Cell culture product and use thereof

Abstract

Provided are a cell culture product and the use thereof. The cell culture product comprises a hepatic progenitor cell proliferation medium, containing a DMEM / F12 medium, insulin, transferrin, sodium selenite, nicotinamide, 2-phosphate-L-ascorbic acid, a human recombinant albumin, an epidermal cell growth factor, a glycogen synthase kinase 3 inhibitor, a transforming growth factor β receptor inhibitor, lysophosphatidic acid, and sphingosine phosphate.

Description

Cell culture products and their applications

[0001] Related applications

[0002] This application claims priority to Chinese patent application number: 2023106543373, entitled “Cell Culture Products and Applications Thereof,” filed on June 5, 2023, the entire text of which is hereby incorporated by reference. Technical Field

[0003] The present invention relates to the field of cell engineering, and in particular to a cell culture product and application thereof. Background Art

[0004] The liver is one of the body's most vital organs, performing crucial functions such as synthesis, detoxification, excretion, and biotransformation. End-stage liver disease (ESLD) refers to progressive, irreversible liver damage caused by various factors. Conventional medical and surgical treatments are incurable, the symptoms are severe, and death is expected within a short period (6-12 months). Under the influence of various inflammatory factors, most liver functions fail drastically, often accompanied by multiple high-risk complications, with a mortality rate as high as 50%-80%. According to statistics from the World Health Organization, approximately 2 billion people worldwide have been infected with the hepatitis B virus, of which 350 million are chronic carriers. Approximately 500,000 to 700,000 people die annually from liver failure, cirrhosis, and primary liver cancer caused by HBV infection. Allogeneic liver transplantation is currently considered the most effective treatment for ESLD, with long-term survival rates reaching 70%-85%. However, the limited number of liver donors far exceeds clinical demand. Reportedly, the mortality rate among patients awaiting liver transplantation is as high as 15%.

[0005] Tissue-specific stem / progenitor cells play a very important role in regulating organ formation, regeneration, and tissue homeostasis. In addition, these cells have broad application prospects in the treatment of various degenerative diseases and injuries. However, it is still technically challenging to directly isolate and culture most types of adult stem cells from tissues in vitro. In order to achieve cell therapy for liver disease, it is necessary to establish a renewable cell source of hepatocytes. In this context, stem cell-derived hepatocytes have good prospects. Embryonic stem cells (ESCs) are derived from the inner cell mass of the blastocyst during embryonic development. They have pluripotency and self-renewal ability, and are capable of differentiating into cells of the three germ layers of the body, including hepatocytes. They are "seed cells" in regenerative medicine research. If hepatocytes can be obtained by induction using embryonic stem cells, it can provide a wide range of cell sources for the clinical application of hepatocyte therapy.

[0006] Traditional technologies for inducing hepatocyte differentiation using embryonic stem cells include:

[0007] CN 105385651 B describes a method for inducing the directed differentiation of induced pluripotent stem cells into hepatocytes, comprising the following steps: step S1, providing or preparing induced pluripotent stem cells; step S2, a first stage of culturing for 3 to 6 days, wherein on days 1 to 2 of the first stage, the induced pluripotent stem cells are initially cultured in RPMI-1640 medium supplemented with human activin A and Wnt3a, and during subsequent culturing in the first stage, the RPMI-1640 medium supplemented with human activin A and fetal bovine serum is replaced to induce the differentiation of the induced pluripotent stem cells into the definitive endoderm; The concentration of human activin A in the RPMI-1640 medium supplemented with human activin A and Wnt3a is 100 ng / ml, and the concentration of Wnt3a is 25 ng / ml; the concentration of human activin A in the RPMI-1640 medium supplemented with human activin A and fetal bovine serum is 10-200 ng / ml, and the volume concentration of fetal bovine serum is 0.2-2%; in the first few days of induction, there are many dead cells. In order to prevent dead cells from affecting the induction process, the medium should be aspirated as much as possible when changing the medium and replaced with RPMI-1640 medium. 1640 wash one or two times, and then replace the culture medium; step S3, the second stage of culture, a total of 6-12 days, the first 1-4 days of the second stage, the cells cultured in step S2 are initially cultured in KO / DMEM medium supplemented with keratinocyte growth factor and fetal bovine serum, and in the subsequent culture process of the second stage, the KO / DMEM medium supplemented with serum replacement, L-glutamine, non-essential amino acids, β-mercaptoethanol and dimethyl sulfoxide is replaced to induce the cultured cells to differentiate into hepatocytes; the K medium supplemented with keratinocyte growth factor and fetal bovine serum The concentration of keratinocyte growth factor in the O / DMEM medium is 15-100 ng / ml, and the volume concentration of fetal bovine serum is 2-3%. The volume concentration of serum substitute in the KO / DMEM medium supplemented with serum substitute, L-glutamine, non-essential amino acids, β-mercaptoethanol and dimethyl sulfoxide is 20%, 1-3 mM L-glutamine, 0.1-15% non-essential amino acids, 0.1-0.12 mM β-mercaptoethanol, and 0.2-2%; during the second stage of culturing, the cell number changes significantly compared to the previous few days. At this time, culture medium should be added as appropriate according to the cell number to ensure normal cell growth; Step S4, in the third stage, the cells cultured in Step S3 are cultured in L-15 culture medium supplemented with fetal bovine serum, hepatocyte growth factor, oncostatin, dexamethasone and L-glutamine for 6-10 days to promote hepatocyte maturation, and the culture medium is replaced every 24 hours; the L-15 culture medium supplemented with fetal bovine serum, hepatocyte growth factor, oncostatin, dexamethasone and L-glutamine has a volume concentration of 10% fetal bovine serum, a concentration of 10-300 ng / ml of hepatocyte growth factor, a concentration of 5-150 ng / ml of oncostatin, a concentration of 0.05-1.2 μM of dexamethasone, and a concentration of 2-3 mM of L-glutamine; the entire induction process lasts 15-28 days. However, the traditional technical solution has a relatively long induction cycle, a small amount of cells obtained, and a high production cost.

[0008] In view of this, this application is hereby filed.

[0009] Summary of the Invention

[0010] Based on this, according to various embodiments of the present application, a cell culture product and its application are provided, and the technical solution is:

[0011] In a first aspect of the present application, a cell culture product is provided, comprising a hepatic progenitor cell proliferation medium, wherein the hepatic progenitor cell proliferation medium comprises DMEM / F12 medium and 1 μg / mL-8 μg / mL insulin, 5 μg / mL-15 μg / mL transferrin, 5 ng / mL-8 ng / mL sodium selenite, 3 mM-8 mM nicotinamide, 25 μg / mL-35 μg / mL 2-phospho-L-ascorbic acid, 45 μg / mL-55 μg / mL human recombinant albumin, 5 ng / mL-15 ng / mL epidermal growth factor, 1 μM-5 μM glycogen synthase kinase 3 inhibitor, 1 μM-3 μM transforming growth factor β receptor inhibitor, 2 μM-7 μM lysophosphatidic acid, and 0.2 μM-0.8 μM sphingosine phosphate.

[0012] In some embodiments, the hepatic progenitor cell proliferation medium comprises DMEM / F12 medium and 4.5 μg / mL-5.5 μg / mL insulin, 8 μg / mL-12 μg / mL transferrin, 6 ng / mL-7 ng / mL sodium selenite, 4.5 mM-5.5 mM nicotinamide, 29 μg / mL-32 μg / mL 2-phospho-L-ascorbic acid, 48 μg / mL-52 μg / mL human recombinant albumin, 7.5 ng / mL-12.5 ng / mL epidermal growth factor, 2.5 μM-4 μM glycogen synthase kinase 3 inhibitor, 1.5 μM-2.5 μM transforming growth factor β receptor inhibitor, 4.5 μM-6 μM lysophosphatidic acid and 0.45 μM-0.6 μM sphingosine phosphate.

[0013] In some embodiments, the cell culture product further comprises a differentiation induction medium A for inducing differentiation of human pluripotent stem cells into defined endoderm cells, or further comprises a differentiation induction medium B for inducing differentiation of the defined endoderm cells into hepatic progenitor cells;

[0014] Wherein, the differentiation induction medium A includes differentiation induction medium A1 and differentiation induction medium A2;

[0015] The differentiation induction medium A1 contains RPTM-1640 medium, 5 ng / mL-300 ng / mL human activin A and 2 μM-10 μM GSK-3 inhibitor;

[0016] The differentiation induction medium A2 contains RPTM-1640 medium, 10 ng / mL-200 ng / mL human activin A, and 0.2%-2% (v / v) fetal bovine serum.

[0017] In some embodiments, the differentiation induction medium B includes differentiation induction medium B1 and differentiation induction medium B2;

[0018] The differentiation induction medium B1 comprises KO / DMEM medium, 15 ng / mL-100 ng / mL keratinocyte growth factor, and 2%-3% (v / v) fetal bovine serum;

[0019] The differentiation induction medium B2 contains KO / DMEM medium, 10%-30% (v / v) serum replacement, 1mM-3mM L-glutamine, 0.1wt%-15wt% non-essential amino acids, 0.1mM-0.12mM β-mercaptoethanol and 0.2%-2% (v / v) dimethyl sulfoxide.

[0020] In some embodiments, the human pluripotent stem cells are human embryonic stem cells.

[0021] In some embodiments, the cell culture product further comprises an induction differentiation medium C for inducing hepatic progenitor cells to differentiate into hepatocyte-like cells, wherein the induction differentiation medium C comprises L-15 medium and 5%-15% (v / v) fetal bovine serum, 10 ng / mL-300 ng / mL hepatocyte growth factor, 1 ng / mL-150 ng / mL oncostatin, 0.05 μM-1.2 μM dexamethasone, 2 mM-3 mM L-glutamine and 5 μM-20 μM transforming growth factor β receptor inhibitor.

[0022] In a second aspect of the present application, a method for preparing hepatic progenitor cells or hepatocyte-like cells is provided, the method comprising the step of preparing hepatic progenitor cells or hepatocyte-like cells using the cell culture product described in the first aspect.

[0023] In some embodiments, the preparation method comprises the following steps:

[0024] Inducing differentiation of human pluripotent stem cells into endoderm cells using the differentiation induction medium A;

[0025] Inducing differentiation of the endoderm cells into hepatic progenitor cells using the differentiation induction medium B;

[0026] Proliferating and culturing the hepatic progenitor cells using the hepatic progenitor cell proliferation medium; and,

[0027] The induced differentiation medium C is used to induce the induced hepatic progenitor cells to differentiate into hepatocyte-like cells.

[0028] In some embodiments, the step of culturing the hepatic progenitor cells using the hepatic progenitor cell proliferation medium comprises:

[0029] Initially culturing the hepatic progenitor cells using the hepatic progenitor cell proliferation medium, enzymatically digesting the obtained initial culture to prepare single cells; and,

[0030] The single cell is inoculated into fresh hepatic progenitor cell proliferation medium for subculture.

[0031] In some embodiments, the preparation method has one or more of the following technical features:

[0032] (1) The initial culture time is 0.5-1.5 days;

[0033] (2) The enzyme used for enzymatic digestion was TrypLE;

[0034] (3) The seeding density of the single cells was 1×10 4 pieces / cm 2-5×10 4 pieces / cm 2 ;and,

[0035] (4) The number of generations of subculture is 1 to 5, the culture time of each generation is 120h-168h, and the culture medium is replaced every 24h-48h.

[0036] The details of one or more embodiments of the present application are set forth in the description below, and other features, objects, and advantages of the application will become apparent from the description and from the claims thereof. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the conventional technology, the following briefly introduces the drawings required for use in the embodiments or the conventional technology descriptions. Obviously, the drawings described below are merely embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on the disclosed drawings without any creative work.

[0038] FIG1 is a morphological diagram of hESCs at different confluences during culture in Example 1 of the present invention;

[0039] FIG2 is a flow cytometry analysis of pluripotency-related surface markers in hESCs in Example 1 of the present invention;

[0040] FIG3 is a schematic diagram of the detection of pluripotency-related gene expression in hESCs in Example 1 of the present invention;

[0041] FIG4 shows the morphological changes of human pluripotent stem cells at various stages in Example 1 of the present invention;

[0042] FIG5 shows the expression of the restricted endoderm marker genes at the restricted endoderm stage in Example 1 of the present invention;

[0043] FIG6 shows the expression of marker genes of hepatic progenitor cells at the hepatic progenitor stage in Example 1 of the present invention;

[0044] FIG7 shows the expression of marker genes of hepatic progenitor cells at the hepatic progenitor stage in Example 1 of the present invention;

[0045] FIG8 shows the expression of hepatocyte marker genes obtained at the final stage in Example 1 of the present invention;

[0046] FIG9 is an immunofluorescence staining diagram of AFP and ALB in Example 1 of the present invention;

[0047] FIG10 is the detection result of Oil Red staining in Example 1 of the present invention;

[0048] FIG11 is an ICG endocytosis and exocytosis experiment in Example 1 of the present invention;

[0049] FIG12 shows that hESCs-derived hepatocytes have the ability to synthesize glycogen in Example 1 of the present invention;

[0050] FIG13 shows that hESCs-derived hepatocytes have the ability to take up low-density lipoprotein in Example 1 of the present invention;

[0051] FIG14 is a comparison of indicators of the definitive endoderm induction stage by the method of Example 1 of the present invention and the conventional method;

[0052] FIG15 is a comparison of markers of hepatic precursors induced by the method of Example 1 of the present invention and conventional methods;

[0053] FIG16 is a comparison of hepatocyte markers induced at the mature stage by the method of Example 1 of the present invention and conventional methods. DETAILED DESCRIPTION

[0054] The following will be combined with the drawings in the embodiments of this application to clearly and completely describe the technical solutions in the embodiments of this application. Obviously, the embodiments described are only part of the embodiments of this application, not all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of this application.

[0055] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application pertains. The terms used herein in the specification of this application are for the purpose of describing specific embodiments only and are not intended to limit this application.

[0056] the term

[0057] Unless otherwise specified or incompatible herewith, the terms and phrases used herein shall have the following meanings:

[0058] The present invention will be further described in detail below in conjunction with the accompanying drawings, embodiments and examples. It should be understood that these embodiments and examples are only used to illustrate the present invention and are not used to limit the scope of the invention. The purpose of providing these embodiments and examples is to make the understanding of the disclosure of the present invention more thorough and comprehensive. It should also be understood that the present invention can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various changes or modifications without violating the connotation of the present invention, and the equivalent forms obtained also fall within the protection scope of this application. In addition, in the description below, a large amount of specific details are given in order to provide a more complete understanding of the present invention. It should be understood that the present invention can be implemented without one or more of these details.

[0059] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing embodiments and examples and are not intended to limit the present invention.

[0060] the term

[0061] Unless otherwise specified or incompatible herewith, the terms and phrases used herein shall have the following meanings:

[0062] The terms "and / or", "or / and", and "and / or" used herein include any one of two or more related listed items, and also include any and all combinations of the related listed items, wherein the arbitrary and all combinations include any combination of two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical and" and also undoubtedly includes technical solutions connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution of all being connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the four-item combination of A, B, C, and D (that is, the technical solution of all being connected by "logical AND").

[0063] In the present invention, "plurality", "multiple", "multiple times", "multiple", etc., unless otherwise specified, refer to a number greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0064] As used herein, "combination thereof", "any combination thereof", "any combination thereof" and the like include all suitable combinations of any two or more of the listed items.

[0065] Herein, the “suitable” mentioned in “suitable combination”, “suitable method”, “any suitable method”, etc. shall be based on the ability to implement the technical solution of the present invention, solve the technical problem of the present invention, and achieve the expected technical effect of the present invention.

[0066] Herein, “preferred”, “better”, “more preferred” and “suitable” are merely used to describe implementation methods or examples with better effects. It should be understood that they do not constitute limitations on the scope of protection of the present invention.

[0067] In the present invention, “further”, “further”, “particularly”, etc. are used for descriptive purposes to indicate differences in content, but should not be understood as limiting the scope of protection of the present invention.

[0068] In the present invention, the terms "optionally," "optional," and "optional" mean optional or dispensable, i.e., they refer to either option being selected from two parallel options: "with" or "without." If a technical solution contains multiple "optional" clauses, each "optional" clause is independent unless otherwise specified and there are no conflicts or constraints.

[0069] In the present invention, the terms "first," "second," "third," and "fourth," etc., in "the first aspect," "the second aspect," "the third aspect," and "the fourth aspect," etc., are used for descriptive purposes only and should not be understood as indicating or implying relative importance or quantity, nor as implicitly indicating the importance or quantity of the technical features indicated. Furthermore, "first," "second," "third," and "fourth," etc., serve only as non-exhaustive enumeration and description and should be understood not to constitute a closed-ended limitation on quantity.

[0070] In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0071] In the present invention, when referring to a numerical interval (i.e., a numerical range), unless otherwise specified, the optional numerical distribution is considered continuous within the above numerical interval and includes the two numerical endpoints of the numerical range (i.e., the minimum value and the maximum value), as well as each numerical value between the two numerical endpoints. Unless otherwise specified, when a numerical interval refers only to integers within the numerical interval, it includes the two endpoint integers of the numerical range, as well as each integer between the two endpoints. In this article, it is equivalent to directly listing each integer, such as t is an integer selected from 1 to 10, indicating that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges included therein.

[0072] The temperature parameters in the present invention, unless otherwise specified, may be either constant temperature or fluctuating within a certain temperature range. It should be understood that the constant temperature treatment allows for temperature fluctuations within the precision range of the instrument control. Fluctuations within ranges such as ±5°C, ±4°C, ±3°C, ±2°C, and ±1°C are permitted.

[0073] In the present invention, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass volume percentage.

[0074] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as a reference separately. Unless they conflict with the invention purpose and / or technical solution of this application, the cited documents involved in this invention are cited with all their contents and all their purposes. When the present invention involves cited documents, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited. When the present invention involves cited documents, the examples and preferred embodiments of the cited relevant technical features may also be incorporated into this application as references, but are limited to the ability to implement the present invention. It should be understood that when the cited content conflicts with the description in this application, the present application shall prevail or be modified adaptively according to the description in this application.

[0075] The first aspect of the present application

[0076] The present application provides a cell culture product, which includes a hepatic progenitor cell proliferation medium, wherein the hepatic progenitor cell proliferation medium contains DMEM / F12 medium and 1 μg / mL-8 μg / mL insulin, 5 μg / mL-15 μg / mL transferrin, 5 ng / mL-8 ng / mL sodium selenite, 3 mM-8 mM nicotinamide, 25 μg / mL-35 μg / mL 2-phospho-L-ascorbic acid, 45 μg / mL-55 μg / mL human recombinant albumin, 5 ng / mL-15 ng / mL epidermal growth factor, 1 μM-5 μM glycogen synthase kinase 3 inhibitor, 1 μM-3 μM transforming growth factor β receptor inhibitor, 2 μM-7 μM lysophosphatidic acid and 0.2 μM-0.8 μM sphingosine phosphate.

[0077] In the hepatic progenitor cell proliferation culture medium of the present application, the concentration of insulin is, for example, 1, 2, 3, 4, 5, 6, 7, 8 μg / mL; the concentration of transferrin is, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 μg / mL; the concentration of sodium selenite is, for example, 5, 5.5, 6, 6.5, 7, 7.5, 8 ng / mL; the concentration of nicotinamide is, for example, 3, 4, 5, 6, 7, 8 mM; the concentration of 2-phospho-L-ascorbic acid is, for example, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 μg / mL; the concentration of human recombinant albumin is, for example, 45, 46, 47, 48, 49 , 50, 51, 52, 53, 54, 55 μg / mL; the concentration of epidermal growth factor is, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 ng / mL; the concentration of glycogen synthase kinase 3 inhibitor is, for example, 1, 2, 3, 4, 5 μM; the concentration of transforming growth factor β receptor inhibitor is, for example, 1, 1.2, 1.4, 1.6, 1.8, 2, 2.2, 2.4, 2.6, 2.8, 3 μM; the concentration of lysophosphatidic acid is, for example, 2, 3, 4, 5, 6, 7 μM; the concentration of sphingosine phosphate is, for example, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8 μM.

[0078] Optionally, the hepatic progenitor cell proliferation medium comprises DMEM / F12 medium and 4.5 μg / mL-6 μg / mL insulin, 8 μg / mL-12 μg / mL transferrin, 6 ng / mL-8 ng / mL sodium selenite, 4.5 mM-6.5 mM nicotinamide, 29 μg / mL-35 μg / mL 2-phospho-L-ascorbic acid, 45 μg / mL-52 μg / mL human recombinant albumin, 7.5 ng / mL-12.5 ng / mL epidermal growth factor, 2.5 μM-4 μM glycogen synthase kinase 3 inhibitor, 1.5 μM-2.5 μM transforming growth factor β receptor inhibitor, 2 μM-6 μM lysophosphatidic acid and 0.4 μM-0.6 μM sphingosine phosphate.

[0079] Optionally, the cell culture product further comprises a differentiation induction medium A for inducing differentiation of human pluripotent stem cells into defined endoderm cells, or further comprises a differentiation induction medium B for inducing differentiation of the defined endoderm cells into hepatic progenitor cells;

[0080] Wherein, the differentiation induction medium A includes medium A1 and medium A2;

[0081] The culture medium A1 comprises RPTM-1640 culture medium and 5 ng / mL-300 ng / mL (e.g., 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 ng / mL) of human activin A and 2 μM-10 μM (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 μM) of GSK-3 inhibitor;

[0082] The culture medium A2 comprises RPTM-1640 culture medium and 10 ng / mL-200 ng / mL (e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200 ng / mL) of human activin A and 0.2%-2% (e.g., 0.2%, 0.4%, 0.8%, 1.0%, 1.2%, 1.4%, 1.6%, 1.8%, 2%) (v / v) fetal bovine serum.

[0083] This application does not specifically limit the type of GSK-3 inhibitor, including but not limited to CHIR99021. CHIR99021 replaces Wnt3a in traditional induction systems, improving induction efficiency. CHIR99021 is priced much lower than Wnt3a, saving production costs. In addition, the addition of SB431542 during the terminal induction stage can improve the maturity of hepatocytes, increase the expression efficiency of ALB, and bring the expression level closer to that of mature hepatocytes. It can also shorten the time it takes for hepatic progenitor cells to differentiate into hepatocyte-like cells.

[0084] Optionally, the differentiation induction medium B includes differentiation induction medium B1 and differentiation induction medium B2;

[0085] The differentiation induction medium B1 comprises KO / DMEM medium and 15 ng / mL-100 ng / mL (for example, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 ng / mL) of keratinocyte growth factor and 2%-3% (for example, 2%, 2.2%, 2.4%, 2.6%, 2.8%, 3%) (v / v) of fetal bovine serum;

[0086] The differentiation induction medium B2 comprises KO / DMEM medium and 10%-30% (e.g., 10%, 12%, 14%, 16%, 18%, 20%, 22%, 24%, 26%, 28%, 30%) (v / v) serum replacement, 1mM-3mM (e.g., 1, 1.2, 1.4, 1.6, 2.0, 2.2, 2.4, 2.6, 2.8, 3mM) L-glutamine, 0.1wt%-15wt% ( For example, 0.1, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 wt%) non-essential amino acids, 0.1 mM-0.12 mM (for example, 0.1, 0.11, 0.12 mM) β-mercaptoethanol and 0.2%-2% (for example, 0.2%, 0.4%, 0.6%, 0.8%, 1%, 1.2%, 1.4%, 1.6%, 1.8%, 2%) (v / v) dimethyl sulfoxide.

[0087] Alternatively, the human pluripotent stem cells are human embryonic stem cells. Human embryonic stem cells (hESCs) are isolated from the inner cell mass of the blastocyst during embryonic development. They are a type of pluripotent cell with pluripotency and self-renewal ability that can be infinitely passaged in vitro. In vitro and in vivo environments, human embryonic stem cells have the potential to be induced to differentiate into almost all cell types of the body, including hepatocytes. They are the "seed cells" in regenerative medicine research. The hepatocytes derived from human embryonic stem cells simulate the formation process of liver lineage cells during differentiation. The hepatocytes derived from human embryonic stem cells are good materials for studying liver development and conducting hepatocyte research. In addition, the hepatocytes obtained through human embryonic stem cell induced culture also have broad application prospects in drug screening and drug metabolism research.

[0088] Optionally, the cell culture product further comprises an induction differentiation medium C for inducing hepatic progenitor cells to differentiate into hepatocyte-like cells, wherein the induction differentiation medium C comprises L-15 medium and 5%-15% (e.g., 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15% (v / v) fetal bovine serum, 10 ng / mL-300 ng / mL (e.g., 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 ng / mL) hepatocyte growth factor, 1 ng / mL-150 ng / mL (e.g., 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150 ng / mL) oncostatin, 0.05 μM-1.2 μM (e.g., 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2 μM) dexamethasone, 2 mM-3 mM (e.g., 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3 mM) L-glutamine, and 5 μM-20 μM (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 μM) transforming growth factor beta receptor inhibitor.

[0089] The second aspect of this application

[0090] The present application provides a method for preparing hepatic progenitor cells or hepatocyte-like cells, which comprises the steps of preparing hepatic progenitor cells or hepatocyte-like cells using the cell culture product described in the first aspect.

[0091] Optionally, the preparation method comprises the following steps:

[0092] Inducing differentiation of human pluripotent stem cells into endoderm cells using the differentiation induction medium A;

[0093] Inducing differentiation of the endoderm cells into hepatic progenitor cells using the differentiation induction medium B;

[0094] Proliferating and culturing the hepatic progenitor cells using the hepatic progenitor cell proliferation medium; and,

[0095] The induced differentiation medium C is used to induce the induced hepatic progenitor cells to differentiate into hepatocyte-like cells.

[0096] The present application adopts a multi-stage directional induced differentiation technology, which replaces some factors with small molecules, further improves the efficiency of induced differentiation and shortens the time of the maturation stage, and can greatly improve the yield of terminal hepatocyte induction by passage by increasing the hepatic progenitor expansion stage, saving production costs, greatly increasing cell yield, and reducing the demand for starting seed cells. Furthermore, cells can be frozen at the hepatic progenitor cell stage and then induced later when needed, which increases the flexibility of the induction time and shortens the cell preparation time. In addition, the expansion of the starting seed cell human pluripotent stem cell adopts a feeder-free (feeder layer cell) animal-derived component culture system. By adding the induction culture medium of the corresponding stage, hepatic progenitor cells and hepatocytes can be obtained. The obtained hepatocytes have stable performance, and after testing, the purity is high, and there is no problem of feeder layer cell contamination.

[0097] Optionally, the step of proliferating and culturing the hepatic progenitor cells using the hepatic progenitor cell proliferation medium comprises:

[0098] Initially culturing the hepatic progenitor cells using the hepatic progenitor cell proliferation medium, enzymatically digesting the obtained initial culture to prepare single cells; and,

[0099] The single cell is inoculated into fresh hepatic progenitor cell proliferation medium for subculture.

[0100] Optionally, the preparation method has one or more of the following technical features:

[0101] (1) The initial culture time is 0.5 to 1.5 days (e.g., 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5 days);

[0102] (2) The enzyme used for enzymatic digestion was TrypLE;

[0103] (3) The seeding density of the single cells was 1×10 4 pieces / cm 2 -5×10 4 pieces / cm 2 ;and,

[0104] (4) The number of generations of subculture is 1 to 5 (for example, 1, 2, 3, 4, and 5 generations), the culture time for each generation is 120 h to 168 h (for example, 120, 125, 130, 135, 140, 145, 150, 160, 165, and 168 h), and the culture medium is replaced every 24 h to 48 h (for example, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, and 48). The embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. For experimental methods in the following examples where specific conditions are not specified, reference should be made to the instructions given in the present invention, or to the experimental manuals or conventional conditions in the art, or to the conditions recommended by the manufacturer, or to experimental methods known in the art.

[0105] In the following specific examples, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument testing accuracy or operational accuracy are allowed.

[0106] The following is a specific embodiment:

[0107] Example 1

[0108] 1. Reagents and equipment used

[0109] 1. hESCS (human embryonic stem cells): Select clinical-grade 90-line human embryonic stem cells established by the National Engineering Research Center for Human Stem Cells.

[0110] 2. Cell culture reagents:

[0111] Human activin A (R&D, 338-AC-050, R&D Systems, catalog number 338-AC-050, the same applies below), Wnt3a (R&D, 1324-WN-010), fetal bovine serum (Gibico, 10099-141), keratinocyte growth factor (KGF) (R&D, 251-KG-050), insulin-transferrin-sodium selenite (ITS) (Sigma, I1884), nicotinamide (Sigma, L72 60), 2-phospho-L-ascorbic acid (Sigma, 49752), human recombinant albumin (Sigma, A9731), epidermal growth factor (EGF) (Sigma, 236-GMP), glycogen synthase kinase 3 inhibitor (CHIR99021) (Sigma, SML1046), transforming growth factor β receptor inhibitor (SB431542) (Sigma, S4317), lysophosphatidic acid (LPA) (Sigma, L7260) and sphingosine phosphate (S1P) (Sigma, 73914), TrypLE (Gibco, A1285901), serum replacement (Life, N10828-028), L-glutamine (Gibco, 25030-081), non-essential amino acids (Gibco, 1140-050), β-mercaptoethanol (Gibco, 21385-023), dimethyl sulfoxide (DMSO) (Sigma, D2660), hepatocyte growth factor ( HGF) (R&D, 294-HG-025), oncostatin (OSM) (R&D, 295-OM-050), dexamethasone (Calbiochem, 265005), RPTM-1640 (Life, 11875-085), KO / DMEM (Gibco, A1286101), L-15 (Gibco, 21083-027), LN-521 (BioLamina, LN521), NutriStem hESC xeno-free (XF) medium (Biological Industries, 05-100-1A).

[0112] 2. Specific induction and identification process

[0113] (1) Culture of human pluripotent stem cells

[0114] After resuscitation, the human pluripotent stem cell line was inoculated into a culture flask pre-coated with LN521 matrix. NutriStem hESC xeno-free (XF) medium was replaced daily. The cells were passaged every three days. After three passages, when the human pluripotent stem cells were in optimal growth condition, the induction medium was replaced.

[0115] Once human pluripotent stem cells are detected to have pluripotency-related gene expression, they can be used for the next step of the experiment. Specific tests are as follows:

[0116] 1. Detection of pluripotency-related genes

[0117] Undifferentiated hESCs were collected and RNA was extracted for detection of pluripotency-related genes or differentiation genes. The method is as follows:

[0118] 1) RNA extraction:

[0119] Collect the appropriate cells and lyse them by adding 1 mL of TRIZOL. Add 0.2 mL of chloroform per 1 mL of TRIZOL and incubate at room temperature for 2-3 minutes. Perform high-speed refrigerated centrifugation at 12,000 × g for 15 minutes at 4°C. After centrifugation, the mixture will separate into three layers, with RNA present in the aqueous layer. Transfer the aqueous layer to a clean test tube. Add 0.5 mL of isopropanol and mix thoroughly. Incubate the mixed sample at room temperature for 10 minutes and perform high-speed refrigerated centrifugation at no more than 12,000 × g for 10 minutes at 4°C. Remove the upper suspension. Wash the RNA pellet once with 75 v / v% (i.e., 75% ethanol by volume, similarly) ethanol and perform high-speed refrigerated centrifugation at no more than 7,500 × g for 5 minutes at 2-8°C. Briefly dry the RNA pellet (air dry for 5-10 minutes). Dissolve it in RNase-free DEPC water. After complete dissolution, measure the RNA concentration using a UV spectrophotometer.

[0120] 2) Reverse transcription (RT) synthesis of cDNA:

[0121] Adopt A RevertAid TM First-strand cDNA synthesis kit (Fermentas Life Sciences) was used according to the manufacturer's instructions. The following steps were used: 1 μg of total RNA was added to 1 μL of oligo(dT) primer. RNase-free water was added to a final reaction volume of 12 μL in an EP tube. The reaction was denatured at 70°C for 5 minutes and quickly cooled on ice. Then, 4 μL of 5× reverse transcription buffer, 2 μL of 10 mM dNTPs, and 1 μL of RNase inhibitor were added, followed by gentle mixing and rapid centrifugation. The reaction was incubated at 25°C for 5 minutes. Finally, 1 μL of AMV reverse transcriptase was added to a final reaction volume of 20 μL. The reaction was incubated at 25°C for 10 minutes, 42°C for 60 minutes, and 70°C for 10 minutes. The resulting cDNA was stored at -20°C or used to amplify the target gene through PCR.

[0122] PCR amplification was performed using RNA as a template and commonly used β-actin primers to ensure that there was no gDNA contamination.

[0123] RT-PCR was then performed using the cDNA as a template to detect the expression of pluripotency-associated genes OCT3 / 4, NANOG, and SOX2; the restrictive endoderm marker genes SOX17 and FoxA2; the hepatic precursor and progenitor stage genes AFP, HNF4α, and CK7; the hepatocyte maturation marker genes ALB and AAT; or genes representing the three germ layer differentiation. β-actin was used as a positive control for the reaction system. PCR reaction conditions were: 95°C for 1 minute and 30 seconds; 30 cycles (94°C for 40 seconds, 54°C-64°C for 40 seconds, and 72°C for 40 seconds); and extension at 72°C for 7 minutes.

[0124] (II) Large-scale directed differentiation culture of liver cells derived from human embryonic stem cells

[0125] 1. Recovery of human pluripotent stem cells: Remove cells from the liquid nitrogen tank and immediately thaw in a 37°C constant temperature water bath. Centrifuge and discard the supernatant. Resuspend the cell pellet in NutriStem hESC xeno-free (XF) medium and inoculate into culture flasks pre-coated with LN521 matrix. Change the medium daily and passage the cells every three days.

[0126] 2. Culture of human pluripotent stem cells: After testing to confirm the absence of mycoplasma and bacterial contamination, digest the cells with Tryple digestive enzyme, remove the supernatant after centrifugation, resuspend the cells in NutriStem hESC xeno-free (XF) medium, and inoculate the cells into culture flasks pre-coated with LN521 matrix. After passage, change the medium every 24 hours and observe the cell growth daily.

[0127] 3. Induction and differentiation of human pluripotent stem cells: After three passages, when the human pluripotent stem cells are in optimal growth condition, replace the induction medium. The specific induction process is as follows:

[0128] The first stage (3 days) is to induce human pluripotent stem cells into the definitive endoderm:

[0129] On day 1, the induction medium (differentiation induction medium A1) was prepared by adding human activin A and glycogen synthase kinase 3 inhibitor (CHIR99021) to the basal medium RPTM-1640. The concentrations of human activin A and glycogen synthase kinase 3 inhibitor (CHIR99021) were 100 ng / mL and 6 μM, respectively.

[0130] On day 2, the induction medium (differentiation induction medium A2) was prepared by adding human activin A and fetal bovine serum to the basal medium RPTM-1640, with a final concentration of human activin A of 100 ng / mL and a final concentration of fetal bovine serum of 2% (v / v).

[0131] On day 3, the induction medium (differentiation induction medium A2) was prepared by adding human activin A and fetal bovine serum to the basal medium RPTM-1640, with a final concentration of human activin A of 100 ng / mL and a final concentration of fetal bovine serum of 2% (v / v).

[0132] There are many dead cells in the first few days of induction. In order to prevent dead cells from affecting the induction process, the culture medium should be aspirated as clean as possible and washed one or two times with RPIM-1640 before replacing the culture medium.

[0133] The second stage (7 days) is directed differentiation towards the liver lineage:

[0134] The culture medium used for the first two days of the second phase (differentiation induction medium B1) consists of KO / DMEM basal medium supplemented with 50 ng / mL keratinocyte growth factor and a final concentration of 2% (v / v) fetal bovine serum. During the second phase of culture, the cell population will vary significantly compared to the previous days. During this time, additional culture medium should be added based on the cell population to ensure normal cell growth.

[0135] The culture medium for the next 5 days (differentiation induction medium B2) consisted of a basal medium KO / DMEM supplemented with serum replacement (SR), L-glutamine, non-essential amino acids, β-mercaptoethanol, and dimethyl sulfoxide. The culture medium was changed every 24 hours. The final concentrations of serum replacement, L-glutamine, non-essential amino acids, β-mercaptoethanol, and dimethyl sulfoxide were 20% (v / v), 1 mM, 1% (v / v), 0.1 mM, and 1% (v / v).

[0136] The third stage (5 days) is the hepatic progenitor cell proliferation stage (using hepatic progenitor cell proliferation medium):

[0137] In the third stage, the cells were cultured for 1 day using the basal medium DMEM / F12 supplemented with insulin-transferrin-sodium selenite (ITS), nicotinamide, 2-phospho-L-ascorbic acid, human recombinant albumin, epidermal growth factor (EGF), glycogen synthase kinase 3 inhibitor (CHIR99021), transforming growth factor β receptor inhibitor (SB431542), lysophosphatidic acid (LPA), and sphingosine phosphate (S1P). The cells were then digested into single cells using TrypLE and plated at 1×10 4 -5×10 4 pieces / cm 2Continue culturing for 4 days, and change the culture medium every 24 hours during subsequent culture. At this stage, cells can also be digested and passaged for 1-5 generations using Tryple digestion enzyme. After the cells are expanded to a certain number, the resulting hepatocyte progenitor cells can be frozen in CS10 for later use. When cells are urgently needed, the hepatocyte progenitor cells can be thawed and only maturation induction is required to obtain hepatocytes. This can greatly shorten the induction time. Hepatocyte maturation induction can also be performed directly without freezing at this stage.

[0138] The final concentration of insulin was 6 μg / mL, the final concentration of transferrin was 12 μg / mL, the final concentration of sodium selenite was 8 ng / mL, the final concentration of nicotinamide was 6 mM, the final concentration of 2-phospho-L-ascorbic acid was 35 μg / mL, the final concentration of human recombinant albumin was 45 μg / mL, the final concentration of epidermal growth factor (EGF) was 12 ng / mL, the final concentration of glycogen synthase kinase 3 inhibitor (CHIR99021) was 3 μM, the final concentration of transforming growth factor β receptor inhibitor (SB431542) was 2.5 μM, the final concentration of lysophosphatidic acid (LPA) was 2 μM, and the final concentration of sphingosine phosphate (S1P) was 0.4 μM.

[0139] The fourth stage (5 days) is to promote the maturation of liver cells:

[0140] The culture medium (differentiation induction medium C) is prepared by adding bovine serum, hepatocyte growth factor, oncostatin, dexamethasone, L-glutamine, and transforming growth factor β receptor inhibitor to the basal medium L-15. The culture medium is replaced every 24 hours. The final concentration of fetal bovine serum is 10%, the final concentration of hepatocyte growth factor is 10 ng / mL, the final concentration of oncostatin is 20 ng / mL, the final concentration of dexamethasone is 0.05 μM, the final concentration of L-glutamine is 2 mM, and the concentration of transforming growth factor β receptor inhibitor is 12 μM.

[0141] The preparation method of the present application efficiently expands cells at the liver progenitor stage: first, it increases the yield of liver-like cells obtained at the end of each batch; second, it reduces the demand for the amount of seed cells for initial induction; third, the amplified liver progenitor stage cells can be frozen to establish a liver progenitor cell bank. During production, the liver progenitor cells can be directly thawed and directly induced to differentiate into hepatocyte-like cells after passage and amplification. Only 5-7 days of subsequent maturation induction are required, which greatly shortens the cycle of liver cell preparation and makes liver cell preparation more efficient. On the other hand, small molecules are used to replace some cytokines, which greatly reduces the production cost of cell preparation and improves the quality of liver cells.

[0142] (III) Identification of hepatocytes

[0143] 1. Observation of cell differentiation during induction process:

[0144] From the beginning of human pluripotent stem cell recovery, cells were observed daily under a microscope for growth, attachment, and differentiation. hESCs have a high nuclear-to-cytoplasmic ratio and are densely packed. Figure 1 shows the morphology of hESCs at different confluences. Following induction, cells begin to undergo morphological changes. After three days of induction, cells enter the definitive endoderm stage, becoming flat and oval. After the second stage of induction, cells begin to specialize into hepatocytes, becoming polygonal with distinct boundaries. The third stage is the hepatocyte progenitor stage, with smaller polygonal cells and accelerated growth. In the fourth stage, cells enter the mature hepatocyte stage, with denser colonies, larger cells, and a cuboidal shape. The cytoplasm is abundant, with one or more nuclei and prominent nucleoli. As shown in Figure 4, the morphological changes at each stage show that the resulting cells more closely resemble hepatocytes.

[0145] 2. Flow cytometry

[0146] Direct labeled flow cytometry was used to detect the expression of pluripotency-related proteins in hESCs. Collect cells, discard supernatant, add 2 mL of 1% FBS buffer, gently pipette to resuspend cells, centrifuge at 300g for 5 minutes, and remove supernatant; dilute TRA-1-81 (BD, 560884), SSEA1 (BD, 560127), SSEA4 (BD, 560126) flow cytometry antibodies and corresponding isotype control antibodies (BD, 555584, 555578, 553474) with 1% FBS buffer, each antibody volume is 100 μL, add to the sample tube to be tested, add the antibody to be tested to one tube and the isotype control to the other tube, mix with cells thoroughly, incubate at 2-8℃ in the dark for 30 minutes; add 1 mL of 1% FBS buffer to wash cells twice, centrifuge at 300g for 5 minutes, and remove supernatant; add 300 μL of 1% FBS buffer to each sample tube to resuspend cells, protect from light, and filter; select the corresponding fluorescence channel according to the fluorescence information of the flow cytometry antibody label, and place in BD Accuri Experimental results were analyzed using a C6 instrument. For SOX2 detection, cells were harvested and 0.2 mL of Fixation / Permeabilization solution (BD, cat. no. 51-2090KZ - 125 mL) was added and thoroughly mixed. Fixation / permeabilization was performed at 4°C in the dark for 20 minutes, followed by centrifugation at 300 g for 5 minutes and the supernatant discarded. Cells were washed twice with 1 mL of Perm / Wash Buffer (BD, cat. no. 554723 - 100 mL) directly into the centrifuge tube, centrifuged at 300 g for 5 minutes, and the supernatant discarded. The cells were then assayed using a SOX2 (BD, 561593) flow cytometry antibody and a corresponding isotype control antibody (BD, 557721). Figure 2 shows flow cytometry analysis of hESC pluripotency-associated surface markers. The results indicate that hESCs specifically and highly express the human pluripotency-associated proteins TRA-1-81, SSEA4, and SOX2, but do not express SSEA1, meeting hESC identification criteria.

[0147] 3. RT-QPCR:

[0148] hESCs were collected before the initial induction and on the last day of each induction phase for testing. RNA was extracted using TRIzol. Reverse transcription was performed using a reverse transcription kit according to the manufacturer's instructions, with each sample containing 1 μg of RNA. The PCR reaction system consisted of 0.2 μL of cDNA, 10 μL of PCR Green Mix, 7.8 μL of water, and 1 μL each of 1 μM forward and reverse primers. The sequences of the verified primer pairs are shown in SEQ ID NOs. 1-2, 3-4, 5-6, 7-8, 9-10, 11-12, 13-14, 15-16, 17-18, and 19-20, respectively. Cycling was performed as follows: 95°C for 5 min, followed by 45 cycles of 95°C for 10 s, 58°C for 10 s, and 72°C for 10 s. The results are shown in Figures 3, 5, 6, 7, and 8. Figures 5 to 8 show the detection results of cell-specific gene expression at different stages of induction compared with hESCs. ES indicates pluripotent stem cells (expressing OCT4, NANOG, and SOX2 genes), DE indicates definitive endoderm cells (expressing FoxA2 and SOX17 genes), HP indicates hepatic progenitor cells (expressing AFP, HNF4ɑ, and CK7 genes), and HPLC indicates hepatocyte-like cells (expressing ALB and AAT genes).

[0149] OCT4 upstream primer (SEQ ID No. 1): agcgaaccag tatcgagaac

[0150] OCT4 downstream primer (SEQ ID No. 2): ttacagaacc acactcggac

[0151] NANOG upstream primer (SEQ ID No. 3): ggtctcgtatttgctgcatcg

[0152] NANOG downstream primer (SEQ ID No. 4): acactcggtgaaatcagggt

[0153] SOX2 upstream primer (SEQ ID No. 5): agctacagca tgatgcagga

[0154] SOX2 downstream primer (SEQ ID No. 6): ggtcatggag ttgtactgca

[0155] SOX17 upstream primer (SEQ ID No. 7): ggaccgcacggaatttgaac

[0156] SOX17 upstream primer (SEQ ID No. 8): ggacaccaccgaggaaatgg

[0157] FOXA2 upstream primer (SEQ ID No. 9): ggaacaccac tacgccttca ac

[0158] FOXA2 downstream primer (SEQ ID No.10): tcatgttgct cacggaggag ta

[0159] AFP upstream primer (SEQ ID No. 11): ccatgtacat gagcactgtt g

[0160] AFP downstream primer (SEQ ID No.12): ctccaataac tcctggtatc c

[0161] HNF4α upstream primer (SEQ ID No. 13): catggccaag attgacaacc t

[0162] HNF4α downstream primer (SEQ ID No. 14): ttcccatatg ttcctgcatc ag

[0163] CK-7 upstream primer (SEQ ID No. 15): catggccaag attgacaacc t

[0164] CK-7 downstream primer (SEQ ID No. 16): ttcccatatg ttcctgcatc ag

[0165] ALB upstream primer (SEQ ID No. 17): gatgagatgc ctgctgactt gc

[0166] ALB downstream primer (SEQ ID No. 18): cacgacagag taatcaggat gcc

[0167] AAT upstream primer (SEQ ID No. 19): gatgagatgc ctgctgactt gc

[0168] AAT downstream primer (SEQ ID No. 20): cacgacagag taatcaggat gcc

[0169] TTR upstream primer (SEQ ID No. 21): cgtgcatgtgttcagaaaggctg

[0170] TTR downstream primer (SEQ ID No. 22): ctcctcagttgtgagcccatgc

[0171] RBP4 upstream primer (SEQ ID No. 23): agtgagcagcttccgagtcaag

[0172] RBP4 downstream primer (SEQ ID No. 24): gagaactccgcgacgatgttgt

[0173] 4. Immunofluorescence detection of AFP and ALB expression:

[0174] The cells were fixed with 4 wt% (i.e., mass concentration, the same applies below) paraformaldehyde at room temperature for 15 minutes, then permeabilized with 0.2 v / v% Triton X100 for 15 minutes. Blocked with 4 v / v% normal goat serum for 1 hour, the primary antibody was diluted in blocking buffer, and incubated overnight at 4°C. The secondary antibody was incubated at room temperature for one hour. DAPI was added for counterstaining for 5 minutes. Positive cells were observed under a fluorescence microscope. The results are shown in Figure 9. Figure 9 shows that the hepatocytes induced by this method express the liver-specific markers ALB and AFP.

[0175] 5. Detection of ICG uptake and release by human pluripotent stem cell-derived hepatocytes:

[0176] ICG was dissolved in dimethyl sulfoxide at a concentration of 5 mg / mL, and then diluted with differentiation induction medium C to a final concentration of 1 mg / mL. Human pluripotent stem cell-derived hepatocytes were routinely cultured in differentiation medium containing ICG for 90 minutes. After rinsing with phosphate buffer, the ICG absorption of the cells was recorded by microscopy. The cells were then cultured in ordinary medium for more than 6 hours, and the release of ICG was detected. The results are shown in Figure 10. As shown in Figure 10, after incubating with ICG dye for 90 minutes, microscopic observation results showed that the cells clearly contained ICG dye. 4-6 hours after the ICG dye was removed, the cells returned to a colorless state. This result indicates that human pluripotent stem cell-derived hepatocytes have the ability to absorb and secrete ICG dyes.

[0177] 6. Oil red staining test to detect the ability of hepatocytes to synthesize triglycerides:

[0178] Human pluripotent stem cell-derived hepatocytes were treated with 4wt% paraformaldehyde and a 3:2 volume ratio of 5% Oil Red stock solution to double-distilled water. The mixture was filtered and added to a cell culture dish. The cells were stained in the dark for 15-20 minutes. After removing the Oil Red dye, the cells were rinsed with 60% isopropanol for several seconds, then washed with PBS, observed under a microscope, and photographed. The results are shown in Figure 11. Microscopic observation of the cells after Oil Red O staining revealed the presence of orange-red lipid droplets, demonstrating that the human pluripotent stem cell-derived hepatocytes have the ability to synthesize and store lipids.

[0179] 7. Periodic acid-Schiff reaction to detect glycogen synthesis:

[0180] Human pluripotent stem cell-derived hepatocytes were treated with 4 wt % paraformaldehyde and 1 v / v % Triton X100 and then stained using the periodic acid-Schiff staining system (Sigma-Aldrich, Pittsburgh, USA). The results are shown in FIG12 . As shown in FIG12 , after glycogen staining using the PAS method, most cells were stained purple-red, indicating that human pluripotent stem cell-derived hepatocytes have a strong capacity for glycogen synthesis and storage.

[0181] 8. Low-density lipoprotein uptake experiment:

[0182] The cells were cultured in serum-free medium containing 10 μg / mL Alexa-Flour 488-labeled LDL for 3 to 4 hours. The cells were then counterstained with DAPI and observed under a fluorescence microscope. The results are shown in Figure 13 . As shown in Figure 13 , after incubation with LDL, fluorescent green LDL particles were visible in most cells under a fluorescence microscope, demonstrating that the human pluripotent stem cell-derived hepatocytes possess lipid uptake capabilities.

[0183] 9. Experimental comparison of CHIR99021 replacing Wnt3a

[0184] The present application also set up a control group for the above-mentioned induction process. During the induction culture process, Wnt3a was used instead of CHIR99021 in the induction medium A1 of the control group ("Conventional" in Figure 14). The rest were the same as in "3. Induction and differentiation of human pluripotent stem cells". The results are shown in Figure 14. Figure 14 shows the effects of CHIR99021 and Wnt3a on the induction and differentiation of hepatocytes on day 3 (becoming restricted endoderm induction). In Figure 14, each group of bar graphs, from left to right, is "ES", "Conventional" and "Example 1", where "Example 1" is operated with reference to the above-mentioned "II. Specific induction and identification process".

[0185] 10. Experimental comparison: Adding SB431542 at the end of induction

[0186] Based on the above control group, this application further omitted SB431542 from the induction differentiation medium C of the control group ("Conventional" in Figures 15 and 16). All other procedures were the same as in "3. Induction and differentiation of human pluripotent stem cells". Comparing the terminal hepatocyte indicators in Figure 15, the final addition of the SB431542 small molecule greatly improved the induction efficiency and maturity of hepatocytes. In Figures 15 and 16, each group of bar graphs, from left to right, is designated as "ES", "Conventional", and "Example 1", where "Example 1" was operated with reference to the above "II. Specific induction and identification process".

[0187] The present application provides a method for the directional induction and differentiation of optimized human pluripotent stem cells into hepatic progenitor cells and hepatocytes by the reasonable use of cell growth factors. The method can observe the changes in cell morphology and number at any time during the operation to ensure the normal progress of induction, and can induce the required hepatic progenitor cells and hepatocytes more quickly and efficiently. The method for large-scale preparation of hepatic progenitor cells and hepatocytes derived from human pluripotent stem cells adopts a culture system without feeder (feeder layer cells). Hepatic progenitor cells and hepatocytes can be obtained only by adding the induction culture medium of the corresponding stage, and after testing, the purity is relatively high. By using the above-mentioned large-scale preparation of hepatic progenitor cells and hepatocytes derived from human pluripotent stem cells, cells in the hepatic progenitor stage self-proliferate in large quantities, and can be frozen after obtaining hepatic progenitor cells. When hepatocytes are urgently needed, they are thawed to promote maturation induction. The subsequent induction cycle is short and efficient, and the obtained hepatocytes have stable performance and are free of stromal cell contamination.

[0188] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0189] The above-described embodiments merely represent several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent application. It should be noted that a person of ordinary skill in the art may make various modifications and improvements without departing from the spirit of the present application, and these modifications and improvements fall within the scope of protection of the present application. Therefore, the scope of protection of the present patent application shall be determined by the appended claims.

Claims

1. A cell culture product, characterized in that: The cell culture product includes a hepatic progenitor cell proliferation medium, which contains DMEM / F12 medium and about 1 μg / mL-8 μg / mL insulin, about 5 μg / mL-15 μg / mL transferrin, about 5 ng / mL-8 ng / mL sodium selenite, about 3 mM-8 mM nicotinamide, about 25 μg / mL-35 μg / mL 2-phospho-L-ascorbic acid, about 45 μg / mL-55 μg / mL human recombinant albumin, about 5 ng / mL-15 ng / mL epidermal growth factor, about 1 μM-5 μM glycogen synthase kinase 3 inhibitor, about 1 μM-3 μM transforming growth factor β receptor inhibitor, about 2 μM-7 μM lysophosphatidic acid and about 0.2 μM-0.8 μM sphingosine phosphate.

2. The cell culture product according to claim 1, characterized in that The hepatic progenitor cell proliferation medium comprises DMEM / F12 medium and about 4.5 μg / mL-6 μg / mL insulin, about 8 μg / mL-12 μg / mL transferrin, about 6 ng / mL-8 ng / mL sodium selenite, about 4.5 mM-6.5 mM nicotinamide, about 29 μg / mL-35 μg / mL 2-phospho-L-ascorbic acid, about 45 μg / mL-52 μg / mL human recombinant albumin, about 7.5 ng / mL-12.5 ng / mL epidermal cell growth factor, about 2.5 μM-4 μM glycogen synthase kinase 3 inhibitor, about 1.5 μM-2.5 μM transforming growth factor β receptor inhibitor, about 2 μM-6 μM lysophosphatidic acid and about 0.4 μM-0.6 μM sphingosine phosphate.

3. The cell culture product according to claim 1 or 2, characterized in that: The cell culture product further comprises an induction differentiation medium A for inducing differentiation of human pluripotent stem cells into defined endoderm cells, or further comprises an induction differentiation medium B for inducing differentiation of the defined endoderm cells into hepatic progenitor cells; Wherein, the differentiation induction medium A includes differentiation induction medium A1 and differentiation induction medium A2; The differentiation induction medium A1 comprises RPTM-1640 medium, about 5 ng / mL-300 ng / mL human activin A and about 2 μM-10 μM GSK-3 inhibitor; The differentiation induction medium A2 contains RPTM-1640 medium, about 10 ng / mL-200 ng / mL human activin A, and about 0.2%-2% (v / v) fetal bovine serum.

4. The cell culture product according to claim 3, characterized in that The differentiation induction medium B includes differentiation induction medium B1 and differentiation induction medium B2; The differentiation induction medium B1 comprises KO / DMEM medium, about 15 ng / mL-100 ng / mL keratinocyte growth factor and about 2%-3% (v / v) fetal bovine serum; The differentiation induction medium B2 comprises KO / DMEM medium and about 10%-30% (v / v) serum replacement, about 1 mM-3 mM L-glutamine, about 0.1 wt%-15 wt% non-essential amino acids, about 0.1 mM-0.12 mM β-mercaptoethanol and about 0.2%-2% (v / v) dimethyl sulfoxide.

5. The cell culture product according to claim 3, characterized in that The human pluripotent stem cells are human embryonic stem cells.

6. The cell culture product according to any one of claims 1 to 5, characterized in that The cell culture product also includes an induction differentiation medium C for inducing liver progenitor cells to differentiate into hepatocyte-like cells, wherein the induction differentiation medium C contains L-15 medium and about 5%-15% (v / v) fetal bovine serum, about 10 ng / mL-300 ng / mL hepatocyte growth factor, about 1 ng / mL-150 ng / mL oncostatin, about 0.05 μM-1.2 μM dexamethasone, about 2 mM-3 mM L-glutamine and about 5 μM-20 μM transforming growth factor β receptor inhibitor.

7. A method for preparing hepatic progenitor cells or hepatocyte-like cells, characterized in that: The preparation method comprises the step of preparing hepatic progenitor cells or hepatocyte-like cells using the cell culture product according to any one of claims 1 to 6.

8. The method for preparing hepatic progenitor cells or hepatocyte-like cells according to claim 7, characterized in that: The preparation method comprises the following steps: Inducing differentiation of human pluripotent stem cells into endoderm cells using the differentiation induction medium A; Inducing differentiation of the endoderm cells into hepatic progenitor cells using the differentiation induction medium B; Proliferation culture of the hepatic progenitor cells using the hepatic progenitor cell proliferation medium; and, The induced differentiation medium C is used to induce differentiation of the induced hepatic progenitor cells into hepatocyte-like cells.

9. The method for preparing hepatic progenitor cells or hepatocyte-like cells according to claim 8, characterized in that: The step of using the hepatic progenitor cell proliferation medium to proliferate and culture the hepatic progenitor cells comprises: Using the hepatic progenitor cell proliferation medium to initially culture the hepatic progenitor cells, enzymatically digesting the obtained initial culture to prepare single cells; and, The single cell is inoculated into fresh hepatic progenitor cell proliferation medium for subculture.

10. The method for preparing hepatic progenitor cells or hepatocyte-like cells according to claim 9, characterized in that: The preparation method has one or more of the following technical features: (1) The initial culture time is about 0.5 to 1.5 days; (2) The enzyme used for enzymatic digestion was TrypLE; (3) The seeding density of the single cells is about 1×10 4 Pieces / cm 2 -5×10 4 Pieces / cm 2 ;and, (4) The number of generations of subculture is about 1 to 5, the culture time of each generation is about 120 h to 168 h, and the culture medium is replaced every about 24 h to 48 h.

Images