genetically modified meganuclease fused with a mitochondrial-targeting peptide sequence (MTS) at the N-terminus and a green fluorescent protein peptide (GFP) sequence at the C-terminus. Immunocytological staining was achieved using DAPI and Mitotracker Red to stain mitochondria. Cells were observed at 63x magnification using a Zeiss LSM710 confocal microscope. The upper left image shows a superposition of all stains. The upper right image shows the location of the genetically modified meganucleases. The lower left image shows nuclear staining with DAPI, and the lower right image shows mitochondrial staining. [Figure 21] The graphs provide showing the ratio of circular mtDNA to total mtDNA in mitochondria containing 100% mutant mtDNA (m.3243G) in cells transfected with the indicated control (mock, MTS-GFP, MTS-APC 11-12L.330, and MTS-MIT 25-26x.91 KO) and test genetically modified meganucleases, at 0, 6, 24, 48, and 72 hours after transfection. [Figure 22]The graphs provide the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 100% mutant mtDNA (m.3243G) in cells transfected with the indicated control (mock, MTS-GFP, MTS-APC 11-12L.330, and MTS-MIT 25-26x.91 KO) and test genetically modified meganucleases, at 0, 6, 24, 48, and 72 hours after transfection. [Figure 23] The graphs provide the ratio of circular mtDNA to total mtDNA in mitochondria containing wild-type mtDNA in cells transfected with the indicated controls (mock, MTS-GFP, MTS-APC 11-12L.330, and MTS-MIT 25-26x.91 KO) and test genetically modified meganucleases, at 0, 6, 24, 48, and 72 hours after transfection. [Figure 24] The graphs provide the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing wild-type mtDNA at 0, 6, 24, 48, and 72 hours after transfection in cells transfected with the indicated control (mock, MTS-GFP, MTS-APC 11-12L.330, and MTS-MIT 25-26x.91 KO) and test genetically modified meganucleases. [Figure 25] The graphs provide the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing wild-type mtDNA in cells transfected with the indicated control (mock, MTS-GFP, MTS-APC 11-12L.330, and MTS-MIT 25-26x.91 KO) and test genetically modified meganucleases, at 0, 3, 6, 12, 24, 48, and 72 hours after transfection. [Figure 26]The graphs provide the ratio of circular mtDNA to total mtDNA in mitochondria containing wild-type mtDNA in cells transfected with the indicated control (mock, MTS-GFP, MTS-APC 11-12L.330, and MTS-MIT 25-26x.91 KO) and test genetically modified meganucleases, at 0, 3, 6, 12, 24, 48, and 72 hours after transfection. [Figure 27] This graph provides the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 96% mutant mtDNA (m.3243G) in MELAS cells transfected with the indicated control (mock, MTS-GFP) or four different concentrations of MIT 25-26x.91 meganuclease, one day after transfection. The height of the bars indicates the loss of mtDNA normalized to MTS-GFP transfected cells. Within the bars, the gray relative percentages correspond to the relative percentage of wild-type mtDNA present, and the black relative percentages correspond to the relative percentage of mutant mtDNA present. [Figure 28] This graph provides the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 96% mutant mtDNA (m.3243G) in MELAS cells transfected with the indicated control (mock, MTS-GFP) or four different concentrations of MIT 25-26x.91 meganuclease, 4 days after transfection. The height of the bars indicates the loss of mtDNA normalized to MTS-GFP transfected cells. Within the bars, the gray relative percentages correspond to the relative percentage of wild-type mtDNA present, and the black relative percentages correspond to the relative percentage of mutant mtDNA present. [Figure 29]This graph provides the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 96% mutant mtDNA (m.3243G) in MELAS cells transfected with the indicated control (mock, MTS-GFP) or four different concentrations of MIT 25-26x.91 meganuclease, 7 days after transfection. The height of the bars indicates the loss of mtDNA normalized to MTS-GFP transfected cells. Within the bars, the gray relative percentages correspond to the relative percentage of wild-type mtDNA present, and the black relative percentages correspond to the relative percentage of mutant mtDNA present. [Figure 30] This graph shows the mitochondrial stress test of MELAS cybrid cells 11 days after transfection with mitochondrial-targeting gene-modified meganuclease (MTEM) MIT 25-26x.91. [Figure 31] This figure shows the energy map of MELAS cybrid cells 11 days after transfection with mitochondrial-targeted gene-modified meganuclease (MTEM) MIT 25-26x.91, illustrating the relative contributions of glycolysis and OXPHOS to ATP production. [Figure 32] This shows the basal respiratory rate of MELSA cybrid cells 11 days after transfection with mitochondrial-targeting gene-modified meganuclease (MTEM) MIT 25-26x.91. [Figure 33] This shows the maximum respiratory rate of MELSA cybrid cells 11 days after transfection with mitochondrial-targeting gene-modified meganuclease (MTEM) MIT 25-26x.91. [Figure 34] This shows the mitochondrial ATP production rate of MELSA cybrid cells 11 days after transfection with the mitochondrial-targeting gene-modified meganuclease (MTEM) MIT 25-26x.91. [Figure 35]This graph provides the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 96% mutant mtDNA (m.3243G) in MELAS cells transfected with the indicated control (mock, MTS-GFP) or four different concentrations of MIT 25-26x.91 259H>Q meganuclease, one day after transfection. The height of the bars indicates the loss of mtDNA normalized to MTS-GFP transfected cells. Within the bars, the gray relative percentages correspond to the relative percentage of wild-type mtDNA present, and the black relative percentages correspond to the relative percentage of mutant mtDNA present. [Figure 36] This graph shows the mitochondrial stress test of MELAS cybrid cells one day after transfection with mitochondrial-targeted gene-modified meganuclease (MTEM) MIT 25-26x.91 259 H>Q. [Figure 37] This graph provides the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 96% mutant mtDNA (m.3243G) in MELAS cells transfected with the indicated control (mock, MTS-GFP) or four different concentrations of MIT 25-26x.91 259H>Q meganuclease, 3 days after transfection. The height of the bars indicates the loss of mtDNA normalized to MTS-GFP transfected cells. Within the bars, the gray relative percentages correspond to the relative percentage of wild-type mtDNA present, and the black relative percentages correspond to the relative percentage of mutant mtDNA present. [Figure 38] This graph shows the mitochondrial stress test of MELAS cybrid cells 3 days after transfection with mitochondrial-targeting gene-modified meganuclease (MTEM) MIT 25-26x.91 259 H>Q. [Figure 39]This graph provides the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 96% mutant mtDNA (m.3243G) in MELAS cells transfected with the indicated control (mock, MTS-GFP) or four different concentrations of MIT 25-26x.91 259H>Q meganuclease, 7 days after transfection. The height of the bars indicates the loss of mtDNA normalized to MTS-GFP transfected cells. Within the bars, the gray relative percentages correspond to the relative percentage of wild-type mtDNA present, and the black relative percentages correspond to the relative percentage of mutant mtDNA present. [Figure 40] This graph shows the mitochondrial stress test results of MELAS cybrid cells 7 days after transfection with mitochondrial-targeting gene-modified meganuclease (MTEM) MIT 25-26x.91 259H>Q. [Figure 41] This graph shows the results of an oligo capture assay to identify off-target cleavage induced by MIT 25-26L.35 19 A>S and MIT 25-26x.91 259 H>Q meganucleases transfected in the Flp-In 293 reporter cell line. Circled points indicate on-target sites. Only MT-oligo represents the negative control. [Figure 42] This graph shows the time course of cell proliferation in either untreated mitochondria containing 96% mutant mtDNA (m.3243G) from MELAS cells transfected with MIT 25-26x.91 259H>Q meganuclease at a dose of 1e5 RNA copies / cell, or untreated 0% mutant (WT cells). [Figure 43] This bar graph shows the time course of cell doubling on D2, D3, and D4 after either untreated mitochondria containing 96% mutant mtDNA (m.3243G) from MELAS cells transfected with MIT 25-26x.91 259H>Q meganuclease at a dose of 1e5 RNA copies / cell, or untreated 0% mutant (WT) cells. [Figure 44] This provides a schematic diagram of an experimental study demonstrating the effects of genetic manipulation using MTEM meganuclease editing on mitochondrial heteroplasmy in a mouse xenograft tumor model. [Figure 45] This provides graphs showing tumor volume at D18 (after cybrid introduction) upon administration of AAV9 vectors capsidizing three different doses of MIT 25-26x.91 genetically modified meganuclease. [Figure 46] This provides graphs showing the percentage of WT mtDNA after administration of AAV9 vectors capsidizing three different doses of MIT 25-26x.91 genetically modified meganuclease at 35 days post-cybrid cell introduction and 17 days post-meganuclease administration. [Figure 47] This graph shows the percentage of WT mtDNA after administration of three different doses of AAV9 vectors capsidizing MIT 25-26x.91 genetically modified meganuclease at 35 days post-cybrid cell introduction and 17 days post-meganuclease administration. NS indicates statistically insignificant differences between groups. [Figure 48] This graph provides a graph showing the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 85% mutant mtDNA (m.3243G) in MELAS cells transfected with the indicated control (mock, MTS-GFP) or four different concentrations of MIT 25-26x.91 259H>Q meganuclease, 1 day after transfection. The height of the bar indicates the loss of mtDNA normalized to MTS-GFP transfected cells. Within the bar, the gray relative percentage corresponds to the relative percentage of wild-type mtDNA present, and the black relative percentage corresponds to the relative percentage of mutant mtDNA present. [Figure 49] This graph shows the mitochondrial stress test results of MELAS cybrid cells one day after transfection with mitochondrial-targeting gene-modified meganuclease (MTEM) MIT 25-26x.91 259H>Q. [Figure 50] This graph provides the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 85% mutant mtDNA (m.3243G) in MELAS cells transfected with the indicated control (mock, MTS-GFP) or four different concentrations of MIT 25-26x.91 259H>Q meganuclease, 3 days post-transfection. The height of the bars indicates the loss of mtDNA normalized to MTS-GFP transfected cells. Within the bars, the gray relative percentages correspond to the relative percentage of wild-type mtDNA present, and the black relative percentages correspond to the relative percentage of mutant mtDNA present. [Figure 51] This graph shows the mitochondrial stress test of MELAS cybrid cells 3 days after transfection with mitochondrial-targeting gene-modified meganuclease (MTEM) MIT 25-26x.91 259 H>Q. [Figure 52] This graph provides the ratio of total mtDNA to ribosomal 18s DNA in mitochondria containing 96% mutant mtDNA (m.3243G) in MELAS cells or in WT cells containing 0% mutant mtDNA, 1 day after transfection. Mutant cells were either untreated or treated with 1 e5 RNA copy / cell of MIT 25-26x.91 259 H>Q meganuclease. 0% mutant cells were untreated. The height of the bar indicates the loss of normalized mtDNA relative to mutant mtDNA cells. Within the bar, the gray relative percentage corresponds to the relative percentage of wild-type mtDNA present, and the black relative percentage corresponds to the relative percentage of mutant mtDNA present. [Figure 53] This graph shows the mitochondrial stress test of WT or MELAS cybrid cells one day after transfection with mitochondrial-targeted gene-modified meganuclease (MTEM) MIT 25-26x.91 259 H>Q.
[0058] A brief explanation of arrays Sequence ID 1 shows the nucleic acid sequence of the MIT 25-26 recognition sequence (sense).
[0059] Sequence ID 2 shows the nucleic acid sequence of the MIT 25-26 recognition sequence (antisense).
[0060] Sequence ID 3 shows the amino acid sequence of the MIT 25-26x.91 genetically modified meganuclease.
[0061] Sequence ID 4 shows the amino acid sequence of the MIT 25-26x.48 genetically modified meganuclease.
[0062] Sequence ID 5 shows the amino acid sequence of the MIT 25-26x.73 genetically modified meganuclease.
[0063] Sequence ID 6 shows the amino acid sequence of the MIT 25-26x.29 genetically modified meganuclease.
[0064] Sequence ID 7 shows the amino acid sequence of the MIT 25-26x.37 genetically modified meganuclease.
[0065] Sequence ID 8 shows the amino acid sequence of the MIT 25-26L.35 genetically modified meganuclease.
[0066] Sequence ID 9 shows the amino acid sequence of the MIT 25-26x.91 genetically modified meganuclease, which has an H-to-Q substitution at amino acid position 259, known as MIT 25-26x.91 259 H>Q.
[0067] Sequence ID 10 shows the amino acid sequence of the MIT 25-26L.35 genetically modified meganuclease, which has an A-to-S substitution at amino acid position 19, known as MIT 25-26L.35 19 A>S.
[0068] Sequence ID 11 shows the amino acid sequence of the MIT 25-26x.91 genetically modified meganuclease, which has a T-to-R substitution at amino acid position 263, and is called MIT 25-26x.91 263 T>R.
[0069] Sequence ID 12 shows the amino acid sequence of the MIT 25-26x.91 genetically modified meganuclease, which has an H-to-W substitution at amino acid position 46, known as MIT 25-26x.91 46 H>W.
[0070] Sequence ID 13 shows the amino acid sequence of the MIT 25-26x.91 meganuclease 25-binding subunit.
[0071] Sequence ID 14 shows the amino acid sequence of the MIT 25-26x.48 meganuclease 25-binding subunit.
[0072] Sequence ID 15 shows the amino acid sequence of the MIT 25-26x.73 meganuclease 25-binding subunit.
[0073] Sequence ID 16 shows the amino acid sequence of the MIT 25-26x.29 meganuclease 25-binding subunit.
[0074] Sequence ID 17 shows the amino acid sequence of the MIT 25-26x.37 meganuclease 25-binding subunit.
[0075] Sequence ID 18 shows the amino acid sequence of the MIT 25-26L.35 meganuclease 25-binding subunit.
[0076] Sequence ID 19 shows the amino acid sequence of the MIT 25-26x.91 259 H>Q meganuclease 25-binding subunit.
[0077] Sequence ID 20 shows the amino acid sequence of the MIT 25-26L.35 19 A>S meganuclease 25-binding subunit.
[0078] Sequence ID 21 shows the amino acid sequence of the MIT 25-26x.91 263 T>R meganuclease 25-binding subunit.
[0079] Sequence ID 22 shows the amino acid sequence of the MIT 25-26x.91 46 H>W meganuclease 25-binding subunit.
[0080] Sequence ID 23 shows the amino acid sequence of the MIT 25-26x.91 meganuclease 26-binding subunit.
[0081] Sequence ID 24 shows the amino acid sequence of the MIT 25-26x.48 meganuclease 26-binding subunit.
[0082] Sequence ID 25 shows the amino acid sequence of the MIT 25-26x.73 meganuclease 26-binding subunit.
[0083] Sequence ID 26 shows the amino acid sequence of the MIT 25-26x.29 meganuclease 26-binding subunit.
[0084] Sequence ID 27 shows the amino acid sequence of the MIT 25-26x.37 meganuclease 26-binding subunit.
[0085] Sequence ID 28 shows the amino acid sequence of the MIT 25-26L.35 meganuclease 26-binding subunit.
[0086] Sequence ID 29 shows the amino acid sequence of the MIT 25-26x.91 259 H>Q meganuclease 26-binding subunit.
[0087] Sequence ID 30 shows the amino acid sequence of the MIT 25-26L.35 19 A>S meganuclease 26-binding subunit.
[0088] Sequence ID 31 shows the amino acid sequence of the MIT 25-26x.91 263 T>R meganuclease 26-binding subunit.
[0089] Sequence ID 32 shows the amino acid sequence of the MIT 25-26x.91 46 H>W meganuclease 26-binding subunit.
[0090] Sequence ID 33 shows the nucleic acid sequence of MIT 25-26x.91 meganuclease.
[0091] Sequence ID 34 shows the nucleic acid sequence of MIT 25-26x.48 meganuclease.
[0092] Sequence ID 35 shows the nucleic acid sequence of MIT 25-26x.73 meganuclease.
[0093] Sequence ID 36 shows the nucleic acid sequence of MIT 25-26x.29 meganuclease.
[0094] Sequence ID 37 shows the nucleic acid sequence of MIT 25-26x.37 meganuclease.
[0095] Sequence ID 38 shows the nucleic acid sequence of MIT 25-26L.35 meganuclease.
[0096] Sequence ID 39 shows the nucleic acid sequence of MIT 25-26x.91 259 H>Q meganuclease.
[0097] Sequence ID 40 shows the nucleic acid sequence of MIT 25-26L.35 19A>S meganuclease.
[0098] Sequence ID 41 shows the nucleic acid sequence of MIT 25-26x.91 263 T>R meganuclease.
[0099] Sequence ID 42 shows the nucleic acid sequence of MIT 25-26x.91 46 H>W meganuclease.
[0100] Sequence ID 43 shows the amino acid sequence of COX VIII MTP.
[0101] Sequence ID 44 shows the amino acid sequence of SU9 MTP.
[0102] Sequence ID 45 shows the amino acid sequence of COX VIII-SU9 MTP.
[0103] Sequence ID 46 shows the amino acid sequence of the MVMp NS2 NES sequence.
[0104] Sequence ID 47 shows the amino acid sequence of the NES sequence.
[0105] Sequence ID 48 shows the amino acid sequence of the wild-type I-CreI sequence.
[0106] Sequence ID 49 shows the nucleic acid sequence of digital droplet PCR (ddPCR) primer P1, which is used to determine the indel frequency at the APC 11-12 binding site.
[0107] Sequence ID 50 shows the nucleic acid sequence of ddPCR primer F1, which is used to determine the indel frequency at the APC 11-12 binding site.
[0108] Sequence ID 51 shows the nucleic acid sequence of ddPCR primer R1, which is used to determine the indel frequency at the APC 11-12 binding site.
[0109] Sequence ID 52 shows the nucleic acid sequence of ddPCR primer P2, which is used to determine the indel frequency at the APC 11-12 binding site, and ddPCR primer P3 is used to determine the heteroplasmy level of mtDNA and the mtDNA copy number relative to nuclear DNA.
[0110] Sequence ID 53 shows the nucleic acid sequence of ddPCR primer F2, which is used to determine the indel frequency at the APC 11-12 binding site. ddPCR primer F3 is used to determine the heteroplasmy level of mtDNA and the mtDNA copy number relative to nuclear DNA.
[0111] Sequence ID 54 shows the nucleic acid sequence of ddPCR primer R2, which is used to determine the indel frequency at the APC 11-12 binding site. ddPCR primer R3 is used to determine the heteroplasmy level of mtDNA and the mtDNA copy number relative to nuclear DNA.
[0112] Sequence ID 55 shows the nucleic acid sequence of ddPCR primer F1, which is used to identify potential nuclear off-target site editing induced by the MIT 25-26x.91 nuclease.
[0113] Sequence ID 56 shows the nucleic acid sequence of ddPCR primer R1, which is used to identify potential nuclear off-target site editing induced by the MIT 25-26x.91 nuclease.
[0114] Sequence ID 57 shows the nucleic acid sequence of ddPCR primer F2, which is used to identify potential nuclear off-target site editing induced by the MIT 25-26x.91 nuclease.
[0115] Sequence ID 58 shows the nucleic acid sequence of ddPCR primer R2, which is used to identify potential nuclear off-target site editing induced by the MIT 25-26x.91 nuclease.
[0116] Sequence ID 59 shows the nucleic acid sequence of ddPCR primer F3, which is used to identify potential nuclear off-target site editing induced by the MIT 25-26x.91 nuclease.
[0117] Sequence ID 60 shows the nucleic acid sequence of ddPCR primer R3, which is used to identify potential nuclear off-target site editing induced by the MIT 25-26x.91 nuclease.
[0118] Sequence ID 61 shows the nucleic acid sequence of ddPCR primer F4, which is used to identify potential nuclear off-target site editing induced by the MIT 25-26x.91 nuclease.
[0119] Sequence ID 62 shows the nucleic acid sequence of ddPCR primer R4, which is used to identify potential nuclear off-target site editing induced by the MIT 25-26x.91 nuclease.
[0120] Sequence ID 63 shows the nucleic acid sequence of ddPCR primer P1, which is used to determine the heteroplasmy level of mtDNA and the mtDNA copy number relative to nuclear DNA (mutant allele).
[0121] Sequence ID 64 shows the nucleic acid sequence of ddPCR primer F1, which is used to determine the heteroplasmy level of mtDNA and the mtDNA copy number relative to nuclear DNA.
[0122] Sequence ID 65 shows the nucleic acid sequence of ddPCR primer R1, which is used to determine the heteroplasmy level of mtDNA and the mtDNA copy number relative to nuclear DNA.
[0123] Sequence ID 66 shows the nucleic acid sequence of ddPCR primer P2, which is used to determine the heteroplasmy level of mtDNA and the mtDNA copy number relative to nuclear DNA.
[0124] Sequence ID 67 shows the nucleic acid sequence of ddPCR primer F2, which is used to determine the heteroplasmy level of mtDNA and the mtDNA copy number relative to nuclear DNA.
[0125] Sequence ID 68 shows the nucleic acid sequence of ddPCR primer R2, which is used to determine the heteroplasmy level of mtDNA and the mtDNA copy number relative to nuclear DNA.
[0126] Sequence ID 69 shows the nucleic acid sequence of ddPCR primer P4, which is used to determine the heteroplasmy level of mtDNA and the mtDNA copy number relative to nuclear DNA.
[0127] Sequence ID 70 shows the nucleic acid sequence of ddPCR primer F4, which is used to determine the heteroplasmy level of mtDNA and the mtDNA copy number relative to nuclear DNA.
[0128] Sequence ID 71 shows the nucleic acid sequence of ddPCR primer R4, which is used to determine the heteroplasmy level of mtDNA and the mtDNA copy number relative to nuclear DNA.
[0129] Sequence ID 72 shows the nucleic acid sequence of ddPCR primer P1, which is used to determine the heteroplasmy level of mtDNA and the mtDNA copy number relative to nuclear DNA (WT allele). [Modes for carrying out the invention]
[0130] Detailed description of the invention 1.1 References and Definitions The patents and scientific literature referenced herein establish knowledge available to those skilled in the art. References cited herein, including issued U.S. patents, granted applications, published foreign applications, and GenBank database arrays, are incorporated herein by reference to the same extent as each is specifically and individually indicated as being incorporated by reference.
[0131] The present invention can be embodied in different forms and should not be construed as being limited to the embodiments described herein. Rather, these embodiments are provided so as to ensure that this disclosure is thorough and complete and that the scope of the invention is fully conveyed to those skilled in the art. For example, features shown in relation to one embodiment can be incorporated into other embodiments, and features shown in relation to a particular embodiment can be omitted from that embodiment. Furthermore, numerous modifications and additions to the embodiments proposed herein will be obvious to those skilled in the art in light of this disclosure and will not depart from the invention.
[0132] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art to which the invention pertains. The terms used herein in describing the invention are for the purpose of describing specific embodiments only and are not intended to limit the invention.
[0133] All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety.
[0134] As used herein, “a,” “an,” or “the” may mean one or more. For example, “a” cell may mean a single cell or more cells.
[0135] As used herein, the term “5' cap” (also known as RNA cap, RNA 7-methylguanosine cap, or RNA m7G cap) refers to a modified guanine nucleotide added to the “front” or 5' end of eukaryotic messenger RNA immediately after transcription initiation. The 5' cap consists of a terminal group linked to the first nucleotide to be transcribed. Its presence is important for ribosome recognition and protection from RNases. Capping is coupled to transcription and occurs cotranscribeally, with each affecting the other. Immediately after transcription initiation, the 5' end of the synthesized mRNA is fused by a cap synthesis complex conjugated with RNA polymerase. This enzyme complex catalyzes the chemical reactions necessary for mRNA capping. Synthesis proceeds as a multi-step biochemical reaction. The capping portion can be modified to modulate the functionality of the mRNA, such as its stability or translation efficiency.
[0136] As used herein, the term "allele" refers to one of two or more variant forms of a gene.
[0137] As used herein, the terms “allogeneic” or, alternatively, “allogenic” refer to any substance originating from a different animal of the same species or a different patient in the individual into which the substance is introduced. Two or more individuals are said to be allogeneic if their genes at one or more loci are not identical. In some embodiments, allogeneic substances from individuals of the same species may be genetically distinct enough to interact antigenically.
[0138] As used herein, the term “constitutive promoter” refers to a nucleotide sequence that, when operably linked to a polynucleotide encoding or designating a gene product, causes the cell to produce the gene product under most or all physiological conditions of the cell.
[0139] As used herein, the terms “control” or “control cell” refer to a cell that provides a reference point for measuring changes in the genotype or phenotype of a genetically modified cell. Control cells may include, for example, (a) wild-type cells, i.e., wild-type cells with the same genotype as the starting material for the genetic modification that resulted in the genetically modified cell; (b) cells with the same genotype as the genetically modified cell but transformed with a null construct (i.e., a construct that does not have a known effect on the trait of interest); or (c) cells that are genetically identical to the genetically modified cell but have not been exposed to conditions or stimuli or further genetic modification that induce the expression of the modified genotype or phenotype. For example, the controls or control cells of the present invention may be cells or cell populations that do not contain the MTEM or genetically modified meganuclease described herein, or polynucleotides having an amino acid sequence encoding the MTEM or genetically modified meganuclease described herein.
[0140] As used herein, the term “corresponding” with respect to modifications of two proteins or amino acid sequences is used to indicate that a particular modification of the first protein is the substitution of the same amino acid residue as a modification of the second protein, and that when the two proteins are subjected to standard sequence alignment (e.g., using the BLASTp program), the amino acid position of the modification of the first protein corresponds to or aligns with the amino acid position of the modification of the second protein. Thus, the modification of residue “X” in the first protein to amino acid “A” corresponds to the modification of residue “Y” in the second protein to amino acid “A,” despite the fact that residues X and Y can be different numbers, if residues X and Y correspond to each other in sequence alignment.
[0141] As used herein, the terms “disrupted,” “disrupt,” “disrupt expression,” or “disrupt target sequence” refer to the introduction of a mutation (e.g., a frameshift mutation) that interferes with gene function and thereby impairs the expression and / or function of the polypeptide / expression product it encodes. For example, nuclease-mediated disruption of a gene may result in the expression of a cleaved protein and / or a protein that does not retain its wild-type function. Furthermore, the introduction of a donor template into a gene may not result in the expression of the encoded protein, the expression of a cleaved protein, and / or a protein that does not retain its wild-type function.
[0142] As used herein, the term “encodes” refers to the inherent properties of a particular sequence of nucleotides in a polynucleotide, such as a gene, cDNA, or mRNA, and the biological properties arising therefrom, which serve as a template for the synthesis of other polymers and macromolecules in a biological process having either a defined sequence of nucleotides (e.g., rRNA, tRNA, and mRNA) or a defined sequence of amino acids. Thus, a gene, cDNA, or RNA codes for a protein if the transcription and translation of the mRNA corresponding to that gene produces a protein in a cell or other biological system. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and is typically provided in a sequence listing, and the non-coding strand, which is used as a template for the transcription of the gene or cDNA, can be said to code for a protein or other product of that gene or cDNA.
[0143] As used herein, the term “endogenous” with respect to a nucleotide sequence or protein is intended to mean a sequence or protein that is naturally present in a cell or expressed by a cell.
[0144] As used herein, the terms “exogenous” or “heterogeneous” with respect to nucleotide or amino acid sequences are intended to mean sequences that are purely synthetic, derived from alien species, or, if derived from the same species, substantially modified from their natural form in composition and / or at genomic loci by intentional human intervention.
[0145] As used herein, the term “expression” refers to the transcription and / or translation of a particular nucleotide sequence driven by a promoter.
[0146] As used herein, the term “expression vector” refers to a vector containing recombinant polynucleotides, which include an expression regulatory sequence operably ligated to the nucleotide sequence to be expressed. An expression vector contains sufficient cis-acting elements for expression, and other elements for expression may be supplied by a host cell or in an in vitro expression system. Expression vectors include all known in the art, including cosmids, plasmids (e.g., naked or liposome-containing), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) incorporating recombinant polynucleotides.
[0147] As used herein, the term “genetically modified” refers to a cell or organism whose genomic DNA sequence has been intentionally modified by recombinant technology, or has been intentionally modified in its ancestors. As used herein, the term “genetically modified” encompasses the term “transgenic.” For example, as used herein, a “genetically modified” cell may refer to a cell in which mitochondrial DNA has been intentionally modified by recombinant technology.
[0148] As used herein, the terms “homologous recombination” or “HR” refer to the innate cellular process in which double-strand DNA breaks are repaired using homologous DNA sequences as repair templates (see, for example, Cahill et al. (2006), Front. Biosci. 11:1958–1976). The homologous DNA sequence may be an endogenous chromosome sequence or an exogenous nucleic acid delivered to the cell.
[0149] As used herein, the terms “homologous arm” or “sequence homologous to a sequence adjacent to a nuclease cleavage site” refer to sequences adjacent to the 5' and 3' ends of a nucleic acid molecule that facilitate the insertion of the nucleic acid molecule into a cleavage site produced by a nuclease. Generally, homologous arms can be at least 50 base pairs, preferably at least 100 base pairs, and up to 2000 base pairs or more in length, and can have at least 90%, preferably at least 95% or more sequence homology to their corresponding sequences in the genome. In some embodiments, homologous arms are about 500 base pairs.
[0150] As used herein, the term “in vitro transcription RNA” refers to RNA synthesized in vitro, preferably mRNA. Generally, in vitro transcription RNA is produced from an in vitro transcription vector. An in vitro transcription vector contains a template used to produce in vitro transcription RNA.
[0151] As used herein, the term “isolated” means modified or removed from its natural state. For example, a nucleic acid or peptide that is naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide that has been partially or completely separated from its natural coexisting substances is “isolated.” Isolated nucleic acids or proteins may exist in a substantially purified form or in a non-natural environment, such as a host cell.
[0152] As used herein, the term “lentivirus” refers to a genus of the family Retroviridae. Lentiviruses are unique among retroviruses in that they can infect non-dividing cells. Because lentiviruses can deliver a significant amount of genetic information to the host cell's DNA, they are one of the most efficient methods of gene delivery vectors. HIV, SIV, and FIV are all examples of lentiviruses.
[0153] As used herein, the term “lipid nanoparticles” refers to lipid compositions having a spherical structure typically with an average diameter of 10 to 1000 nanometers. In some formulations, lipid nanoparticles may include at least one cationic lipid, at least one non-cationic lipid, and at least one conjugate lipid. Lipid nanoparticles known in the art that are suitable for encapsulating nucleic acids such as mRNA are intended for use in the present invention.
[0154] As used herein, the term “modification” in relation to recombinant proteins means any insertion, deletion, or substitution of amino acid residues within the recombinant sequence relative to a reference sequence (e.g., wild-type or natural sequence).
[0155] As used herein, the terms “non-homologous end joining” or “NHEJ” refer to the innate cellular process in which double-strand DNA breaks are repaired by the direct joining of two non-homologous DNA segments (see, e.g., Cahill et al. (2006), Front. Biosci. 11:1958–1976). DNA repair by non-homologous end joining is prone to errors and frequently results in templateless additions or deletions of the DNA sequence at the repair site. In some cases, breaks at target recognition sequences result in an NHEJ at the target recognition site. Nuclease-induced breaks at target sites in the coding sequence of a gene, followed by DNA repair by an NHEJ, can introduce mutations into the coding sequence, such as frameshift mutations that disrupt gene function. Thus, genetically engineered nucleases can be used to effectively knock out genes in a population of cells.
[0156] As used herein, the term “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that encode the same amino acid sequence, including degenerate versions of each other. The phrase “nucleotide sequence encoding a protein or RNA” can also mean that a nucleotide sequence encoding a protein may contain introns to the extent that one version may contain one or more introns.
[0157] As used herein, the term “operatably linked” is intended to mean a functional link between two or more elements. For example, the operatably linked link between a nucleic acid sequence encoding a nuclease and a regulatory sequence (e.g., a promoter) described herein is a functional link that enables the expression of the nucleic acid sequence encoding the nuclease. The operatably linked elements may be contiguous or discontinuous. When used to refer to the joining of two protein-coding regions, operatably linked means that the coding regions are within the same reading frame.
[0158] Where used herein, unless otherwise specified, the word “or” is used in the comprehensive sense of “and / or” and not in the exclusive sense of “either / or.”
[0159] As used herein, the terms “peptide,” “polypeptide,” and “protein” are interchangeable and refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can be included in a protein or peptide sequence. A polypeptide includes any peptide or protein containing two or more amino acids linked to each other by peptide bonds. As used herein, the terms refer to both short chains, also commonly called peptides, oligopeptides, and oligomers in the art, and long chains, also commonly called proteins in the art, of which there are many types. A “polypeptide” includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, and fusion proteins. Polypeptides include native peptides, recombinant peptides, or combinations thereof.
[0160] As used herein, the terms “reduced” or “decreased” refer to a reduction in the percentage or ratio of cells in a population of cells containing a mutant mitochondrial genome with the MELAS mutation, compared to a population of control cells. In some embodiments, “reduced” or “decreased” refers to a reduction in the percentage of mutant mitochondrial genomes or the ratio of mutant mitochondrial genomes to wild-type mitochondrial genomes in a single cell or cell population. Such reductions may be up to 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or up to 100%. Thus, the term “reduced” encompasses both partial and complete reductions of mutant mtDNA.
[0161] As used herein, terms such as “identity percentage,” “sequence identity,” “similarity percentage,” and “sequence similarity,” which relate to both amino acid sequences and nucleic acid sequences, refer to a measure of the degree of similarity between two sequences based on sequence alignment, which maximizes the similarity between aligned amino acid residues or nucleotides and is a function of the number of identical or similar residues or nucleotides, the total number of residues or nucleotides, and the presence and length of gaps in the sequence alignment. Various algorithms and computer programs are available to determine sequence similarity using standard parameters. Where used herein, sequence similarity is measured using the BLASTp program for amino acid sequences and the BLASTn program for nucleic acid sequences, both of which are available from the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ) and are described, for example, in Altschul et al. (1990), J.Mol.Biol.215:403-410, Gish and States (1993), Nature Genet.3:266-272, Madden et al. (1996), Meth.Enzymol.266:131-141, Altschul et al. (1997), Nucleic Acids Res.25:33 89-3402), and Zhang et al. (2000), J.Comput.Biol.7(1-2):203-14. As used herein, the similarity percentage of two amino acid sequences is a score based on the following parameters for the BLASTp algorithm: word size = 3, gap start penalty = -11, gap extension penalty = -1, and score matrix = BLOSUM 62. As used herein, the similarity percentage of two nucleic acid sequences is a score based on the following parameters for the BLASTn algorithm: word size = 11, gap start penalty = -5, gap extension penalty = -2, match reward = 1, mismatch penalty = -3.
[0162] As used herein, the term "poly(A)" refers to a series of adenosines bound to mRNA by polyadenylation. In preferred embodiments of constructs for transient expression, poly(A) is 50 to 5000, preferably greater than 64, more preferably greater than 100, and most preferably greater than 300 or 400. The poly(A) sequence can be chemically or enzymatically modified to modulate the functionality of the mRNA, such as localization, stability, or translation efficiency.
[0163] As used herein, the term “polyadenylation” refers to the covalent bonding of a polyadenylyl moiety or a modified variant thereof to a messenger RNA molecule. In eukaryotes, most messenger RNA (mRNA) molecules are polyadenylated at their 3' end. The 3' poly(A) tail is a long sequence of adenine nucleotides (often hundreds) added to pre-mRNA by the action of the enzyme polyadenylate polymerase. In higher eukaryotes, the poly(A) tail is added to transcripts containing a specific sequence, the polyadenylation signal. The poly(A) tail and the proteins bound to it help protect mRNA from degradation by exonucleases. Polyadenylation is also important for transcription termination, export of mRNA from the nucleus, and translation. Polyadenylation occurs in the nucleus immediately after DNA is transcribed into RNA, but may also occur later in the cytoplasm. After transcription is complete, the mRNA strand is cleaved by an endonuclease complex bound to RNA polymerase. The cleavage site is usually characterized by the presence of the base sequence AAUAAA near the cleavage site. After the mRNA is cleaved, an adenosine residue is added to the free 3' end of the cleavage site.
[0164] As used herein, the terms “promoter” or “regulatory sequence” refer to a nucleic acid sequence required for the expression of a gene product operably ligated to a promoter / regulatory sequence. In some examples, this sequence may be a core promoter sequence, while in others, this sequence may also include enhancer sequences and other regulatory elements required for the expression of the gene product. The promoter / regulatory sequence may, for example, express the gene product in a tissue-specific manner.
[0165] As used herein, the terms “recombinant” or “genetically engineered” with respect to proteins mean having an amino acid sequence that has been modified as a result of the application of genetic engineering techniques to the nucleic acid encoding the protein and to the cells or organisms expressing the protein. With respect to nucleic acids, the terms “recombinant” or “genetically engineered” mean having a nucleic acid sequence that has been modified as a result of the application of genetic engineering techniques. Genetic engineering techniques include, but are not limited to, PCR and DNA cloning techniques, transfection, transformation and other gene transfer techniques, homologous recombination, site-directed mutagenesis, and gene fusion. According to this definition, a protein that has the same amino acid sequence as a naturally occurring protein but is produced by cloning and expression in a heterologous host is not considered recombinant or genetically engineered.
[0166] As used herein, the terms “recombinant DNA construct,” “recombinant construct,” “expression cassette,” “expression construct,” “chimeric construct,” “construct,” and “recombinant DNA fragment” are used interchangeably herein and refer to single-stranded or double-stranded polynucleotides. Recombinant constructs include artificial combinations of nucleic acid fragments that include, but are not limited to, regulatory and coding sequences not found together in nature. For example, a recombinant DNA construct may include regulatory and coding sequences from different sources, or regulatory and coding sequences from the same source arranged in a manner different from that found in nature. Such constructs may be used alone or in combination with a vector.
[0167] As used herein, the term “tissue-specific promoter” refers to a nucleotide sequence that, when operably linked to a polynucleotide encoding or specified by a gene, causes the cell to substantially produce a gene product only if the cell is a tissue type corresponding to the promoter.
[0168] As used herein, the terms “transfected,” “transformed,” “transduced,” or “nucleofected” refer to the process by which an exogenous nucleic acid is transferred to or introduced into a host cell. A “transfected,” “transformed,” or “transduced” cell is a cell that has been transfected, transformed, or transduced with an exogenous nucleic acid. Cells include primary target cells and their offspring.
[0169] As used herein, the term “transfer vector” refers to a composition of substances comprising isolated nucleic acids that can be used to deliver the isolated nucleic acids into the interior of a cell. Numerous vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Therefore, the term “transfer vector” includes autonomously replicating plasmids or viruses. The term should also be interpreted to further include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as polylysine compounds and liposomes. Examples of viral transfer vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, and lentiviral vectors.
[0170] As used herein, the term “transient” refers to the expression of a non-integrated transgene over a period of several hours, days, or weeks, the expression period being shorter than the expression period of a gene if it is integrated into the genome or contained within a stable plasmid replicon in a host cell.
[0171] As used herein, the terms “vector” or “recombinant DNA vector” may refer to a construct comprising a replication system and sequence capable of transcribing and translating a polypeptide-encoding sequence in a given host cell. Where a vector is used, the choice of vector depends, as is well known to those skilled in the art, on the method used to transform the host cell. Examples of vectors include, but are not limited to, plasmid vectors and recombinant AAV vectors, or any other vectors known in the art suitable for delivering genes to target cells. Those skilled in the art are well aware of the genetic elements that must be present on a vector in order to successfully transform, select, and propagate host cells containing any of the isolated nucleotides or nucleic acid sequences described herein. In some embodiments, “vector” also refers to a viral vector. Viral vectors may include, but are not limited to, retroviral vectors, lentiviral vectors, adenovirus vectors, and adeno-associated virus vectors (AAVs).
[0172] As used herein, the term “wild-type” refers to the most common naturally occurring allele (i.e., polynucleotide sequence) in the allele population of the same type of gene, the polypeptide encoded by the wild-type allele having its original function. The term “wild-type” also refers to the polypeptide encoded by the wild-type allele. Wild-type alleles (i.e., polynucleotides) and polypeptides are distinguishable from mutant or variant alleles and polypeptides that contain one or more mutations and / or substitutions to the wild-type sequence. Wild-type alleles or polypeptides may confer a normal phenotype in an organism, while mutant or variant alleles or polypeptides may, in some cases, confer an altered phenotype. Wild-type nucleases are distinguishable from recombinant nucleases or nucleases that do not exist naturally. The term “wild-type” may also refer to cells, organisms and / or subjects that have the wild-type allele of a particular gene, or cells, organisms and / or subjects used for comparative purposes.
[0173] As used herein, the term “modified specificity” when referring to a nuclease means that the nuclease binds to and cleaves a recognition sequence that does not bind to a reference nuclease (e.g., wild-type) under physiological conditions and is not cleaved by the reference nuclease, or that the cleavage rate of the recognition sequence is increased or decreased by a biologically significant amount (e.g., at least 2×, or 2×-10×) compared to the reference nuclease.
[0174] As used herein, the term “central sequence” refers to the four base pairs that separate a half-part of the meganuclease recognition sequence. These bases are numbered +1 through +4. The central sequence contains the four bases that become a 3' single-stranded overhang after meganuclease cleavage. The “central sequence” can refer to the sequence of the sense strand or the antisense (opposite) strand. Meganucleases are symmetric and recognize the bases equally on both the sense and antisense strands of the central sequence. For example, the sequence A+1A+2A+3A+4 on the sense strand is recognized by the meganuclease as T+1T+2T+3T+4 on the antisense strand, and therefore A+1A+2A+3A+4 and T+1T+2T+3T+4 are functionally equivalent (e.g., both can be cleaved by a given meganuclease). Therefore, sequence C+1T+2G+3C+4 is equivalent to its opposite-chain sequence G+1C+2A+3G+4 due to the fact that the meganuclease binds to its recognition sequence as a symmetric homodimer.
[0175] As used herein, the terms “cleave” or “cleave” refer to the hydrolysis of a phosphodiester bond within the backbone of a recognition sequence in the target sequence, which results in a double-strand break in the target sequence, as referred herein to as a “cleavage site.”
[0176] As used herein, the terms “DNA binding affinity” or “binding affinity” mean the tendency of a nuclease to non-covalently bind to a reference DNA molecule (e.g., a recognition sequence or any sequence). Binding affinity is measured by the dissociation constant Kd. As used herein, a nuclease has “modified” binding affinity if its Kd to a reference recognition sequence increases or decreases by a statistically significant percentage compared to the reference nuclease.
[0177] As used herein, the term “hypervariable region” refers to a localization sequence within a meganuclease monomer or subunit containing amino acids with relatively high variability. A hypervariable region may include about 50–60 consecutive residues, about 53–57 consecutive residues, or preferably about 56 residues. In some embodiments, the residues of the hypervariable region may correspond to positions 24–79 or 215–270 of any one of SEQ ID NOs: 3–12. A hypervariable region may include one or more residues that come into contact with DNA bases in the recognition sequence and may be modified to alter the base selectivity of the monomer or subunit. A hypervariable region may also include one or more residues that bind to the DNA backbone when the meganuclease binds to a double-stranded DNA recognition sequence. Such residues may be modified to alter the binding affinity of the meganuclease to the DNA backbone and the target recognition sequence. In different embodiments described herein, a hypervariable region may include 1–20 residues that exhibit variability and can be modified to affect base selectivity and / or DNA binding affinity. In certain embodiments, the hypervariable region comprises about 15–20 residues that can be modified to exhibit variability and affect base selectivity and / or DNA binding affinity. In some embodiments, the variable residues within the hypervariable region correspond to one or more of the positions 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 3–12. In other embodiments, the variable residues within the hypervariable region correspond to one or more of the positions 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of any one of SEQ ID NOs: 3–12.
[0178] As used herein, the term “linker” refers to an exogenous peptide sequence used to link two nuclease subunits to a single polypeptide. The linker may have a sequence found in native proteins or an artificial sequence not found in native proteins. The linker may be flexible, lack secondary structure, or have a tendency to form a specific three-dimensional structure under physiological conditions. The linker may include, but is not limited to, those covered by U.S. Patents 8,445,251, 9,340,777, 9,434,931 and 10,041,053, each of which is incorporated as a whole by reference. In some embodiments, the linker may have an amino acid sequence showing any one of residues 154–195 of SEQ ID NOs. 3–12.
[0179] As used herein, the term “meganucleases” refers to endonucleases that bind to double-stranded DNA with a recognition sequence of more than 12 base pairs. In some embodiments, the recognition sequences of the meganucleases of this disclosure are 22 base pairs. Meganucleases may be endonucleases derived from I-CreI (SEQ ID NO: 48), and may refer to genetically engineered variants of I-CreI that are modified from the native I-CreI with respect to, for example, DNA binding specificity, DNA cleavage activity, DNA binding affinity, or dimerization properties. Methods for producing such modified variants of I-CreI are known in the art (e.g., International Publication No. 2007 / 047859, which is incorporated in whole by reference). Meganucleases as used herein bind to double-stranded DNA as heterodimers. Meganucleases may also be “single-stranded meganucleases” in which a pair of DNA-binding domains are linked to a single polypeptide using a peptide linker. The term “homing endonuclease” is synonymous with the term “meganuclease.” The meganucleases of this disclosure, when expressed in target cells as described herein, are substantially nontoxic when measured using the methods described herein, and can transfect cells and maintain them at 37°C without observing any adverse effects on cell viability or a significant reduction in meganuclease cleavage activity.
[0180] As used herein, the terms “nuclease” and “endonuclease” are used interchangeably to refer to naturally occurring or genetically modified enzymes that cleave phosphodiester bonds within polynucleotide chains.
[0181] As used herein, the term “mitochondrial-targeted genetically engineered meganuclease” or “MTEM” refers to a genetically engineered meganuclease that is conjugated to a peptide or other molecule that can direct the genetically engineered meganuclease to mitochondria so that it can bind to and cleave mitochondrial DNA within mitochondrial organelles.
[0182] As used herein, the term “mitochondrial-transfer peptide” or “MTP” refers to a peptide or amino acid fragment that can bind to another molecule in order to transport a molecule within mitochondria. For example, an MTP can bind to a nuclease, such as a genetically modified meganuclease, in order to transport the genetically modified meganuclease to mitochondria. An MTP can consist of an alternating pattern of hydrophobic and positively charged amino acids, forming a so-called amphiphilic helix.
[0183] As used herein, the terms “recognition half-site,” “recognition sequence half-site,” or simply “half-site” mean a nucleic acid sequence within a double-stranded DNA molecule that is recognized and bound by a monomer of a homodimeric or heterodimeric meganuclease, or by one subunit of a single-stranded meganuclease, or by one subunit of a single-stranded meganuclease.
[0184] As used herein, the terms “recognition sequence” or “recognition site” refer to the DNA sequence that is bound and cleaved by a nuclease. In the case of meganucleases, the recognition sequence contains a pair of inverted 9-base pair “half-sites” separated by 4 base pairs. In the case of single-stranded meganucleases, the N-terminal domain of the protein contacts the first half-site, and the C-terminal domain of the protein contacts the second half-site. Cleavage by the meganuclease creates a 4-base pair 3' overhang. An “overhang” or “sticky end” is a short single-stranded DNA segment that can be produced by endonuclease cleavage of a double-stranded DNA sequence. In the case of meganucleases derived from I-CreI and single-stranded meganucleases, the overhang contains bases 10–13 of the 22-base pair recognition sequence. As used herein, the term “single-stranded meganuclease” refers to a polypeptide containing a pair of nuclease subunits linked by a linker. Single-stranded meganucleases have the following structure: N-terminal subunit - linker - C-terminal subunit. The two meganuclease subunits generally have different amino acid sequences and bind to non-identical DNA sequences. Therefore, single-stranded meganucleases typically cleave pseudopalindromic or non-palindromic recognition sequences. Single-stranded meganucleases are not actually dimers, but are sometimes called "single-stranded heterodimers" or "single-stranded heterodimer meganucleases." For clarity, unless otherwise specified, the term "meganucleases" can refer to dimers or single-stranded meganucleases.
[0185] As used herein, the term “specificity” means the ability of a nuclease to bind to and cleave a double-stranded DNA molecule only at a specific sequence of base pairs called a recognition sequence, or only at a specific set of recognition sequences. A set of recognition sequences shares certain conserved positions or sequence motifs, but can be degenerate at one or more positions. A highly specific nuclease can cleave only one or a very small number of recognition sequences. Specificity can be determined by any method known in the art.
[0186] As used herein, the terms “target site” or “target sequence” refer to a region of cellular chromosomal DNA containing the nuclease recognition sequence.
[0187] As used herein, “vector” may also refer to a viral vector (i.e., a recombinant virus). Viral vectors may include, but are not limited to, retroviral vectors, lentiviral vectors, adenovirus vectors, and adeno-associated virus vectors (AAVs).
[0188] As used herein, the terms “serotype” or “capsid” refer to distinct variants within a species of virus determined based on viral cell surface antigens. Known serotypes of AAV include, among others, AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAVHSC (Weitzman and Linden (2011) in *Snyder and Moullier Adeno-associated virus methods and protocols*, Totowa, NJ: Humana Press).
[0189] As used herein, “control” or “control cell” refers to a cell that provides a reference point for measuring changes in the genotype or phenotype of a genetically modified cell. Control cells may include, for example, (a) wild-type cells, i.e., wild-type cells with the same genotype as the starting material for the genetic modification that resulted in the genetically modified cell; (b) cells with the same genotype as the genetically modified cell but transformed with a null construct (i.e., a construct that does not have a known effect on the trait of interest); or (c) cells that are genetically identical to the genetically modified cell but have not been exposed to conditions, stimuli or further genetic modifications that induce the expression of the modified genotype or phenotype.
[0190] As used herein, the terms “effective dose” or “therapeutic effective dose” refer to an amount sufficient to produce a beneficial or desirable biological and / or clinical outcome. The therapeutic effective dose varies depending on the formulation or composition used, the disease and its severity, and the age, weight, physical condition, and responsiveness of the subject being treated. In some specific embodiments, the effective dose of the MTEM or genetically modified meganuclease described herein is approximately 1 x 10⁻¹⁶ 10 gc / kg ~ approx. 1x10 14 gc / kg (for example, 1 x 10) 10 gc / kg, 1x10 11 gc / kg, 1x10 12 gc / kg, 1x10 13 gc / kg, or 1x10 14 The composition comprises (gc / kg) a nucleic acid encoding the MTEM or genetically modified meganuclease described herein, or a template nucleic acid. In certain embodiments, a pharmaceutical composition comprising an effective amount of the MTEM or genetically modified meganuclease encoding nucleic acid and / or template nucleic acid described herein, or the MTEM or genetically modified meganuclease encoding nucleic acid and / or template nucleic acid described herein, reduces at least one symptom of a disease in a subject.
[0191] As used herein, the terms “effective dose,” “effective amount,” “therapeutic effective dose,” or “therapeutic effective amount” refer to an amount sufficient to produce a beneficial or desirable biological and / or clinical outcome.
[0192] As used herein, the terms “gc / kg” or “gene copies / kilogram” mean the number of copies of the MTEM or genetically modified meganuclease encoding nucleic acid described herein, or the number of copies of the template nucleic acid described herein, per kilogram of body weight of the subject to whom the MTEM or genetically modified meganuclease encoding nucleic acid and / or template nucleic acid described herein are administered.
[0193] As used herein, the term “prevent” refers to the prevention of a patient’s disease or condition.
[0194] As used herein, the term “prevention” means measures to prevent or protect against disease or disease condition.
[0195] As used herein, the term “reduced” refers to any reduction in the symptoms or severity of a disease. Such reductions may be up to 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or up to 100%. Thus, the term “reduced” encompasses both partial and complete reductions of the disease condition.
[0196] Where used herein, an enumeration of numerical ranges for a variable is intended to convey that the disclosure may be carried out with a variable equal to any value within that range. Thus, for a variable that is inherently discrete, the variable may be equal to any integer value within the numerical range that includes the endpoint of the range. Similarly, for a variable that is inherently continuous, the variable may be equal to any real number within the numerical range that includes the endpoint of the range. As an example, a variable described, but not limited to, having values between 0 and 2 may, if the variable is inherently discrete, take the values 0, 0.1, 0.01, 0.001, or any other real number ≥ 0 and ≤ 2.
[0197] 2.1 Principle of the Invention Mitochondria regulate cellular energy and metabolism under normal growth and development, as well as in response to stress. Therefore, mitochondrial genome editing has diverse applications in both animals and plants. In humans, harmful mitochondrial mutations are the cause of several disorders to which gene editing therapy can be applied. However, even considering the potential of using mitochondrial genome editing for therapeutic applications, this remains an unexplored area of science because it is not possible to efficiently target mitochondrial DNA (mtDNA) and produce precise edits. The mitochondrial genome is difficult to edit because editing techniques must be delivered to this organelle. Furthermore, mitochondria lack predictable repair mechanisms. Previous attempts to edit the mitochondrial genome have resulted in large-scale and unpredictable deletions / reorganizations. Therefore, compositions and methods are desired that enable the targeting and editing of a given region of the mitochondrial genome (preferably limited to a single gene) in a more predictable manner.
[0198] This disclosure provides compositions and methods for binding to and cleaving recognition sequences on the mitochondrial genome without affecting surrounding regions within the mitochondrial genome. This disclosure discloses genetically engineered meganucleases bound to MTPs such that double-stroke bonds (DSBs) can be generated in mtDNA. The invention demonstrates that genetically engineered meganucleases can be directed to mitochondrial organelles to facilitate precise editing of mtDNA, thus opening up a whole field of prospects and opportunities in life sciences.
[0199] 2.2 Genetically modified meganucleases and mitochondrial-targeted genetically modified meganucleases for recognizing and cleaving recognition sequences in human mitochondrial DNA It is known in the art that site-specific nucleases can be used to cleave DNA within the genome of living cells, and that such DNA cleavage can lead to permanent genomic modification via homologous recombination with transgenic DNA sequences. The use of nucleases to induce double-strand breaks at target loci is known to stimulate homologous recombination of transgenic DNA sequences adjacent to sequences homologous to genomic targets. In this way, exogenous nucleic acid sequences can be inserted into target loci.
[0200] Mitochondrial-targeting genetically engineered meganucleases (MTEMs), constructed from genetically engineered meganucleases bound to mitochondrial-transfer peptides (MTPs), can be effectively transported from the cytoplasm of eukaryotic cells to mitochondria. Once inside the mitochondrial organelle, MTEMs can bind to and cleave recognition sequences within the mitochondrial genome. It is known in the art that site-specific nucleases can be used to perform DNA cleavage within the genome of living cells, and such DNA cleavage can lead to permanent genomic modification via mutagenic NHEJ repair or homologous recombination with transgenic DNA sequences. NHEJs can induce mutagenesis at the cleavage site, resulting in allelic inactivation. NHEJ-associated mutagenesis can inactivate alleles through the generation of early stop codons, frameshift mutations producing abnormal non-functional proteins, or induce mechanisms such as nonsense mutation-mediated mRNA degradation. The use of nucleases that induce mutagenesis via NHEJs can be used to target specific mutations or sequences present in wild-type alleles. Furthermore, the use of nucleases to induce double-strand breaks at target loci is known to stimulate homologous recombination of transgenic DNA sequences adjacent to sequences homologous to genomic targets. In this way, exogenous nucleic acid sequences can be inserted into target loci. Such exogenous nucleic acids can encode any sequence or polypeptide of interest. In some embodiments, site-specific nucleases can cleave recognition sequences within the mitochondrial genome, resulting in the degradation of the mitochondrial genome from the cleavage ends created by the site-specific nuclease.
[0201] The nuclease used to carry out the present invention is a meganuclease. In certain embodiments, the meganuclease used to carry out the present invention is a single-stranded meganuclease. The single-stranded meganuclease comprises an N-terminal subunit and a C-terminal subunit linked by a linker peptide. Each of the two domains recognizes and binds to half of the recognition sequence (i.e., the recognition half-site), and the site of DNA breakage is located in the middle of the recognition sequence near the interface of the two subunits. The DNA strand break is offset by four base pairs such that the DNA breakage by the meganuclease produces a pair of four-base pair 3' single-stranded overhangs.
[0202] In some embodiments, the genetically engineered meganucleases described herein are genetically engineered to bind to and cleave the MIT 25-26 recognition sequence (SEQ ID NO: 1). Such genetically engineered meganucleases are referred to herein as “MIT 25-26 meganucleases” or “MIT 25-26 nucleases.” In certain embodiments, the MIT 25-26 meganuclease is bound to an MTP for the MTEM to cleave the MIT 25-26 recognition sequence of SEQ ID NO: 1.
[0203] The genetically engineered meganucleases described herein may comprise a first subunit comprising a first hypervariable (HVR1) region and a second subunit comprising a second hypervariable (HVR2) region. Furthermore, the first subunit may bind to a first recognition half-site in the recognition sequence (e.g., MIT 25 half-site), and the second subunit may bind to a second recognition half-site in the recognition sequence (e.g., MIT 26 half-site). In embodiments where the genetically engineered meganuclease is a single-stranded meganuclease, the first and second subunits may be oriented such that the first subunit comprising the HVR1 region and binding to the first half-site is positioned as the N-terminal subunit, and the second subunit comprising the HVR2 region and binding to the second half-site is positioned as the C-terminal subunit. In alternative embodiments, the first and second subunits may be oriented such that the first subunit, which includes the HVR1 region and binds to the first half-region, is positioned as the C-terminal subunit, and the second subunit, which includes the HVR2 region and binds to the second half-region, is positioned as the N-terminal subunit.
[0204] Exemplary MIT 25-26 meganucleases described herein are provided in Table 1 and further described below.
[0205] [Table 1]
[0206] * "MIT25 subunit%" and "MIT26 subunit%" represent the amino acid sequence identity between the MIT25-binding subunit region and the MIT26-binding subunit region of each meganuclease and the MIT25-26x.91 meganuclease, respectively.
[0207] In certain embodiments described herein, the genetically engineered meganuclease binds to and cleaves a recognition sequence containing Sequence ID No. 1 in the mitochondrial genome, wherein the genetically engineered meganuclease comprises a first subunit and a second subunit, the first subunit binding to a first recognition half-site of the recognition sequence and comprising a first hypervariable (HVR1) region, and the second subunit binding to a second recognition half-site of the recognition sequence and comprising a second hypervariable (HVR2) region.
[0208] In some embodiments, the HVR1 region includes an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with respect to the amino acid sequence corresponding to residues 24–79 of any one of SEQ ID NOs: 3–12. In some such embodiments, the HVR1 region includes one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 3–12. In some such embodiments, the HVR1 region includes residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of any one of SEQ ID NOs: 3–12. In some such embodiments, the HVR1 region includes Y, R, K, or D in the residue corresponding to any one residue 66 of SEQ ID NOs: 3-12. In some such embodiments, the HVR1 region includes any one residue 24-79 of SEQ ID NOs: 3-12. In some such embodiments, the HVR2 region includes an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with respect to the amino acid sequence corresponding to any one residue 215-270 of SEQ ID NOs: 3-12. In some such embodiments, the HVR2 region includes one or more residues corresponding to any one residue 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NOs: 3-12. In some such embodiments, the HVR2 region includes residues corresponding to any one of the residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NOs: 3-12.In some such embodiments, the HVR2 region includes Y, R, K, or D in the residue corresponding to any one of the residues 257 of SEQ ID NOs: 3-12. In some such embodiments, the HVR2 region includes any one of the residues 215-270 of SEQ ID NOs: 3-12. In some such embodiments, the first subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one residue 7-153 of SEQ ID NOs. 3-12, and the second subunit comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one residue 198-344 of SEQ ID NOs. In some such embodiments, the first subunit comprises G, S, or A in the residue corresponding to any one residue 19 of SEQ ID NOs. 3-12. In some such embodiments, the first subunit contains E, Q, or K at the residue corresponding to any one residue 80 of SEQ ID NOs: 3-12. In some such embodiments, the second subunit contains G, S, or A at the residue corresponding to any one residue 210 of SEQ ID NOs: 3-12. In some such embodiments, the second subunit contains E, Q, or K at the residue corresponding to any one residue 271 of SEQ ID NOs: 3-12. In some such embodiments, the first subunit contains the residue corresponding to any one residue 80 of SEQ ID NOs: 3-12. In some such embodiments, the second subunit contains the residue corresponding to any one residue 271 of SEQ ID NOs: 3-12. In some such embodiments, the genetically engineered meganuclease is a single-stranded meganuclease containing a linker, which covalently bonds the first subunit and the second subunit.In some such embodiments, the genetically engineered meganuclease comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 3-12. In some such embodiments, the genetically engineered meganuclease comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence shown in any one of SEQ ID NOs: 33-42. In some such embodiments, the genetically engineered meganuclease comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleic acid sequence shown in any one of SEQ ID NOs: 33-42.
[0209] MIT 25-26x.91 (Sequence ID 3) In some embodiments, the HVR1 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 3. In some embodiments, the HVR1 region includes one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 3. In some embodiments, the HVR1 region includes residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 3. In some embodiments, the HVR1 region includes Y, R, K, or D in the residue corresponding to residue 66 of SEQ ID NO: 3. In some embodiments, the HVR1 region includes residues 24-79 of SEQ ID NO: 3, having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions.
[0210] In some embodiments, the first subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 7-153 of SEQ ID NO: 3. In some embodiments, the first subunit includes G, S, or A in the residue corresponding to residue 19 of SEQ ID NO: 3. In some embodiments, the first subunit includes a residue corresponding to residue 19 of SEQ ID NO: 3. In some embodiments, the first subunit includes E, Q, or K in the residue corresponding to residue 80 of SEQ ID NO: 3. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 3 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0211] In some embodiments, the HVR2 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 3. In some embodiments, the HVR2 region includes one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 3. In some embodiments, the HVR2 region includes residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 3. In some embodiments, the HVR2 region includes Y, R, K, or D in the residue corresponding to residue 257 of SEQ ID NO: 3. In some embodiments, the HVR2 region includes the residue corresponding to residue 241 of SEQ ID NO: 3. In some embodiments, the HVR2 region includes the residue corresponding to residue 262 of SEQ ID NO: 3. In some embodiments, the HVR2 region includes the residue corresponding to residue 263 of SEQ ID NO: 3. In some embodiments, the HVR2 region includes the residue corresponding to residue 264 of SEQ ID NO: 3. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 3 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 3.
[0212] In some embodiments, the second subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 198-344 of SEQ ID NO: 3. In some embodiments, the second subunit includes G, S, or A in the residue corresponding to residue 210 of SEQ ID NO: 3. In some embodiments, the second subunit includes E, Q, or K in the residue corresponding to residue 271 of SEQ ID NO: 3. In some embodiments, the second subunit includes a residue corresponding to residue 330 of SEQ ID NO: 3. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 3 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0213] In some embodiments, the genetically engineered meganuclease is a single-stranded meganuclease containing a linker, the linker covalently bonding the first subunit to the second subunit. In some embodiments, the genetically engineered meganuclease contains an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to SEQ ID NO: 3. In some embodiments, the genetically engineered meganuclease contains the amino acid sequence of SEQ ID NO: 3. In some embodiments, the genetically engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the nucleic acid sequence shown in SEQ ID NO: 33. In some embodiments, the genetically engineered meganuclease is encoded by the nucleic acid sequence shown in SEQ ID NO: 33.
[0214] MIT 25-26x.48 (Sequence ID 4) In some embodiments, the HVR1 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 4. In some embodiments, the HVR1 region includes one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 4. In some embodiments, the HVR1 region includes residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 4. In some embodiments, the HVR1 region includes Y, R, K, or D in the residue corresponding to residue 66 of SEQ ID NO: 4. In some embodiments, the HVR1 region includes residues 24-79 of SEQ ID NO: 4, which have up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions.
[0215] In some embodiments, the first subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 7-153 of SEQ ID NO: 4. In some embodiments, the first subunit includes G, S, or A in the residue corresponding to residue 19 of SEQ ID NO: 4. In some embodiments, the first subunit includes a residue corresponding to residue 19 of SEQ ID NO: 4. In some embodiments, the first subunit includes E, Q, or K in the residue corresponding to residue 80 of SEQ ID NO: 4. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 4 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0216] In some embodiments, the HVR2 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 4. In some embodiments, the HVR2 region includes one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 4. In some embodiments, the HVR2 region includes residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 4. In some embodiments, the HVR2 region includes Y, R, K, or D in the residue corresponding to residue 257 of SEQ ID NO: 4. In some embodiments, the HVR2 region includes the residue corresponding to residue 241 of SEQ ID NO: 4. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 4 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 4.
[0217] In some embodiments, the second subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 198-344 of SEQ ID NO: 4. In some embodiments, the second subunit includes G, S, or A in the residue corresponding to residue 210 of SEQ ID NO: 4. In some embodiments, the second subunit includes E, Q, or K in the residue corresponding to residue 271 of SEQ ID NO: 4. In some embodiments, the second subunit includes a residue corresponding to residue 276 of SEQ ID NO: 4. In some embodiments, the second subunit includes a residue corresponding to residue 330 of SEQ ID NO: 4. In some embodiments, the second subunit includes residues 198-344 of SEQ ID NO: 4, having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0218] In some embodiments, the genetically engineered meganuclease is a single-stranded meganuclease containing a linker, the linker covalently bonding the first subunit to the second subunit. In some embodiments, the genetically engineered meganuclease contains an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to SEQ ID NO: 4. In some embodiments, the genetically engineered meganuclease contains the amino acid sequence of SEQ ID NO: 4. In some embodiments, the genetically engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the nucleic acid sequence shown in SEQ ID NO: 34. In some embodiments, the genetically engineered meganuclease is encoded by the nucleic acid sequence shown in SEQ ID NO: 34.
[0219] MIT 25-26x.73 (Sequence ID 5) In some embodiments, the HVR1 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 5. In some embodiments, the HVR1 region includes one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 5. In some embodiments, the HVR1 region includes residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 5. In some embodiments, the HVR1 region includes Y, R, K, or D in the residue corresponding to residue 66 of SEQ ID NO: 5. In some embodiments, the HVR1 region includes residues 24-79 of SEQ ID NO: 5, which have up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions.
[0220] In some embodiments, the first subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 7-153 of SEQ ID NO: 5. In some embodiments, the first subunit includes G, S, or A in the residue corresponding to residue 19 of SEQ ID NO: 5. In some embodiments, the first subunit includes a residue corresponding to residue 19 of SEQ ID NO: 5. In some embodiments, the first subunit includes E, Q, or K in the residue corresponding to residue 80 of SEQ ID NO: 5. In some embodiments, the residue is the residue corresponding to residue 80 of SEQ ID NO: 5. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 5, having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0221] In some embodiments, the HVR2 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 5. In some embodiments, the HVR2 region includes one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 5. In some embodiments, the HVR2 region includes residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 5. In some embodiments, the HVR2 region includes Y, R, K, or D in the residue corresponding to residue 257 of SEQ ID NO: 5. In some embodiments, the HVR2 region includes the residue corresponding to residue 241 of SEQ ID NO: 5. In some embodiments, the HVR2 region includes the residue corresponding to residue 263 of SEQ ID NO: 5. In some embodiments, the HVR2 region includes the residue corresponding to residue 264 of SEQ ID NO: 5. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 5 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 5.
[0222] In some embodiments, the second subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 198-344 of SEQ ID NO: 5. In some embodiments, the second subunit includes G, S, or A in the residue corresponding to residue 210 of SEQ ID NO: 5. In some embodiments, the second subunit includes E, Q, or K in the residue corresponding to residue 271 of SEQ ID NO: 5. In some embodiments, the second subunit includes a residue corresponding to residue 330 of SEQ ID NO: 5. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 5, having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0223] In some embodiments, the genetically engineered meganuclease is a single-stranded meganuclease containing a linker, the linker covalently bonding the first subunit to the second subunit. In some embodiments, the genetically engineered meganuclease contains an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to SEQ ID NO: 5. In some embodiments, the genetically engineered meganuclease contains the amino acid sequence of SEQ ID NO: 5. In some embodiments, the genetically engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the nucleic acid sequence shown in SEQ ID NO: 35. In some embodiments, the genetically engineered meganuclease is encoded by the nucleic acid sequence shown in SEQ ID NO: 35.
[0224] MIT 25-26x.29 (Sequence ID 6) In some embodiments, the HVR1 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 6. In some embodiments, the HVR1 region includes one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 6. In some embodiments, the HVR1 region includes residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 6. In some embodiments, the HVR1 region includes Y, R, K, or D in the residue corresponding to residue 66 of SEQ ID NO: 6. In some embodiments, the HVR1 region includes residues 24-79 of SEQ ID NO: 6, which have up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions.
[0225] In some embodiments, the first subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 7-153 of SEQ ID NO: 6. In some embodiments, the first subunit includes G, S, or A in the residue corresponding to residue 19 of SEQ ID NO: 6. In some embodiments, the first subunit includes a residue corresponding to residue 19 of SEQ ID NO: 6. In some embodiments, the first subunit includes E, Q, or K in the residue corresponding to residue 80 of SEQ ID NO: 6. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 6 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0226] In some embodiments, the HVR2 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 6. In some embodiments, the HVR2 region includes one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 6. In some embodiments, the HVR2 region includes residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 6. In some embodiments, the HVR2 region includes Y, R, K, or D in the residue corresponding to residue 257 of SEQ ID NO: 6. In some embodiments, the HVR2 region includes the residue corresponding to residue 241 of SEQ ID NO: 6. In some embodiments, the HVR2 region includes the residue corresponding to residue 263 of SEQ ID NO: 6. In some embodiments, the HVR2 region includes the residue corresponding to residue 264 of SEQ ID NO: 6. In some embodiments, the HVR2 region includes the residue corresponding to residue 265 of SEQ ID NO: 6. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 6 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 6.
[0227] In some embodiments, the second subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 198-344 of SEQ ID NO: 6. In some embodiments, the second subunit includes G, S, or A in the residue corresponding to residue 210 of SEQ ID NO: 6. In some embodiments, the second subunit includes E, Q, or K in the residue corresponding to residue 271 of SEQ ID NO: 6. In some embodiments, the second subunit includes a residue corresponding to residue 330 of SEQ ID NO: 6. In some embodiments, the second subunit includes residues 198-344 of SEQ ID NO: 6 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0228] In some embodiments, the genetically engineered meganuclease is a single-stranded meganuclease containing a linker, the linker covalently bonding the first subunit to the second subunit. In some embodiments, the genetically engineered meganuclease contains an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to SEQ ID NO: 6. In some embodiments, the genetically engineered meganuclease contains the amino acid sequence of SEQ ID NO: 6. In some embodiments, the genetically engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the nucleic acid sequence shown in SEQ ID NO: 36. In some embodiments, the genetically engineered meganuclease is encoded by the nucleic acid sequence shown in SEQ ID NO: 36.
[0229] MIT 25-26x.37 (Sequence ID 7) In some embodiments, the HVR1 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 7. In some embodiments, the HVR1 region includes one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 7. In some embodiments, the HVR1 region includes residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 7. In some embodiments, the HVR1 region includes Y, R, K, or D in the residue corresponding to residue 66 of SEQ ID NO: 7. In some embodiments, the HVR1 region includes residues 24-79 of SEQ ID NO: 7, which have up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions.
[0230] In some embodiments, the first subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 7-153 of SEQ ID NO: 7. In some embodiments, the first subunit includes G, S, or A in the residue corresponding to residue 19 of SEQ ID NO: 7. In some embodiments, the first subunit includes a residue corresponding to residue 19 of SEQ ID NO: 7. In some embodiments, the first subunit includes E, Q, or K in the residue corresponding to residue 80 of SEQ ID NO: 7. In some embodiments, the first subunit includes a residue corresponding to residue 80 of SEQ ID NO: 7. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 7, which have up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0231] In some embodiments, the HVR2 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 7. In some embodiments, the HVR2 region includes one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 7. In some embodiments, the HVR2 region includes residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 7. In some embodiments, the HVR2 region includes Y, R, K, or D in the residue corresponding to residue 257 of SEQ ID NO: 7. In some embodiments, the HVR2 region includes the residue corresponding to residue 241 of SEQ ID NO: 7. In some embodiments, the HVR2 region includes the residue corresponding to residue 263 of SEQ ID NO: 7. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 7 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 7.
[0232] In some embodiments, the second subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 198-344 of SEQ ID NO: 7. In some embodiments, the second subunit includes G, S, or A in the residue corresponding to residue 210 of SEQ ID NO: 7. In some embodiments, the second subunit includes E, Q, or K in the residue corresponding to residue 271 of SEQ ID NO: 7. In some embodiments, the second subunit includes a residue corresponding to residue 330 of SEQ ID NO: 7. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 7, having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0233] In some embodiments, the genetically engineered meganuclease is a single-stranded meganuclease containing a linker, the linker covalently bonding the first subunit to the second subunit. In some embodiments, the genetically engineered meganuclease contains an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to SEQ ID NO: 7. In some embodiments, the genetically engineered meganuclease contains the amino acid sequence of SEQ ID NO: 7. In some embodiments, the genetically engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to the nucleic acid sequence shown in SEQ ID NO: 37. In some embodiments, the genetically engineered meganuclease is encoded by the nucleic acid sequence shown in SEQ ID NO: 37.
[0234] MIT 25-26L.35 (Sequence ID 8) In some embodiments, the HVR1 region comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 8. In some embodiments, the HVR1 region comprises one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75 and 77 of SEQ ID NO: 8. In some embodiments, the HVR1 region comprises residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 8. In some embodiments, the HVR1 region comprises Y, R, K or D in the residue corresponding to residue 66 of SEQ ID NO: 8. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 8 having a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR1 region comprises residues 24-79 of SEQ ID NO: 8.
[0235] In some embodiments, the first subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the amino acid sequence corresponding to residues 7-153 of SEQ ID NO: 8. In some embodiments, the first subunit comprises G, S or A in the residue corresponding to residue 19 of SEQ ID NO: 8. In some embodiments, the first subunit comprises the residue corresponding to residue 19 of SEQ ID NO: 8. In some embodiments, the first subunit comprises E, Q or K in the residue corresponding to residue 80 of SEQ ID NO: 8. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 8 having a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 8.
[0236] In some embodiments, the HVR2 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 8. In some embodiments, the HVR2 region includes one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 8. In some embodiments, the HVR2 region includes residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 8. In some embodiments, the HVR2 region includes Y, R, K, or D in the residue corresponding to residue 257 of SEQ ID NO: 8. In some embodiments, the HVR2 region includes the residue corresponding to residue 241 of SEQ ID NO: 8. In some embodiments, the HVR2 region includes the residue corresponding to residue 263 of SEQ ID NO: 8. In some embodiments, the HVR2 region includes the residue corresponding to residue 264 of SEQ ID NO: 8. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 8 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 8.
[0237] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198-344 of SEQ ID NO: 8. In some embodiments, the second subunit comprises G, S or A at the residue corresponding to residue 210 of SEQ ID NO: 8. In some embodiments, the second subunit comprises E, Q or K at the residue corresponding to residue 271 of SEQ ID NO: 8. In some embodiments, the second subunit comprises the residue corresponding to residue 330 of SEQ ID NO: 8. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 8 having a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 8.
[0238] In some embodiments, the engineered meganuclease is a single-stranded meganuclease comprising a linker that covalently links the first subunit and the second subunit. In some embodiments, the engineered meganuclease comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 8. In some embodiments, the engineered meganuclease comprises the amino acid sequence of SEQ ID NO: 8. In some embodiments, the engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the nucleic acid sequence shown in SEQ ID NO: 38. In some embodiments, the engineered meganuclease is encoded by the nucleic acid sequence shown in SEQ ID NO: 38.
[0239] MIT 25-26x.91 259H>Q (SEQ ID NO: 9) In some embodiments, the HVR1 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 9. In some embodiments, the HVR1 region includes one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 9. In some embodiments, the HVR1 region includes residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 9. In some embodiments, the HVR1 region includes Y, R, K, or D in the residue corresponding to residue 66 of SEQ ID NO: 9. In some embodiments, the HVR1 region includes residues 24-79 of SEQ ID NO: 9, which have up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions.
[0240] In some embodiments, the first subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 7-153 of SEQ ID NO: 9. In some embodiments, the first subunit includes G, S, or A in the residue corresponding to residue 19 of SEQ ID NO: 9. In some embodiments, the first subunit includes a residue corresponding to residue 19 of SEQ ID NO: 9. In some embodiments, the first subunit includes E, Q, or K in the residue corresponding to residue 80 of SEQ ID NO: 9. In some embodiments, the first subunit includes a residue corresponding to residue 80 of SEQ ID NO: 9. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 9 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0241] In some embodiments, the HVR2 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 9. In some embodiments, the HVR2 region includes one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 9. In some embodiments, the HVR2 region includes residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 9. In some embodiments, the HVR2 region includes Y, R, K, or D in the residue corresponding to residue 257 of SEQ ID NO: 9. In some embodiments, the HVR2 region includes the residue corresponding to residue 241 of SEQ ID NO: 9. In some embodiments, the HVR2 region includes the residue corresponding to residue 263 of SEQ ID NO: 9. In some embodiments, the HVR2 region includes the residue corresponding to residue 264 of SEQ ID NO: 9. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 9 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 9.
[0242] In some embodiments, the second subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 198-344 of SEQ ID NO: 9. In some embodiments, the second subunit includes G, S, or A in the residue corresponding to residue 210 of SEQ ID NO: 9. In some embodiments, the second subunit includes E, Q, or K in the residue corresponding to residue 271 of SEQ ID NO: 9. In some embodiments, the second subunit includes a residue corresponding to residue 330 of SEQ ID NO: 9. In some embodiments, the second subunit includes residues 198-344 of SEQ ID NO: 9, having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0243] In some embodiments, the genetically engineered meganuclease is a single-stranded meganuclease containing a linker, the linker covalently bonding the first subunit to the second subunit. In some embodiments, the genetically engineered meganuclease contains an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to SEQ ID NO: 9. In some embodiments, the genetically engineered meganuclease contains the amino acid sequence of SEQ ID NO: 9. In some embodiments, the genetically engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the nucleic acid sequence shown in SEQ ID NO: 39. In some embodiments, the genetically engineered meganuclease is encoded by the nucleic acid sequence shown in SEQ ID NO: 39.
[0244] MIT 25-26L.35 19A>S (Sequence ID 10) In some embodiments, the HVR1 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 10. In some embodiments, the HVR1 region includes one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 10. In some embodiments, the HVR1 region includes residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 10. In some embodiments, the HVR1 region includes Y, R, K, or D in the residue corresponding to residue 66 of SEQ ID NO: 10. In some embodiments, the HVR1 region includes residues 24-79 of SEQ ID NO: 10 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions.
[0245] In some embodiments, the first subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 7-153 of SEQ ID NO: 10. In some embodiments, the first subunit includes G, S, or A in the residue corresponding to residue 19 of SEQ ID NO: 10. In some embodiments, the first subunit includes a residue corresponding to residue 19 of SEQ ID NO: 10. In some embodiments, the first subunit includes E, Q, or K in the residue corresponding to residue 80 of SEQ ID NO: 10. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 10 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0246] In some embodiments, the HVR2 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 10. In some embodiments, the HVR2 region includes one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 10. In some embodiments, the HVR2 region includes residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 10. In some embodiments, the HVR2 region includes Y, R, K, or D in the residue corresponding to residue 257 of SEQ ID NO: 10. In some embodiments, the HVR2 region includes the residue corresponding to residue 241 of SEQ ID NO: 10. In some embodiments, the HVR2 region includes the residue corresponding to residue 263 of SEQ ID NO: 10. In some embodiments, the HVR2 region includes the residue corresponding to residue 264 of SEQ ID NO: 10. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 10 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 10.
[0247] In some embodiments, the second subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 198-344 of SEQ ID NO: 10. In some embodiments, the second subunit includes G, S, or A in the residue corresponding to residue 210 of SEQ ID NO: 10. In some embodiments, the second subunit includes E, Q, or K in the residue corresponding to residue 271 of SEQ ID NO: 10. In some embodiments, the second subunit includes a residue corresponding to residue 330 of SEQ ID NO: 10. In some embodiments, the second subunit includes residues 198-344 of SEQ ID NO: 10 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0248] In some embodiments, the genetically engineered meganuclease is a single-stranded meganuclease containing a linker, the linker covalently bonding the first subunit to the second subunit. In some embodiments, the genetically engineered meganuclease contains an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to SEQ ID NO: 10. In some embodiments, the genetically engineered meganuclease contains the amino acid sequence of SEQ ID NO: 10. In some embodiments, the genetically engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the nucleic acid sequence shown in SEQ ID NO: 40. In some embodiments, the genetically engineered meganuclease is encoded by the nucleic acid sequence shown in SEQ ID NO: 40.
[0249] MIT 25-26x.91 263T>R(Sequence ID 11) In some embodiments, the HVR1 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 11. In some embodiments, the HVR1 region includes one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 11. In some embodiments, the HVR1 region includes residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 11. In some embodiments, the HVR1 region includes Y, R, K, or D in the residue corresponding to residue 66 of SEQ ID NO: 11. In some embodiments, the HVR1 region includes residues 24-79 of SEQ ID NO: 11, having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions.
[0250] In some embodiments, the first subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 7-153 of SEQ ID NO: 11. In some embodiments, the first subunit includes G, S, or A in the residue corresponding to residue 19 of SEQ ID NO: 11. In some embodiments, the first subunit includes a residue corresponding to residue 19 of SEQ ID NO: 11. In some embodiments, the first subunit includes E, Q, or K in the residue corresponding to residue 80 of SEQ ID NO: 11. In some embodiments, the first subunit includes a residue corresponding to residue 80 of SEQ ID NO: 11. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 11 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0251] In some embodiments, the HVR2 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 11. In some embodiments, the HVR2 region includes one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 11. In some embodiments, the HVR2 region includes residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 11. In some embodiments, the HVR2 region includes Y, R, K, or D in the residue corresponding to residue 257 of SEQ ID NO: 11. In some embodiments, the HVR2 region includes the residue corresponding to residue 241 of SEQ ID NO: 11. In some embodiments, the HVR2 region includes the residue corresponding to residue 263 of SEQ ID NO: 11. In some embodiments, the HVR2 region includes the residue corresponding to residue 264 of SEQ ID NO: 11. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 11 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 11.
[0252] In some embodiments, the second subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 198-344 of SEQ ID NO: 11. In some embodiments, the second subunit includes G, S, or A in the residue corresponding to residue 210 of SEQ ID NO: 11. In some embodiments, the second subunit includes E, Q, or K in the residue corresponding to residue 271 of SEQ ID NO: 11. In some embodiments, the second subunit includes a residue corresponding to residue 330 of SEQ ID NO: 11. In some embodiments, the second subunit comprises residues 198-344 of SEQ ID NO: 11 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0253] In some embodiments, the genetically engineered meganuclease is a single-stranded meganuclease containing a linker, the linker covalently bonding the first subunit to the second subunit. In some embodiments, the genetically engineered meganuclease contains an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to SEQ ID NO: 11. In some embodiments, the genetically engineered meganuclease contains the amino acid sequence of SEQ ID NO: 11. In some embodiments, the genetically engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity to the nucleic acid sequence shown in SEQ ID NO: 41. In some embodiments, the genetically engineered meganuclease is encoded by the nucleic acid sequence shown in SEQ ID NO: 41.
[0254] MIT 25-26x.91 46H>W (Sequence ID 12) In some embodiments, the HVR1 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the amino acid sequence corresponding to residues 24-79 of SEQ ID NO: 12. In some embodiments, the HVR1 region includes one or more residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 12. In some embodiments, the HVR1 region includes residues corresponding to residues 24, 26, 28, 30, 32, 33, 38, 40, 42, 44, 46, 68, 70, 75, and 77 of SEQ ID NO: 12. In some embodiments, the HVR1 region includes Y, R, K, or D in the residue corresponding to residue 66 of SEQ ID NO: 12. In some embodiments, the HVR1 region includes residues 24-79 of SEQ ID NO: 12 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions.
[0255] In some embodiments, the first subunit includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with residues 7-153 of SEQ ID NO: 12. In some embodiments, the first subunit includes G, S, or A in the residue corresponding to residue 19 of SEQ ID NO: 12. In some embodiments, the first subunit includes a residue corresponding to residue 19 of SEQ ID NO: 12. In some embodiments, the first subunit includes E, Q, or K in the residue corresponding to residue 80 of SEQ ID NO: 12. In some embodiments, the first subunit includes a residue corresponding to residue 80 of SEQ ID NO: 12. In some embodiments, the first subunit comprises residues 7-153 of SEQ ID NO: 12 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions.
[0256] In some embodiments, the HVR2 region includes an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the amino acid sequence corresponding to residues 215-270 of SEQ ID NO: 12. In some embodiments, the HVR2 region includes one or more residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 12. In some embodiments, the HVR2 region includes residues corresponding to residues 215, 217, 219, 221, 223, 224, 229, 231, 233, 235, 237, 259, 261, 266, and 268 of SEQ ID NO: 12. In some embodiments, the HVR2 region includes Y, R, K, or D in the residue corresponding to residue 257 of SEQ ID NO: 12. In some embodiments, the HVR2 region includes the residue corresponding to residue 241 of SEQ ID NO: 12. In some embodiments, the HVR2 region includes the residue corresponding to residue 263 of SEQ ID NO: 12. In some embodiments, the HVR2 region includes the residue corresponding to residue 264 of SEQ ID NO: 12. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 12 having up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino acid substitutions. In some embodiments, the HVR2 region includes residues 215-270 of SEQ ID NO: 12.
[0257] In some embodiments, the second subunit comprises an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to residues 198 - 344 of SEQ ID NO: 12. In some embodiments, the second subunit comprises G, S or A at a residue corresponding to residue 210 of SEQ ID NO: 12. In some embodiments, the second subunit comprises E, Q or K at a residue corresponding to residue 271 of SEQ ID NO: 12. In some embodiments, the second subunit comprises a residue corresponding to residue 330 of SEQ ID NO: 12. In some embodiments, the second subunit comprises residues 198 - 344 of SEQ ID NO: 12 having a maximum of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acid substitutions. In some embodiments, the second subunit comprises residues 198 - 344 of SEQ ID NO: 12.
[0258] In some embodiments, the genetically engineered meganuclease is a single-stranded meganuclease containing a linker, the linker covalently bonding the first subunit to the second subunit. In some embodiments, the genetically engineered meganuclease contains an amino acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to SEQ ID NO: 12. In some embodiments, the genetically engineered meganuclease contains the amino acid sequence of SEQ ID NO: 12. In some embodiments, the genetically engineered meganuclease is encoded by a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with respect to the nucleic acid sequence shown in SEQ ID NO: 42. In some embodiments, the genetically engineered meganuclease is encoded by the nucleic acid sequence shown in SEQ ID NO: 42. The MTP for directing a genetically engineered meganuclease to mitochondria may be 10 to 100 amino acid lengths. In certain embodiments, the MTP is approximately 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or longer. The MTP may then contain additional signals that target the protein to different regions of mitochondria, such as the mitochondrial matrix.Non-limiting examples of MTPs for use in the compositions and methods disclosed herein include: rhesus monkey F0 ATPase subunit 9 (SU9) MTP, human cytochrome c oxidase subunit VIII (CoxVIII or Cox8) MTP, P1 isoform of subunit c of human ATP synthase MTP, aldehyde dehydrogenase targeted sequence MTP, glutaredoxin 5 MTP, pyruvate dehydrogenase MTP, peptidyl-prolyl isomerase MTP, acetyltransferase MTP, isocitrate dehydrogenase MTP, cytochrome oxidase MTP, and subunit of the FA portion of ATP synthase MTP, CPN60 / No GG linker MTP, superoxide dismutase (SOD) MTP, superoxide dismutase dual (2 SOD) MTP, superoxide dismutase modified (SODmod) MTP, superoxide dismutase modified (2 Examples include SODmod (SODmod) dual MTP, L29 MTP, gATPase-gamma subunit (FAγ51) MTP, CoxIV twin strep (ABM97483) MTP, and CoxIV 10xHis MTP.
[0259] In certain embodiments, the MTP includes a combination of at least two MTPs. The MTP combination may be a combination of identical MTPs or a combination of different MTPs. In certain embodiments, the MTP includes the Cox VIII MTP (SEQ ID NO: 43) and the SU9 MTP (SEQ ID NO: 44) in a single MTP represented by SEQ ID NO: 45.
[0260] To form an MTEM, MTPs can be bound to the genetically engineered meganuclease described herein by any suitable means. In certain embodiments, MTPs can be bound to the N-terminus of the genetically engineered meganuclease. In other embodiments, MTPs can be bound to the C-terminus of the genetically engineered meganuclease. In some embodiments, multiple MTPs can be bound to a single genetically engineered meganuclease to form an MTEM. For example, a first MTP can be bound to the N-terminus of the genetically engineered meganuclease, and a second MTP can be bound to the C-terminus of the genetically engineered meganuclease. In some embodiments, the first and second MTPs are identical, and in other embodiments, the first and second MTPs are not identical. MTPs can be bound by any means that enables the transport of the genetically engineered meganuclease into the mitochondria of a cell. In certain embodiments, MTPs are bound by fusing the MTP to the N-terminus or C-terminus of the genetically engineered meganuclease. MTPs can also be bound to the genetically engineered meganuclease by a peptide linker. The linker may consist of, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 15, or 20 amino acids. In certain embodiments, the MTP is bound to the peptide linker at the N-terminus or C-terminus of the genetically engineered meganuclease.
[0261] In some embodiments, the MTEM or genetically engineered meganuclease described herein for use in the compositions and methods of this disclosure is bound to an export sequence (NES) to help prevent the genetically engineered meganuclease from cleaving the nuclear genome. In some such embodiments, the NES comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 46 or 47. For example, the NES may comprise the amino acid sequence of SEQ ID NO: 46 or 47. In certain embodiments, the NES is bound to the N-terminus of the genetically engineered meganuclease. In other embodiments, the NES is bound to the C-terminus of the genetically engineered meganuclease. In certain embodiments, the NES is fused to the genetically engineered meganuclease. In certain embodiments, the NES is bound to the genetically engineered meganuclease by a polypeptide linker.
[0262] In certain embodiments, the MTEM or genetically modified meganuclease described herein is conjugated to a plurality of NESs. For example, the genetically modified meganuclease described herein may include a first NES and a second NES. In some such embodiments, the first NES is conjugated to the N-terminus of the MTEM or genetically modified meganuclease described herein, and the second NES is conjugated to the C-terminus of the MTEM or genetically modified meganuclease described herein. In some such embodiments, the first NES and / or the second NES contain an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with respect to the amino acid sequence shown in SEQ ID NO: 46 or 47. For example, the first NES and / or the second NES may contain the amino acid sequence shown in SEQ ID NO: 46 or 47. In some embodiments, the first NES and the second NES are identical. In other embodiments, the first NES and the second NES are not identical. The NES can be conjugated to the MTEM or genetically modified meganuclease described herein by any suitable means known in the art. For example, the first NES and / or the second NES can be fused to the MTEM or genetically modified meganuclease described herein. In some embodiments, the first NES and / or the second NES are conjugated to the MTEM or genetically modified meganuclease described herein by a polypeptide linker.
[0263] MTEMs or genetically modified meganucleases described herein, including NES, may reduce or decrease the transport of target cells or target cell populations (e.g., eukaryotic cells or eukaryotic cell populations) to the nucleus compared to genetically modified meganucleases that do not contain NES. For example, the nuclear transport of an MTEM or genetically modified meganuclease described herein, including NES, may be about 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, 90-100%, or more (for example, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100%, or more) less than the nuclear transport of an MTEM or genetically modified meganuclease described herein, including NES. In some embodiments, genetically engineered meganucleases containing NES may induce fewer nuclear indels (i.e., fewer breaks and resulting deletions in the nuclear genome of target cells or target cell populations) compared with MTEMs or genetically engineered meganucleases described herein that do not contain NES. For example, nuclear indels induced by MTEMs or genetically engineered meganucleases described herein that contain NES may be about 5–10%, 10–20%, 20–30%, 30–40%, 40–50%, 50–60%, 60–70%, 70–80%, 80–90%, 90–100%, or more less than nuclear indels induced by MTEMs or genetically engineered meganucleases described herein that do not contain NES.
[0264] 2.3 Pharmaceutical Compositions In some embodiments, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and an isolated polynucleotide comprising a nucleic acid sequence encoding a pharmaceutically acceptable carrier and an MTEM or genetically modified meganuclease as described herein, or a pharmaceutically acceptable carrier and an MTEM or genetically modified meganuclease as described herein. In particular, a pharmaceutical composition is provided comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of a nucleic acid encoding an MTEM or genetically modified meganuclease as described herein, or an MTEM or genetically modified meganuclease as described herein, wherein the genetically modified meganuclease of MTEM or genetically modified meganuclease as described herein has specificity for recognition sequences in mtDNA such as human mtDNA (e.g., the MIT 25-26 recognition sequence of SEQ ID NO: 1).
[0265] In other embodiments, the present invention provides a pharmaceutical composition comprising a pharmaceutically acceptable carrier and gene-modified cells as described herein.
[0266] Such pharmaceutical compositions can be prepared according to known techniques. See, for example, Remington, The Science and Practice of Pharmacy (21st ed., Philadelphia, Lippincott, Williams & Wilkins, 2005). In the preparation of the pharmaceutical formulation according to the present invention, a nuclease polypeptide (or the DNA / RNA encoding it or a cell expressing it) is mixed with a typically pharmaceutically acceptable carrier, and the resulting composition is administered to the subject. The carrier must be acceptable in the sense that it is compatible with any other components in the formulation and must not be harmful to the subject. In some embodiments, the pharmaceutical compositions described herein may further contain one or more additional agents or biological molecules useful for treating the disease of interest. Similarly, additional agents and / or biological molecules may be administered simultaneously as separate compositions.
[0267] In certain embodiments described herein, the pharmaceutical composition comprises a recombinant virus (i.e., a viral vector) comprising a polynucleotide (e.g., a viral genome) containing a nucleic acid sequence encoding the MTEM or genetically modified meganuclease described herein. Such recombinant viruses are known in the art and include recombinant retroviruses, recombinant lentiviruses, recombinant adenoviruses, and recombinant adeno-associated viruses (AAVs) (2013 New Microbiol. 36:1-22). Recombinant AAVs useful in the present invention may have any capsid or serotype that enables transduction of the virus into a target cell type and expression of the MTEM or genetically modified meganuclease described herein by the target cells. For example, in some embodiments, the recombinant AAV may have the serotypes AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAVHSC. In some embodiments, the recombinant virus is injected directly into the target tissue. In alternative embodiments, recombinant viruses are delivered systemically via the circulatory system. It is known in the art that different AAVs tend to localize to different tissues, and that appropriate AAV capsid / serotypes can be selected for preferential delivery to specific tissues. Thus, in some embodiments, the AAV serotype is AAV9. AAVs can also be self-complementary so as not to require second-strand DNA synthesis in host cells (McCarty et al. (2001) Gene Ther. 8:1248-54). Nucleic acids delivered by recombinant AAVs may contain left (5') and right (3') reverse-ended repeats.
[0268] In certain embodiments described herein, the pharmaceutical composition comprises one or more mRNAs described herein (e.g., mRNA encoding an MTEM or genetically modified meganuclease as described herein) formulated within lipid nanoparticles.
[0269] The selection of cationic lipids, non-cationic lipids, and / or lipid conjugates containing lipid nanoparticles, as well as the relative molar ratios of such lipids to each other, is based on the characteristics of the selected lipids, the properties of the intended target cells, and the characteristics of the mRNA to be delivered. Further considerations include, for example, alkyl chain saturation, as well as the size, charge, pH, pKa, fusionability, and toxicity of the selected lipids. Therefore, the molar ratios of the individual components can be adjusted accordingly.
[0270] Lipid nanoparticles for use in the methods described herein can be prepared by various techniques currently known in the art. Nucleic acid-lipid particles and methods for preparing them are disclosed, for example, in U.S. Patent Publications 20040142025 and 20070042031, which are incorporated herein by reference in their entirety for all purposes.
[0271] The selection of an appropriate size for lipid nanoparticles must take into account the site of the target cell and the intended use for which the lipid nanoparticles are produced. Generally, lipid nanoparticles have a size in the range of about 25 to about 500 nm. In some embodiments, lipid nanoparticles have a size in the range of about 50 nm to about 300 nm or about 60 nm to about 120 nm. The size of lipid nanoparticles can be determined by quasi-electric light scattering (QELS), as described in Bloomfield, Ann. Rev. Biophys. Bioeng., 10:421^150 (1981), incorporated herein by reference. Various methods for producing populations of lipid nanoparticles within a specific size range, such as sonication or homogenization, are known in the art. One such method is described in U.S. Patent No. 4,737,323, incorporated herein by reference.
[0272] Some lipid nanoparticles intended for use in the present invention comprise at least one cationic lipid, at least one non-cationic lipid, and at least one conjugate lipid. In more specific examples, the lipid nanoparticles may comprise about 50 mol% to about 85 mol% of cationic lipids, about 13 mol% to about 49.5 mol% of non-cationic lipids, and about 0.5 mol% to about 10 mol% of lipid conjugates, and are produced in a manner that results in a non-lamellar (i.e., non-bilayer) morphology. In other specific examples, the lipid nanoparticles may comprise about 40 mol% to about 85 mol% of cationic lipids, about 13 mol% to about 49.5 mol% of non-cationic lipids, and about 0.5 mol% to about 10 mol% of lipid conjugates, and are produced in a manner that results in a non-lamellar (i.e., non-bilayer) morphology.
[0273] Cationic lipids may include, for example, one or more of the following: palmitoyl oleoyl-nor-arginine (PONA), MPDACA, GUADACA, ((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate) (MC3), LenMC3, CP-LenMC3, γ-LenMC3, CP-γ-LenMC3, MC3MC, MC2MC, MC3 ether, MC4 ether, MC3 amide, Pan-MC3, Pan-MC4 and Pan MC5, 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenDMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-K-C2-DMA; "XTC2"), 2,2-dilinoleyl-4-(3-dimethylaminopropyl)-[1,3]-dioxolane (DLin-K-C3-DMA), 2,2-dilinoleyl-4-(4-dimethylaminobutyl)-[1,3]-dioxolane (DLin-K-C4-DMA), 2,2-dilinoleyl-5-dimethylaminomethyl-[1,3]-dioxane (DLin-K6-DMA), 2,2-dilinoleyl-4-N-methylpepiazino-[1,3]-dioxolane (DLin-K-MPZ), 2,2-dilinoleyl-4-dimeth L-aminomethyl-[1,3]-dioxolane (DLin-K-DMA), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-dilinoleyl-3-dimethylaminopropane (DLi nDAP), 1,2-dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1-linoleyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-dilinoleyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-Dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), 3-(N,N-dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-dioleylamino)-1,2-propanediol (DOAP), 1,2-dilinoleylxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), 1,2-dioleyloxy-N,N-dimethyl Aminopropane (DODMA), 1,2-distearyloxy-N,N-dimethylaminopropane (DSDMA), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), 3-(N-(N',N'-dimethylaminoethane)-cal Bamoyl cholesterol (DC-Chol), N-(1,2-dimyristyloxypropane-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE), 2,3-dioleyloxy-N-[2(spermine-carboxamide)ethyl]-N,N-dimethyl-1-propaneaminium trifluoroacetate (DOSPA), dioctadecylamideglycylspermine (DOGS), 3-dimethylamino-2-(cholesta-5-ene-3-beta-oxybutane- 4-Oxy)-1-(cis,cis-9,12-octadecadienoxy)propane (CLinDMA), 2-[5'-(cholesta-5-ene-3-beta-oxy)-3'-oxapentoxy)-3-dimethyl-1-(cis,cis-9',1-2'-octadecadienoxy)propane (CpLinDMA), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP), 1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP), or mixtures thereof. Cationic lipids may also be DLinDMA, DLin-K-C2-DMA ("XTC2"), MC3, LenMC3, CP-LenMC3, γ-LenMC3, CP-γ-LenMC3, MC3MC, MC2MC, MC3 ether, MC4 ether, MC3 amide, Pan-MC3, Pan-MC4, Pan MC5, or mixtures thereof.
[0274] In various embodiments, cationic lipids constitute approximately 50 mol% to 90 mol%, 50 mol% to 85 mol%, 50 mol% to 80 mol%, 50 mol% to 75 mol%, 50 mol% to 70 mol%, 50 mol% to 65 mol%, or 50 mol% to 60 mol% of the total lipids present in the particles.
[0275] In other embodiments, cationic lipids constitute approximately 40 mol% to 90 mol%, 40 mol% to 85 mol%, 40 mol% to 80 mol%, 40 mol% to 75 mol%, 40 mol% to 70 mol%, 40 mol% to 65 mol%, or 40 mol% to 60 mol% of the total lipids present in the particles.
[0276] Noncationic lipids may, for example, include one or more anionic lipids and / or neutral lipids. In certain embodiments, the noncationic lipids include one of the following neutral lipid components: (1) cholesterol or a derivative thereof; (2) phospholipids; or (3) mixtures of phospholipids and cholesterol or a derivative thereof. Examples of cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'-hydroxybutyl ether, and mixtures thereof. Phospholipids may include, but are not limited to, neutral lipids such as dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), palmitoyloleylphosphatidylglycerol (POPG), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidylethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), monomethylphosphatidylethanolamine, dimethylphosphatidylethanolamine, dierydoylphosphatidylethanolamine (DEPE), stearoyloleoylphosphatidylethanolamine (SOPE), egg phosphatidylcholine (EPC), and mixtures thereof. In certain specific embodiments, the phospholipid is DPPC, DSPC, or a mixture thereof.
[0277] In some embodiments, noncationic lipids (e.g., one or more phospholipids and / or cholesterol) constitute about 10 mol% to about 60 mol%, about 15 mol% to about 60 mol%, about 20 mol% to about 60 mol%, about 25 mol% to about 60 mol%, about 30 mol% to about 60 mol%, about 10 mol% to about 55 mol%, about 15 mol% to about 55 mol%, about 20 mol% to about 55 mol%, about 25 mol% to about 55 mol%, about 30 mol% to about 55 mol%, about 13 mol% to about 50 mol%, about 15 mol% to about 50 mol%, or about 20 mol% to about 50 mol% of the total lipids present in the particles. If the noncationic lipids are a mixture of phospholipids and cholesterol or cholesterol derivatives, the mixture may constitute up to about 40, 50, or 60 mol% of the total lipids present in the particles.
[0278] Conjugate lipids that inhibit particle aggregation may include, for example, one or more of the following: polyethylene glycol (PEG)-lipid conjugates, polyamide (ATTA)-lipid conjugates, cationic polymer-lipid conjugates (CPLs), or mixtures thereof. In one particular embodiment, nucleic acid-lipid particles include either PEG-lipid conjugates or ATTA-lipid conjugates. In a particular embodiment, PEG-lipid conjugates or ATTA-lipid conjugates are used together with CPLs. Conjugate lipids that inhibit particle aggregation may include, for example, PEG-lipids containing PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), or mixtures thereof. PEG-DAA conjugates may be PEG-dilauryloxypropyl (C12), PEG-dimyristyloxypropyl (C14), PEG-dipalmityloxypropyl (C16), PEG-distearyloxypropyl (C18), or mixtures thereof.
[0279] Further PEG-lipid conjugates suitable for use in the present invention include, but are not limited to, mPEG2000-1,2-di-O-alkyl-sn3-carbomoylglyceride (PEG-C-DOMG). The synthesis of PEG-C-DOMG is described in PCT application PCT / US08 / 88676. Further PEG-lipid conjugates suitable for use in the present invention include, but are not limited to, 1-[8'-(1,2-dimiristoyl-3-propanoxy)-carboxamide-3',6'-dioxaoctanyl]carbamoyl-ω-methyl-poly(ethylene glycol) (2KPEG-DMG). The synthesis of 2KPEG-DMG is described in U.S. Patent No. 7,404,969.
[0280] In some cases, the conjugate lipids that inhibit particle aggregation (e.g., PEG-lipid conjugates) may constitute about 0.1 mol% to about 2 mol%, about 0.5 mol% to about 2 mol%, about 1 mol% to about 2 mol%, about 0.6 mol% to about 1.9 mol%, about 0.7 mol% to about 1.8 mol%, about 0.8 mol% to about 1.7 mol%, about 1 mol% to about 1.8 mol%, about 1.2 mol% to about 1.8 mol%, about 1.2 mol% to about 1.7 mol%, about 1.3 mol% to about 1.6 mol%, about 1.4 mol% to about 1.5 mol%, or about 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2 mol% (or any fraction or range thereof) of the total lipids present in the particles. Typically, in such cases, the PEG portion has an average molecular weight of about 2,000 daltons. In other cases, the conjugate lipids that inhibit particle aggregation (e.g., PEG-lipid conjugates) may constitute about 5.0 mol% to about 10 mol%, about 5 mol% to about 9 mol%, about 5 mol% to about 8 mol%, about 6 mol% to about 9 mol%, about 6 mol% to about 8 mol%, or about 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, or 10 mol% (or any fraction or range thereof) of the total lipids present in the particles. Typically, in such cases, the PEG portion has an average molecular weight of about 750 daltons.
[0281] In other embodiments, the composition comprises amphoteric liposomes containing at least one positively charged carrier and at least one negatively charged carrier distinct from the positively charged carrier, with the isoelectric point of the liposomes being 4 to 8. This objective is achieved by the fact that the liposomes are prepared using pH-dependently changing charges.
[0282] Liposome structures with desired properties are formed, for example, when the amount of membrane-forming or membrane-based cationic charge carriers exceeds the amount of anionic charge carriers at low pH, and the ratio reverses at higher pH. This is always true when the ionizable components have pKa values of 4-9. As the pH of the medium decreases, all cationic charge carriers become more charged, and all anionic charge carriers lose their charge.
[0283] Cationic compounds useful for amphoteric liposomes include those previously described above in this specification. Strong cationic compounds, however, may include, for example: DC-Chol 3-β-[N-(N',N'-dimethylmethane)carbamoyl]cholesterol, TC-Chol 3-β-[N-(N',N',N'-trimethylaminoethane)carbamoylcholesterol, BGSC bisguanidinium-spermidine-cholesterol, BGTC bis-guanidium-threne-cholesterol, DOTAP(1,2-dioleoyloxypropyl)-N,N,N-trimethylammonium chloride, DOSPER(1,3-dioleoyloxy-2-(6-carboxy-spermyl)-propylalnide, DOTMA(1,2-dioleoyloxypropyl)-N,N,N-trimethylammonium chloride) (LIPOFECTIN®), DORIE 1,2-Dioleoyloxypropyl)-3-dimethylhydroxyethylammonium bromide, DOSC (1,2-Dioleoyl-3-succinyl-sn-glycerylcholine ester), DOGSDSO (1,2-Dioleoyl-sn-glycero-3-succinyl-2-hydroxyethyl disulfide omitin), DDAB dimethyldioctadecylammonium bromide, DOGS ((C18)2GlySper3+)N,N-dioctadecylamide-glycol-spermine (TRANSFECTAM®) (C18)2Gly+N,N-dioctadecylamide-glycine, CTAB cetyltrimethylammonium bromide, CpyC cetylpyridinium chloride, DOEPC 1,2-Dioleoyl-sn-glycero-3-ethylphosphocholine or other O-alkyl-phosphatidylcholine or amides from ethanolamine, lysine, arginine or ornithine, and phosphatidylethanolamine.
[0284] Examples of weakly cationic compounds include, but are not limited to, His-Chol (histaminyl cholesterol hemisuccinate), Mo-Chol (morpholine-N-ethylamino-cholesterol hemisuccinate), or histidinyl-PE.
[0285] Examples of neutral compounds include, but are not limited to, cholesterol, ceramide, phosphatidylcholine, phosphatidylethanolamine, tetraether lipids, or diacylglycerol.
[0286] Anionic compounds useful for amphoteric liposomes include noncationic compounds previously described herein. Examples of weakly anionic compounds include, but are not limited to, CHEMS (cholesterol hemisuccinates), alkyl carboxylic acids having 8 to 25 carbon atoms, or diacylglycerol hemisuccinates. Further weakly anionic compounds may include amides of aspartic acid or glutamic acid, as well as PE and PS, as well as their amides with glycine, alanine, glutamine, asparagine, serine, cysteine, threonine, tyrosine, glutamic acid, aspartic acid, or other amino acids or aminodicarboxylic acids. By similar principle, esters of hydroxycarboxylic acids or hydroxydicarboxylic acids with PS are also weakly anionic compounds.
[0287] In some embodiments, the amphoteric liposomes contain conjugate lipids such as those described above herein. Specific examples of useful conjugate lipids include, but are not limited to, PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, and PEG-modified 1,2-diacyloxypropane-3-amines. Some specific examples are PEG-modified diacylglycerols and dialkylglycerols.
[0288] In some embodiments, neutral lipids constitute approximately 10 mol% to approximately 60 mol%, approximately 15 mol% to approximately 60 mol%, approximately 20 mol% to approximately 60 mol%, approximately 25 mol% to approximately 60 mol%, approximately 30 mol% to approximately 60 mol%, approximately 10 mol% to approximately 55 mol%, approximately 15 mol% to approximately 55 mol%, approximately 20 mol% to approximately 55 mol%, approximately 25 mol% to approximately 55 mol%, approximately 30 mol% to approximately 55 mol%, approximately 13 mol% to approximately 50 mol%, approximately 15 mol% to approximately 50 mol%, or approximately 20 mol% to approximately 50 mol% of the total lipids present in the particles.
[0289] In some cases, the conjugate lipids that inhibit particle aggregation (e.g., PEG-lipid conjugates) constitute about 0.1 mol% to 2 mol%, 0.5 mol% to 2 mol%, 1 mol% to 2 mol%, 0.6 mol% to 1.9 mol%, 0.7 mol% to 1.8 mol%, 0.8 mol% to 1.7 mol%, 1 mol% to 1.8 mol%, 1.2 mol% to 1.8 mol%, 1.2 mol% to 1.7 mol%, 1.3 mol% to 1.6 mol%, 1.4 mol% to 1.5 mol%, or about 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mol% (or any fraction or range thereof) of the total lipids present in the particles. Typically, in such cases, the PEG portion has an average molecular weight of about 2,000 daltons. In other cases, the conjugate lipids that inhibit particle aggregation (e.g., PEG-lipid conjugates) may constitute about 5.0 mol% to about 10 mol%, about 5 mol% to about 9 mol%, about 5 mol% to about 8 mol%, about 6 mol% to about 9 mol%, about 6 mol% to about 8 mol%, or about 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, or 10 mol% (or any fraction or range thereof) of the total lipids present in the particles. Typically, in such cases, the PEG portion has an average molecular weight of about 750 daltons.
[0290] Considering the total amount of neutral and conjugate lipids, the remainder of the amphoteric liposome can contain mixtures of cationic and anionic compounds formulated in various ratios. The ratio of cationic lipids to anionic lipids can be selected to achieve desired properties of nucleic acid encapsulation, zeta potential, pKa, or other physicochemical properties that depend at least partially on the presence of charged lipid components.
[0291] In some embodiments, the lipid nanoparticles have a composition that specifically enhances delivery and uptake in eukaryotic cells such as mammalian cells (e.g., human cells). In certain embodiments, the lipid nanoparticles have a composition that specifically enhances delivery and uptake in the liver or, in particular, in hepatocytes. In certain embodiments, the lipid nanoparticles have a composition that specifically enhances delivery and uptake in nerve cells.
[0292] 2.4 Method for producing recombinant viruses In some embodiments, the present invention provides recombinant viruses (e.g., recombinant AAV) for use in the methods described herein. Recombinant AAV is typically produced in mammalian cell lines such as HEK-293. The virus's cap and rep genes need to be provided to the transpackaging cell line, as these are removed from the vector to prevent their self-replication and make room for therapeutic genes (e.g., nuclease genes) that are delivered. Furthermore, it is necessary to provide “helper” (e.g., adenovirus) components necessary to support replication (Cots et al. (2013), Curr. Gene Ther. 13(5):370-81). Often, recombinant AAV is produced using triple transfection, in which the cell line is transfected with a first plasmid encoding “helper” components, a second plasmid containing the cap and rep genes, and a third plasmid containing a viral ITR containing an intervening DNA sequence that packages the virus. Next, viral particles containing the genome (the ITR and intervening gene of interest) enclosed in a capsid are isolated from cells by freeze-thaw cycles, sonication, surfactants, or other means known in the art. The particles are then purified using cesium chloride density gradient centrifugation or affinity chromatography and subsequently delivered to the gene of interest in organisms such as cells, tissues, or human patients.
[0293] Since recombinant AAV is typically produced (manufactured) intracellularly, care must be taken when carrying out the invention to ensure that the MTEM or genetically modified meganucleases described herein are not expressed in the packaging cells. Because the viral genomes described herein may contain nuclease recognition sequences, any nuclease expressed in the packaging cell line may be able to cleave the viral genome before it can be packaged into viral particles. This results in reduced packaging efficiency and / or packaging of fragmented genomes. Several approaches can be used to prevent nuclease expression in the packaging cells.
[0294] The MTEMs or genetically modified meganucleases described herein can be controlled by any promoter suitable for the expression of the MTEMs or genetically modified meganucleases described herein. In some embodiments, the promoter is a constitutive promoter, or the promoter is a tissue-specific promoter, such as a stem cell-specific promoter, a CD34+HSC-specific promoter, a muscle-specific promoter, a skeletal muscle-specific promoter, a myotube-specific promoter, a muscle satellite cell-specific promoter, a neuron-specific promoter, an astrocyte-specific promoter, a microglia-specific promoter, an ophthalmocellular-specific promoter, a retinal cell-specific promoter, a retinal ganglion cell-specific promoter, a retinal pigment epithelium-specific promoter, a pancreatic cell-specific promoter, a pancreatic beta cell-specific promoter, a renal cell-specific promoter, a myeloid cell-specific promoter, or an ear hair cell-specific promoter. In some embodiments, the ubiquitous promoter is a CMV promoter, a CAG promoter, an EF1 alpha promoter, or an UbC promoter.
[0295] In certain embodiments, the MTEMs or genetically modified meganucleases described herein can be placed under the control of tissue-specific promoters that are not active in the packaging cells. For example, when developing a viral vector for the delivery of a nuclease gene to muscle tissue, a muscle-specific promoter can be used. Examples of muscle-specific promoters include C5-12 (Liu et al. (2004) Hum Gene Ther. 15:783-92), muscle-specific creatine kinase (MCK) promoters (Yuasa et al. (2002) Gene Ther. 9:1576-88), or smooth muscle 22 (SM22) promoters (Haase et al. (2013) BMC Biotechnol. 13:49-54). Examples of CNS (neuron)-specific promoters include NSE, synapsin, and MeCP2 promoters (Lentz et al. (2012) Neurobiol Dis. 48:179-88). Examples of liver-specific promoters include albumin promoters (e.g., Palb), human α1-antitrypsin (e.g., Pa1AT), and hemopecin (e.g., Phpx) (Kramer et al., (2003) Mol. Therapy 7:375-85), hybrid liver-specific promoters (hepatic locus regulatory region derived from the ApoE gene (ApoE-HCR), and liver-specific alpha-1-antitrypsin promoter), human thyroxine-binding globulin (TBG) promoter, and apolipoprotein A-II promoter. Examples of eye-specific promoters include opsin and corneal epithelium-specific K12 promoter (Martin et al., (2002) Methods (28):267-75) (Tong et al., (2007) J Gene Med, 9:956-66). These promoters, or other tissue-specific promoters known in the art, are not highly active in HEK-293 cells and therefore are not expected to produce significant levels of nuclease gene expression in packaging cells when incorporated into the viral vector of the present invention. Similarly, the viral vector of the present invention is intended for use with other cell lines (i.e., well-known HeLa cell lines (human epithelial cells) and liver-specific hemopexin promoters) with the use of incompatible tissue-specific promoters.Other examples of tissue-specific promoters include synovial sarcoma PDZD4 (cerebellum), C6 (liver), ASB5 (muscle), PPP1R12B (heart), SLC5A12 (kidney), cholesterol regulation APOM (liver), ADPRHL1 (heart), and monogenic malformation syndrome TP73L (muscle). (Jacox et al. (2010), PLoS One v.5(8):e12274).
[0296] Alternatively, recombinant viruses can be packaged into cells of different species where the nuclease is less likely to be expressed. For example, viral particles can be produced in microbial, insect, or plant cells using mammalian promoters such as well-known cytomegaloviruses or SV40 virus initial promoters that are not active in non-mammalian packaging cells. In certain embodiments, viral particles are produced in insect cells using a baculovirus system described by Gao et al. (Gao et al. (2007), J. Biotechnol. 131(2):138-43). Nucleases under the control of mammalian promoters are less likely to be expressed in these cells (Airenne et al. (2013), Mol. Ther. 21(4):739-49). Furthermore, insect cells utilize different mRNA splicing motifs than mammalian cells. Therefore, it is possible to incorporate mammalian introns, such as human growth hormone (HGH) introns or SV40 large T antigen introns, into the coding sequence of the nuclease. Because these introns are not efficiently spliced from premRNA transcripts in insect cells, insect cells do not express functional nucleases and package the full genome. In contrast, mammalian cells to which the resulting recombinant AAV particles are delivered properly splice the premRNA and express functional nuclease proteins. Haifeng Chen has reported the use of HGH and SV40 large T antigen introns to attenuate the expression of the toxic protein barnase and diphtheria toxin fragment A in insect packaging cells, enabling the production of recombinant AAV vectors containing these toxin genes (Chen, H(2012)Mol Ther Nucleic Acids.1(11):e57).
[0297] The MTEM or genetically modified meganuclease genes described herein can be operably linked to an inducible promoter so that a small molecule inducer is required for nuclease expression. Examples of inducible promoters include the Tet-On system (Clontech; Chen et al. (2015), BMC Biotechnol. 15(1):4)) and the RheoSwitch system (Intrexon; Sowa et al. (2011), Spine, 36(10):E623-8). Both systems, as well as similar systems known in the art, rely on ligand-inducible transcription factors (variants of the Tet repressor and ecdysone receptor, respectively) that activate transcription in response to small molecule activators (doxycycline or ecdysone, respectively). Practicing the present invention using such ligand-inducible transcription activators involves: 1) placing a nuclease gene under the control of a promoter that responds to the corresponding transcription factor, such that the nuclease gene (a) has a binding site for the transcription factor; and 2) including the gene encoding the transcription factor in a packaged viral genome. The latter step is necessary because if the transcription activator is not also provided to the same cells, the nuclease will not be expressed in the target cells or tissues after recombinant AAV delivery. The transcription activator then induces nuclease gene expression only in cells or tissues treated with the homologous small molecule activator. This approach is advantageous because it allows for spatial and temporal regulation of nuclease gene expression by selecting when and to which tissue the small molecule inducer is delivered. However, the need to include the inducer in a viral genome, which has significantly limited transport capacity, presents a drawback to this approach.
[0298] In another specific embodiment, recombinant AAV is produced in a mammalian cell line expressing a transcriptional repressor that inhibits nuclease expression. Transcriptional repressors are known in the art and include Tet repressors, Lac repressors, Cro repressors, and lambda repressors. Many nuclear hormone receptors, such as ecdysone receptors, also act as transcriptional repressors in the absence of their congener hormone ligands. To carry out the present invention, packaging cells are transfected / transduced with a vector encoding a transcriptional repressor, and the nuclease gene in the viral genome (packaging vector) is operably ligated to a promoter modified to include a binding site for the repressor, so that the repressor silences the promoter. The gene encoding the transcriptional repressor can be located at various positions. This can be encoded on a separate vector, incorporated into a packaging vector outside the ITR sequence, incorporated into a cap / rep vector or adenovirus helper vector, or stably incorporated into the genome of packaging cells for constitutive expression. Methods for modifying common mammalian promoters to incorporate transcriptional repressor sites are known in the art. For example, Chang and Roninson modified potent constitutive CMV and RSV promoters to include operators of the Lac repressor and showed that gene expression from the modified promoters was greatly attenuated in cells expressing the repressor (Chang and Roninson (1996), Gene 183:137-42). The use of non-human transcriptional repressors ensures that transcription of nuclease genes is repressed only in packaging cells expressing the repressor and not in target cells or tissues transduced with the resulting recombinant AAV.
[0299] 2.5 Methods for producing genetically modified cells The present invention provides a method for producing genetically modified cells both in vitro and in vivo using MTEM or genetically modified meganucleases described herein that bind to and cleave recognition sequences found within mtDNA, such as human mtDNA. Cleavage at such recognition sequences may enable NHEJ, insertion of exogenous sequences by homologous recombination, or degradation of mtDNA at the cleavage site.
[0300] The present invention includes the ability to deliver (i.e., introduce) an MTEM or genetically modified meganuclease described herein, or a nucleic acid encoding an MTEM or genetically modified meganuclease described herein, into a cell such as a eukaryotic cell (e.g., a human cell).
[0301] The MTEMs or genetically modified meganucleases described herein can be delivered to cells in the form of proteins, or preferably as nucleic acids encoding the MTEMs or genetically modified meganucleases described herein. Such nucleic acids may be DNA (e.g., circular or linear plasmid DNA or PCR products) or RNA (e.g., mRNA). Accordingly, polynucleotides comprising nucleic acid sequences encoding the MTEMs or genetically modified meganucleases described herein are provided herein. In certain embodiments, the polynucleotide is mRNA. The polynucleotides encoding the MTEMs or genetically modified meganucleases described herein can be operably ligated to a promoter. In certain embodiments, an expression cassette is provided comprising a promoter operably ligated to a polynucleotide having a nucleic acid sequence encoding the MTEMs or genetically modified meganucleases described herein.
[0302] In embodiments where the sequence encoding the MTEM or genetically engineered meganuclease is delivered in DNA form, it should be operably linked to a promoter to facilitate transcription of the MTEM or genetically engineered meganuclease sequence. Suitable mammalian promoters for the present invention include constitutive promoters such as the cytomegalovirus early (CMV) promoter (Thomsen et al. (1984), Proc Natl Acad Sci USA, 81(3):659-63), the SV40 early promoter (Benoist and Chambon (1981), Nature. 290(5804):304-10), the CAG promoter, the EF1 alpha promoter, or the UbC promoter, as well as inductive promoters such as the tetracycline-inducible promoter (Dingermann et al. (1992), Mol Cell Biol. 12(9):4038-45). The MTEM or genetically engineered meganucleases described herein may also be operably linked to synthetic promoters. Examples of synthetic promoters include, but are not limited to, the JeT promoter (International Publication No. 2002 / 012514). In certain embodiments, the nucleic acid sequences encoding the MTEM or genetically modified meganucleases described herein are operably linked to tissue-specific promoters such as muscle cell-specific promoters, skeletal muscle-specific promoters, myotube-specific promoters, muscle satellite cell-specific promoters, neuron-specific promoters, astrocyte-specific promoters, microglia-specific promoters, ophthalmocellular-specific promoters, retinal cell-specific promoters, retinal ganglion cell-specific promoters, retinal pigment epithelium-specific promoters, pancreatic cell-specific promoters, or pancreatic beta cell-specific promoters.
[0303] In certain embodiments, the nucleic acid sequence encoding the MTEM or genetically modified meganuclease is delivered onto a recombinant DNA construct or expression cassette. For example, a recombinant DNA construct may include an expression cassette (i.e., the "cassette") comprising a promoter and a polynucleotide having the nucleic acid sequence encoding the MTEM or genetically modified meganuclease described herein. The polynucleotide provided herein may be mRNA or DNA. In certain embodiments, the polynucleotide further comprises a sequence encoding a selectable marker. The selectable marker may be any marker that enables selection of cells or organisms (e.g., bacteria, eukaryotic cells, mammalian cells, plant cells, plants and / or plant parts) containing the polynucleotide described herein. In certain embodiments, the selectable marker is an antibiotic resistance gene.
[0304] In some embodiments, mRNA encoding METM is delivered to the cell, which reduces the likelihood of the gene encoding the MTEM or genetically modified meganuclease described herein being incorporated into the cell's genome.
[0305] Such mRNA encoding METM can be produced using methods known in the art, such as in vitro transcription. In some embodiments, the mRNA is 5' capped using 7-methyl-guanosine, an anti-reverse cap analog (ARCA) (U.S. Patent No. 7,074,596), a CLEANCAP® analog, such as a Cap 1 analog (Trilink, San Diego, CA), or enzymatically capped using a vaccinia capping enzyme, etc. In some embodiments, the mRNA may be polyadenylated. The mRNA may contain various 5' and 3' untranslated sequence elements to enhance the expression of the encoded MTEM or genetically modified meganuclease described herein and / or the stability of the mRNA itself. Such elements may include posttranslational regulators, such as woodchuck hepatitis virus posttranslational regulators. The mRNA may contain nucleoside analogs or naturally occurring nucleosides such as pseudouridine, 5-methylcytidine, N6-methyladenosine, 5-methyluridine, or 2-thiouridine. Further nucleoside analogs include, for example, those described in U.S. Patent No. 8,278,036.
[0306] The purified MTEMs or genetically modified meganucleases described herein can be delivered to cells by various different mechanisms known in the art, including those further detailed herein, to cleave mitochondrial DNA.
[0307] In another specific embodiment, the nucleic acid encoding the MTEM or genetically modified meganuclease described herein is introduced into cells using a single-stranded DNA template. The single-stranded DNA may further include 5' and / or 3' AAV reverse end repeats (ITRs) upstream and / or downstream of the sequence encoding the MTEM or genetically modified meganuclease described herein. The single-stranded DNA may further include 5' and / or 3' homology arms upstream and / or downstream of the sequence encoding the MTEM or genetically modified meganuclease described herein.
[0308] In another specific embodiment, the gene encoding the MTEM or genetically modified meganuclease described herein is introduced into cells using a linearized DNA template. Such a linearized DNA template can be produced by methods known in the art. For example, plasmid DNA encoding a nuclease can be digested with one or more restriction enzymes so that the circular plasmid DNA is linearized before being introduced into cells.
[0309] The purified MTEM or genetically modified meganucleases described herein, or the nucleic acids encoding the MTEM or genetically modified meganucleases described herein, can be delivered to cells by various different mechanisms known in the art, including those further detailed below herein, to cleave mitochondrial DNA.
[0310] In some embodiments, the MTEM or genetically modified meganuclease described herein, the DNA / mRNA encoding the MTEM or genetically modified meganuclease described herein, or cells expressing the MTEM or genetically modified meganuclease described herein are formulated for systemic or target tissue administration in a pharmaceutically acceptable carrier according to known techniques. See, for example, Remington, The Science and Practice of Pharmacy (21st ed., Philadelphia, Lippincott, Williams & Wilkins, 2005). In the manufacture of the pharmaceutical formulation according to the present invention, the protein / RNA / mRNA / cell is typically miscible with a pharmaceutically acceptable carrier. The carrier must, of course, be acceptable in the sense that it is compatible with any other components in the formulation and must not be harmful to the patient. The carrier may be solid or liquid or both and may be formulated together with the compound as a unit dose formulation.
[0311] In some embodiments, the MTEM or genetically modified meganuclease described herein, or the DNA / mRNA encoding the MTEM or genetically modified meganuclease described herein, is bound to a cell-permeable peptide or targeted ligand to facilitate cell uptake. Examples of cell-permeable peptides known in the art include polyarginine (Jearawiriyapaisarn et al. (2008) Mol Ther. 16:1624-9), HIV virus-derived TAT peptide (Hudecz et al. (2005), Med. Res. Rev. 25:679-736), MPG (Simeoni et al. (2003) Nucleic Acids Res. 31:2717-2724), Pep-1 (Deshayes et al. (2004) Biochemistry 43:7698-7706), and HSV-1 VP-22 (Deshayes et al. (2005) Cell Mol Life See Sci.62:1839-49 for an example. In an alternative embodiment, the MTEM or genetically modified meganuclease described herein, or the DNA / mRNA encoding the MTEM or genetically modified meganuclease described herein, is covalently or non-covalently bound to an antibody that recognizes a specific cell surface receptor expressed on the target cell, so that the MTEM protein / DNA / mRNA binds to the target cell and is thereby internalized. Alternatively, the MTEM protein / DNA / mRNA may be covalently or non-covalently bound to a native ligand (or part of a native ligand) of such a cell surface receptor (McCall et al. (2014) Tissue Barriers.2(4):e944449; Dinda et al. (2013) Curr Pharm Biotechnol.14:1264-74; Kang et al. (2014) Curr Pharm Biotechnol.15(3):220-30; Qian et al. (2014) Expert Opin Drug Metab Toxicol. 10(11): 1491-508).
[0312] In some embodiments, the MTEM or genetically modified meganuclease described herein, or the DNA / mRNA encoding the MTEM or genetically modified meganuclease described herein, is encapsulated within a biodegradable hydrogel. The hydrogel can provide sustained and controllable release of a therapeutic payload to a desired area of target tissue without requiring frequent injections, and stimulus-responsive materials (e.g., temperature and pH-responsive hydrogels) can be designed to release the payload in response to environmental or externally applied cues (Kang Derwent et al. (2008) Trans Am Ophthalmol Soc. 106:206-214).
[0313] In some embodiments, the MTEM or genetically engineered meganuclease described herein, or the DNA / mRNA encoding the MTEM or genetically engineered meganuclease described herein, are covalently or preferably noncovalently bonded to or encapsulated within nanoparticles using methods known in the art (Sharma et al. (2014) Biomed Res Int. 2014). The nanoparticles are nanoscale delivery systems with a length scale of <1 μm, preferably <100 nm. Such nanoparticles can be designed using a core composed of metal, lipid, polymer, or biomacromolecule, and multiple copies of nuclease protein, mRNA, or DNA can be attached to or encapsulated within the nanoparticle core. This increases the intracellular expression of each MTEM or genetically engineered meganuclease described herein to increase the number of protein / mRNA / DNA delivered to each cell and thus maximize the likelihood that the target recognition sequence will be cleaved. The surface of such nanoparticles may be further modified with polymers or lipids (e.g., chitosan, cationic polymers, or cationic lipids) to form core-shell nanoparticles in which the surface confers additional functionality for enhancing cell delivery and payload uptake (Jian et al. (2012) Biomaterials. 33(30):7621-30). Nanoparticles may also be favorably bound to targeting molecules to direct the nanoparticles to the appropriate cell type and / or to increase the likelihood of cell uptake. Examples of such targeting molecules include antibodies specific to cell surface receptors and native ligands (or parts of native ligands) of cell surface receptors.
[0314] In some embodiments, the MTEM or genetically modified meganuclease described herein, or the DNA / mRNA encoding the MTEM or genetically modified meganuclease described herein, is encapsulated within a liposome or complexed using a cationic lipid (see, for example, LIPOFECTAMINE®, Life Technologies Corp., Carlsbad, CA; Zuris et al. (2015) Nat Biotechnol. 33:73-80; Mishra et al. (2011) J Drug Deliv. 2011:863734). Liposomes and lipoplex formulations can protect the payload from degradation, enhance accumulation and retention at target sites, and promote cellular uptake and delivery efficiency through fusion with and / or disruption of the cell membrane of target cells.
[0315] In some embodiments, the MTEM or genetically modified meganuclease described herein, or the DNA / mRNA encoding the MTEM or genetically modified meganuclease described herein, is encapsulated within a polymer scaffold (e.g., PLGA) or complexed using a cationic polymer (e.g., PEI, PLL) (Tamboli et al. (2011) Ther Deliv. 2(4):523-536). The polymer carrier can be designed to provide a drug release rate tunable by controlling polymer erosion and drug diffusion, and high drug encapsulation efficiency can provide protection of the therapeutic payload until intracellular delivery to the desired target cell population.
[0316] In some embodiments, the MTEM or genetically modified meganuclease described herein, or the DNA / mRNA encoding the nMTEM or genetically modified meganuclease described herein, is combined with an amphiphilic molecule that self-assembles into a micelle (Tong et al. (2007) J Gene Med. 9(11):956-66). The polymer micelle may include a micelle shell formed of a hydrophilic polymer (e.g., polyethylene glycol) that can prevent aggregation, mask charge interactions, and reduce nonspecific interactions.
[0317] In some embodiments, the MTEM or genetically modified meganuclease described herein, or the DNA / mRNA encoding the MTEM or genetically modified meganuclease described herein, are formulated into emulsions or nanoemulsions (i.e., having an average particle size of <1 nm) for administration and / or delivery to target cells. The term “emulsion” refers to any oil-in-water, water-in-oil, water-in-oil-in-water, or oil-in-water-in-oil-in-oil-in-oil-in-oil-in-oil-in-oil-in-oil-in-oil-in-oil-in-oil-in-oil-in-a-water-in Nanoemulsion formulations are well known, for example, as described in U.S. Patents No. 6,015,832, 6,506,803, 6,635,676, 6,559,189 and 7,767,216, each of which is incorporated herein by reference in whole.
[0318] In some embodiments, the MTEM or genetically modified meganuclease described herein, or the DNA / mRNA encoding the MTEM or genetically modified meganuclease described herein, are covalently or acovalently bonded to polyfunctional polymer conjugates, DNA dendrimers, and polymer dendrimers (Mastorakos et al. (2015) Nanoscale. 7(9):3845-56; Cheng et al. (2008) J Pharm Sci. 97(1):123-43). Dendrimer generation allows for control of payload capacity and size, and can provide high payload capacity. Furthermore, the presentation of multiple surface groups can be used to improve stability, reduce nonspecific interactions, and enhance cell-specific targeting and drug release.
[0319] In some embodiments, polynucleotides having nucleic acid sequences encoding MTEM are introduced into cells using recombinant viruses. Such recombinant viruses are known in the art and include recombinant retroviruses, recombinant lentiviruses, recombinant adenoviruses, and recombinant AAVs (Vannucci et al. (2013 New (Discussed in Microbiol. 36:1-22). Recombinant AAVs useful in the present invention may have any capsid or serotype that enables transduction of the virus into target cell types and expression of MTEM by the target cells. For example, in some embodiments, recombinant AAVs may have serotypes AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, or AAVHSC. In some embodiments, the recombinant virus is injected directly into the target tissue. In alternative embodiments, the recombinant virus is delivered systemically via the circulatory system. It is known in the art that different AAVs tend to localize to different tissues and that an appropriate AAV capsid / serotype can be selected for preferential delivery to a particular tissue. In some embodiments, the AAV serotype is AAV9. AAVs may also be self-complementary so as not to require second-strand DNA synthesis in host cells (McCarty et al. (2001) Gene). Ther. 8:1248-54). Nucleic acids delivered by recombinant AAV may contain left (5') and right (3') reversed terminal repeats.
[0320] In one embodiment, the recombinant virus used for the delivery of a polynucleotide having a nucleic acid sequence encoding the MTEM or genetically modified meganuclease described herein is a self-restrictive recombinant virus. Because the recognition sequence for the genetically modified meganuclease is present within the vector, the self-restrictive recombinant virus can have a limited duration in a cell or organism. Therefore, the self-restrictive recombinant virus can be genetically engineered to encode a promoter, the MTEM or genetically modified meganuclease described herein, and a meganuclease recognition site within the ITR. The self-restrictive recombinant virus delivers the meganuclease gene to a cell, tissue, or organism so that the MTEM or genetically modified meganuclease described herein is expressed and can cleave the cell's genome at the endogenous recognition sequence within the genome. The delivered meganuclease also finds its target site within the self-restrictive recombinant virus itself and cleaves the vector at this target site. Upon cleavage, the 5' and 3' ends of the viral genome are exposed and degraded by the exonuclease, thus killing the virus and halting the production of the MTEM or genetically modified meganuclease described herein.
[0321] When polynucleotides having nucleic acid sequences encoding MTEMs or genetically modified meganucleases described herein are delivered in DNA form (e.g., plasmids) and / or via viral vectors (e.g., AAVs), they must be operably ligated to a promoter. In some embodiments, this may be an endogenous promoter derived from a viral vector (e.g., the LTR of a lentiviral vector) or a viral promoter such as a constitutive or tissue-specific promoter described elsewhere herein. In certain embodiments, polynucleotides having nucleic acid sequences encoding MTEMs or genetically modified meganucleases described herein are operably ligated to a promoter that preferentially drives gene expression in target cells such as neurons, glial cells (e.g., astrocytes or oligodendrocytes), or muscle cells (e.g., skeletal muscle cells, cardiomyocytes, or smooth muscle cells). In some embodiments, the target cells are muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the population of the target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells. The target cell population is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the target cell population is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells.
[0322] In some embodiments, methods for producing genetically modified eukaryotic cells or populations of genetically modified eukaryotic cells are provided herein by introducing polynucleotides of the Disclosure, for example, polynucleotides comprising nucleic acid sequences encoding the genetically modified meganucleases described herein, into eukaryotic cells or populations of eukaryotic cells. When expressed in eukaryotic cells or populations of eukaryotic cells, the genetically modified meganucleases localize to mitochondria, bind to recognition sequences within the mitochondrial genome, and generate cleavage sites. The cleavage sites generated by the genetically modified meganucleases can be repaired by the NHEJ repair pathway, which can result in nucleic acid insertion or deletion at the cleavage site. Additionally or alternatively, cleavage sites generated by the genetically modified meganucleases in the mitochondrial genome of eukaryotic cells or populations of eukaryotic cells can be repaired by alternative non-homologous end joining (Alt-NHEJ) or microhomology-mediated end joining (MMEJ). NHEJ or Alt-NHEJ / MMEJ can result in nucleic acid insertion and / or deletion at the cleavage site. In particular, NHEJ or Alt-NHEJ / MMEJ have 1 to 1000 (e.g., 1 to 10, 10 to 100, 100 to 200, 200 to 300, 300 to 400, 400 to 500, 500 to 600, 600 to 700, 700 to 80, 800 to 900 or 900 to 1000) nucleotides at the cleavage site, for example, about 1, 5, 10, 15, 20, 25, 50, 75, 100, 125, This can result in insertions and / or deletions of 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, or 1000 nucleotides. In some embodiments, the mitochondrial genome can be degraded in the gene-modified eukaryotic cells or populations of gene-modified eukaryotic cells described herein.In some such embodiments, the percentage of the mitochondrial genome containing the recognition sequence may be reduced by approximately 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% compared to control cells, or by approximately 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, 90-100%, or more.
[0323] In certain embodiments, the mutant mitochondrial genome containing the recognition sequence of SEQ ID NO: 1 is degraded. By degrading the mutant mitochondrial genome having the recognition sequence of SEQ ID NO: 1, the overall ratio of the wild-type mitochondrial genome to the mutant mitochondrial genome increases after administration or expression of the MTEM or genetically modified meganuclease described herein. In some embodiments, the ratio of the wild-type mutant mitochondrial genome to the wild-type mitochondrial genome in a single genetically modified eukaryotic cell or population of genetically modified eukaryotic cells described herein is approximately 5:95, approximately 10:90, approximately 15:85, approximately 20:80, approximately 25:75, approximately 30:70, approximately 35:65, approximately 40:60, approximately 45:55, approximately 50:50, approximately 55:45, approximately 60:40, approximately 65:35, approximately 70:30, approximately 75:25, and approximately 80. It increases to approximately 20, 85:15, 90:10, 95:5, 20:1, 50:1, 100:1, 150:1, 200:1, 250:1, 300:1, 350:1, 400:1, 450:1, 500:1, 550:1, 600:1, 650:1, 700:1, 750:1, 800:1, 850:1, 900:1, 950:1, 1000:1 or more.
[0324] In certain embodiments, the percentage of wild-type genome in a single gene-modified eukaryotic cell or population of gene-modified eukaryotic cells described herein may increase as the mutant mitochondrial genome containing SEQ ID NO: 1 is recognized, cleaved, and degraded by the MTEM or genetically engineered meganuclease described herein. The percentage of wild-type mitochondrial genome in a gene-modified eukaryotic cell or population of gene-modified cells described herein may be about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or more of the total mitochondrial genome in a gene-modified eukaryotic cell or population of gene-modified cells compared to a eukaryotic cell or population of eukaryotic cells that do not express the MTEM or genetically engineered meganuclease described herein. Similarly, the percentage of mutant mitochondrial genomes containing the recognition sequence of Sequence ID No. 1 in genetically modified eukaryotic cells or populations of genetically modified cells may be reduced by approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more compared to eukaryotic cells or populations of eukaryotic cells that do not express the MTEM or genetically modified meganuclease described herein.
[0325] In some embodiments, mitochondrial respiration in genetically modified eukaryotic cells or populations of genetically modified eukaryotic cells described herein may increase by approximately 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more compared to eukaryotic cells that do not express the MTEM or genetically modified meganuclease described herein. Mitochondrial respiration in genetically modified eukaryotic cells or populations of genetically modified eukaryotic cells described herein may increase by approximately 30-40%, 40-50%, 50-60%, 60-70%, 70-80%, 80-90%, 90-100%, or more compared to eukaryotic cells or populations of eukaryotic cells that do not express the MTEM or genetically modified meganuclease described herein.
[0326] In certain cases, the recognition sequence is located within a region of the mitochondrial genome associated with mitochondrial dysfunction. For example, the recognition sequence may be located within a region of the mitochondrial genome associated with mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS). Mutations in the mtDNA gene MT-TL1 are associated with MELAS in approximately 80% of cases. Over 80% of MELAS cases are caused by A3243G point mutations in tRNA-Leu. Mutations in MT-TQ, MT-TH, MT-TK, MT-TS1, MT-ND1, MT-ND5, MT-ND6, and MT-TS2 are also associated with MELAS syndrome. Some cases of MELAS syndrome appear to result from new, spontaneous mutations in mitochondrial genes and are not hereditary (Sue et al., J Pediatr 134:696-700 (1999); Singh et al., Indian J Pediatr 66:621-625 (1999); Deschauer et al., Neuromuscul Disord, 9:305-307 (1999)). MELAS begins in childhood, usually between 2 and 15 years of age, and primarily affects the nervous and muscular systems. The most common initial symptoms are seizures, recurrent headaches, loss of appetite, and recurrent vomiting. Stroke-like episodes (hemiplegia) with temporary muscle weakness on one side of the body may also occur, which can lead to altered consciousness, vision and hearing loss, loss of motor skills, and intellectual disability. MELAS is caused by mutations in mtDNA.
[0327] Both normal and mutant mtDNA may be present in the same cell; this is a known condition called heteroplasmy. The number of deficient mitochondria may be greater than the number of normal mitochondria. Symptoms may not appear in a given generation until the mutation significantly affects a proportion of the mtDNA. Heterogeneous distribution of normal and mutant mtDNA in different tissues can affect different organs in members of the same family. This can lead to a variety of symptoms in affected family members.
[0328] In certain embodiments, the recognition sequence described herein in the mitochondrial genome of a eukaryotic cell or population of eukaryotic cells is located at nucleotides 3000–3500 of the mitochondrial genome. In certain embodiments, the MTEM or genetically engineered meganuclease described herein targets the A3243G mutation in the mitochondrial genome. As used herein, “MELAS mutation” refers to the A3243G mutation in the mitochondrial genome, in which A in the wild-type genome is replaced with G in the mutant mitochondrial genome at position 3243. In certain embodiments, the recognition sequence of Sequence ID No. 1 is located only on the mutant mitochondrial genome. When expressed in genetically modified eukaryotic cells or populations of genetically modified eukaryotic cells, the MTEM or genetically engineered meganuclease can localize to mitochondria, bind to the recognition sequence within the mitochondrial genome, and generate a cleavage site. Thus, by targeting the recognition sequence located only on the mutant genome, the genome can be cleaved and subsequently degraded. This specific degradation of the mutant mitochondrial genome can be used to help treat or alleviate the symptoms of MELAS.
[0329] Accordingly, a method for degrading a mutant mitochondrial genome in target cells or a population of target cells is provided herein by delivering a nucleic acid sequence encoding the MTEM or genetically modified meganuclease described herein, or a polynucleotide containing the MTEM or genetically modified meganuclease, to target cells or a population. In a particular embodiment, the target cells or population of target cells contain a mutant mitochondrial genome having the MELAS mutation (i.e., the A3243G mutation), and the MTEM or genetically modified meganuclease recognizes and cleaves the recognition sequence of Sequence ID No. 1. The target cells or population of target cells may be in a mammalian subject such as a human subject. In some embodiments, the target cells are muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the population of the target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells. The target cell population is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the target cell population is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells.
[0330] Methods for treating conditions associated with the subject MELAS disorder are described herein. Such methods include administering to the subject a polynucleotide having a nucleic acid sequence encoding a therapeutically effective amount of MTEM or a gene-editing meg nuclease, or a therapeutically effective amount of MTEM or a gene-editing meg nuclease described herein, wherein the MTEM or gene-editing meg nuclease creates a cleavage site at the recognition sequence of SEQ ID NO: 1 in a mutant mitochondrial genome having a MELAS mutation. The cleavage site created in the mutant mitochondrial genome can result in the degradation of the mutant mitochondrial genome. In certain embodiments, treating includes reducing or alleviating at least one symptom of MELAS. Symptoms of MELAS include, but are not limited to, seizures, recurrent headaches, loss of appetite, recurrent vomiting, stroke-like episodes (hemiparesis) with transient muscle weakness on one side of the body, changes in consciousness, loss of vision and hearing, loss of motor skills, and intellectual impairment. In certain embodiments, a method for treating a condition associated with MELAS in a subject includes administering a pharmaceutical composition described herein.
[0331] In some embodiments, the subject is administered the pharmaceutical composition described herein at a dose of about 1 x 10 10 gc / kg to about 1 x 10 14 gc / kg (e.g., 1 x 10 10 gc / kg, 1 x 10 11 gc / kg, 1 x 10 12 gc / kg, 1 x 10 13 gc / kg, or 1 x 10 14 gc / kg) of a nucleic acid encoding MTEM or a gene-editing meg nuclease. In some embodiments, the subject is administered at least about 1 x 10 10 gc / kg, at least about 1 x 10 11 gc / kg, at least about 1 x 10 12 gc / kg, at least about 1 x 10 13 gc / kg, or at least about 1 x 10 14The pharmaceutical composition is administered at a dose of gc / kg. In some embodiments, the subject is approximately 1 × 10⁶ of nucleic acids encoding MTEM or genetically modified meganucleases. 10 gc / kg ~ approx. 1×10 11 gc / kg, approximately 1×10 11 gc / kg ~ approx. 1×10 12 gc / kg, approximately 1×10 12 gc / kg ~ approx. 1×10 13 gc / kg, or approximately 1 × 10⁻⁶ 13 gc / kg ~ approx. 1×10 14 The pharmaceutical composition is administered at a dose of gc / kg. In certain embodiments, the subject is approximately 1 x 10⁻¹⁶ of nucleic acids encoding MTEM or genetically modified meganucleases. 12 gc / kg ~ approx. 9x10 13 gc / kg (for example, approximately 1 x 10) 12 gc / kg, approx. 2x10 12 gc / kg, approx. 3x10 12 gc / kg, approx. 4x10 12 gc / kg, approx. 5x10 12 gc / kg, approx. 6x10 12 gc / kg, approx. 7x10 12 gc / kg, approx. 8x10 12 gc / kg, approx. 9x10 12 gc / kg, approx. 1x10 13 gc / kg, approx. 2x10 13 gc / kg, approx. 3x10 13 gc / kg, approx. 4x10 13 gc / kg, approx. 5x10 13 gc / kg, approx. 6x10 13 gc / kg, approx. 7x10 13 gc / kg, approx. 8x10 13 gc / kg, or approximately 9x10 13 The pharmaceutical composition is administered at a dose of gc / kg.
[0332] In some embodiments, subjects are administered a lipid nanoparticle formulation at doses of approximately 0.1 mg / kg to approximately 3 mg / kg of mRNA encoding MTEM or genetically modified meganuclease. In some embodiments, subjects are administered a lipid nanoparticle formulation at doses of at least approximately 0.1 mg / kg, at least approximately 0.25 mg / kg, at least approximately 0.5 mg / kg, at least approximately 0.75 mg / kg, at least approximately 1.0 mg / kg, at least approximately 1.5 mg / kg, at least approximately 2.0 mg / kg, at least approximately 2.5 mg / kg, or at least approximately 3.0 mg / kg of mRNA encoding MTEM or genetically modified meganuclease. In some embodiments, subjects are administered a lipid nanoparticle formulation at doses of approximately 0.1 mg / kg to approximately 0.25 mg / kg, approximately 0.25 mg / kg to approximately 0.5 mg / kg, approximately 0.5 mg / kg to approximately 0.75 mg / kg, approximately 0.75 mg / kg to approximately 1.0 mg / kg, approximately 1.0 mg / kg to approximately 1.5 mg / kg, approximately 1.5 mg / kg to approximately 2.0 mg / kg, approximately 2.0 mg / kg to approximately 2.5 mg / kg, or approximately 2.5 mg / kg to approximately 3.0 mg / kg of mRNA encoding MTEM or genetically modified meganuclease.
[0333] Target tissues for delivery of MTEM or genetically modified meganucleases described herein, or nucleic acids encoding MTEM or genetically modified meganucleases described herein, include, but are not limited to, muscle tissue, brain tissue, central nervous system tissue, pancreatic tissue, or ocular / retinal tissue. In some embodiments, target cells for delivery are muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the population of target cells is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells. The target cell population is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells, or the target cell population is a population of muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, or pancreatic beta cells.
[0334] In various embodiments of the methods described herein, a recombinant virus comprising one or more MTEMs or genetically modified meganucleases described herein, a polynucleotide encoding such MTEMs or genetically modified meganucleases described herein, or one or more polynucleotides encoding such MTEMs or genetically modified meganucleases described herein, can be administered via any suitable route of administration known in the art, as described herein. Thus, a recombinant virus comprising one or more MTEMs or genetically modified meganucleases described herein, a polynucleotide encoding such MTEMs or genetically modified meganucleases described herein, or one or more polynucleotides encoding such MTEMs or genetically modified meganucleases described herein, can be administered by routes of administration including intravenous, intramuscular, intraperitoneal, subcutaneous, intrahepatic, transmucosal, transdermal, intra-arterial, and sublingual, as described herein. In some embodiments, the MTEMs or genetically modified meganucleases described herein, or mRNA or DNA vectors described herein, are delivered to target cells (e.g., nerve cells, muscle cells, pancreatic cells, ocular cells, etc.) via direct injection into target tissue. In some embodiments, eukaryotic cells are stem cells, CD34+HSCs, muscle cells, skeletal muscle cells, myotubes, muscle satellite cells, neurons, astrocytes, microglia, ophthalmic cells, retinal cells, retinal ganglion cells, retinal pigment epithelial cells, pancreatic cells, pancreatic beta cells, kidney cells, bone marrow cells, or ear hair cells. In some embodiments, the condition is a muscular, brain, central nervous system, pancreatic, or retinal condition. In some embodiments, the condition is mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS), progressive extraocular myopalsy, maternal diabetes mellitus, migraine, or ocular myopathy.
[0335] Other suitable routes of administration of recombinant viruses comprising MTEM or genetically modified meganucleases described herein, polynucleotides encoding such MTEM or genetically modified meganucleases described herein, or one or more polynucleotides encoding such genetically modified nucleases, can be readily determined by the treating physician as needed.
[0336] In some embodiments, a therapeutically effective dose of the MTEM or genetically modified meganuclease described herein is administered to a subject in need. If necessary, the dose or frequency of administration of the MTEM or genetically modified meganuclease may be adjusted throughout the course of treatment at the discretion of the administering physician. The appropriate dose depends, among other factors, on the details of any AAV selected (e.g., serotype), the route of administration, the subject being treated (i.e., age, weight, sex, and general condition of the subject), and the mode of administration. Therefore, the appropriate dose may vary from patient to patient. The appropriate effective dose can be readily determined by those skilled in the art. The drug administration may be a single-dose schedule or a multi-dose schedule. Furthermore, the subject may be administered as many doses as appropriate. Those skilled in the art can readily determine the appropriate number of doses. Dosages may need to be adjusted to take alternative routes of administration into consideration or to balance the therapeutic benefits with any side effects.
[0337] The exogenous nucleic acid molecules described herein may be introduced into cells and / or delivered to a target by any of the previously considered means. In certain embodiments, the exogenous nucleic acid molecules are introduced by a lentivirus, retrovirus, adenovirus, or recombinant virus such as recombinant AAV. Recombinant AAVs useful for introducing exogenous nucleic acid molecules may have any serotype, including the serotypes / capsids described herein, that enable transduction of the virus into cells and insertion of the exogenous nucleic acid molecule sequence into the cellular genome. Recombinant AAVs may also be self-complementary so as not to require second-strand DNA synthesis in the host cell. Exogenous nucleic acid molecules introduced using recombinant AAVs may be flanked by 5' (left) and 3' (right) reverse terminal repeats.
[0338] In another specific embodiment, an exogenous nucleic acid molecule can be introduced into cells using a single-stranded DNA template. The single-stranded DNA may contain an exogenous nucleic acid molecule and, in a specific embodiment, may include 5' and 3' homology arms to facilitate the insertion of the nucleic acid sequence into a nuclease cleavage site by homologous recombination. The single-stranded DNA may further contain a 5'AAV reverse terminal repeat (ITR) sequence 5' upstream of the 5' homology arm and a 3'AAV ITR sequence 3' downstream of the 3' homology arm.
[0339] In another specific embodiment, a polynucleotide comprising a nucleic acid sequence encoding an MTEM or genetically modified meganuclease and / or an exogenous nucleic acid molecule described herein can be introduced into cells by transfection using a linearized DNA template. Plasmid DNA encoding an MTEM or genetically modified meganuclease and / or an exogenous nucleic acid molecule described herein can be digested with one or more restriction enzymes, for example, so that the circular plasmid DNA is linearized before transfection into cells.
[0340] When delivered to cells, the exogenous nucleic acids described herein can be operably ligated to any promoter suitable for the expression of the encoded polypeptide in cells, including the mammalian and inducible promoters previously considered. The exogenous nucleic acids described herein can also be operably ligated to synthetic promoters. Examples of synthetic promoters include, but are not limited to, the JeT promoter (International Publication No. 2002 / 012514).
[0341] 2.6 Variant The present invention encompasses variants of polypeptides and polynucleotide sequences described herein.
[0342] As used herein, “variant” is intended to mean a substantially similar sequence. “Variant” polypeptide is intended to mean a polypeptide derived from a “natural” polypeptide by the deletion or addition of one or more amino acids at one or more internal sites of a natural protein, and / or the substitution of one or more amino acids at one or more sites of a natural polypeptide. As used herein, “natural” polynucleotide or polypeptide includes the parent sequence from which the variant is derived. Variant polypeptides encompassed by embodiments are biologically active; that is, they retain the desired biological activity of the natural protein, e.g., the ability to bind to and cleave recognition sequences found in mtDNA (e.g., human mtDNA), such as the MIT 25-26 recognition sequence (SEQ ID NO: 1). Such variants may arise, for example, from human manipulation. In some embodiments, a biologically active variant of the embodiment's natural polypeptide (e.g., any one of SEQ ID NOs: 3-12) or a biologically active variant of the recognition half-site binding subunit described herein has at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the amino acid sequence of the natural polypeptide, natural subunit, natural HVR1, or natural HVR2 as determined by the sequence alignment programs and parameters described elsewhere in this specification. A biologically active variant of the polypeptide or subunit of an embodiment may differ from that polypeptide or subunit by as few as 1 to 40 amino acid residues, as few as 1 to 20, as few as 1 to 10, as few as 5, as few as 4, 3, 2, or even as few as 1 amino acid residue.
[0343] The polypeptides of the embodiments can be modified in various ways, including amino acid substitution, deletion, cleavage, and insertion. Methods for such operations are generally known in the art. For example, amino acid sequence variants can be prepared by mutations in DNA. Methods for mutagenesis and polynucleotide modification are well known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382; U.S. Patent No. 4,873,192; Walker and Gaastra (eds.). (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the references cited therein. Guidelines for appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC), which is incorporated herein by reference. Conservative substitutions, such as replacing one amino acid with another amino acid having similar properties, may be optimal.
[0344] In some embodiments, the genetically engineered meganucleases described herein may include variants of the HVR1 and HVR2 regions described herein. The parent HVR region may include, for example, residues 24-79 or 215-270 of the exemplified genetically engineered meganuclease. Thus, the variant HVR may include an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more sequence identity with the amino acid sequence corresponding to residues 24-79 or 215-270 of the exemplified genetically engineered meganuclease, so that the variant HVR region maintains the biological activity of the genetically engineered meganuclease (i.e., binding to and cleavage of the recognition sequence). Furthermore, in some embodiments described herein, the variant HVR1 region or the variant HVR2 region may include residues corresponding to amino acid residues found at specific positions within the parent HVR. In this context, "corresponding" means that the amino acid residue in the variant HVR is the same amino acid residue (i.e., a distinct and identical residue) that exists in the parent HVR sequence at the same relative position (i.e., with respect to the remaining amino acids in the parent sequence). For example, if the parent HVR sequence contains a serine residue at position 26, then a variant HVR that "contains a corresponding residue" at residue 26 will also contain serine at a position relative to (i.e., corresponding to) the parent position 26.
[0345] In certain embodiments, the genetically modified meganucleases described herein include HVR1 having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more sequence identity with respect to the amino acid sequence corresponding to residues 215-270 of any one of SEQ ID NOs: 3-12.
[0346] In certain embodiments, the genetically modified meganucleases described herein include HVR2 having 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more sequence identity with respect to the amino acid sequence corresponding to residues 24–79 of any one of SEQ ID NOs: 3–12.
[0347] A substantial number of amino acid modifications to the DNA recognition domain of wild-type I-CreI meganuclease have been previously identified (e.g., U.S. Patent No. 8,021,867), which, alone or in combination, result in genetically engineered meganucleases in which specificity has been altered at individual bases within the DNA recognition sequence half-site, such that the resulting reasonably engineered meganuclease has different half-site specificity from the wild-type enzyme. Table 2 provides potential substitutions that may be made in genetically engineered meganuclease monomers or subunits to enhance specificity based on the bases present at each half-site position (-1 to -9) of the recognition half-site. Such substitutions are incorporated into the meganuclease variants described herein.
[0348] [Table 2]
[0349] Items in bold are wild-type contact residues and do not constitute "modifications" as used herein. An asterisk indicates that the residue is in contact with a base on the antisense strand.
[0350] Specific modifications can be made to the genetically modified meganuclease monomer or subunit to modulate DNA binding affinity and / or activity. For example, the genetically modified meganuclease monomer or subunit described herein may include G, S, or A at the residue corresponding to position 19 of I-CreI or any one of SEQ ID NOs. 3-12 (International Publication No. 2009001159), Y, R, K, or D at the residue corresponding to position 66 of I-CreI or any one of SEQ ID NOs. 3-12, and / or E, Q, or K at the residue corresponding to position 80 of I-CreI or any one of SEQ ID NOs. 3-12 (U.S. Patent No. 8021867).
[0351] In the case of polynucleotides, a “variant” includes the deletion and / or addition of one or more nucleotides at one or more sites within a native polynucleotide. Those skilled in the art will recognize that variants of the nucleic acids of an embodiment are constructed such that the open reading frame is maintained. In the case of polynucleotides, a conserved variant includes a sequence that codes for one amino acid sequence of the polypeptide of an embodiment, for the degeneracy of the genetic code. Variant polynucleotides include synthetically derived polynucleotides, such as those produced by using site-directed mutagenesis, but still genetically engineered meganucleases or exogenous nucleic acid molecules or those that code for the template nucleic acid of an embodiment. Generally, a variant of a particular polynucleotide in an embodiment, when determined by the sequence alignment programs and parameters described elsewhere in this specification, will have at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more sequence identity with respect to that particular polynucleotide. A variant of a particular polynucleotide (i.e., a reference polynucleotide) in an embodiment can also be evaluated by comparing the percentage sequence identity between the polypeptide encoded by the variant polynucleotide and the polypeptide encoded by the reference polynucleotide.
[0352] Deletions, insertions, and substitutions of protein sequences as defined herein are not expected to result in fundamental changes to the polypeptide's characteristics. However, when it is difficult to predict the exact effect of a substitution, deletion, or insertion beforehand, those skilled in the art will understand that the effect can be assessed by screening the polypeptide for its ability to preferentially bind to and cleave recognition sequences found within human mtDNA, such as the MIT 25-26 recognition sequence (SEQ ID NO: 1).
[0353] Table 3 is an overview of the sequences disclosed herein.
[0354] [Table 3] TIFF0007849677000004.tif255157TIFF0007849677000005.tif255157TIFF00078496770 00006.tif254155TIFF0007849677000007.tif254151TIFF0007849677000008.tif253156 TIFF0007849677000009.tif255160TIFF0007849677000010.tif255157TIFF00078496770 00011.tif255149TIFF0007849677000012.tif255151TIFF0007849677000013.tif102158 [Examples]
[0355] This disclosure is further illustrated by the following examples, which should not be construed as limiting. Those skilled in the art can recognize or confirm numerous equivalents to the specific substances and procedures described herein by means of routine experiments alone. Such equivalents are intended to be included in the claims following the following examples.
[0356] Example 1. Reporter assay of MIT 25-26 nuclease activity. The objective of this experiment was to determine whether various MIT 25-26 meganucleases can bind to and cleave human MIT 25-26 recognition sequences in mammalian cells, and whether various MIT 25-26 meganucleases can distinguish wild-type alleles. To do this, genetically engineered meganucleases were evaluated using the previously described CHO cell reporter assay (see International Publication No. 2012 / 167192). To perform the assay, two CHO cell reporter lines were produced, each containing a non-functional green fluorescent protein (GFP) gene expression cassette integrated into the cell genome. The GFP gene in each cell line contained a direct sequence duplication separated by a pair of recognition sequences, such that intracellular cleavage of either recognition sequence by the genetically engineered meganuclease stimulates a homologous recombination event resulting in a functional GFP gene.
[0357] In the CHO reporter cell lines developed for this study, two recognition sequences were inserted into the GFP gene. One recognition sequence was for the human MIT 25-26 recognition sequence (either a mutant sequence differing by only one nucleotide or the wild-type sequence). Cell line number 1 (mutant) contained the mutant allele, and cell line number 2 (wild-type) contained the wild-type allele. The second recognition sequence inserted into both lines was the CHO-23 / 24 recognition sequence, which is recognized and cleaved by a control genetically modified meganuclease called "CHO-23 / 24". The CHO-23 / 24 recognition sequence is used as a positive control and standard activity measure.
[0358] The CHO reporter cells detailed above were transfected with mRNA encoding various MIT 25-26 nucleases. A control sample of CHO reporter cells was transfected with mRNA encoding CHO-23 / 24 meganuclease. In each assay, 5e4 CHO reporter cells were transfected with 2.5 ng (low dose) of mRNA in a 96-well plate using LIPOFECTAMINE® MESSENGERMAX (ThermoFisher) according to the manufacturer's instructions. Transfected CHO cells were evaluated by image cytometry two days after transfection to determine the percentage of GFP-positive cells compared to untransfected negative controls. Cells transfected with low doses of mRNA in mutant reporter cell lines were also evaluated by image cytometry on days 5 and 7. The data obtained at each time point were normalized to the percentage of GFP-positive cells observed using CHO-23 / 24 meganuclease to determine the "activity score," and the normalized data from the earliest time point was subtracted from the data from the latest time point to determine the "toxicity score." Next, the activity and toxicity scores were added together to determine the "activity index," which was then normalized to the activity index of CHO-23 / 24 meganuclease to compare data between cell lines ("normalized activity index"). This was performed for both wild-type and mutant cell lines to determine the specificity of the nuclease to the mutant sequence.
[0359] After nuclease optimization, the same reporter cell line was transfected with the MIT 25-26 genetically modified meganuclease. The same transfection and evaluation protocols were followed, except that mutant cell lines were transfected with 90 ng (high dose) or 2.5 ng (low dose) mRNA, while wild-type cell lines were transfected with only 90 ng.
[0360] The various MIT 25-26 modified meganucleases tested were able to bind to and cleave the MIT 25-26 recognition sequence in the mutant reporter strain (Figure 1). Furthermore, none of the genetically modified meganucleases were able to bind to and cleave the wild-type reporter strain, demonstrating a high level of specificity for the mutant sequence. In addition, the optimized MIT 25-26 nuclease (MIT 25-26L.35) showed further discrimination against the wild-type sequence, particularly at higher mRNA doses (Figure 2).
[0361] These studies demonstrated that the genetically modified MIT 25-26 meganucleases described herein can efficiently and selectively bind to and cleave their human recognition sequences (e.g., MIT 25-26) within cells.
[0362] Example 2. Evaluation of MIT 25-26 meganuclease in FlpIn CHO cell line. The objective of this experiment was to evaluate several MIT 25-26 meganucleases in an in vitro model for (1) activity against mutant target sites and (2) specificity against the corresponding wild-type sequence. This was performed using two FlpIn CHO cell lines containing a portion of the human mitochondrial genome integrated onto the nuclear chromosome. The integrated sequence included either a wild-type or mutant MIT 25-26 binding site and the surrounding mtDNA sequence. Since the objective was to generate a genetically modified meganuclease that could efficiently cleave the mutant sequence without cleaving the wild-type sequence, the mutant and wild-type binding sites differed by only one nucleotide, and therefore meganuclease specificity was paramount. Specificity and potency were evaluated by droplet digital PCR (ddPCR) by calculating insertion / deletion (indel) formation at each site.
[0363] The genetically modified meganucleases compared in the experiment shown in Figure 3 were as follows: MIT 25-26x.29, MIT 25-26x.37, MIT 25-26x.48, MIT 25-26x.73, and MIT 25-26x.91. The genetically modified meganucleases compared in the experiment shown in Figure 4 were MIT 25-26x.91 and MIT 25-26L.35 meganuclease.
[0364] FlpIn CHO cells were constructed using ThermoFisher Scientific's Flp-In® system. The embedded cassette contained either an MIT 25-26 mutant or wild-type sequence, along with surrounding mtDNA sequences. To compare the specificity and potency of various MIT 25-26 meganucleases, 6e5 FlpIn CHO cells were nucleofected with either 500 ng or 5 ng of MIT 25-26 meganuclease mRNA using Lonza 4D-Nucleofector® (SF buffer, condition EN-138). Cells were collected two days after nucleofection for gDNA extraction, and transfection efficiency was assessed using a Beckman Coulter CytoFlex S cytometer. Transfection efficiency exceeded 95% in both cell lines. gDNA was isolated using the Macherey Nagel NucleoSpin Blood QuickPure kit.
[0365] Using droplet digital PCR (ddPCR), indel frequencies at both the MIT 25-26 mutant and wild-type sites were determined by using P1 / P2, F1, and R1 to generate amplicons surrounding the binding site, and P3, F2, and R2 to generate a reference amplicon acting as a genome counter. The ratio of the two amplicons should be equal in the untreated population and decrease with respect to indel formation at the binding site in treated samples. Amplification was multiplexed in 24 μL reaction mixture containing 1×ddPCR Supermix for Probes (without dUTP, BioRad), 250 nM probes, 900 nM primers, 20 U / μL Kpn-I HF (NEB), and 150 ng of cellular gDNA. Droplets were generated using a QX100 droplet generator (BioRad). The cycle conditions were as follows: 1 cycle of 10 minutes at 95°C (2°C / s ramp), 45 cycles of 10 seconds at 94°C (2°C / s ramp), 30 seconds at 59.2°C (2°C / s ramp), 1 minute 30 seconds at 72°C (0.2°C / s ramp), 1 cycle of 10 minutes at 98°C, and a hold at 4°C. Droplets were analyzed using a QX200 droplet reader (BioRad), and data were acquired and analyzed using QuantaSoft analysis software (BioRad).
[0366] P1 (mutant allele): TGGCAGGGCCCGGT (Sequence ID 63) P2 (wild-type allele): ACCGGGCTCTGCCAT (Sequence ID 72) F1:CCCAAGAACAGGGTTTGTTAAG (Sequence ID 64) R1:GGAATGCCATTGCGATTAG(Sequence ID 65) P3:AGCAGTTCTACCGTACAACCCTAACA (Sequence ID 66) F2:GGCAGTTGAGGTGGATTA(Sequence ID 67) R2:GGAATGCGGTAGTAGTTAGG (Sequence ID 68)
[0367] Genetically modified meganucleases were designed for the MIT 25-26 mutant sequence, and indel formation in both the mutant and wild-type sequences was evaluated at two mRNA doses. All five genetically modified meganucleases tested showed activity at the wild-type site at very high mRNA doses (500 ng) (Figure 3). MIT 25-26x.91 produced the fewest wild-type indels at 20%, while MIT 25-26x.48 produced the most wild-type indels at 44%. Regarding mutant recognition site cleavage, both MIT 25-26x.29 and MIT 25-26x.37 were highly active at low mRNA doses (5 ng), both producing 74% indels. From the set evaluated here, MIT 25-26x.91 appears to be the most specific.
[0368] Optimized meganucleases were designed for the MIT 25-26 mutant sequence and evaluated for indel formation in both the mutant and wild-type sequences at two mRNA doses, along with MIT 25-26x.91. Efficacy for the mutant sequence appeared relatively consistent between MIT 25-26x.91 and MIT 25-26L.35, while specificity for the wild-type sequence was significantly improved with MIT 25-26L.35. MIT 25-26x.91 induced 16% wild-type indels with 500 ng of MIT 25-26x.91 mRNA, while MIT 25-26L.35 induced only 2% indels (Figure 4).
[0369] In summary, these data indicate that a group of MIT 25-26 meganucleases are highly active and specific to the mutant MIT 25-26 site. Furthermore, they can be optimized to reduce remaining off-target (wild-type) editing.
[0370] Example 3: Mitochondrial localization The objective of this experiment was to visualize the localization of genetically modified meganucleases when the nuclear localization signal (NLS) on a protein is replaced with a mitochondrial localization peptide (MTP).
[0371] 6e5 MRC-5 cells were nucleofected with 600 ng of genetically engineered meganuclease mRNA using Lonza 4D-Nucleofector® (SE buffer, condition CM-150). Two genetically engineered meganuclease constructs were compared: both had NLS at the N-terminus of the protein, one and MTP. Twenty-four hours after nucleofection, cells were stained with 50 nM MitoTracker® Deep Red FM (ThermoFisher Scientific, M22426) for 30 minutes and then washed with PBS. Cells were then fixed with 4% PFA by HIER for 15 minutes and stained with DAPI and monoclonal genetically engineered meganuclease antibody (V34 Hu). Cells were imaged using a Zeiss microscope with 20× Z-stack images.
[0372] When fused with a nuclear localization sequence, genetically modified meganuclease staining appears diffuse throughout the cytoplasm and nucleus (Figure 5). However, when fused with a mitochondrial-transfer peptide, genetically modified meganuclease staining appears as punctate and overlaps with MitoTracker staining (Figure 6). When bound to MTP, nuclear localization of genetically modified meganuclease appears to be absent.
[0373] When NLS is replaced with MTP, the genetically modified meganuclease effectively localizes from the nucleus to the mitochondria.
[0374] Example 4: Nuclease activity using mitochondrial localization data The objective of this experiment was to determine whether mitochondrial-targeted genetically engineered meganuclease (MTEM) proteins reach the nucleus and induce double-strand breaks (DSBs) after mRNA nucleofection. While staining and imaging data from Example 1 suggested this should not be occurring, this experiment delved deeper into the molecular level to determine whether indels were being generated.
[0375] The genetically modified meganuclease used in this experiment was APC 11-12L.330, which possesses a nuclear target site (i.e., APC 11-12).
[0376] 6e5 MRC-5 cells were nucleofected with an equal number of genetically modified meganuclease mRNA copies using Lonza 4D-Nucleofector™ (SE buffer, condition CM-150). Three genetically modified meganuclease constructs were compared: one with an NLS, one without a targeting sequence, and one with a mitochondrial localization peptide (MTP). Because these different constructs produced mRNA of different lengths, the mRNA copy number was consistently maintained between transfections (5.8e11 copies). Cells were collected two days after nucleofection for gDNA extraction, and transfection efficiency was assessed using a Beckman Coulter CytoFlex S cytometer. Transfection efficiency exceeded 95%. gDNA was isolated using the Macherey Nagel NucleoSpin Blood QuickPure kit.
[0377] Digital droplet PCR (ddPCR) was used to determine the indel frequency at the APC 11-12 binding site by using P1, F1, and R1 to generate amplicons surrounding the binding site, and P2, F2, and R2 to generate a reference amplicon acting as a genome counter. The ratio of the two amplicons should be equal in the untreated population and decrease with respect to indel formation at the binding site in treated samples. Amplification was multiplexed in a 24 μL reaction mixture containing 1× ddPCR Supermix for Probes (without dUTP, BioRad), 250 nM probes, 900 nM primers, 20 U / μL Hind-III HF (NEB), and 120 ng of cellular gDNA. Droplets were generated using a QX100 droplet generator (BioRad). The cycle conditions were as follows: 1 cycle of 10 minutes at 95°C (2°C / s ramp), 45 cycles of 10 seconds at 94°C (2°C / s ramp), 30 seconds at 57.5°C (2°C / s ramp), 1 minute at 72°C (2°C / s ramp), 1 cycle of 10 minutes at 98°C, and a hold at 4°C. Droplets were analyzed using a QX200 droplet reader (BioRad), and data were acquired and analyzed using QuantaSoft analysis software (BioRad).
[0378] P1:AGCCCCGGGTACTCCTTGTT (Sequence No. 49) F1:TTCCTTGCAGGAACAGAG (Sequence ID 50) R1:CTGCTTGACCACCCATT(Sequence ID 51) P2:CCAGCAGGCCAGGTACACC (Sequence ID 52) F2:ACCGCCAAGGATGCAC (Sequence ID 53) R2:GCGGGTGGGAATGGAG (Sequence ID 54)
[0379] As shown in Figure 7, with NLS fused to the N-terminus, APC 11-12L.330 can generate 59% indels at its intended (nuclear) target site. In the absence of any targeting sequence, it can generate 42% indels at its intended target site. With MTP fused to a genetically modified meganuclease, it can still generate 23% indels at its intended target site.
[0380] Genetically modified meganucleases are small proteins that can diffuse into and out of the nucleus and induce indel formation even in the absence of NLS on the protein. This effect can be exacerbated by cellular nucleofection and cell membrane permeabilization, but can potentially be mitigated by the addition of nuclear export signals (NES).
[0381] Example 5: Nuclease activity by adding mitochondrial localization and nuclear export sequences. The objective of this experiment was to determine whether the addition of a nuclear export signal (NES) to genetically modified meganucleases eliminates nuclear indels.
[0382] The NES used in Figure 8 was rationally designed based on data from Kosugi et al. 2008 Traffic 12:2053-62. The NES amino acid sequence fused to the C-terminus of the genetically modified meganuclease was LGAGLGALGL (SEQ ID NO: 47). The NES used in Figures 9 and 10 was obtained from Minczuk et al. 2006 Proc Natl Acad Sci USA 103(52):19689-19694. The NES amino acid sequence fused to the C-terminus of the genetically modified meganuclease was VDEMTKKFGTLTIHDTEK (SEQ ID NO: 46).
[0383] The genetically modified meganuclease used in Figures 8 and 9 was APC 11-12L.330, which has a nuclear target site. The genetically modified meganuclease used in Figure 10 was MIT 25-26x.91, which does not have an endogenous nuclear target site. However, a mitochondrial sequence containing the binding site was introduced into the nuclear chromosomes of FlpIn 293 cells, and these are the cells evaluated in Figure 10 (site 0 is the nuclease binding site).
[0384] For experiments involving APC 11-12L.330, 6e5 MRC-5 cells were nucleofected with an equal number of genetically modified meganuclease mRNA copies using Lonza 4D-Nucleofector® (SE buffer, condition CM-150). In Figure 8, four meganuclease constructs were compared: one with NLS, one without a targeting sequence, one with mitochondrial localization peptide (MTP), and one with MTP and NES. In Figure 9, four genetically modified meganuclease constructs were compared: one with NLS, one with MTP, one with MTP and NES, and one with MTP and MVMp NS2 NES. Both NLS and MTP were fused to the N-terminus of their respective proteins, while NES was fused to the C-terminus. Because these different constructs produced mRNA of different lengths, the mRNA copy number remained constant between transfections (5.8e11 copies in the data in Figure 8, and 2.88e11 copies in the data in Figure 9). Cells were collected two days after nucleofection for gDNA extraction, and transfection efficiency was assessed using a Beckman Coulter CytoFlex S cytometer. Transfection efficiency exceeded 95%. gDNA was isolated using the Macherey Nagel NucleoSpin Blood QuickPure kit.
[0385] Digital droplet PCR (ddPCR) was used to determine the indel frequency at the APC 11-12 binding site by using P1, F1, and R1 to generate amplicons surrounding the binding site, and P2, F2, and R2 to generate a reference amplicon acting as a genome counter. The ratio of the two amplicons should be equal in the untreated population and decrease with respect to indel formation at the binding site in treated samples. Amplification was multiplexed in 24 μL of reaction mixture containing 1×ddPCR Supermix for Probes (without dUTP, BioRad), 250 nM probes, 900 nM primers, 20 U / μL Hind-III HF (NEB), and 120 ng of cellular gDNA. Droplets were generated using a QX100 droplet generator (BioRad). The cycle conditions were as follows: 1 cycle of 10 minutes at 95°C (2°C / s ramp), 45 cycles of 10 seconds at 94°C (2°C / s ramp), 30 seconds at 57.5°C (2°C / s ramp), 1 minute at 72°C (2°C / s ramp), 1 cycle of 10 minutes at 98°C, and a hold at 4°C. Droplets were analyzed using a QX200 droplet reader (BioRad), and data were acquired and analyzed using QuantaSoft analysis software (BioRad).
[0386] P1:AGCCCCGGGTACTCCTTGTT (Sequence No. 49) F1:TTCCTTGCAGGAACAGAG (Sequence ID 50) R1:CTGCTTGACCACCCATT(Sequence ID 51) P2:CCAGCAGGCCAGGTACACC (Sequence ID 52) F2:ACCGCCAAGGATGCAC (Sequence ID 53) R2:GCGGGTGGGAATGGAG (Sequence ID 54)
[0387] In experiments involving MIT 25-26x.91, FlpIn 293 cells were generated using the Flp-In™ system from ThermoFisher Scientific. The integration cassette contained the MIT 25-26 mutant binding site and the surrounding mtDNA sequence. Using a Neon electroporator, 1.8e12 copies of engineered Meganuclease mRNA were electroporated into 1.5e6 FlpIn 293 cells (Neon condition #11, 100uL tip). For gDNA extraction, cells were collected 2 days after electroporation and evaluated for transfection efficiency using a Beckman Coulter CytoFlex S cytometer. The transfection efficiency exceeded 95%. gDNA was isolated using the Macherey Nagel NucleoSpin Blood QuickPure kit.
[0388] To identify potential nuclear off-target site editing induced by the MIT 25-26x.91 nuclease, targeted amplicon sequencing was performed at...
Claims
1. A mitochondrial-targeting gene-modifying meganuclease (MTEM) that binds to and cleaves a recognition sequence containing Sequence ID No. 1 in the mitochondrial genome of eukaryotic cells, The aforementioned MTEM includes a genetically modified meganuclease bound to a mitochondrial-transfer peptide (MTP). The genetically modified meganuclease comprises a first subunit and a second subunit, The first subunit is bound to the first recognition semi-site of the recognition sequence and includes residues 7 to 153 of SEQ ID NO: 9, The second subunit is bound to the second recognition semi-site of the recognition sequence and includes residues 198-344 of SEQ ID NO: 9, The genetically modified meganuclease contains an amino acid sequence having at least 99% sequence identity with SEQ ID NO: 9, wherein the genetically modified meganuclease comprises an amino acid sequence having at least 99% sequence identity with SEQ ID NO:
9.
2. The MTEM according to claim 1, wherein the genetically modified meganuclease comprises the amino acid sequence of SEQ ID NO:
9.
3. The MTEM according to claim 1, wherein the MTP comprises the amino acid sequence described in SEQ ID NO: 45 and is bound to the N-terminus of the genetically modified meganuclease.
4. The MTEM according to claim 2, wherein the MTP comprises the amino acid sequence described in SEQ ID NO: 45 and is bound to the N-terminus of the genetically modified meganuclease.
5. The MTEM according to any one of claims 1 to 4, wherein the MTEM is bound to an extranuclear export sequence (NES) containing the amino acid sequence of SEQ ID NO: 46, and the NES is bound to the C-terminus of the MTEM.
6. Includes a nucleic acid sequence encoding MTEM, The aforementioned MTEM binds to and cleaves the recognition sequence consisting of Sequence ID No. 1 in the mitochondrial genome of eukaryotic cells. The aforementioned MTEM includes a genetically modified meganuclease bound to MTP, The genetically modified meganuclease comprises a first subunit and a second subunit, The first subunit is bound to the first recognition semi-site of the recognition sequence and includes residues 7 to 153 of SEQ ID NO: 9, The second subunit is bound to the second recognition semi-site of the recognition sequence and includes residues 198-344 of SEQ ID NO: 9, The genetically modified meganuclease is a polynucleotide comprising an amino acid sequence having at least 99% sequence identity with SEQ ID NO:
9.
7. The polynucleotide according to claim 6, wherein the genetically modified meganuclease comprises the amino acid sequence of SEQ ID NO:
9.
8. The polynucleotide according to claim 6, wherein the MTP comprises the amino acid sequence of SEQ ID NO: 45 and is bound to the N-terminus of the genetically modified meganuclease.
9. The polynucleotide according to claim 7, wherein the MTP comprises the amino acid sequence of SEQ ID NO: 45 and is bound to the N-terminus of the genetically modified meganuclease.
10. The polynucleotide according to any one of claims 6 to 9, wherein the MTEM is bound to an NES having the amino acid sequence of SEQ ID NO: 46, and the NES is bound to the C-terminus of the MTEM.
11. It contains polynucleotides that include nucleic acid sequences encoding MTEM, The aforementioned MTEM binds to and cleaves the recognition sequence consisting of Sequence ID No. 1 in the mitochondrial genome of eukaryotic cells. The aforementioned MTEM includes a genetically modified meganuclease bound to MTP, The genetically modified meganuclease comprises a first subunit and a second subunit, The first subunit is bound to the first recognition semi-site of the recognition sequence and includes residues 7 to 153 of SEQ ID NO: 9, The second subunit binds to the second recognition semi-site of the recognition sequence and includes residues 198-344 of SEQ ID NO: 9, The genetically modified meganuclease contains an amino acid sequence having at least 99% sequence identity with SEQ ID NO: 9, and Recombinant adeno-associated virus (AAV) comprising a promoter in which the polynucleotide is operably linked to the nucleic acid sequence encoding the MTEM.
12. The recombinant AAV according to claim 11, wherein the genetically modified meganuclease comprises the amino acid sequence of SEQ ID NO:
9.
13. The recombinant AAV according to claim 11, wherein the MTP comprises the amino acid sequence of SEQ ID NO: 45 and is bound to the N-terminus of the genetically modified meganuclease.
14. The recombinant AAV according to claim 12, wherein the MTP comprises the amino acid sequence of SEQ ID NO: 45 and is bound to the N-terminus of the genetically modified meganuclease.
15. The recombinant AAV according to any one of claims 11 to 14, wherein the MTEM is bound to an extranuclear export sequence (NES) containing the amino acid sequence of SEQ ID NO: 46, and the NES is bound to the C-terminus of the MTEM.
16. The recombinant AAV according to claim 11, wherein the recombinant AAV has an AAV9 capsid.
17. The recombinant AAV according to claim 13, wherein the recombinant AAV has an AAV9 capsid.
18. The recombinant AAV according to claim 15, wherein the recombinant AAV has an AAV9 capsid.
Citation Information
Patent Citations
Polypeptides targeting mitochondria
JP2009520488A
Cell organelle-localized fusion protein
JP2017209080A
Meganucleases engineered against recognition sequences found in the human T cell receptor alpha constant region gene
JP2018536390A
Genetic modification of mitochondrial genomes
WO2019183349A1