Method for preparing cell line for amplification of replication-defective recombinant virus, defective virus and use thereof

Abstract

A method for preparing a cell line for the amplification of a replication-defective recombinant virus, a defective virus and the use thereof, which belong to the technical field of genetic engineering. In the method for preparing the cell line for the amplification of the replication-defective recombinant virus, replication-related virus genes can be efficiently integrated into a cell genome by means of the gene transfer function of a transposase, and the expression of the replication-related genes is activated under the action of Cre recombinase, thereby activating the translation of corresponding proteins and ensuring the packaging and amplification of the replication-defective virus in cells, such that large-scale amplification of the replication-defective recombinant virus is realized. The cell line prepared by means of the provided method is suitable for the replication of a corresponding replication-defective recombinant virus, and provides a raw material basis for preparing a vaccine using a replication-defective recombinant virus as a candidate antigen and for preparing a gene therapy vector.

Description

Preparation method of a cell line for amplifying replication-defective recombinant virus, defective virus and its application

[0001] This application claims priority to the Chinese patent application with application number 202310847211.8, filed with the Patent Office of China on July 11, 2023, and entitled “A method for preparing a cell line for amplifying replication-defective recombinant virus, defective virus and its application”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The present application belongs to the field of genetic engineering technology, and specifically relates to a method for preparing a cell line for amplifying a replication-defective recombinant virus, a defective virus, and applications thereof. Background Art

[0003] The replication process of most viruses has six steps, namely adsorption, invasion, uncoating, biosynthesis, assembly and release. Viruses can infect and replicate in a variety of cells, causing cell lysis and death. When the ability of a virus to replicate in a cell is enhanced, it will inevitably cause a pandemic. For example, the Paramyxoviridae virus is a type of negative-stranded single-stranded RNA virus. The virus particles are polymorphic, with an envelope and a spike. The nucleocapsid is helically symmetrical, and the spike has two glycoproteins, hemagglutinin neuraminidase (HN) and fusion protein (F). The fusion of the viral envelope and the cell membrane is the main way for enveloped viruses to penetrate the host. The F protein has membrane fusion activity and is related to the pathogenicity of the virus. Therefore, the preparation of defective recombinant viruses is beneficial for limiting the pathogenicity of the virus while also facilitating more detailed and accurate research on the pathogenic mechanism of the virus, thereby having a more in-depth study and understanding of the virus at the genetic level.

[0004] When packaging a defective recombinant virus, it is necessary to construct a cell line with viral replication ability. However, when the constructed defective replicating virus lacks proteins that infect host cells, the replication of the defective recombinant virus will be limited, and the requirements for the defective recombinant virus in the preparation of vaccines or other biological products cannot be met.

[0005] Summary of the Invention

[0006] In view of this, the purpose of the present application is to provide a method for preparing a cell line for packaging a replication-deficient recombinant virus, wherein the expression of the fusion protein is activated by Cre recombinase, and the cells expressing the fusion protein can enable the recombinant paramyxovirus lacking the corresponding gene to replicate.

[0007] The present application also provides the use of the cell line prepared by the above scheme in the proliferation of replication-defective recombinant viruses.

[0008] The present application provides a method for preparing a cell line for amplifying a replication-deficient recombinant virus, comprising the following steps:

[0009] The CALPdL-linear sequence recognized by the transposon system is synthesized and cloned into a plasmid to obtain a recombinant vector containing CALPdL-linear, and a CAG promoter sequence is inserted into the recombinant vector containing CALPdL-linear to obtain a recombinant vector containing CALPdL-CAG;

[0010] Amplifying viral genes related to replication and cloning them into a recombinant vector containing CALPdL-CAG to obtain a recombinant vector containing a CALPdL-CAG-replication-related viral gene;

[0011] The recombinant vector containing the CALPdL-CAG-replication-related viral gene and the recombinant vector containing the transposase are co-transfected into mammalian cells to obtain a cell line for amplification of the replication-deficient recombinant virus.

[0012] Preferably, the virus comprises a Paramyxovirus.

[0013] Preferably, the Paramyxovirus includes Sendai virus.

[0014] Preferably, the replication-related gene of the Sendai virus is the F gene; the nucleotide sequence of the F gene is shown in SEQ ID NO: 1.

[0015] Preferably, the nucleotide sequence of the CALPdL-linear is shown in SEQ ID NO: 2 or SEQ ID NO: 3;

[0016] The nucleotide sequence of the CAG promoter sequence is shown in SEQ ID NO: 4.

[0017] Preferably, the mass ratio of the recombinant vector containing the CALPdL-CAG-replication-related viral gene and the recombinant vector containing the transposase is 9:1;

[0018] The recombinant vector containing the transposase includes SB100X or PBase.

[0019] The present application provides the use of a cell line for amplifying a replication-defective recombinant virus prepared by the preparation method in producing a replication-defective recombinant virus.

[0020] Preferably, the replication-deficient recombinant virus comprises Sendai virus lacking the F gene.

[0021] Preferably, the packaging method of the replication-defective recombinant virus comprises the following steps:

[0022] The coding gene of T7 RNA polymerase is cloned into a plasmid to obtain a recombinant vector containing the coding gene of T7 RNA polymerase;

[0023] Co-transfecting a recombinant vector containing a T7 RNA polymerase encoding gene and a recombinant vector containing a transposase gene into mammalian cells, and obtaining a replication-defective recombinant virus packaging cell line after screening;

[0024] The recombinant vector containing the viral genome lacking replication-related viral genes and the recombinant vector containing each gene of the virus are co-transfected into the replication-deficient recombinant virus packaging cell line to obtain the transfected replication-deficient recombinant virus packaging cell line.

[0025] Preferably, the method for amplifying the replication-deficient recombinant virus is to transfect the recombinant vector containing the CRE gene into the cell line for amplifying the replication-deficient recombinant virus, co-culture the transfected cell line with the transfected cell line for packaging the replication-deficient recombinant virus, and collect the virus.

[0026] The method for preparing a cell line for amplifying a replication-deficient recombinant virus provided in the present application comprises pre-cloning a Cre recombinase recognition sequence, a promoter for a replication-related viral gene, and a replication-related viral gene into a plasmid to obtain a recombinant vector containing the CALPdL-CAG-replication-related viral gene; co-transfecting the recombinant vector containing the CALPdL-CAG-replication-related viral gene and a recombinant vector containing a transposase into mammalian cells, utilizing the gene transfer function of the transposase to efficiently integrate the replication-related viral gene into the cell genome. Subsequently, under the action of the Cre recombinase, the expression of the replication-related gene is activated, thereby activating the translation of the corresponding protein, ensuring that the replication-deficient virus can be packaged and amplified in the cell, thereby achieving large-scale amplification of the replication-deficient recombinant virus. The cell line prepared by the method provided in the present application is suitable for the replication of the corresponding replication-deficient recombinant virus, providing a raw material basis for preparing vaccines and gene therapy vectors using the replication-deficient recombinant virus as a candidate antigen.

[0027] At the same time, the technical solution of this application uses a transposon system to integrate exogenous replication-related viral genes and cell genomes, greatly improving the efficiency of simple plasmid integration, which is 50 to 100 times higher than traditional integration methods.

[0028] At the same time, the amplification cell line obtained by the preparation method of the present application has strong genetic stability, and the characteristics will not be lost even after 15 cell passages, while also maintaining high protein expression activity. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 is a schematic diagram of the CALPdL-linear gene composition;

[0030] Figure 2 is a sequence map of pUC-CALPdL;

[0031] Figure 3 is a sequence map of pCALPdL-empty;

[0032] Figure 4 is the plasmid map of pCALPdL-Fwt-Flag

[0033] Figure 5 is a sequence map of pCAGGS-Flag-T7opt;

[0034] FIG6 is a schematic diagram showing that the inserted sequence of pCAGGS-Flag-T7opt has been verified to have no mutation;

[0035] Figure 7 is a sequence map of pSBtet-Flag-T7opt;

[0036] Figure 8 shows the results of western blot detection of protein expression in LLC-MK2-Fwt-Flag cell line (Sleeping Beauty transposon system);

[0037] FIG9 is the result of western blot detection of protein expression in BHK-Flag-T7opt cell line;

[0038] Figure 10 is a spectrum of SEV-GFP-ΔF plasmid;

[0039] Figure 11 shows the electrophoresis results of SEV-ΔF plasmid after F was knocked out;

[0040] FIG12 is the experimental result of verifying the successful knockout of F gene;

[0041] Figure 13 is a schematic diagram of a hemagglutination test;

[0042] FIG14 shows the results of a hemagglutination test of F protein-deficient Sendai virus;

[0043] Figure 15 shows a purified virus particle layer;

[0044] FIG16 shows the results of optimizing the ratio of transposase plasmid to transposon plasmid;

[0045] FIG17 shows the genetic stability of LLC-MK2-Fwt-Flag cells;

[0046] FIG18 is a spectrum of the pcDNA3.1-hyPBase recombinant plasmid;

[0047] Figure 19 is the result of western blot detection of protein expression in PB-LLC-MK2-Fwt-Flag cell line (Piggybac transposon system);

[0048] FIG20 is a comparison of the results of the transposon method and the non-transposon method using crystal violet staining after the puromycin selection. DETAILED DESCRIPTION

[0049] The present application provides a method for preparing a cell line for amplifying a replication-deficient recombinant virus, comprising the following steps:

[0050] Synthesizing the sequence between the CALPdL-linear sequence recognized by the transposon system and cloning it into a plasmid to obtain a recombinant vector containing CALPdL-linear, and inserting a CAG promoter sequence into the recombinant vector containing CALPdL-linear to obtain a recombinant vector containing CALPdL-CAG;

[0051] Amplifying viral genes related to replication and cloning them into a recombinant vector containing CALPdL-CAG to obtain a recombinant vector containing a CALPdL-CAG-replication-related viral gene;

[0052] The recombinant vector containing the CALPdL-CAG-replication-related viral gene and the recombinant vector containing the transposase are co-transfected into mammalian cells to obtain a cell line for amplification of the replication-deficient recombinant virus.

[0053] The present application synthesizes the sequence between the CALPdL-linear sequence recognized by the transposon system and clones it into a plasmid to obtain a recombinant vector containing CALPdL-linear. The CAG promoter sequence is inserted into the recombinant vector containing CALPdL-linear to obtain a recombinant vector containing CALPdL-CAG.

[0054] In the present application, the transposon system preferably includes the Sleeping Beauty transposon system or the Piggybac transposon system. The CALPdL-linear sequence recognized by the transposon system includes a 5'-loxp sequence (L), a puromycin resistance gene, an AT-rich element (d:AT-rich element), and a 3'-loxp sequence (L). The composition of the CALPdL-linear sequence in CALPdL-linear is shown in Figure 1. In the embodiment of the present application, the resistance gene is the puromycin resistance gene PuroR. The AU-rich element (ARE) is preferably the sequence of the c-fos, c-myc, nur77 or zif268 gene.

[0055]

[0056]

[0057] After obtaining the recombinant vector containing CALPdL-CAG, the present application amplified the viral gene related to replication and cloned it into the recombinant vector containing CALPdL-CAG to obtain a recombinant vector containing the CALPdL-CAG-replication-related viral gene.

[0058]

[0059] In the present application, the method for amplifying viral genes associated with replication preferably uses a primer pair to amplify viral genes associated with replication. In order to facilitate the detection of viral genes, a Flag tag is added after the viral gene. The primer pair is a sequence comprising two restriction sites and a Flag tag, preferably including a forward primer as shown in SEQ ID NO:5 (aaaggcctctgaggccgaattcccatggggaaacatgacagcatatatccagaggtcacagtgc) and a reverse primer as shown in SEQ ID NO:6 (atggcctgacaggccctcgagtcaCTTATCGTCGTCATCCTTGTAATCtcttttctcagccatcgcatcaaac). The nucleotide sequence of the Flag tag is shown in SEQ ID NO:7 (GATTACAAGGATGACGACGATAAG).

[0060] In the present application, after amplifying viral genes related to replication, the amplified fragment is preferably treated with T4 PNK enzyme to facilitate phosphorylation of the 5' and 3' ends of the DNA, first cloned into the pUC57 plasmid, and then cloned into a recombinant vector containing CALPdL-CAG if no mutation occurs after sequencing verification.

[0061]

[0062] After obtaining the recombinant vector containing the CALPdL-CAG-replication-related viral gene, the present application co-transfected the recombinant vector containing the CALPdL-CAG-replication-related viral gene and the recombinant vector containing the transposase into mammalian cells to obtain a cell line for amplifying the replication-deficient recombinant virus.

[0063] In the present application, the mass ratio of the recombinant vector containing the CALPdL-CAG-replication-related viral gene and the recombinant vector containing the transposase is 9:1. The recombinant vector containing the transposase includes SB100X. The present application optimizes the mass ratio of the recombinant vector and the recombinant vector containing the transposase. The results show that a relatively high (1:5) or low (1:20) mass ratio will affect the integration effect. The present application has no special restrictions on the operation method of the co-transfection, and the co-transfection method well known in the art can be used. In the examples of the present application, the co-transfection is preferably completed using the Novezan transfection reagent ExFect Transfection Reagent (Cat. No. T101-01). The mammalian cell is preferably the LLC-MK2 cell line. The LLC-MK2 cell line is derived from the cell bank of the Chinese Academy of Sciences (LLC-MK2 catalog No. GNO 6).

[0064] In the present application, after the co-transfection, screening is preferably performed, and the screening method is preferably to perform screening and culture in DMEM culture medium containing 10% FBS and 5 μg / mL puromycin (puromycin White Shark Product No. BS111-25mg), and the liquid is replaced every 2 days to obtain a stable cell line named: LLC-MK2-Fwt-Flag.

[0065] In this application, the amplification cell line prepared was the LLC-MK2 cell line, which expresses wild-type F protein with a Flag tag at the C-terminus via Cre recombinase induction. The cell line, LLC-MK2-Fwt-Flag, was found to be genetically stable after subculture, with no mutations occurring within 15 generations.

[0066] The present application provides the use of a cell line for amplifying a replication-defective recombinant virus prepared by the preparation method in producing a replication-defective recombinant virus.

[0067] The replication-deficient recombinant virus prepared in this application is applicable to all types of viruses. The defective genes in different types of replication-deficient recombinant viruses can be expressed in cell lines. To illustrate the amplification method, an experiment on the amplification method is carried out using Sendai virus lacking the F gene as an example.

[0068] In the present application, the packaging method of the replication-defective recombinant virus preferably comprises the following steps:

[0069] The coding gene of T7 RNA polymerase is cloned into a plasmid to obtain a recombinant vector containing the coding gene of T7 RNA polymerase;

[0070] Co-transfecting a recombinant vector containing a T7 RNA polymerase encoding gene and a recombinant vector containing a transposase gene into mammalian cells, and obtaining a replication-defective recombinant virus packaging cell line after screening;

[0071] The recombinant vector containing the viral genome lacking replication-related viral genes and the recombinant vector containing each gene of the virus are co-transfected into the replication-deficient recombinant virus packaging cell line to obtain the transfected replication-deficient recombinant virus packaging cell line.

[0072] In the present application, the method for cloning the coding gene of T7 RNA polymerase into a plasmid is preferably to first insert a Flag tag upstream of the coding gene, and then insert the T7 RNA polymerase recombinant vector containing the Flag tag into pSBtet-puro as a template to obtain a recombinant vector containing the coding gene of T7 RNA polymerase. The construction method of inserting the Flag tag upstream of the coding gene is preferably to use primer pair 1 and primer pair 2 to respectively amplify the position of the coding gene of T7 RNA polymerase, and at the same time, in order to facilitate the detection of the target gene, a restriction enzyme site is added to facilitate subsequent cloning into a plasmid. The primer pair 1 preferably includes the nucleotide sequence N-Flag-T7opt-for shown in SEQ ID NO:9 and the nucleotide sequence Amp-rev shown in SEQ ID NO:10. The primer pair 2 preferably includes the nucleotide sequence Amp-for shown in SEQ ID NO:11 and the nucleotide sequence N-Flag-T7opt-rev shown in SEQ ID NO:12. Primer pair 1 amplified a 5158bp DNA fragment, named Flag-T7opt-5K, and primer pair 2 amplified a 2280bp DNA fragment, named Flag-T7opt-2K. The Flag-T7opt-5K and Flag-T7opt-2K were cloned into a plasmid to obtain pCAGGS-Flag-T7opt (see Figure 5 for the spectrum). Sequencing verification showed that the inserted fragment in pCAGGS-Flag-T7opt did not mutate (see Figure 6). The plasmid is preferably a pCAGGS-T7opt plasmid. The insertion sites of the pSBtet-puro are preferably EcorI and XhoI. The cloning method preferably uses restriction enzyme sites to respectively cut the target fragment and the backbone vector, and uses a ligation transformation kit to obtain the recombinant vector pSBtet-Flag-T7opt plasmid (see Figure 7).

[0073] In the present application, the mass ratio of the recombinant vector containing the gene encoding T7 RNA polymerase to the recombinant vector containing the transposase is preferably 9:1. The recombinant vector containing the transposase comprises SB100X. The mammalian cell is preferably a BHK-21 cell line. The BHK-21 cell line is derived from the Chinese Academy of Sciences Cell Bank (BHK-21[C-13] catalog number GNHa10).

[0074] In the present application, after the co-transfection, screening is preferably performed, and the screening method is preferably to perform screening and culture in DMEM culture medium containing 10% FBS and 5 μg / mL puromycin, and the medium is replaced every 2 days to obtain a stably transfected cell line named: BHK-Flag-T7opt.

[0075] In the present application, the cell lines were tested and Flag tags were detected in all of them, indicating that the cell lines successfully expressed T7 RNA polymerase.

[0076] In the present application, the method for preparing the replication-deficient recombinant virus, taking Sendai virus as an example, is preferably to co-transfect SEV-GFP-ΔF plasmid, pCAGGS-NP plasmid, pCAGGS-P plasmid, pCAGGS-L plasmid, and pCAGGS-Fwt plasmid into BHK-Flag-T7opt cells. 24 hours after transfection, the cells are replaced with a medium, and an antibiotic selection is performed for 72 hours to obtain a packaging cell line. Upon testing, green fluorescent protein expression was observed in the packaging cell line. The mass ratio of the SEV-GFP-ΔF plasmid, pCAGGS-NP plasmid, pCAGGS-P plasmid, pCAGGS-L plasmid, and pCAGGS-Fwt plasmid is preferably 6:1:1:4:1. The construction methods of the pCAGGS-NP plasmid, pCAGGS-P plasmid, and pCAGGS-L plasmid are preferably carried out according to the method disclosed in CN112538498B (see Figures A, B, and C in Figure 1 and Figure 10 of the accompanying drawings of the invention specification for details). The spectrum of the SEV-GFP-ΔF plasmid is shown in Figure 10.

[0077] In the present application, the method for producing replication-defective recombinant virus preferably involves transfecting a recombinant vector containing the CRE gene into the cell line for amplifying the replication-defective recombinant virus, co-culturing the transfected cell line with the transfected cell line for packaging the replication-defective recombinant virus, and collecting the virus.

[0078] The transfection method for the recombinant vector containing the CRE gene is not particularly limited in this application; any transfection method known in the art can be used. For example, pCAG-Cre:GFP was prepared by removing the GFP gene. The pCAG-Cre:GFP vector was purchased from Miaoling Biotechnology under the product number P0734. The co-culture is preferably performed by overlaying the transfected cell line on a layer of BHK-Flag-T7opt cells and culturing for 4 days.

[0079] This application includes two conditional expression schemes: Cre recombinase-induced conditional expression. After adding Cre recombinase, Cre recombinase will cut the DNA sequence before the first loxP and the second loxP, leaving the second loxP and the subsequent target gene in the genome. Doxycycline-induced conditional expression, on the other hand, adds tetracycline drugs (Doxycycline-inducible Gene Expression) to turn on the switch, allowing the target protein to be expressed.

[0080] In the present application, the amplified replication-defective virus was tested using a hemagglutination test, and the test results showed that the hemagglutination titer ranged from 1:8 to 1:32.

[0081] The following is a detailed description of the preparation method of a cell line for amplifying a replication-defective recombinant virus, the defective virus and its application provided by the present application in conjunction with the examples. However, they should not be construed as limiting the scope of protection of the present application.

[0082] Example 1

[0083] A method for preparing a cell line for amplifying replication-defective recombinant viruses

[0084] 1. Preparation of pCALPdL-empty recombinant plasmid

[0085] The CALPdL-linear sequence (SEQ ID NO: 2) was synthesized using pUC57-simple as a backbone vector to obtain pUC-CALPdL.

[0086] The pCAGGS-GFP plasmid and pUC-CALPdL were digested with SpeI-HF and XbaI, and the 1616 bp fragment (including the CAG promoter) obtained by digestion of the pCAGGS-GFP backbone was inserted into the SpeI-HF and XbaI of pUC-CALPdL to obtain pCALPdL-empty.

[0087] 2. Construction of pUC57-Fwt-Flag and pUC57-F5R-Flag plasmids

[0088] The Fwt-Flag fragment was amplified using primers for PCR. The reaction procedure is shown in Table 1. The reaction system was a 50 μl reaction system. The details are shown in Table 2.

[0089] Table 1 Reaction procedure for amplifying Fwt-Flag fragment

[0090] Table 2 6. PCR reaction concentration and dosage

[0091] The primer sequences are as follows:

[0092] F-Nco1-for:

[0093] aaaggcctctgaggccgaattcccatggggaaacatgacagcatatatccagaggtcacagtgc (SEQ ID NO: 5);

[0094] F-flag-Sfi1-rev:

[0095] atggcctgacaggccctcgagtcaCTTATCGTCGTCATCCTTGTAATCtcttttctcagccatcgcatcaaac (SEQ ID NO: 6).

[0096] The Fwt-Flag fragment was amplified and then treated with T4 PNK to phosphorylate the 5' and 3' ends of the DNA. The fragment was then ligated with the pUC57 linearized fragment to obtain the pUC57-Fwt-Flag plasmid.

[0097] The pUC57-F5R-Flag plasmid was obtained in the same way.

[0098] The two plasmids obtained were sequenced and verified, and the sequencing results were correct and had no point mutations.

[0099] 3. Preparation of pCALPdL-Fwt-Flag and pCALPdL-F5R-Flag Plasmids

[0100] The pUC57-Fwt-Flag or pUC57-F5R-Flag plasmid was digested with EcoI and XhoI, and the digested DNA fragment was ligated to the pCALPdL-empty plasmid to obtain pCALPdL-Fwt-Flag (see Figure 4 for the spectrum) or pCALPdL-F5R-Flag.

[0101] 4. Co-transfect LLC-MK2 cell line with pCALPdL-Fwt-Flag and SB100X to obtain LLCMK2-Fwt-Flag cell line

[0102] 3.6 μg of pCALPdL-Fwt-Flag and 0.4 μg of SB100X plasmid were co-transfected into LLC-MK2 cell line using ExFect Transfection Reagent (Cat. No. T101-01) according to the instructions.

[0103] Two days after transfection, the cells were cultured in DMEM medium containing 10% FBS and 5 μg / mL puromycin (puromycin White Shark Product No. BS111-25mg). The medium was changed every two days. After three changes of medium, a stable cell line was obtained, which was named: LLC-MK2-Fwt-Flag.

[0104] Similarly, LLC-MK2-F5R-Flag cell line was obtained.

[0105] 5. Cell Line Expression Detection

[0106] LLC-MK2-Fwt-Flag and LLC-MK2-F5R cell lines were cultured in 6-well plates and the cells were counted, 2 × 10 5 The cells were transfected with 2 μg of pCAGGS-CRE plasmid. After 72 h, the cells were digested with 0.25% trypsin solution, collected, and lysed with 100 μL of cell lysis buffer.

[0107] 15 μL of each sample was used for protein electrophoresis, and then western blot was performed to detect the Flag tag and GAPDH protein (the Flag tag detection antibody was CSTAnti-FLAG product number: 14793S, and the GAPDH detection antibody was Santa Cruz product number SC365062).

[0108] The test results are shown in Figure 8. The cell line transfected with Fwt showed higher expression levels, so LLC-MK2-Fwt-Flag was selected for downstream experiments.

[0109] Example 2

[0110] 1.1 Insert the Flag tag into the N-terminus of the T7 RNA polymerase from the pCAGGS-T7opt plasmid to generate pCAGGS-Flag-T7opt. Amplify the two fragments using the following primer pairs:

[0111] Primer pair 1:

[0112] N-Flag-T7opt-for: atggactacaaggacgatgacgacaaGatgaacaccatcaatattgccaagaacg (SEQ ID NO: 9);

[0113] Amp-rev:CATGAGTGATAACACTGCGGCCAACTTAC (SEQ ID NO: 10).

[0114] The reaction system was a 50 μl reaction system, and the reaction procedure was shown in Table 3.

[0115] Table 3 Reaction procedure

[0116] A 5158 bp DNA fragment was amplified and named Flag-T7opt-5K.

[0117] Primer pair 2:

[0118] Amp-for:GTGTTATCACTCATGGTTATGGCAGCACTG(SEQ ID NO:11)

[0119] N-Flag-T7opt-rev: GTCCTTGTAGTCCATGGTGGCGAATTCTTTGCCAAAATG (SEQ ID NO: 12).

[0120] The reaction system was a 50 μl reaction system, and the reaction procedure was shown in Table 4.

[0121] Table 4 Reaction procedure

[0122] A 2280 bp DNA fragment was amplified and named Flag-T7opt-2K.

[0123] The two fragments Flag-T7opt-5K and Flag-T7opt-2K were cloned using the Novezan ClonExpress Ultra One Step Cloning Kit (Cat. No. C115-01) according to the instructions to obtain a plasmid with a Flag tag added to the N-terminus: pCAGGS-Flag-T7opt.

[0124] Sequencing verification showed that the insertion was correct and there was no mutation.

[0125] 2. Insert N-Flag-T7opt into pSBtet-puro to obtain pSBtet-Flag-T7opt

[0126] Digest pCAGGS-Flag-T7opt with EcoI and XhoI to obtain the N-Flag-T7opt DNA fragment. Digest pSBtet-puro with EcoI and XhoI to obtain the pSBtet-puro plasmid vector backbone. Ligate and transform the N-Flag-T7opt DNA fragment and the pSBtet-puro plasmid vector backbone using Novezan T4 DNA Ligase (Cat. No. C301-01) to obtain the pSBtet-Flag-T7opt plasmid.

[0127] 3. Co-transfect pSBtet-N-Flag-T7opt and SB100X into BHK-21 cell line, and screen to obtain BHK-21-Flag-T7opt, which is the target cell line.

[0128] 3.6 μg of pSBtet-N-Flag-T7opt plasmid and 0.4 μg of SB100X plasmid were co-transfected into BHK-21 cell line using ExFect Transfection Reagent (Cat. No. T101-01) according to the instructions.

[0129] Two days after transfection, cells were cultured in DMEM medium containing 1.0 μg / mL puromycin (White Shark Catalog No. BS111-25 mg). The medium was changed every two days. After three changes of medium, a stable cell line was obtained, which was named: BHK-Flag-T7opt.

[0130] 4. Cell Line Expression Detection

[0131] The BHK-Flag-T7opt cell line was cultured in a 6-well plate. When the cell confluence reached 80%, doxycycline was added to DMEM complete medium at a concentration of 1.0 μg / mL. After 48 hours, the cells were digested with 0.25% trypsin solution, and the cells were collected and lysed with 100 μL of cell lysis buffer.

[0132] 15 μL of each sample was used for protein electrophoresis, and then western blot was performed for detection to detect the Flag tag (the Flag tag detection antibody was CSTAnti-FLAG, catalog number: 14793S).

[0133] The detection results are as follows: the expression of T7opt can be detected at around 98 kd ( FIG. 9 ).

[0134] Example 3

[0135] Method for packaging F protein-deficient Sendai virus

[0136] 1. The construction method of SEV-GFP-ΔF plasmid (see Figure 10 for the spectrum) is as follows:

[0137] The F gene is removed using DNA molecular biology. The specific steps are as follows:

[0138] 1. PCR amplification was performed using pUC57-Sev as a template using the following primers. The reaction procedure was: initial denaturation at 95°C for 30 seconds; denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 5 minutes, 30 cycles; complete extension at 72°C for 5 minutes, and storage at 12°C. The MFHN fragment (5061 bp) was obtained.

[0139] P-end-for(31-mer):CGTAGAAGAGGACATAGAGTCACTGACCAAC(SEQ ID NO:13);

[0140] L-start-rev(20-mer):GGGAGGACTCCTGCCCATCC(SEQ ID NO:14);

[0141] The MFHN fragment was blunt-ended and ligated into the linearized pUC57 plasmid to generate the recombinant vector pUC57-MFHN.

[0142] 2. PCR amplification was performed using the following primers using the pUC57-MFHN plasmid as a template. The reaction procedure was: pre-denaturation at 95°C for 30 seconds; denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 5 minutes, 30 cycles; complete extension at 72°C for 3.5 minutes, and storage at 12°C. The vector fragment (3283 bp) was obtained.

[0143] Vector.FOR(37-mer):AACTTAGGGATAAAGTGAGGTCGCGCGGTACTTTAGC(SEQ ID NO:15);

[0144] Vector.REV(33-mer):GAGATAGGTGCCTCACTGATTAAGCATTGGTAA(SEQ ID NO:16);

[0145] 3. PCR amplification was performed using the pUC57-MFHN plasmid as a template using the following primers. The reaction procedure was: pre-denaturation at 95°C for 30 seconds; denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 5 minutes, 30 cycles; complete extension at 72°C for 5 minutes, and storage at 12°C. A fragment (2841 bp) was obtained.

[0146] Fragment.FOR(42-mer):CTTTATCCCTAAGTTTTTCTTATTTAAGACAAGGAGTGACCC(SEQ ID NO:17);

[0147] Fragment.REV(26-mer):TGAGGCACCTATCTCAGCGATCTGTC(SEQ ID NO:18);

[0148] 4. The Vector fragment (3283 bp) and the Fragment fragment (2841 bp) were cleaved using the CloneExpress kit (Novagen, Cat. No. C115) according to the instructions, with a 10 μL reaction system and a reaction at 50°C for 15 min to construct the plasmid pUC57-defect-F.

[0149] 5. pUC57-defect-F was digested with Not1 (NEB, Catalog No. R0189S) and Age1 (NEB Catalog No. R3552S) to obtain a 2262 bp fragment;

[0150] The Sev-KOS (Y942H) plasmid (the Sev-KOS (Y942H) plasmid in FIG. 8 described in CN 112538498A) was digested with Not1 (NEB, catalog number R0189S) and Age1 (NEB catalog number R3552S) to obtain two fragments of 10135 bp and 4312 bp.

[0151] The three fragments were ligated using T7 DNA polymerase (Novizan, Cat. No. C301) to obtain the Sev-DelF-type1 plasmid with the F gene removed.

[0152] The expected simulated electropherogram is shown in Figure 11. The successful F gene knockout was verified as follows: Hind3 and Afe1 restriction endonucleases were used for digestion and the results were compared with the software simulation results. The results were consistent, indicating successful excision of the Sendai virus F gene. The verification results are shown in Figure 12. Simulation result #1 is a wild-type SEV-PM with the F gene retained, and #2 is a Sev-DelF-type1 with the gene excised.

[0153] 2. The mass ratio of SEV-GFP-ΔF plasmid, pCAGGS-NP plasmid, pCAGGS-P plasmid, pCAGGS-L plasmid, and pCAGGS-Fwt plasmid is preferably 6:1:1:4:1. The construction method of the pCAGGS-NP plasmid, pCAGGS-P plasmid, and pCAGGS-L plasmid was completed with reference to the method disclosed in CN112538498B (see Figures 1A, B, and C and Figure 10 of the accompanying drawings in the specification of the invention for details).

[0154] 3 μg SEV-GFP-ΔF plasmid; 0.5 μg pCAGGS-NP plasmid, 0.5 μg pCAGGS-P plasmid, 2 μg pCAGGS-L plasmid, 0.5 μg pCAGGS-Fwt plasmid; according to the instructions of ExFect Transfection Reagent (Cat. No. T101-01). The above plasmids were transfected into 5×10 5 In BHK-Flag-T7opt cells, the cell medium was changed 24 hours after transfection and 1.0 μg / mL doxycycline was added. Green fluorescent protein expression could be detected 72 hours later.

[0155] Example 4

[0156] 1. Amplification of F protein-deficient Sendai virus

[0157] Day-1 LLC-MK2-Fwt-Flag cells were transfected with pCAGGS-CRE plasmid. 5 Cells were transfected with 5 μg of pCAGGS-CRE plasmid.

[0158] On Day 0, LLC-MK2-Fwt-Flag cells transfected with pCAGGS-CRE were digested with trypsin and overlaid on the BHK-Flag-T7opt cells.

[0159] On Days 1-4, the complete culture medium was replaced with serum-free DMEM (5.0 μg / mL recombinant trypsin was added to the serum-free DMEM). After 4 days, more than 50% of the cells could be detected to express green fluorescent protein under a fluorescence microscope.

[0160] SEV-GFP-ΔF Sendai virus can be amplified by adding newly pCAGGS-CRE-transfected LLC-MK2-Fwt-Flag cells to the culture medium.

[0161] 2. Detection of F protein-deficient Sendai virus

[0162] The cell supernatant was collected and tested by hemagglutination assay. 50 μl of cell supernatant was added to the leftmost well, followed by 50 μl of PBS (phosphate-buffered saline) to the right well. The concentration in the right well was then diluted to half that of the left well. After dilution, 50 μl of 1% SPF chicken red blood cells was added to each well. The cells were incubated at room temperature for 40 minutes, and the results were recorded.

[0163] The results are shown in Figure 14. The hemagglutination titers ranged from 1:8 to 1:32. Titer determination of F protein-deficient Sendai virus was performed, which varied depending on the incubation time.

[0164] Example 5

[0165] Concentration of F protein-deficient Sendai virus

[0166] 1. Remove organelle impurities by centrifuging the cell supernatant at 15,000 g for 10 minutes, and take the cell supernatant for subsequent experiments.

[0167] 2. Centrifuge at 30,000 g and 4°C for 14 h to obtain viral pellet.

[0168] 3. Use sucrose density gradient centrifugation at 30,000 g and 4°C for 10 h to obtain a virus intermediate layer between 70% sucrose and 30% sucrose.

[0169] 4. Dilute the viral middle layer with PBS and centrifuge at 30,000 g at 4°C for 10 h to obtain the purified Sendai virus precipitate.

[0170] The results are shown in Figure 15. It can be seen that a clear layer of precipitate, which is purified Sendai virus, appears at the portion indicated by the arrow.

[0171] Example 5

[0172] Determination of the ratio of transposase plasmid to transposon plasmid

[0173] 500 ng of transposon plasmid (pCALPdL-GFP) was used, and the transposase plasmid was added at 10 ng, 50 ng, 250 ng, 500 ng and 1000 ng, respectively, for 5 groups of conditions (see Table 5). 2×10 4 LLC-MK2 cells were transfected using ExFect Transfection Reagent (Cat. No. T101-01) according to the manufacturer's instructions. The assay was performed in a 12-well plate with 4 wells per group.

[0174] Two days after transfection, cells were cultured in DMEM supplemented with 10% FBS and 5 μg / mL puromycin (White Shark Catalog No. BS111-25mg). The medium was changed every two days, and after three changes, clones of stably transfected (pCALPdL-GFP) cells were obtained. Seven days later, cells were cultured in DMEM supplemented with 10% FBS and 2.5 μg / mL puromycin. All cells were transfected with the pCAGGS-Cre plasmid, and the number of cell clones showing GFP fluorescence was counted.

[0175] The results are shown in Table 6 and Figure 16.

[0176] Table 5 Ratio of transposase plasmid and transposon plasmid

[0177] The number of clones in different treatment groups is shown in Table 6.

[0178] Table 6 Number of clones in different treatment groups

[0179] Example 6

[0180] Genetic stability experiment of LLC-MK2-Fwt-Flag cells

[0181] The experimental method is as follows: LLC-MK2-Fwt-Flag cells were passaged every 3 days on average, and the highest generation was 15, which was recorded as F15, and so on. 6 LLC-MK2-Fwt-Flag cells were transfected with 5 μg of pCAGGS-Cre plasmid, and Flag tag expression was measured 48 hours later. Flag tag expression was determined by Western blot. 15 μL of each sample was subjected to protein electrophoresis, followed by Western blot analysis to detect the Flag tag (Flag tag detection antibody used was CST Anti-FLAG, Catalog No. 14793S).

[0182] The results are shown in Figure 17. The test results showed that the F1, F7 and F15 generations all had similar expression levels, thus confirming that the cell line remained stable.

[0183] Example 7

[0184] Cells constructed with the PeggyBac transposon system and their detection methods

[0185]

[0186] Two days after transfection, cells were cultured in DMEM medium containing 10% FBS and 5 μg / mL puromycin (puromycin White Shark Catalog No. BS111-25mg). The medium was changed every two days and then three times to obtain a stable cell line. This stable cell line was named: PB-LLC-MK2-Fwt-Flag. The PB-LLC-MK2-Fwt-Flag cell line was cultured in a 6-well plate and the cells were counted. 2×10 5 The cells were transfected with 2 μg of pCAGGS-CRE plasmid. After 72 h, the cells were digested with 0.25% trypsin solution, collected, and lysed with 100 μL of cell lysis buffer.

[0187] 15 μL of each sample was used for protein electrophoresis, and then western blot was performed to detect Flag tag proteins (Flag tag detection antibody is CSTAnti-FLAG catalog number: 14793S).

[0188] The test results are shown in Figure 19. The PB transposon system also enables genomic integration and expression of wild-type F protein.

[0189] Example 8

[0190] Comparative experiment between transposon method and non-transposon method

[0191] The test method is as follows: the test was carried out in two groups, with 3 replicates in each group;

[0192] Group #1: 2 x 10 5 LLC-MK2 cells were transfected with 4.5 μg of pCALPdL-Fwt-Flag plasmid and 0.5 μg of SB100X plasmid (mock transposon method);

[0193] Group #2: 2×10 5 LLC-MK2 cells were transfected with 4.5 μg of pCALPdL-Fwt-Flag plasmid (mimicking the non-transposon method);

[0194] After transfection, selection was performed using 5 μg / ml puromycin for 7 consecutive days. On day 8, crystal violet staining was performed. The area of ​​crystal violet staining is proportional to the number of LLC-MK2 cells with puromycin resistance (cells that have successfully integrated puromycin resistance). Wells 1, 2, and 3 (the top three wells) simulate group #1, which uses a non-transposon method; wells 4, 5, and 6 (the bottom three wells) simulate group #2, which uses a transposon method. The area of ​​the designated stained region was measured using ImageJ, and the gene integration efficiency was calculated based on the ratio of pixel areas.

[0195] The results are shown in Figure 20. The results show that the crystal violet-stained area of ​​the transposon method is greater than the crystal violet-blue area of ​​the non-transposon method by more than 200, and the gene integration efficiency of the transposon method is more than 200 times higher than that of the non-transposon method.

[0196] The above is only a preferred embodiment of the present application. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present application. These improvements and modifications should also be regarded as the scope of protection of the present application.

Claims

1. A method for preparing a cell line for amplifying a replication-deficient recombinant virus, characterized in that: The following steps are involved: The CALPdL-linear sequence recognized by the synthetic transposon system is cloned into a plasmid to obtain a recombinant vector containing CALPdL-linear, and a CAG promoter sequence is inserted into the recombinant vector containing CALPdL-linear to obtain a recombinant vector containing CALPdL-CAG; Amplifying viral genes associated with replication and cloning them into the recombinant vector containing CALPdL-CAG to obtain a recombinant vector containing CALPdL-CAG-replication-associated viral genes; The recombinant vector containing the CALPdL-CAG-replication-related viral gene and the recombinant vector containing the transposase are co-transfected into mammalian cells to obtain a cell line for amplifying replication-deficient recombinant viruses.

2. The method for preparing a cell line for amplifying a replication-deficient recombinant virus according to claim 1, characterized in that: The viruses include Paramyxoviruses.

3. The method for preparing a cell line for amplifying a replication-deficient recombinant virus according to claim 2, characterized in that: The Paramyxovirus includes Sendai virus.

4. The method for preparing a cell line for amplifying a replication-deficient recombinant virus according to claim 3, characterized in that: The gene associated with replication of the Sendai virus is the F gene.

5. The method for preparing a cell line for amplifying a replication-deficient recombinant virus according to claim 4, characterized in that: The nucleotide sequence of the F gene is shown in SEQ ID NO:

1.

6. The method for preparing a cell line for amplifying a replication-deficient recombinant virus according to claim 1, characterized in that: The nucleotide sequence of the CALPdL-linear is shown in SEQ ID NO: 2 or SEQ ID NO:

3.

7. The method for preparing a cell line for amplifying a replication-deficient recombinant virus according to claim 1, characterized in that: The nucleotide sequence of the CAG promoter sequence is shown in SEQ ID NO:

4.

8. The method for preparing a cell line for amplifying a replication-deficient recombinant virus according to claim 1, characterized in that: The mass ratio of the recombinant vector containing the CALPdL-CAG-replication-related viral gene to the recombinant vector containing the transposase is 9:

1.

9. The method for preparing a cell line for amplifying a replication-deficient recombinant virus according to any one of claims 1 to 8, characterized in that: The recombinant vector containing the transposase is SB100X or PBase.

10. A cell line for amplifying a replication-deficient recombinant virus prepared by the preparation method according to any one of claims 1 to 9.

11. Use of the cell line for amplifying replication-defective recombinant virus according to claim 10 in producing replication-defective recombinant virus.

12. The use according to claim 11, characterized in that: The replication-deficient recombinant virus includes Sendai virus lacking the F gene.

13. The use according to claim 11, characterized in that: The packaging method of the replication-deficient recombinant virus comprises the following steps: Cloning the coding gene of T7 RNA polymerase into a plasmid to obtain a recombinant vector containing the coding gene of T7 RNA polymerase; Co-transfecting mammalian cells with the recombinant vector containing the T7 RNA polymerase encoding gene and the recombinant vector containing the transposase gene, and obtaining a replication-deficient recombinant virus packaging cell line after screening; The recombinant vector containing the viral genome lacking the viral gene related to replication and the recombinant vector containing each gene of the virus are co-transfected into the replication-deficient recombinant virus packaging cell line to obtain the transfected replication-deficient recombinant virus packaging cell line.

14. The use according to claim 13, characterized in that: The mass ratio of the recombinant vector containing the T7 RNA polymerase encoding gene to the recombinant vector containing the transposase gene is 9:

1.

15. The use according to claim 14, characterized in that: The recombinant vector containing the transposase includes SB100X.

16. The use according to any one of claims 11 to 15, characterized in that: The method for producing replication-deficient recombinant virus comprises transfecting a recombinant vector containing a CRE gene into a cell line for amplifying the replication-deficient recombinant virus, co-culturing the transfected cell line with the transfected cell line for packaging the replication-deficient recombinant virus, and collecting the virus.

Images