Chimeric ntcr-t construction method for targeting KRAS high-frequency mutant tumor

Abstract

Disclosed in the present invention is a chimeric nTCR-T construction method for targeting a KRAS high-frequency mutant tumor. CDR3 segments in T-cell receptor (TCR) corresponding regions of a patient are replaced with CDR3 fragments of TCR α and β chain hypervariable regions (V) that recognize KRAS high-frequency mutant MHCI epitopes with high affinity, and an extracellular recognition fragment of a KRAS high-frequency mutant tumor TCR is constructed; and the modified α chain V region and β chain V region are connected in series by means of 3-4 G4S peptide fragments, and a hinge region, a transmembrane region and an intracellular signal transduction region are fused at a carboxyl terminal of an extracellular recognition region to form a new chimeric nTCR-T cell.

Description

A chimeric nTCR-T construction method for targeting KRAS high-frequency mutation tumors Technical Field

[0001] The present invention relates to the technical field of tumor immune cell therapy, and specifically to a method for constructing a chimeric nTCR-T for targeting KRAS high-frequency mutation tumors. After the extracellular segments of the α chain and β chain of KRAS-TCR are connected by a G4S peptide segment as the extracellular recognition region, a hinge region (CD28-Hinge), a transmembrane region (CD8-TM), and an intracellular signal transduction region (intracellular segment fusion of CD28, 41BB and CD3ζ) are fused at their carboxyl termini to form a new chimeric TCR-T (nTCR-T). Background Art

[0002] In recent years, with the advancement of T cell receptor (TCR) isolation and genetic engineering technologies, genetically engineered TCR-T cell therapy based on tumor neoantigens has gained widespread attention and achieved good tumor control and disease remission in clinical applications. This technology first screens T cell clones that can specifically recognize MHC-presented tumor neoantigens. Single-cell sequencing is then used to obtain the paired TCR-α and β chain information of the clones. Lentivirus encoding the full-length gene sequences of the TCR-α and β chains is then used to transduce the patient's peripheral blood T lymphocytes, thereby obtaining TCR-T cells that specifically recognize MHC-tumor-associated antigens. After large-scale in vitro expansion, these cells are then infused back into the patient to achieve the goal of tumor treatment.

[0003] Under the premise of satisfying HLA restriction, TCR-T can recognize tumor mutated antigens regardless of tumor type or individual variability. This has led to the rapid development of TCR-T technology, represented by high-frequency tumor mutated neoantigens. KRAS is one of the most frequently mutated oncogenic driver genes in human malignancies, accounting for approximately 15% to 20% of all tumors. More than 50% of patients with high-mortality tumors such as lung adenocarcinoma, pancreatic cancer, and colorectal cancer have KRAS mutations, and over 97% of KRAS mutations occur in exons 2 and 3 (G12 and G13 sites). "Neoantigen epitopes" generated by tumor-specific driver mutations, represented by high-frequency KRAS mutations, have many advantages, including strong tumor specificity, high immunogenicity, lack of heterogeneous expression or loss, natural proteasome processing, and presentation by HLA alleles. They have become broad-spectrum, specific, and ideal target antigens for TCR-T therapy to treat a variety of malignancies.

[0004] However, in conventional TCR-T (cTCR-T) therapy, the TCR-α chain and β chain need to form an 8-chain, 10-ITAM TCR-CD3 complex with three CD3 dimers (including: CD3γε, CD3δε, CD3ζζ), which has an extremely complex structure; its signal transmission mode requires the recognition of TCR and antigen peptide-MHC molecule complex to provide the first signal, co-stimulatory molecules (such as CD28) to provide the second signal, and cytokines to provide the third signal. The signal transmission efficiency is extremely low. In addition, "mismatched" heterodimers may produce unpredictable risks, which seriously limits the further clinical application of TCR-T therapy.

[0005] Summary of the Invention

[0006] In response to the above problems, the present invention is based on the purpose of optimizing TCR-T structure and improving TCR-T signal transmission and tumor control efficiency, and provides a chimeric nTCR-T construction method targeting KRAS high-frequency mutation tumor neoantigens. The method is formed by connecting the extracellular segments of the TCR-α chain and the β chain through a G4S peptide segment, and fusing a hinge region (Hinge), a transmembrane region (TM) and an intracellular signal transduction region (CD28, 41BB and CD3ζ intracellular segment fusion) at its carboxyl end to form an nTCR-T technology that can specifically recognize the target antigen represented by the KRAS high-frequency mutation antigen peptide epitope-MHC complex. The method provided by the present invention can not only avoid the risk of "mismatched" heterodimers, but also achieve efficient TCR-T signal transmission and improve anti-tumor efficacy.

[0007] A method for constructing a chimeric nTCR-T for targeting KRAS high-frequency mutation tumors. After the G4S peptide segment is connected to the extracellular segments of the α chain and β chain of KRAS-TCR as the extracellular recognition region, a new chimeric nTCR-T is formed by fusing the hinge region, transmembrane region, and intracellular signal transduction region at the carboxyl end of the extracellular recognition region.

[0008] Preferably, the nucleotide sequence of the α chain CDR3 is shown as SEQ ID NO.7.

[0009] Preferably, the nucleotide sequence of the β chain CDR3 is shown as SEQ ID NO.15.

[0010] Preferably, the number of the G4S peptide segments is 3 to 4, and the nucleotide sequence is shown as SEQ ID NO.9.

[0011] Preferably, the nucleotide sequence of the hinge region is shown as SEQ ID NO.17.

[0012] Preferably, the nucleotide sequence of the transmembrane region is shown as SEQ ID NO.18.

[0013] Preferably, the CD28 nucleotide sequence of the intracellular signal transduction region is shown as SEQ ID NO.19.

[0014] Preferably, the nucleotide sequence of 41BB in the intracellular signal transduction region is shown as SEQ ID NO.20.

[0015] Preferably, the CD3ζ in the intracellular signal transduction region comprises the nucleotide sequence shown in SEQ ID NO.21.

[0016] The core of the present invention is:

[0017] 1. Replace the CDR3 fragments of the T cell receptor α and β chain hypervariable regions (V) with the CDR3 fragments of the corresponding regions of the patient's own TCR with high affinity recognition of the KRAS high-frequency mutated MHCI epitope, thereby obtaining the extracellular recognition fragment of the KRAS high-frequency mutated tumor TCR;

[0018] 2. The modified α chain V region and β chain V region are connected in series through 3-4 G4S peptide segments, and the hinge region (CD28-Hinge), transmembrane region (CD8-TM), and intracellular signal transduction region (CD28, 41BB and CD3ζ intracellular segment fusion) are fused at their carboxyl termini to form a new chimeric TCR-T (nTCR-T) cell therapy technology.

[0019] The present invention has the following advantages:

[0020] 1. "Neoantigen epitopes" represented by high-frequency KRAS mutations or tumor-specific high-frequency mutations have many advantages, such as strong tumor specificity, high immunogenicity, no heterogeneous expression or loss, can be naturally processed by proteasomes, and presented by HLA alleles.

[0021] 2. The chimeric nTCR has a simple structure and carries its own signal transduction and co-stimulatory signals. It can efficiently recognize the KRAS high-frequency mutant peptide epitope-MHC complex, avoiding the problems of complex signal transmission, low efficiency, and easy "mismatching" in conventional TCR-T therapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is a diagram of TCR-α chain and β chain information acquisition and CDR3 replacement in pancreatic cancer patients with HLA-A*11:01 and KRAS high-frequency mutations, wherein single-cell sequencing was performed on the peripheral blood of pancreatic cancer patients with HLA-A*11:01 and KRAS high-frequency mutations to obtain sequence information for constructing HLA-restricted paired TCR-α chain and β chain; and the CDR3 region sequence information reported in Table 2 was used to replace the CDR3 region of the paired TCR-α / β chain, thereby obtaining HLA-restricted TCR-α / β chain sequence information with high recognition function of KRAS-G12V / D antigen peptide.

[0023] Figure 2 is a schematic diagram of the design of a chimeric nTCR-T in which 3-4 G4Ss serve as linkers to connect the KRAS-TCR-α chain and the β chain.

[0024] FIG3 is a schematic diagram of the design elements and sequence of the chimeric TCR (nTCR-T).

[0025] Figure 4 is a comparison of chimeric nTCR-T and conventional cTCR-T.

[0026] Figure 5 shows the construction of the pCDH-CMV-KRAS-G12D-TCR-α-3 G4S-β-28BBZ target plasmid, virus packaging, Jurkat and T cell infection, and expression verification.

[0027] Figure 6 is a verification diagram of the effect after co-culture of chimeric KRAS-nTCR-T cells with HLA-A*11:01 genotype and KRAS-G12D mutant pancreatic cancer cells for 3 days. Among them, cytokines IL2, IL4, IL6, TNFα and IFNγ were significantly increased in the chimeric KRAS-nTCR-T cell group, while the inhibitory cytokine IL10 showed a significant decrease. DETAILED DESCRIPTION

[0028] The present invention involves replacing the genes for the corresponding regions of the TCR α chain V region and β chain V region CDR3 fragments based on the recognition of personalized tumor-specific, frequently mutated MHC I antigen epitopes. The extracellular recognition region is formed by tandemly connecting 3-4 G4S peptide segments. The hinge region (CD28-Hinge), transmembrane region (CD8-TM), and intracellular signal transduction domains (CD28, 41BB, and intracellular domains of CD3ζ) are further fused to the carboxyl terminus to construct a novel, structurally simple chimeric nTCR-T cell with its own signal transduction and co-stimulatory signals. The present invention also involves the construction and application of a chimeric nTCR-T cell that utilizes TCR α chain V region and β chain V region CDR3 gene segments that recognize KRAS frequently mutated (G12C, G12V) MHC I antigen epitopes to replace the corresponding regions of the patient's own TCR. The present invention also involves the structural design and application of 3-4 G4S peptide segments as linkers to connect the modified TCR-α chain V region and β chain V region peptide segments as the extracellular antigen recognition region. The present invention relates to the structural design and application of a chimeric TCR-T cell, wherein the carboxyl terminus of the extracellular antigen recognition region is fused with a hinge region CD28-Hinge, a transmembrane region CD8-TM, and an intracellular signal transduction region CD28, 41BB, and an intracellular segment of CD3ζ. The present invention also relates to the structural design and application of a chimeric TCR-T cell therapy, wherein the linker connects the extracellular segments of the TCR-α chain and β chain, a hinge and a transmembrane region are fused at the carboxyl terminus, and the intracellular signal transduction region is fused with the intracellular segments of CD28, 41BB, and CD3ζ.

[0029] The first objective of the present invention is to determine the information of TCR-α and β chains (especially CDR3 regions) that can specifically recognize MHC-presented KRAS mutant peptides.

[0030] Targeting KRAS high-frequency mutations with specific receptor T-cell therapy (TCR-T) requires three key factors: a high-frequency KRAS mutation neoantigen peptide, an HLA typing capable of binding to the KRAS mutation peptide, and TCR α and β chain information (particularly the CDR3 region) that can specifically recognize the HLA-bound peptide. Using the peptide-MHC binding prediction website (NetMHC-4.0), we first determined that HLA-A*11:01, a high-frequency HLA subtype in the Chinese population, has affinity for high-frequency KRAS mutation peptide epitopes, with %Rank values ​​all less than 2, as shown in Table 1 (NetMHC-4.0 prediction website for peptide-MHC binding, showing that the three KRAS-G12D / C / V mutation peptide epitopes all have high affinity for the HLA-A*11:01 genotype). Reported TCR α and β chain CDR3 information that specifically recognizes high-frequency KRAS mutation peptide epitopes is shown in Table 2. Single-cell sequencing was performed on peripheral blood from patients with HLA-A*11:01 typing and a high-frequency KRAS-G12V mutation to obtain paired TCR-α and β chain information. The CDR3 regions were then replaced with previously reported CDR3 regions that recognize KRAS-G12V / D antigen peptides, ultimately obtaining TCR-α and β chain information that is highly reactive to the KRAS-G12V / D antigen peptide. The nucleotide sequences of the TCR-α chains specific for KRAS-G12V and HLA-A*11:01 in the present invention include the nucleotide fragments of SEQ ID NOs. 2 to 8. The nucleotide sequences of the TCR-β chains include the nucleotide fragments of SEQ ID NOs. 10 to 16.

[0031] Table 1

[0032] Prediction of affinity between high-frequency KRAS mutant peptide epitopes and human leukocyte antigen Note: a: %Rank represents the strength of the combination , less than 0.5 is strong binding (SB), and less than 2 is weak binding (WB).

[0033] Table 2

[0034] CDR3 information in TCR-α\β specific for high-frequency KRAS mutant peptide epitopes

[0035] The second purpose of the present invention is to use G4S as a linker to connect the length of the TCR-α chain and β chain extracellular fragments that specifically recognize KRAS mutant peptides.

[0036] To determine the most appropriate linker length for chimeric nTCR-T cell construction, the structure prediction website Robetta was used to predict the structures of chimeric nTCRs specifically recognizing KRAS mutant peptide epitopes with 2, 3, 4, and 5 G4S linkages, as shown in Figure 2. The authors analyzed which linker length was most suitable for connecting the extracellular domains (CDJ regions) of the KRAS-TCR-α and β chains. To ensure the chimeric nTCR-T cell's ability to recognize tumor antigen epitope peptides, a published complex structure (PDB ID: 3GH1) was used as a template for structural alignment (Figure 2A). The results of the structural alignment of the extracellular regions of the tandem TCR-α and β chains (Figure 2B) show that 3, 4, and 5 G4S as linkers connecting the extracellular regions (CDJ regions) of the KRAS-TCR-α / β chains can all ensure the formation of a correct pairing recognition conformation. However, 2 G4S as linkers connecting the extracellular regions of the KRAS-TCR-α / β chains are too short to form a correct pairing recognition conformation. To ensure the formation of the correct pairing conformation and avoid protein instability caused by linker redundancy, 3-4 G4S can be used as linkers to connect the KRAS-TCR-α and β chains in the chimeric nTCR-T design.

[0037] The third purpose of the present invention is to design and apply a chimeric nTCR-T structure using CD28-Hinge and CD8 transmembrane regions as the connecting parts of the extracellular recognition and intracellular signal transduction regions, and using the fusion of CD28, 41BB and CD3ζ intracellular segments as the intracellular signal transduction region.

[0038] After 3-4 G4S peptide segments are connected to the extracellular segments of KRAS-TCR-α chain and β chain as the extracellular recognition region, CD28-Hinge, CD8 transmembrane region and CD28, 41BB and CD3ζ intracellular segments are fused to the carboxyl end of the extracellular recognition region (G4S peptide segment is connected to the extracellular segment of KRAS-TCR-α chain and β chain), together forming the transmembrane and intracellular signal transduction regions of the chimeric nTCR-T.

[0039] The full sequence was constructed between the multiple cloning sites XbaI and BmgbI of the pCDH-CMV vector by whole gene synthesis and enzyme ligation to obtain the target plasmid pCDH-CMV-KRAS-G12D-TCR-α-G4S-β-28BBZ.

[0040] The fourth purpose of the present invention is to prepare chimeric nTCR-T cells and use them in KRAS mutant tumors.

[0041] The pCDH-CMV-KRAS-G12D-TCR-α-G4S-β-28BBZ target plasmid was packaged and concentrated in 293T cells and the cells were purified by Lenti-Pac TM The viral titer was measured using a lentiviral titer detection kit, and T cells were infected at an MOI of 100 to generate chimeric KRAS-nTCR-T cells. The normal transcriptional expression of the full-length target gene sequence was determined. Subsequently, the chimeric KRAS-nTCR-T cells were co-cultured with pancreatic cancer cells with the HLA-A*11:01 genotype and the KRAS-G12D mutation, and their cytokine secretion was measured to determine the anti-tumor effect of the chimeric KRAS-nTCR-T cells.

[0042] Example 1

[0043] The constructed pCDH-CMV-KRAS-G12D-TCR-α-G4S-β-28BBZ target plasmid was packaged and concentrated in 293T cell lentivirus and then cloned into the lentivirus vector by Lenti-Pac TM The virus titer was determined by lentiviral titer detection kit. Jurkat cells and T cells were infected at MOI=10 and MOI=100, respectively. On the third day after infection, 1×10 5 mRNA was extracted from the cells and subsequently reverse-transcribed into cDNA. Conventional PCR was used to verify the mRNA levels of full-length nTCR-T in Jurkat cells and T cells. The results showed that full-length nTCR-T mRNA was expressed in both Jurkat cells and T cells.

[0044] Target gene full-length verification primers:

[0045] TCR-CMV-F:GTAGGCGTGTACGGTGGGAG

[0046] TCR-WPRE-R:AGCAGCGTATTCCACATAGCG

[0047] Example 2

[0048] After co-culture of chimeric KRAS-nTCR-T cells with pancreatic cancer tumor cells with HLA-A*11:01 genotype and KRAS-G12D mutation, cytokine secretion showed that compared with the NC-T incubation group, cytokines IL2, IL4, IL6, TNFα and IFNγ were significantly increased in the chimeric KRAS-nTCR-T cell co-culture group, and the inhibitory cytokine IL10 showed a significant downward trend, indicating that chimeric KRAS-nTCR-T cells can specifically respond to the KRAS-G12D mutant peptide epitope complex presented by the HLA-A*11:01 genotype, reflecting the anti-tumor effect of chimeric KRAS-nTCR-T cells.

[0049] The examples of the present invention are described in detail above in conjunction with the embodiments, but the present invention is not limited to the above examples. Various changes can be made within the knowledge of ordinary technicians in this field without departing from the purpose of the present invention, and should also be regarded as the scope of protection of the present invention.

Claims

1. A method for constructing a chimeric nTCR-T targeting KRAS high-frequency mutation tumors, characterized in that: After the G4S peptide segment was connected to the extracellular segments of the α chain and β chain of KRAS-TCR as the extracellular recognition region, a new chimeric nTCR-T was formed by fusing the hinge region, transmembrane region, and intracellular signal transduction region at the carboxyl end of the extracellular recognition region.

2. The method for constructing a chimeric nTCR-T targeting KRAS high-frequency mutation tumors according to claim 1, characterized in that: The CDR3 nucleotide sequence of the α chain is shown in SEQ ID NO.

7.

3. The method for constructing a chimeric nTCR-T targeting KRAS high-frequency mutation tumors according to claim 2, characterized in that: The CDR3 nucleotide sequence of the β chain is shown in SEQ ID NO.

15.

4. The method for constructing a chimeric nTCR-T targeting KRAS high-frequency mutation tumors according to claim 3, characterized in that: The number of the G4S peptide segments is 3 to 4, and the nucleotide sequence is shown in SEQ ID NO.

9.

5. The method for constructing a chimeric nTCR-T targeting KRAS high-frequency mutation tumors according to claim 4, characterized in that: The nucleotide sequence of the hinge region is shown in SEQ ID NO.

17.

6. The method for constructing a chimeric nTCR-T targeting KRAS high-frequency mutation tumors according to claim 5, characterized in that: The nucleotide sequence of the transmembrane region is shown in SEQ ID NO.

18.

7. The method for constructing a chimeric nTCR-T targeting KRAS high-frequency mutation tumors according to claim 6, characterized in that: The nucleotide sequence of CD28 in the intracellular signal transduction region is shown in SEQ ID NO.

19.

8. The method for constructing a chimeric nTCR-T targeting KRAS high-frequency mutation tumors according to claim 7, characterized in that: The nucleotide sequence of 41BB in the intracellular signal transduction region is shown in SEQ ID NO.

20.

9. The method for constructing a chimeric nTCR-T targeting KRAS high-frequency mutation tumors according to claim 8, characterized in that: The CD3ζ in the intracellular signal transduction region includes the nucleotide sequence shown in SEQ ID NO.21.

Images