Probe for measuring capping rate of mRNA sample, and kit and use method therefor

Abstract

The present invention relates to the technical field of biology, and in particular to a probe for measuring the capping rate of an mRNA sample, and a kit and a use method therefor. The kit comprises a probe, a specific probe design form is RNA fragment 0-50 nt + DNA fragment 1-10 nt + RNA fragment 0-50 nt, and selenium substitution is carried out on one or more bases on the DNA fragment; and the part of the DNA fragment of the probe that is not substituted with selenium is specifically cut by an RNase H fast-cutting enzyme. The kit can be used to measure the capping rates of mRNA of different lengths, the results are accurate and stable, retention time and capping rate result RSDs are less than 1%.

Description

Probe, kit and method of use for detecting capping rate of mRNA samples Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a probe and a kit for detecting the capping rate of an mRNA sample, and a method for using the same. Background Art

[0002] The cap structure is an essential component for mRNA to perform its biological functions in the body. Simply put, the mRNA cap structure has two main functions: first, it recruits the protein translation machinery in the cell, allowing the mRNA to be translated into proteins that perform specific biological functions; second, it enhances mRNA stability, preventing degradation by intracellular endonucleases. Given the cap structure's crucial functions, measuring the mRNA capping rate is undoubtedly one of the most critical indicators in analyzing the quality of mRNA production processes.

[0003] mRNA molecules typically weigh hundreds to thousands of kilodaltons, while the cap structure is only about 500 daltons. The tiny cap structure is barely discernible against the larger mRNA molecule, resulting in extremely subtle differences between capped and uncapped mRNA—just a single nucleotide or methyl group difference—that are difficult to detect using conventional separation and analysis methods. Researchers investigating mRNA capping rates have been aware of this issue from the outset. Therefore, they have used enzymatic degradation or cleavage methods, such as RNase T2, RNase H, and Ribozyme, to reduce the massive mRNA molecules to analyzable isotope-labeled single nucleotides or short 5'-terminal sequences. Combined with pyrophosphohydrolases (TAP or RppH), capping orientation can also be detected. Using polyacrylamide gel electrophoresis, capillary gel electrophoresis, or LC-MS systems, researchers can distinguish and quantify these short cap-bearing fragments, ultimately determining the mRNA capping rate.

[0004] RNase H is an endonuclease that removes RNA primers from fragments during DNA replication or processes R-Loops, regulating R-Loop-mediated biological processes such as gene expression, DNA replication, and DNA or histone modifications. In vitro, studies have reported that Escherichia coli RNase H can utilize DNA-RNA chimeric structures to cleave single-stranded RNA at specific sites. However, the presence of one or more RNase H cleavage sites results in heterogeneous 5'-terminal short cleavage fragments that differ by one or several nucleotides.

[0005] Liquid chromatography-mass spectrometry can convert changes in the composition and content of different sample effluents into mass spectrometric signals, which can be measured by mass spectrometry instruments to achieve qualitative and quantitative characterization of the purity and integrity of mRNA products. However, this method requires a high sample volume and is prone to generating ion summation peaks. Furthermore, liquid chromatography-mass spectrometry can also produce unstable results for mRNA detection, manifested in non-repetitive chromatographic peak retention times and large variations in capping rates.

[0006] Summary of the Invention

[0007] In order to address the deficiencies of the prior art, the present invention discloses the following solutions to solve the problems that the existing liquid chromatography-mass spectrometry method is prone to generating ion summation peaks, and the capping rate detection results of mRNA fragments obtained by RNase H rapid digestion are unstable and the sample consumption is large:

[0008] The first aspect of the present invention discloses a customized probe. Specifically, the customized probe is designed as an RNA fragment (0-50 nt) + a DNA fragment (1-10 nt) + an RNA fragment (0-50 nt), with one or more bases in the DNA fragment substituted with selenium. Selenium substitution specifically refers to replacing the oxygen atom in the phosphate group of the deoxyribonucleic acid with a selenium atom. The customized probe is reverse complementary to a specific region at the 5' end of the mRNA to be detected. The unselenosubstituted portion of the DNA fragment in the customized probe is specifically cleaved by RNase H.

[0009] Preferably, the probe is designed in the form of RNA fragment 0-50nt+DNA fragment 2-10nt+RNA fragment 0-50nt.

[0010] The DNA fragment can also be selected from any length of 3, 4, 5, 6, 7, 8, or 9 nt.

[0011] Preferably, the customized probe is designed in the form of a 10 nt RNA fragment + a 6 nt DNA fragment + a 10 nt RNA fragment, and one or more bases on the DNA fragment are substituted with selenium.

[0012] After selenium substitution, the likelihood of enzyme cleavage is reduced, resulting in a preference for enzyme cleavage at the only unsubstituted fourth position of the DNA, which improves enzyme cleavage specificity. This type of design can increase enzyme cleavage specificity from less than 50% previously to over 90%.

[0013] The second aspect of the present invention discloses the use of a combination of a specially prepared mobile phase for nucleic acid analysis, a specially prepared system flushing fluid for nucleic acid analysis, and the above-mentioned customized probes in a kit for detecting mRNA capping rate.

[0014] The nucleic acid mobile phase and flushing solution are prepared with perfluorotriethylamine and benzene as main raw materials. The unique formula and production process of the nucleic acid-specific mobile phase are as follows: phase A: 1% hexafluoroisopropanol + 0.1% perfluorotriethylamine + 0.1% benzene + 98.8% aqueous solution; phase B: 0.5% hexafluoroisopropanol + 0.05% perfluorotriethylamine + 0.05% benzene + 65% ethanol + 34.4% aqueous solution. The entire process is prepared in a plastic PET material container, mixed thoroughly, and then ultrasonicated in an ice-water bath for 10-30 hours. After bottling, the mobile phase is nitrogen-filled and stored.

[0015] The unique formula and production process of the liquid phase system flushing fluid are as follows: 25% methanol, 25% acetonitrile, 25% isopropanol, 24.8% water, 0.1% perfluorotriethylamine, 0.1% benzene, 10mM EDTA; the entire process is prepared in plastic PET material containers and stored in nitrogen after bottling.

[0016] The functions of the above-mentioned mobile phase for nucleic acid analysis and the system flushing liquid for nucleic acid analysis are: first, they can significantly reduce the ion sum peak signal from more than ten ion sum peaks to only the Na ion sum peak; second, they can significantly improve the peak shape and substance separation.

[0017] The above-mentioned nucleic acid-specific mobile phase, high-efficiency system flushing fluid and customized probe can achieve accurate detection of mRNA capping rate by liquid chromatography-mass spectrometry.

[0018] The above kit also includes the following when actually used: RNase H fast cutting enzyme, nuclease-free buffer set, high-load SA magnetic beads, nuclease-free low adsorption consumables set and ultra-high efficiency oligonucleotide separation special chromatographic column.

[0019] Preferably, the nuclease-free buffer set includes solution 1: RNase H reaction buffer; solution 2: 0.1M NaCl; solution 3: 5mM Tris-HCl, 0.5mM EDTA, 60mM NaCl, pH 7.5; solution 4: 1% methanol / water solution, 100μM EDTA.

[0020] Preferably, the nuclease-free low-adsorption consumables set includes a nuclease-free low-adsorption EP tube, a nuclease-free low-adsorption gun tip and a nuclease-free low-adsorption sample bottle.

[0021] The third aspect of the present invention discloses a method for detecting the mRNA capping rate using the above-mentioned kit, comprising the following steps:

[0022] S1: Use a nuclease-free low-adhesion pipette tip to mix the mRNA to be tested, the customized probe, and Solution 1 in a nuclease-free low-adhesion EP tube and anneal according to the annealing procedure;

[0023] S2: Use a nuclease-free low-adsorption pipette tip to transfer the high-load SA magnetic beads to a nuclease-free low-adsorption EP tube and wash the magnetic beads with solution 2;

[0024] S3: Use a nuclease-free low-adhesion pipette tip to mix the annealed solution with the washed magnetic beads and incubate at 37°C for 30 minutes.

[0025] S4: Use a nuclease-free low-adsorption pipette tip to transfer RNase H fast digestion enzyme into the S3 solution and incubate at 37°C for 3 hours to enzymatically digest the hybridized double strands connected to the magnetic beads;

[0026] S5: Wash the magnetic beads in S4 using solution 3;

[0027] S6: Use a nuclease-free low-adsorption pipette tip to transfer solution 4 and mix it with the magnetic beads in S5. Incubate at 80°C for 3 minutes, transfer it to a magnetic stand for adsorption, and quickly aspirate the supernatant and transfer it to a nuclease-free low-adsorption sample bottle.

[0028] S7: Rinse the HPLC system with the dedicated nucleic acid analysis system flushing solution;

[0029] S8: The mRNA fragments obtained in S6 are subjected to liquid chromatography-mass spectrometry analysis using a mobile phase specifically for nucleic acid analysis and a super-efficient oligonucleotide separation column;

[0030] S9: Analyze the obtained chromatogram mass spectrum and calculate the capping rate.

[0031] Preferably, the ratio of mRNA to the customized probe is in the range of 1:10-10:1.

[0032] Preferably, the high-load SA magnetic beads are ferroferric oxide magnetic beads with a particle size of 30-3000 nm, coated with streptavidin.

[0033] Compared with the prior art, the present invention has the following significant effects:

[0034] (1) The present invention currently does not have such a complete mRNA detection kit on the market; using this kit, the sample requirement is reduced by one tenth compared with the literature method, and the results are accurate and stable. The retention time and capping rate results RSD <1%. Note: Because the production cost per unit mass of mRNA is high, the sample cost of the test is high. Reducing the sample requirement to one tenth can significantly reduce the sample cost of the test. Specifically, the cost of mRNA preparation is about 20 yuan / 100μg. The existing mRNA capping rate detection method requires 500pmol mRNA, which is calculated based on a molecular weight of 1000000Da and a mass of 500μg. In this way, the sample cost required for the test is as high as 100 yuan. However, using the method described in this patent, due to the improvement of the signal intensity per unit sample, the sample amount can be reduced to 50pmol mRNA, and the sample cost can be reduced to 10 yuan.

[0035] (2) The technical solution of obtaining customized probes by selenium substitution in the present application reduces the possibility of endonuclease cleavage at other sites, causing the enzyme cleavage to be more inclined to the DNA where only the fourth position is not substituted, thereby improving the enzyme cleavage specificity, and increasing the enzyme cleavage specificity from less than 50% previously to more than 90%; thereby keeping the fragments after enzyme cleavage consistent, and making the chromatographic peak retention time in chromatography-mass spectrometry highly consistent; the results of the capping rate determination calculation are stable and accurate.

[0036] (3) The functions of the mobile phase and flushing solution for nucleic acid analysis are: first, they can significantly reduce the ion sum peak signal from more than ten ion sum peaks to only the Na ion sum peak; second, they can significantly improve the peak shape and substance separation.

[0037] (4) A patented method was used to measure the capping rate of mRNAs of different lengths, with each length sample tested seven times in parallel. The results were accurate and stable, with RSDs of retention time and capping rate results <1%. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] FIG1 is a sample spectrum detected by LC-MS in Example 1.

[0039] FIG2 is a sample spectrum obtained after sample pretreatment using a conventional probe in Example 2.

[0040] FIG3 is a sample spectrum obtained after sample pretreatment using a selenium-substituted probe in Example 2. DETAILED DESCRIPTION

[0041] The present invention is further illustrated by way of examples below, but the present invention is not limited to the scope of the examples. Experimental methods in the following examples where specific conditions are not specified were performed according to conventional methods and conditions, or selected according to the product specifications.

[0042] Example 1 Actual sample detection

[0043] Through continuous experiments and verification, the inventors of the present invention established a new test kit detection method for capping rate.

[0044] Scope of application: It can be used for sample detection of mRNA produced by different capping processes, different types of cap structures, and different LC-MS systems.

[0045] Technical difficulties: The production cost per unit mass of mRNA is high, and the sample testing cost is high; using LC-MS to detect the mRNA capping rate is prone to produce ion summation peaks; the mRNA capping rate detection has unstable results, which is reflected in the non-repetitive retention time of the chromatographic peak and large variations in the capping rate results.

[0046] Solution: Using a combination kit of a special nucleic acid-specific mobile phase, a high-efficiency system flushing fluid, and a customized probe can significantly reduce the ion sum peak signal, from more than ten ion sum peaks to only the Na ion sum peak; secondly, it can significantly improve the peak shape and substance separation.

[0047] The kit components include: (1) mobile phase for nucleic acid analysis; (2) system flushing fluid for nucleic acid analysis; (3) customized probe; (4) RNase H fast-cutting enzyme; (5) nuclease-free buffer set; (6) high-load SA magnetic beads; (7) nuclease-free low-adsorption consumables set; and (8) ultra-high-efficiency oligonucleotide separation-specific chromatographic column.

[0048] The main method flow of the present invention is: first probe annealing, then magnetic bead binding, then dissociation and elution, and finally LC-MS detection.

[0049] Sample processing

[0050] 1. Probe Annealing

[0051] a. Prepare the annealing system according to the following ratio

[0052] b. Anneal at the following temperature

[0053] 2. Magnetic Bead Binding

[0054] a. Pretreatment of magnetic beads

[0055] Equilibrate Beaver 2.8μm SA magnetic beads to room temperature, vortex to mix, and transfer 100μL / reaction to a centrifuge tube. Place on a magnetic rack and remove the storage solution. Resuspend and mix in an equal volume of buffer (0.1M NaOH, 0.05M NaCl). Place on a magnetic rack and remove the supernatant. Add 1mL of 0.1M NaCl solution, invert, centrifuge, and continue washing until the supernatant is neutral.

[0056] b. Incubation

[0057] Dispense 100 μL of resuspended magnetic beads into a centrifuge tube per reaction, place on a magnetic rack, and remove the supernatant. Add 100 μL of annealing solution, pipette evenly, and incubate on a vortexer at 1000 rpm and 37°C for 30 minutes.

[0058] c. RNase H cleavage: Add RNase H (50 units) to the incubated mixture, blow evenly with a pipette, and incubate at 37°C for 3 h.

[0059] d. Cleaning

[0060] The incubated mixed system was placed on a magnetic stand, washed three times with 100 μL of wash buffer (5 mM Tris-HCl, 0.5 mM EDTA, 60 mM NaCl, pH 7.5), and then washed again three times with nuclease-free water.

[0061] 3. Dissociation and elution

[0062] Add 50 μL of dissociation solution (1% methanol / water solution, 100 μM EDTA) that has been preheated to 80°C, then incubate on a vortexer at 1000 rpm and 80°C for 3 minutes. Immediately transfer to a magnetic stand and adsorb for about 1 minute. Quickly aspirate the supernatant and transfer it to a new centrifuge tube. Centrifuge and aspirate 40 μL of the supernatant into a sample bottle.

[0063] 4. LC-MS Analysis

[0064] Mobile phase A: Add 494 mL of ultrapure water (plastic graduated cylinder), 5 mL of hexafluoroisopropanol, 0.5 mL of perfluorotriethylamine, and 0.5 mL of benzene. Mobile phase B: 2.5 mL of hexafluoroisopropanol, 0.25 mL of perfluorotriethylamine, 0.25 mL of benzene, 325 mL of ethanol (glass graduated cylinder), and 172 mL of ultrapure water (plastic graduated cylinder). Shake to mix thoroughly and sonicate on ice for 6 h.

[0065] Instrument parameters:

[0066] Notes: (1) The pipette tips, centrifuge tubes, and sample bottles used in pretreatment were all low-adsorption and RNase-free. The reagents used were Sigma. (2) The mobile phase bottles used were Agilent-specific PET mobile phase bottles. (3) System flushing: Use flushing solution (25% methanol, 25% acetonitrile, 25% isopropanol, 24.8% water, 0.1% perfluorotriethylamine, 0.1% benzene, 10mM EDTA) to flush the LC-MS system for 12 hours. After replacing the mobile phase, purge and flush the system for 0.5 hours before connecting the column.

[0067] The capping rates of mRNAs of different lengths were measured using the kit method of the present invention, with each length sample tested in parallel seven times. The results were accurate and stable, with RSDs of retention time and capping rate results less than 1%, as shown in Tables 1 and 2.

[0068] Table 1

[0069] Table 2

[0070] Example 2 (Verification of the specificity of enzyme cleavage after hybridization of selenoprobe)

[0071] The mRNA capping rate was detected using the following mRNA samples and probes.

[0072] Sequence mRNA: 5'GGAAAUAAACUAGUACUUUUCUGGU3';

[0073] Probe1: 5'dAdCdCdAdGdAAAAGUACUAGUUUAUUUCC3';

[0074] Probe2: 5'dAdCdCdAdGdAAAAGUACUAGUUUAUUUCC3';

[0075] The six DNA sequences in Probe 1 are all unmodified. The first four DNA sequences in Probe 2 are substituted with selenium, the fifth DNA sequence is unmodified, and the sixth DNA sequence is substituted with selenium.

[0076] In addition to the probe, other specific capping rate detection methods use the method of the kit of the present invention.

[0077] When probe 1 was used for capping rate detection, the results are shown in Figure 2. There are four enzyme cleavage sites, namely, cleavage at position 0, cleavage at position 1, cleavage at position 2, and cleavage at position 3. The proportion of cleavage at position 2 is approximately 43%.

[0078] When probe 2 was used for capping rate detection, the results are shown in Figure 3. There are only two enzyme cleavage sites, one at position 1 and the other at position 2. The proportion of enzyme cleavage at position 2 is approximately 91%.

[0079] The above results indicate that using selenium-substituted probes reduces the likelihood of enzyme cleavage, resulting in a preference for cleavage at the only unsubstituted position, the fourth, thus improving enzyme specificity. This design can increase enzyme specificity from less than 50% previously to over 90%.

[0080] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A probe for determining the mRNA capping rate specifically cleaved by RNase H, characterized in that: The probe design is in the form of RNA fragment 0-50nt+DNA fragment 1-10nt+RNA fragment 0-50nt, and one or more bases on the DNA fragment are substituted with selenium; the selenium substitution refers to the replacement of the oxygen atom in the phosphate group on the deoxynucleic acid with a selenium atom; The probe is reversely complementary to the specific segment at the 5' end of the mRNA to be detected; the part of the DNA fragment of the probe that is not selenosubstituted is specifically cut by RNase H fast cutting enzyme.

2. A probe for determining the mRNA capping rate specifically cleaved by RNase H according to claim 1, characterized in that: The probe design is preferably in the form of RNA fragment 0-50nt+DNA fragment 2-10nt+RNA fragment 0-50nt.

3. A kit, characterized in that: The kit comprises a mobile phase for nucleic acid analysis, a system flushing solution for nucleic acid analysis and the probe according to claim 1, and the kit is used to detect the mRNA capping rate; The mobile phase dedicated to nucleic acid analysis and the system flushing solution dedicated to nucleic acid analysis are prepared using perfluorotriethylamine and benzene as raw materials.

4. The kit according to claim 3, characterized in that The following components are also included: RNase H fast cutting enzyme, nuclease-free buffer set, high-load SA magnetic beads, nuclease-free low adsorption consumables set and ultra-efficient oligonucleotide separation special chromatographic column.

5. The kit according to claim 4, characterized in that The nuclease-free buffer set includes solution 1: RNase H reaction buffer; solution 2: 0.1M NaCl; solution 3: 5mM Tris-HCl, 0.5mM EDTA, 60mM NaCl, pH 7.5; solution 4: 100μΜ EDTA.

6. The kit according to claim 5, characterized in that The non-nuclease low-adsorption consumables set comprises a non-nuclease low-adsorption EP tube, a non-nuclease low-adsorption gun tip and a non-nuclease low-adsorption sample bottle.

7. The kit according to claim 6, characterized in that The method for detecting the mRNA capping rate by the kit comprises the following steps: S1: Use a nuclease-free low-adsorption pipette tip to mix the mRNA to be tested, the probe and solution 1 in a nuclease-free low-adsorption EP tube, and anneal according to the annealing procedure; S2: Use a nuclease-free low-adsorption pipette tip to transfer the high-load SA magnetic beads to a nuclease-free low-adsorption EP tube, and wash the magnetic beads with solution 2; S3: Use a nuclease-free low-adsorption pipette tip to mix the annealed solution with the washed magnetic beads and incubate at 37°C for 30 min. S4: Use a low-adsorption pipette tip without nuclease to transfer RNase H fast digestion enzyme into S3 solution, incubate at 37℃ for 3h, and then digest with a magnetic Hybridized duplex linked to beads; S5: Wash the magnetic beads in S4 using solution 3; S6: Use a nuclease-free low-adsorption pipette tip to transfer solution 4 and mix it with the magnetic beads in S5, incubate at 80°C for 3 min, transfer to a magnetic stand for adsorption, and quickly aspirate the supernatant and transfer it to a nuclease-free low-adsorption sample bottle; S7: Rinse the liquid quality control system with the dedicated system flushing solution for nucleic acid analysis; S8: The mRNA fragments obtained in S6 are subjected to liquid chromatography-mass analysis using a mobile phase for nucleic acid analysis and a super-efficient oligonucleotide separation column; S9: Analyze the obtained chromatogram mass spectrum and calculate the capping rate.

8. The kit according to claim 7, characterized in that The ratio of mRNA to the probe is in the range of 1:10-10:

1.

9. The kit according to claim 8, characterized in that The high-load SA magnetic beads are ferroferric oxide magnetic beads with a particle size of 30-3000 nm and coated with streptavidin.

Images