Therapeutic modulation of snora13 for treatment of ribosomopathies

Abstract

Provided herein are nucleic acid inhibitors or activators that impact the expression, levels or activity of SNORA13 in a cell. Also provided are pharmaceutical compositions for using these activators and inhibitors for the treatment of ribosomopathies, cancer, and senescence-associated pathologies.

Description

Attorney Docket No.106546-804769 (4262) THERAPEUTIC MODULATION OF SNORA13 FOR TREATMENT OF RIBOSOMOPATHIES CROSS REFERENCE TO RELATED APPLICATION

[0001] This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 520,025, filed August 16, 2023, and titled “THERAPEUTIC MODULATION OF SNORA13 FOR TREATMENT OF RIBOSOMOPATHIES” which is incorporated by reference herein in its entirety. ACKNOWLEDGEMENT OF GOVERNMENT SUPPORT

[0002] This invention was made with government support under grant no. RP220309 awarded by the Cancer Prevention and Research Institute of Texas (CPRIT). The government has certain rights in the invention. INCORPORATION OF SEQUENCE LISTING

[0003] The present application contains a Sequence Listing which has been submitted in .XML format via Patent Center and is hereby incorporated by reference in its entirety. Said WIPO Sequence Listing was created on August 9, 2024, XML copy is named 106546- 804769_4262_Sequence listing.xml, and is 152 kilobytes in size. BACKGROUND 1. Field

[0004] The present disclosure relates to compositions and methods, that impact SNORA13 production or activity. In one aspect, the disclosure relates to medical treatments using the disclosed composition and methods. 2. Background

[0005] Cellular senescence was initially described as an irreversible state of cell cycle arrest induced in primary human cells after prolonged passaging. It is now understood that the progressive shortening of telomeres during cell division, and the resulting DNA damage response, is primarily responsible for this phenomenon. Senescence can be triggered by a variety of stresses, including telomere shortening, DNA damage, and excessive oncogenic activity, as well as oxidative stress and several chemotherapeutic drugs. In addition to cell cycle arrest, cellular senescence triggers a pro-inflammatory secretory phenotype that is thought to contribute to many aging-associated conditions, including neurodegeneration, cardiovascular disease, and diabetes. These broad effects of cellular senescence on human health and disease underscore the importance of achieving a comprehensive understanding 1 95635253Attorney Docket No.106546-804769 (4262) of the molecular mechanisms that drive this critical stress response pathway.

[0006] While numerous protein-coding genes that contribute to activation and execution of the senescence program have been identified, the roles of noncoding RNAs in cellular senescence remain poorly understood. An intriguing class of noncoding RNAs are the small nucleolar RNAs (snoRNAs), a family of noncoding RNAs that classically function as guides for chemical modification of other RNAs such as ribosomal RNAs (rRNAs) and small nuclear RNAs (snRNAs). Most snoRNAs are encoded in introns of protein-coding or noncoding transcripts and are processed into their mature ~60-300 nucleotide forms after excision of the host intron during splicing. Although eukaryotic cells express hundreds of distinct snoRNAs, they can largely be classified into two groups: the H / ACA and C / D box snoRNAs. Each class of snoRNA assembles a distinct ribonucleoprotein (RNP) complex, with H / ACA box snoRNPs converting uridine to pseudouridine and C / D box snoRNPs depositing 2'-O-methylation at sites selected by snoRNA:target RNA base pairing interactions. Beyond their canonical role as guides for RNA modifications, snoRNAs have been proposed to perform a diverse array of additional functions including regulation of pre-mRNA splicing and regulation of target mRNAs through a microRNA-like mechanism. Indeed, a large number of snoRNAs without identifiable RNA targets, referred to as orphan snoRNAs, are expressed in human cells, highlighting the potential of these transcripts to perform yet-to-be characterized functions.

[0007] Some snoRNA have recently been linked to senescence. Given the importance of cellular senescence to human health and disease, there is an unmet need to identify and utilize snoRNAs that impact senescence. SUMMARY

[0008] In an aspect, the current disclosure encompasses a nucleic acid inhibitor, comprising a nucleic acid sequence that reduces the expression, level or activity of SNORA13. In an aspect, the nucleic acid sequence specifically targets the SNORA13 gene. In an aspect, the nucleic acid sequence specifically targets SNORA13. In some aspects, the nucleic acid sequence may comprise an antisense oligonucleotide (ASO), siRNA, miRNA, a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid, a single guide RNA (sgRNA), a CRISPR-RNA (crRNA), a trans-activating crRNA (tracrRNA), or an aptamer. In some aspects, the nucleic acid sequence may comprise a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid, a single guide RNA (sgRNA), a CRISPR-RNA (crRNA), or a trans-activating crRNA (tracrRNA). In an aspect, the sgRNA, crRNA, or tracrRNA comprises a nucleic acid sequence at least 80% homologous to a nucleic acid sequence complementary to at least 10 contiguous nucleotides of SEQ ID NO: 1. In an aspect, the sgRNA has a sequence at least 80% identical to any one of SEQ ID NO: 3 or 4. 2 95635253Attorney Docket No.106546-804769 (4262) In an aspect, the nucleic acid sequence comprises an antisense oligonucleotide (ASO), an siRNA, or a miRNA. In an aspect, the ASO is double stranded or single stranded. In an aspect, the nucleic acid inhibitor comprises a nucleic acid sequence is at least 80% homologous to a nucleic acid sequence complementary to at least 10 to 30 contiguous nucleotides of SEQ ID NO: 2.

[0009] In an aspect, the nucleic acid inhibitor may further comprise at least one chemical modification. In an aspect, the nucleic acid inhibitor comprises a modification at least one ribosugar moiety of its nucleotide sequence. In an aspect, the at least one ribosugar moiety is modified with 22′-O-methyl (2′OMe), 2′-deoxy-2′-fluoro (2′F), 2′-deoxy, 5-C-methyl, 2′-O-(2- methoxyethyl) (MOE), 4′-thio, 2′-amino, 2′-C-allyl, cMOE, 2'-O-ethyl (cET), or is a locked nucleic acid (LNA) or any combination thereof.

[0010] In an aspect, the current disclosure also encompasses a nucleic acid activator of SNORA13, wherein the nucleic acid activator comprises or encodes an effector that enhances the expression, level, or activity of SNORA13. In an aspect, the effector comprises a nucleic acid sequence at least about 80% identical to a nucleic acid sequence as provided in SEQ ID NO: 2. In an aspect, the effector may be an RNA. In an aspect, the nucleic acid sequence may encode SNORA13 or a variant, or a derivative thereof. In an aspect, the nucleic acid sequence is at least 80% identical to a nucleic acid sequence provided in SEQ ID NO: 1. In an aspect, the nucleic acid activator may further comprise at least one chemical modification, wherein the modification may comprise a ribosugar moiety modified with 22′-O-methyl (2′OMe), 2′- deoxy-2′-fluoro (2′F), 2′-deoxy, 5-C-methyl, 2′-O-(2-methoxyethyl) (MOE), 4′-thio, 2′-amino, 2′- C-allyl, cMOE, 2'-O-ethyl (cET), or is a locked nucleic acid (LNA) or any combination thereof.

[0011] In an aspect, the current disclosure also encompasses a pharmaceutical composition comprising a nucleic acid inhibitor or a nucleic acid activator as disclosed herein and at least one pharmaceutically acceptable delivery agent. In an aspect, the delivery agent may comprise a lipidoid, a liposome, a lipoplex, a nanoparticle, a lipid nanoparticle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, or a conjugate. In an aspect, the pharmaceutical composition is for the treatment of a ribosomopathy, a cancer, or a senescence associated pathology.

[0012] In an aspect, the current disclosure also encompasses a method of treating a subject in need thereof, comprising administering to the subject a pharmaceutical composition as disclosed herein. In an aspect, the subject is diagnosed with, or is at risk of developing a ribosomopathy or a cancer, for example a hematological or a non-hematological cancer. In an aspect, the ribosomopathy is an inflammation, tumor, hypertrophy, hematopoietic abnormality, anemia, bone marrow failure, skeletal abnormalities, growth insufficiency, pancreatic 3 95635253Attorney Docket No.106546-804769 (4262) insufficiency, microcephaly and other neurologic deficits, cardiac defects, alopecia, liver failure, neurodegeneration, wound healing, Diamond-Blackfan anemia (DBA), Shwachman- Diamond syndrome (SDS), X-linked dyskeratosis congenita (DC), cartilage hair hypoplasia (CHH), Treacher Collins syndrome (TCS), muscle wasting, or an age-related disorder. In an aspect. The subject is a mammal, for example a human.

[0013] In another aspect, the subject is diagnosed with, or is at risk of developing a senescence associated pathology The senescence for example, is selected from replicative senescence and DNA damage-induced senescence. In one aspect, the senescence associated pathology is selected from the group consisting of lung fibrosis, atherosclerosis, Alzheimer's disease, diabetes, liver fibrosis, chronic kidney disease, cardiac fibrosis, Parkinson’s disease, age-related tissue decline, age-related organ decline, degenerative disease, cancer, cataracts, macular degeneration, glaucoma, atherosclerosis, acute coronary syndrome, myocardial infarction, stroke, recovery after stroke, PSD-95 decrease, hypertension, idiopathic pulmonary fibrosis (IPF), chronic obstructive pulmonary disease (COPD), type 1 diabetes, obesity, fat dysfunction, coronary artery disease, cerebrovascular disease, periodontal disease, cancer treatment-related disability, chemotherapy treatment- related disability, chemotherapy treatment-related frailty, frailty, radiotherapy and other radiation related disability, chemotherapy treatment-related frailty, cancer treatment-related atrophy, cancer treatment-related fibrosis, brain injury, heart injury, and therapy-related myelodysplastic syndrome, accelerated aging, accelerated aging disease, Hutchinson-Gilford progeria syndrome, Werner syndrome, Cockayne syndrome, xeroderma pigmentosum, ataxia telangiectasia, Fanconi anemia, dyskeratosis congenital, aplastic anemia, idiopathic pulmonary fibrosis, atherosclerosis, cardiovascular disease, adult cancer, arthritis, osteoporosis, hypertension, neurodegeneration, stroke, atrophic gastritis, osteoarthritis, NASH, camptocormia, chronic obstructive pulmonary disease, coronary artery disease, dopamine dysregulation syndrome, metabolic syndrome, effort incontinence, Hashimoto's thyroiditis, heart failure, late life depression, immunosenescence, myocardial infarction, acute coronary syndrome, sarcopenia, sarcopenic obesity, senile osteoporosis, and urinary incontinence. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The application file contains at least one drawing executed in color. Copies of this patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0015] Aspects of the present disclosure are illustrated by way of example in which like 4 95635253Attorney Docket No.106546-804769 (4262) reference numerals indicate similar elements and in which:

[0016] FIG.1A shows growth curves of BJ-HRASG12V-dCas9KRABclones used in the screen expressing the indicated sgRNAs in the presence of tamoxifen.

[0017] FIG.1B is an overview of the genome-wide CRISPRi screen for noncoding RNAs required for OIS.

[0018] FIG. 1C provides a plot of gene enrichment (tamoxifen-treated / untreated cells) versus p value calculated by MAGeCK.

[0019] FIG. 1D shows a schematic of EPB41L4A-AS1 locus showing location and conservation of SNORA13. UCSC Genome Browser PhastCons track shown in green.

[0020] FIG. 1E provides qRT-PCR analysis of EPB41L4A-AS1 expression relative to GAPDH, in BJ-HRASG12V-dCas9KRABcells after lentiviral expression of non-target (NT) or EPB41L4A-AS1-targeting sgRNAs. Indicated cells were treated with tamoxifen for 7 days. Mean ± SD shown for qRT-PCR (n=3 biological replicates).

[0021] FIG.1F provides a northern blot of SNORA13 and U6 snRNA (loading control), in BJ-HRASG12V-dCas9KRABcells after lentiviral expression of non-target (NT) or EPB41L4A-AS1- targeting sgRNAs. Indicated cells were treated with tamoxifen for 7 days. Mean ± SD shown for qRT-PCR (n=3 biological replicates).

[0022] FIG. 1G shows growth curve of BJ-HRASG12V-dCas9KRABcells expressing the indicated sgRNAs in the absence (left) or presence of tamoxifen (right).

[0023] FIG.1H shows the cell morphology, SA-b-gal staining, and EdU incorporation of BJ- HRASG12V-dCas9KRABcells expressing the indicated sgRNAs 15 days after addition of tamoxifen.

[0024] FIG.1I provides a Western blot analysis showing induction of HRASG12V after 7 days of tamoxifen treatment.

[0025] FIG.2A shows a schematic of dual guide CRISPR strategy for SNORA13 deletion.

[0026] FIG. 2B shows a northern blot of SNORA13 and U6 snRNA, in wild-type BJ- HRASG12Vcells or four independent SNORA13 knockout clones.

[0027] FIG. 2C shows a qRT-PCR analysis of EPB41L4A-AS1 expression relative to GAPDH, in wild-type BJ-HRASG12Vcells or four independent SNORA13 knockout clones.

[0028] FIG.2D shows growth curves of wild-type or SNORA13 knockout BJ-HRASG12Vcells in the absence (left) or presence of tamoxifen (right).

[0029] FIG. 2E shows a Western blot analysis of HRASG12Vin wild-type and SNORA13 5 95635253Attorney Docket No.106546-804769 (4262) knockout BJ-HRASG12Vcells after 7 days of tamoxifen treatment.

[0030] FIG. 2F shows a schematic of EPB41L4A-AS1 rescue constructs with or without SNORA13.

[0031] FIG. 2G shows a northern blot of SNORA13 and U6 snRNA, in wild-type or SNORA13 knockout BJ-HRASG12Vcells following stable transfection with empty vector (EV) or the indicated EPB41L4A-AS1 rescue constructs.

[0032] FIG.2H shows qRT-PCR analysis of EPB41L4A-AS1 expression relative to GAPDH, in wild-type or SNORA13 knockout BJ-HRASG12Vcells following stable transfection with empty vector (EV) or the indicated EPB41L4A-AS1 rescue constructs.

[0033] FIG. 2I shows the growth curve of BJ-HRASG12Vcells expressing the indicated EPB41L4A-AS1 rescue constructs in the absence of tamoxifen.

[0034] FIG. 2J shows the growth curve of BJ-HRASG12Vcells expressing the indicated EPB41L4A-AS1 rescue constructs in the presence of tamoxifen.

[0035] FIG.2K shows the cell morphology, SA-b-gal staining, and EdU incorporation of BJ- HRASG12Vcells expressing the indicated EPB41L4A-AS1 rescue constructs 15 days after addition of tamoxifen. For qRT-PCR experiments, data are represented as mean ± SD (n=3 biological replicates).

[0036] FIG.2L is a line graph showing growth of CCD-1070Sk human fibroblasts. Prior to monitoring growth, cells were infected with lentivirus expressing Cas9 and non-target (NT) or SNORA13-targeting sgRNA. ****p≤0.0001.

[0037] FIG.2M are photographs showing cell morphology and SA-β-gal staining of CCD- 1070Sk cells at the indicated times.

[0038] FIG. 2N is a bar graph showing quantification of SA-β-gal activity in FIG. 2M. ****p≤0.0001.

[0039] FIG.2O depicts photograph of western blots of total cell lysates in CCD-1070Sk cells at the indicated time points.

[0040] FIG. 2P is a line graph showing growth of IMR-90 human fibroblasts. Prior to monitoring growth, cells were infected with lentivirus expressing Cas9 and non-target (NT) or SNORA13-targeting sgRNA. ****p≤0.0001.

[0041] FIG.2Q are photographs showing cell morphology and SA-β-gal staining of IMR-90 cells at the indicated times.

[0042] FIG.2R is a bar graph showing quantification of SA-β-gal activity in FIG.2Q. 6 95635253Attorney Docket No.106546-804769 (4262)

[0043] FIG.2S depicts photograph of western blots of total cell lysates in IMR-90 cells at the indicated time points.

[0044] FIG. 2T is a line graph showing growth of etoposide-treated IMR-90 human fibroblasts. Prior to monitoring growth, cells were infected with lentivirus expressing Cas9 and non-target (NT) or SNORA13-targeting sgRNA. For etoposide experiments, day 0 represents the timepoint at which drug was removed and proliferation measurements were initiated (after prior treatment with 50 µM etoposide for 48 hours). *p≤0.05.

[0045] FIG. 2U are photographs showing cell morphology and SA-β-gal staining of etoposide-treated IMR-90 cells at the indicated times.

[0046] FIG. 2V is a bar graph showing quantification of SA-β-gal activity in FIG. 2U. ****p≤0.0001.

[0047] FIG.2W depicts photograph of western blots of total cell lysates in etoposide-treated IMR-90 cells at the indicated time points.

[0048] FIG. 3A shows a qRT-PCR analysis of SNORA13 subcellular localization in the absence of tamoxifen (upper) or after 15 days of tamoxifen treatment (lower).

[0049] FIG.3B provides SNORA13 RNA FISH in the absence of tamoxifen (upper) or after 15 days of tamoxifen treatment (lower). Red, SNORA13; green, nucleolar marker Nucleolin; blue, DAPI.

[0050] FIG.3C shows a northern blot of SNORA13 and U6 snRNA (loading control) after treatment with tamoxifen for the indicated number of days.

[0051] FIG.3D shows installation of m1acp3Y on human 18S:1248U.

[0052] FIG.3E shows HinF1 digestion assay to monitor 18S.1248m1acp3Y.

[0053] FIG.3F shows primer extension assay for detection of 18S.1248U m1acp3^.

[0054] FIG.4A shows anti-puromycin western blot of wild-type or SNORA13 knockout BJ- HRASG12Vcells pulsed with puromycin in the absence of tamoxifen.

[0055] FIG.4B provides flow cytometry analysis of OP-Puro incorporation in wild-type or SNORA13 knockout BJ-HRASG12Vcells in the absence of tamoxifen.

[0056] FIG.4C shows anti-puromycin western blot of BJ-HRASG12Vcells of the indicated genotypes pulsed with puromycin after 7 days of tamoxifen treatment.

[0057] FIG. 4D shows flow cytometry analysis of OP-Puro incorporation in BJ-HRASG12Vcells of the indicated genotypes after 7 days of tamoxifen treatment.

[0058] FIG.4E shows stop codon readthrough assay for translational fidelity. Firefly / Renilla 7 95635253Attorney Docket No.106546-804769 (4262) activity in reporter-transfected cells was normalized to firefly / Renilla activity in noTer control- transfected cells. Cells were treated with tamoxifen for 7 days where indicated.Data are represented as mean ± SD with individual data points shown (n=3 biological replicates).

[0059] FIG. 4F shows Volcano plot of translation efficiency (TE; defined as ribosome occupancy / mRNA abundance), as determined by ribosome profiling and RNA-seq, in SNORA13 knockout relative to wild-type BJ-HRASG12Vcells treated with tamoxifen for 7 days. Transcripts with a statistically significant increase or decrease in TE (p<0.01) highlighted in red.

[0060] FIG.4G shows qRT-PCR analysis of transcripts whose translation was significantly decreased (p<0.01) in both tamoxifen-treated and untreated SNORA13 knockout cells, after lentiviral expression of Cas9 and the indicated sgRNAs.

[0061] FIG. 4H shows a growth curve of BJ-HRASG12Vcells expressing Cas9 and the indicated sgRNAs in the presence of tamoxifen.

[0062] FIG.4I shows qRT-PCR analysis of transcripts whose translation was significantly increased (p<0.01) in both tamoxifen-treated and untreated SNORA13 knockout cells, after lentiviral expression of Cas9 and the indicated sgRNAs.

[0063] FIG.4J shows growth curves of SNORA13 knockout BJ-HRASG12Vcells expressing Cas9 and the indicated sgRNAs in the presence of tamoxifen.

[0064] FIG.4K provides the Spearman correlations between the frequency of each codon in transcripts and their relative translational efficiency in tamoxifen-treated SNORA13 knockout versus wild-type BJ-HRASG12Vcells. X axis represents correlation between codon frequency and translation efficiency (Spearman’s correlation coefficient).

[0065] FIG.4L provides the Spearman correlations between the frequency of each codon in transcripts and their relative translational efficiency in wild-type BJ-HRASG12Vcells minus tamoxifen (normal growth) versus plus tamoxifen (senescence). X axis represents correlation between codon frequency and translation efficiency (Spearman’s correlation coefficient).

[0066] FIG.4M provides the Spearman correlations between the frequency of each codon in transcripts and their relative translational efficiency in shows tamoxifen-treated TP53 knockout versus wild-type BJ-HRASG12Vcells. X axis represents correlation between codon frequency and translation efficiency (Spearman’s correlation coefficient).

[0067] FIG.4N provides the Spearman correlations between the frequency of each codon in transcripts and their relative translational efficiency in shows or untreated SNORA13 knockout versus wild-type BJ-HRASG12Vcells. X axis represents correlation between codon frequency and translation efficiency (Spearman’s correlation coefficient). 8 95635253Attorney Docket No.106546-804769 (4262)

[0068] FIG.5A provides sucrose gradient fractionation of wild-type and SNORA13 knockout BJ-HRASG12Vcells in the absence of tamoxifen (upper) or after 7 days of tamoxifen treatment (lower).

[0069] FIG. 5B provides sucrose gradient fractionation showing that expression of SNORA13 normalizes levels of 60S subunits in SNORA13 knockout BJ-HRASG12Vcells.

[0070] FIG. 5C shows qRT-PCR analysis of EU-labeled nascent rRNA in wild-type and SNORA13 knockout BJ-HRASG12Vcells. Data are represented as mean ± SD with individual data points shown (n=3 biological replicates).

[0071] FIG.5D shows Northern blot analysis of rRNA precursors with ITS1 and ITS2 probes. ACTB served as a loading control.

[0072] FIG.5E shows Northern blot analysis of SNORA13 and U6 snRNA (loading control) in HEK293T RPL28-SNAP cells after lentiviral expression of Cas9 and the indicated sgRNAs.

[0073] FIG. 5F provides sucrose gradient fractionation showing total ribosome levels (upper) or fluorescently labeled newly synthesized 60S ribosomal subunits (lower) in HEK293T RPL28-SNAP cells after lentiviral expression of Cas9 and non-target sgRNA (sgNT) or sgRNA targeting SNORA13.

[0074] FIG. 5G provides sucrose gradient fractionation showing total ribosome levels (upper) or fluorescently labeled newly synthesized 60S ribosomal subunits (lower) in HEK293T RPL28-SNAP cells after lentiviral expression of Cas9 and non-target sgRNA (sgNT) or sgRNA targeting SNORA13.

[0075] FIG. 5H shows images of pulse-labeled HEK293T RPL28-SNAP cells expressing Cas9 and the indicated sgRNAs immediately after labeling (0 hr) or 1 hour later. White arrowheads indicate nucleolar RPL28.

[0076] FIG.5I is a series of bar graph showing qRT-PCR analysis of SNORA13 in HEK293T RPL28-SNAP cells after amino acid starvation for the indicated number of days. ***p≤0.001, ****p≤0.0001.

[0077] FIG.5J is series of bar graph showing qRT-PCR analysis of SNORA13 in HEK293T (left) or BJ-HRASG12V (right) cells after 3 days of 50 nM rapamycin treatment. **p≤0.01, ***p≤0.001.

[0078] FIG.5K shows sucrose gradient fractionation of total (upper) or newly-synthesized ribosomes (lower) after culturing cells for 3 days in amino acid-free media. ****p≤0.0001.

[0079] FIG.5L shows sucrose gradient fractionation of total (upper) or newly-synthesized ribosomes (lower) after culturing cells for 3 days in amino acid-free media and treating lysates 9 95635253Attorney Docket No.106546-804769 (4262) with 50 mM EDTA to collapse polysomes into individual ribosomal subunits. **p≤0.01, ****p≤0.0001.

[0080] FIG.6A shows gene set enrichment analysis (GSEA) showing downregulation of the p53 pathway in SNORA13 knockout BJ-HRASG12Vcells at baseline or after tamoxifen treatment.

[0081] FIG.6B shows qRT-PCR analysis of CDKN1A expression relative to GAPDH in wild- type BJ-HRASG12Vcells or four independent SNORA13 knockout clones at baseline or after tamoxifen treatment.

[0082] FIG.6C shows Western blots of total cell lysates in tamoxifen-treated wild-type or SNORA13 knockout BJ-HRASG12Vcells.

[0083] FIG. 6D shows Western blots of nuclear and cytoplasmic fractions in tamoxifen- treated wild-type or SNORA13 knockout BJ-HRASG12Vcells.

[0084] FIG.6E provides immunofluorescence assay of p53 in tamoxifen-treated wild-type or SNORA13 knockout BJ-HRASG12Vcells.

[0085] FIG.6F shows ChIP-qPCR of p53 binding at the CDKN1A promoter in tamoxifen- treated wild-type or SNORA13 knockout BJ-HRASG12Vcells.

[0086] FIG.6G shows Western blots showing ribosome and non-ribosome associated RP levels in wild-type or SNORA13 knockout BJ-HRASG12Vcells with or without tamoxifen treatment. Bar graph shows western blot quantification of ribosome-free RP levels in tamoxifen-treated cells (n=3 biological replicates).

[0087] FIG. 6H shows Western blot of MDM2 co-immunoprecipitation with the indicated proteins in tamoxifen-treated wild-type or SNORA13 knockout BJ-HRASG12Vcells.

[0088] FIG.6I provides growth curves of tamoxifen-treated wild-type or SNORA13 knockout BJ-HRASG12Vcells after MDM2 inhibition using siRNA.

[0089] FIG.6J shows growth curves of tamoxifen-treated wild-type or SNORA13 knockout BJ-HRASG12Vcells after MDM2 inhibition using Nutlin-3.

[0090] FIG.6K shows qRT-PCR analysis of MDM2 expression following siRNA-mediated knockdown. Data are represented as mean ± SD with individual data points shown (n=3 biological replicates).

[0091] FIG.6L shows immunofluorescence of p53 following MDM2 knockdown or Nutlin-3 treatment.

[0092] FIG. 7A shows sequences of wild-type and mutant SNORA13 used for rescue experiments. The sequences displayed include residues 56-67 and 125-133 of SEQ ID NO: 1 10 95635253Attorney Docket No.106546-804769 (4262) (first row), residues 56-67 and 125-133 of SEQ ID NO: 171 (middle row), and residues 56-61 and 119-124 of SEQ ID NO: 172.

[0093] FIG. 7B provides Northern blots showing expression of wild-type and mutant SNORA13 constructs. U6 snRNA served as a loading control.

[0094] FIG. 7C shows HinF1 digestion assay for pseudouridylation of 18S:1248U in SNORA13 knockout cells reconstituted with wild-type or mutant SNORA13. Note that TSR3 was also knocked out in these cells to prevent the addition of acp, thereby enabling the specific detection of 18S:1248Y after treatment with CMC.

[0095] FIG.7D shows growth curves of tamoxifen-treated wild-type or SNORA13 knockout BJ-HRASG12Vcells reconstituted with wild-type or mutant SNORA13.

[0096] FIG.7E Cell morphology, SA- ^ ^-gal staining, and EdU incorporation of wild-type or SNORA13 knockout BJ-HRASG12V cells with or without rescue with SNORA13 mutants, 15 days after addition of tamoxifen.

[0097] FIG. 7F provides sucrose gradient fractionation showing normalization of 60S ribosomal subunit levels in SNORA13 mutant-expressing BJ-HRASG12Vcells without tamoxifen treatment.

[0098] FIG.7G shows qRT-PCR analysis of EMG1 and TSR3 following lentiviral expression of Cas9 and sgRNAs targeting the indicated genes. Data are represented as mean ± SD with individual data points shown (n=3 biological replicates).

[0099] FIG. 7H shows growth curves of BJ-HRASG12Vcells expressing Cas9 and the indicated sgRNAs in the presence of tamoxifen.

[0100] FIG.8A provides a schematic of UV-crosslinking and purification of the endogenous SNORA13 RNP to identify interacting proteins by mass spectrometry.

[0101] FIG.8B shows qRT-PCR analysis of SNORA13 recovery after pull-down with ASOs.

[0102] FIG. 8C shows a silver-stained gel of recovered proteins after pull-down of SNORA13 from UV-crosslinked lysates.

[0103] FIG.8D provides volcano plot showing fold enrichment and significance of putative SNORA13 interacting proteins detected by mass spectrometry. H / ACA box snoRNP component DKC1 and RPL23 highlighted in red text.

[0104] FIG.8E shows qRT-PCR analysis of SNORA13 and SNORA25 in UV-RIP samples after pull-down of large and small subunit ribosomal proteins. Enrichment was normalized to input. Data are represented as mean ± SD with individual data points shown (n=3 biological replicates). 11 95635253Attorney Docket No.106546-804769 (4262)

[0105] FIG.8F shows western blot of ribosomal proteins in UV-RIP samples used for qRT- PCR analysis in FIG.6C.

[0106] FIG.8G shows western blots of ribosomal proteins after UV crosslinking and pull- down of SNORA13 with ASOs under denaturing conditions. SNORA13 sense oligonucleotides served as a negative control.

[0107] FIG.8H shows Coomassie stain gel of purified MBP-RPL23 protein used for in vitro binding experiments.

[0108] FIG.8I shows in vitro binding assays with purified MBP-RPL23 and SNORA13 or SNORA25.

[0109] FIG. 8J shows qRT-PCR analysis of SNORA13 (wild-type and mutants) and SNORA25 in UV-RIP samples after pull-down of RPL23. Enrichment was normalized to input. Data are represented as mean ± SD with individual data points shown (n=3 biological replicates).

[0110] FIG. 8K shows in vitro binding assay demonstrating interaction of RPL23 with SNORA13 mutants.

[0111] FIG.8L shows the structure of human 28S rRNA in 60S ribosomal subunit (grey and green) with RPL23 (red) (PDB ID: 6OM7). Other ribosomal proteins not shown. The 3' fragment of human 28S rRNA used for binding assays (nucleotides 4389 to 5070) is highlighted in green. Structure rendered by UCSF ChimeraX.

[0112] FIG.8M provides competitive binding assays with MBP-RPL23:28S rRNA4389-5070 and increasing concentrations of unlabeled SNORA13. SNORA13 concentration is expressed as fold excess over the concentration of 28S rRNA4389-5070 in the assay.

[0113] FIG.8N shows Northern blot analysis of SNORA13 copy number in BJ-HRASG12Vcells.

[0114] FIG.8O provides 32S pre-rRNA copy number in BJ-HRASG12Vcells.

[0115] FIG.9 shows a proposed model for the regulation of ribosome biogenesis and the nucleolar stress response by SNORA13: (Upper panel) Through a direct interaction with RPL23, SNORA13 slows the rate of assembly of pre-60S subunits (1). Under conditions of nucleolar stress, as triggered by aberrant oncogene activation for example, inhibition of ribosome biogenesis by SNORA13 increases the concentration of non-ribosome associated RPs (2) that can interact with and inhibit MDM2 (3), thereby promoting p53 activation. (Lower panel) In SNORA13-deficient cells, accelerated pre-60S assembly (5) reduces the concentration of free RPs (6), preventing activation of the nucleolar stress response (7) and 12 95635253Attorney Docket No.106546-804769 (4262) diminishing activity of p53 (8).

[0116] The drawing figures do not limit the present disclosure to the specific aspects disclosed and described herein. The drawings are not necessarily to scale, emphasis instead being placed on clearly illustrating principles of certain aspects of the present disclosure. DETAILED DESCRIPTION

[0117] The following detailed description references the accompanying drawings that illustrate various aspects of the present disclosure. The drawings and description are intended to describe aspects and aspects of the present disclosure in sufficient detail to enable those skilled in the art to practice the present disclosure. Other components can be utilized and changes can be made without departing from the scope of the present disclosure. The following description is, therefore, not to be taken in a limiting sense.

[0118] The present disclosure is based, in part, on the surprising discovery that SNORA13, a member of the H / ACA class of small nucleolar RNA that guide the sites of modification of uridines to pseudouridines, is essential for senescence pathway. Overexpression of oncogenic HRAS (HRASG12V) cause non-transformed cells to undergo cell cycle arrest and enter a state that closely resembled replicative senescence, rather than promoting proliferation as anticipated. Termed oncogene-induced senescence (OIS), this anti- proliferative response of cells to excessive oncogenic activity is an important tumor suppressor mechanism that prevents pre-malignant cells with oncogenic mutations from expanding and initiating tumorigenesis. Indeed, many different types of pre-cancerous lesions show signs of senescence, including p16INK4Aexpression, senescence-associated ^-galactosidase activity (SA- ^-gal), and senescence-associated heterochromatin foci (SAHF), while more advanced tumors typically lose these markers. Using a genome-wide CRISPR interference (CRISPRi) screen in a model of HRASG12V-driven senescence, it was discovered as described in detail in the Examples, that SNORA13, is essential for this pathway. Although snoRNA guides the pseudouridylation of a highly conserved nucleotide in 18S rRNA located in the decoding center of the ribosome, unexpectedly it was found that loss of SNORA13 had little effect on translation. Rather, loss of this snoRNA accelerated 60S ribosomal subunit biogenesis, thereby decreasing nucleolar stress and consequent p53 activation induced by aberrant oncogene activity. Remarkably, these effects on ribosome biogenesis were genetically separable from SNORA13-guided pseudouridylation of 18S rRNA and could be attributed to a direct interaction of SNORA13 with RPL23, which regulated the rate of 60S subunit assembly. Together, these findings provided a non-canonical and heretofore unknown function for an H / ACA box SNORA13 as a regulator of ribosome biogenesis and the p53 13 95635253Attorney Docket No.106546-804769 (4262) pathway that potently impacts cellular senescence.

[0119] The SNORA13 RNA is encoded by the small nucleolar RNA, H / ACA box 13 gene (NCBI gene database with a Gene ID NO: 654322). The sequence of the gene in the human genome is provided herein as SEQ ID NO: 1 (see Table 1). The corresponding RNA sequence is provided as SEQ ID NO: 2. Table 1 SEQ NAME SEQUENCE ID C G U Athat negatively or positively impact the level or functioning of SNORA13 in a cell and methods for using these compositions for therapeutic and / or non-therapeutic applications. I. Terminology

[0121] The phraseology and terminology employed herein are for the purpose of description and should not be regarded as limiting. For example, the use of a singular term, such as, “a” is not intended as limiting of the number of items. Also, the use of relational terms such as, but not limited to, “top,” “bottom,” “left,” “right,” “upper,” “lower,” “down,” “up,” and “side,” are used in the description for clarity in specific reference to the figures and are not intended to limit the scope of the present disclosure or the appended claims.

[0122] Further, as the present disclosure is susceptible to aspects of many different forms, it is intended that the present disclosure be considered as an example of the principles of the present disclosure and not intended to limit the present disclosure to the specific aspects shown and described. Any one of the features of the present disclosure may be used separately or in combination with any other feature. References to the terms “aspect,” “aspects,” and / or the like in the description mean that the feature and / or features being referred to are included in, at least, one aspect of the description. Separate references to the terms “aspect,” “aspects,” and / or the like in the description do not necessarily refer to the same aspect and are also not mutually exclusive unless so stated and / or except as will be readily apparent to those skilled in the art from the description. For example, a feature, structure, process, step, action, or the like described in one aspect may also be included in other aspects 14 95635253Attorney Docket No.106546-804769 (4262) but is not necessarily included. Thus, the present disclosure may include a variety of combinations and / or integrations of the aspects described herein. Additionally, all aspects of the present disclosure, as described herein, are not essential for its practice. Likewise, other systems, methods, features, and advantages of the present disclosure will be, or become, apparent to one with skill in the art upon examination of the figures and the description. It is intended that all such additional systems, methods, features, and advantages be included within this description, be within the scope of the present disclosure, and be encompassed by the claims.

[0123] Any term of degree such as, but not limited to, “substantially” as used in the description and the appended claims, should be understood to include an exact, or a similar, but not exact configuration. For example, “a substantially planar surface” means having an exact planar surface or a similar, but not exact planar surface. Similarly, the terms “about” or “approximately,” as used in the description and the appended claims, should be understood to include the recited values or a value that is three times greater or one third of the recited values. For example, about 3 mm includes all values from 1 mm to 9 mm, and approximately 50 degrees includes all values from 16.6 degrees to 150 degrees. For example, they can refer to less than or equal to ± 5%, such as less than or equal to ± 2%, such as less than or equal to ± 1%, such as less than or equal to ± 0.5%, such as less than or equal to ± 0.2%, such as less than or equal to ± 0.1%, such as less than or equal to ± 0.05%.

[0124] The terms "comprising," "including" and "having" are used interchangeably in this disclosure. The terms "comprising," "including" and "having" mean to include, but not necessarily be limited to the things so described.

[0125] Lastly, the terms “or” and “and / or,” as used herein, are to be interpreted as inclusive or meaning any one or any combination. Therefore, “A, B or C” or “A, B and / or C” mean any of the following: “A,” “B” or “C”; “A and B”; “A and C”; “B and C”; “A, B and C.” An exception to this definition will occur only when a combination of elements, functions, steps or acts are in some way inherently mutually exclusive.

[0126] The terms ‘’nucleic acid’’, ‘’nucleic acid molecule’’, and ‘’polynucleotide’’ are used interchangeably herein. The terms “nucleic acid encoding . . .” or “nucleic acid molecule encoding . . . ” should be understood as referring to the sequence of nucleotides which encodes a polypeptide.

[0127] A polynucleotide described herein may comprise one or more nucleic acids each encoding a polypeptide, operably linked to (i.e., in a functional relationship with) one or more regulatory sequences, such as a promoter. Such a polynucleotide may alternatively be referred to herein as a ‘’nucleic acid construct’’ or ‘’construct’’. As used herein, the term 15 95635253Attorney Docket No.106546-804769 (4262) “operably linked” refers to a functional linkage between a promoter or other regulatory element and an associated transcribable DNA sequence or coding sequence of a gene (or transgene), such that the promoter, etc., operates to initiate, assist, affect, cause, and / or promote the transcription and expression of the associated transcribable DNA sequence or coding sequence, at least in certain tissue(s), developmental stage(s) and / or condition(s).

[0128] As used herein, “regulatory elements” refer to any sequence elements that regulate, positively or negatively, the expression of an operably linked sequence. “Regulatory elements” include, without being limiting, a promoter, an enhancer, a leader, a transcription start site (TSS), a linker, 5′ and 3′ untranslated regions (UTRs), an intron, a polyadenylation signal, and a termination region or sequence, etc., that are suitable, necessary or preferred for regulating or allowing expression of the gene or transcribable DNA sequence in a cell. Such additional regulatory element(s) can be optional and used to enhance or optimize expression of the gene or transcribable DNA sequence. A regulatory sequence can, for example, be inducible, non- inducible, constitutive, cell-cycle regulated, metabolically regulated, and the like. A regulatory sequence may be a promoter. As used herein, the term “promoter” refers to a DNA sequence that contains an RNA polymerase binding site, a transcription start site, and / or a TATA box and assists or promotes the transcription and expression of an associated transcribable polynucleotide sequence and / or gene (or transgene). A promoter can be synthetically produced, varied, or derived from a known or naturally occurring promoter sequence or other promoter sequence. A promoter can also include a chimeric promoter comprising a combination of two or more heterologous sequences. A promoter of the present application can thus include variants of promoter sequences that are similar in composition, but not identical to, other promoter sequence(s) known or provided herein.

[0129] As used herein, the term “operably linked” refers to a functional linkage between a promoter or other regulatory element and an associated transcribable DNA sequence or coding sequence of a gene (or transgene), such that the promoter, etc., operates to initiate, assist, affect, cause, and / or promote the transcription and expression of the associated transcribable DNA sequence or coding sequence, at least in certain tissue(s), developmental stage(s) and / or condition(s). II. Compositions

[0130] In an aspect, the current disclosure encompasses a composition that comprises an agent that changes the levels of SNORA13 in a cell or impacts SNORA13’s function. In an aspect, a disclosed agent can be a small molecule, non-limiting example of which include a drug, a metal, an ion, a sugar, a nucleotide, a nucleoside, or an amino acid. In an aspect, a disclosed agent is a biomolecule, non-limiting examples of which include a polynucleotide, or 16 95635253Attorney Docket No.106546-804769 (4262) a polypeptide, or derivatives thereof. In an aspect, the agent is an inhibitor that can decrease the level of SNORA13 or negatively impact its function in a cell. In an aspect, the agent is an activator, that enhances the level, or positively impacts the function of SNORA13. Inhibitors

[0131] In an aspect, a disclosed composition can comprise an agent that can decrease SNORA13 gene expression, or decrease SNORA13 activity, or both. In an aspect, a disclosed agent is an inhibitor of SNORA13. In an aspect, a disclosed composition comprises an inhibitor of the SNORA13 gene or SNORA13 or both. As used herein, the term “inhibitor” includes an agent that disrupts the SNORA13 gene, disrupts gene expression of SNORA13, directly inhibits SNORA13 activity, indirectly inhibits SNORA13 activity, or a combination thereof. As used herein the terms “disrupt,” “disruption,” “disrupting,” or “disrupted” gene refers to genetic modifications that alter the level of expression of a target gene. In some aspects, the disruption can be due to a deletion of at least one nucleotide within or near the target gene or a deletion of part or all of a target gene, as described above. In other aspects, the disruption can be due to a substitution of at least one nucleotide and / or an insertion of at least one nucleotide within or near the target gene. In further aspects, the disruption can be due to an insertion of one or more exogenous polynucleotides within or near the target gene. In general, as used herein, disrupted expression refers to reduced or eliminated expression of the target gene. In some aspects, the disruption can be a reduced level of expression (e.g., express less than 30%, less than 25%, less than 20%, less than 10%, or less than 5% of the level of an unmodified cell). In some aspect, the disruption can be eliminated expression (e.g., no expression or an undetectable level of RNA). Expression can be measured directly using any standard RNA- based assay, or indirectly using protein-based, and / or antibody-based detection method (e.g., RT-PCR, ELISA, flow cytometry, immunocytochemistry, and the like). Methods known in the art for the detection and quantification of RNA expression suitable for use herein can include, but are not limited to northern blotting and in situ hybridization, RNAse protection assays, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time quantitative reverse transcription PCR (RT-qPCR or qPCR), sequencing-based gene expression analysis (e.g., Serial Analysis of Gene Expression (SAGE)), gene expression analysis by massively parallel signature sequencing (MPSS), and the like. Detectable levels are defined as being higher that the limit of detection (LOD), which is the lowest concentration that can be measured (detected) with statistical significance by means of a given detection method.

[0132] In an aspect, a disclosed composition comprises a small molecule inhibitor of SNORA13. In an aspect, a disclosed composition comprises a nucleic acid inhibitor of SNORA13. In an aspect, a disclosed composition comprises a polynucleotide encoding a 17 95635253Attorney Docket No.106546-804769 (4262) nucleic acid inhibitor of SNORA13. In an aspect, the composition comprises a polynucleotide that encodes a polypeptide that directly or indirectly disrupts the expression or function of SNORA13.

[0133] In an aspect, the inhibitor of SNORA13 is a nucleic acid inhibitor. The term “nucleic acid inhibitor” as used herein refers to a molecule having nucleotides and capable of disrupting SNORA13 gene or SNORA13 in a cell. The nucleic acid inhibitor can be single, double, or multiple stranded and may comprise modified or unmodified nucleotides or non-nucleotides or various mixtures and combinations thereof. In an aspect, the nucleic acid inhibitor is a DNA. In an aspect, the nucleic acid inhibitor is an RNA. In some instances the nucleic acid inhibitor is a single stranded RNA. In an aspect, the nucleic acid inhibitor is a single stranded RNA. Examples of nucleic acids suitable for use herein can be small temporal RNA, small nuclear RNA, small nucleolar RNA, short hairpin RNA, microRNA, an anti-sense oligonucleotide (ASO), a ribozyme, an aptamer, a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid, a single guide RNA (sgRNA), a CRISPR-RNA (crRNA), a trans-activating crRNA (tracrRNA).

[0134] In an aspect, the nucleic acid inhibitor is a small Interfering RNA (siRNA) or a miRNA (microRNA).

[0135] In an aspect, the nucleic acid inhibitor is a siRNA. siRNAs are short double-stranded RNA molecules typically around 20-25 nucleotides in length that work by guiding a protein complex called the RNA-induced silencing complex (RISC) to complementary RNA sequences, resulting in the degradation of the target RNA molecule. In some aspects, the siRNA molecule comprises a nucleic acid sequence that is 2 to 30 nucleotides in length and wherein the nucleic acid sequence is at least 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homologous to a nucleic acid sequence complementary to at least 2 to 30 contiguous nucleotides of SNORA13. In an aspect, the siRNA molecule comprises a nucleic acid sequence that is 2 to 30 nucleotides in length and wherein the nucleic acid sequence is at least 80% ((e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homologous to a nucleic acid sequence complementary to at least 2 to 30 contiguous nucleotides of human SNORA13. In an aspect, the siRNA molecule comprises a nucleic acid sequence that is 2 to 30 nucleotides in length and wherein the nucleic acid sequence is at least 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homologous to a nucleic acid sequence complementary to at least 2 to 30 contiguous nucleotides of SEQ ID NO: 2. In an aspect, the siRNA molecule comprises a nucleic acid sequence that is 2 to 30 nucleotides in length and wherein the nucleic acid sequence is homologous to a nucleic acid sequence complementary to at least 2 to 30 contiguous nucleotides of SEQ ID NO: 2. In an aspect, the nucleic acid inhibitor is a microRNA. In some aspects, the miRNA molecule 18 95635253Attorney Docket No.106546-804769 (4262) comprises a nucleic acid sequence that is 2 to 20 nucleotides in length and wherein the nucleic acid sequence is at least 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homologous to a nucleic acid sequence complementary to at least 2 to 20 contiguous nucleotides of SNORA13. In an aspect, the miRNA molecule comprises a nucleic acid sequence that is 2 to 20 nucleotides in length and wherein the nucleic acid sequence is at least 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homologous to a nucleic acid sequence complementary to at least 2 to 20 contiguous nucleotides of human SNORA13. In an aspect the miRNA molecule comprises a nucleic acid sequence that is 2 to 20 nucleotides in length and wherein the nucleic acid sequence is at least 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homologous to a nucleic acid sequence complementary to at least 2 to 20 contiguous nucleotides of SEQ ID NO: 2. In an aspect, the miRNA molecule comprises a nucleic acid sequence that is 2 to 30 nucleotides in length and wherein the nucleic acid sequence is homologous to a nucleic acid sequence complementary to at least 2 to 30 contiguous nucleotides of SEQ ID NO: 2. siRNA or miRNA inhibitors disclosed herein may be any interfering RNA with a duplex length of about 2-60, about 5-50, or about 10-40 nucleotides in length, more typically about 2-30, about 5-25, or about 10-25 nucleotides in length. In some aspects, siRNA molecule disclosed herein may have a nucleotide sequence that is about 2 to about 30 nucleotides in length, about 5 to about 25 nucleotides in length, or about 10 to about 20 nucleotides in length. In some aspects, siRNA or miRNA molecule disclosed herein may have a nucleotide sequence that is about 10 nucleotides in length, about 11 nucleotides in length, about 12 nucleotides in length, about 13 nucleotides in length, about 14 nucleotides in length, about 15 nucleotides in length, about 14 nucleotides in length, about 15 nucleotides in length, about 16 nucleotides in length, about 17 nucleotides in length, about 18 nucleotides in length, about 19 nucleotides in length, about 20 nucleotides in length, about 21 nucleotides in length, about 22 nucleotides in length, about 23 nucleotides in length, about 24 nucleotides in length, or about 25 nucleotides in length. Each complementary sequence of the double-stranded siRNA o miRNA may be about 2-60, about 5-50, about 10-40, about 2-30, about 5-25, or about 10-25 nucleotides in length, but other noncomplementary sequences may be present. For example, siRNA duplexes may comprise 3′ overhangs of about 1 to about 4 or more nucleotides and / or 5′ phosphate termini comprising about 1 to about 4 or more nucleotides.

[0136] In an aspect, the nucleic acid inhibitor is an Antisense Oligonucleotides (ASOs). ASOs are short single-stranded synthetic DNA or RNA molecules designed to bind to specific RNA sequences through complementary base pairing. By targeting specific RNA molecules, ASOs can promote RNA degradation. In some aspects, the ASO molecule comprises a nucleic acid sequence that is 2 to 30 nucleotides in length and wherein the nucleic acid sequence is 19 95635253Attorney Docket No.106546-804769 (4262) at least 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homologous to a nucleic acid sequence complementary to at least 2 to 30 contiguous nucleotides of SNORA13. In an aspect, the ASO molecule comprises a nucleic acid sequence that is 2 to 20 nucleotides in length and wherein the nucleic acid sequence is at least 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homologous to a nucleic acid sequence complementary to at least 2 to 20 contiguous nucleotides of human SNORA13. In an aspect the ASO molecule comprises a nucleic acid sequence that is 2 to 20 nucleotides in length and wherein the nucleic acid sequence is at least 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homologous to a nucleic acid sequence complementary to at least 2 to 30 contiguous nucleotides of SEQ ID NO: 2. In an aspect, the ASO molecule comprises a nucleic acid sequence that is 2 to 30 nucleotides in length and wherein the nucleic acid sequence is homologous to a nucleic acid sequence complementary to at least 2 to 30 contiguous nucleotides of SEQ ID NO: 2. ASOs disclosed herein may be any interfering RNA with a length of about 2-60, about 5-50, or about 10-40 nucleotides in length, more typically about 2-30, about 5-25, or about 10-25 nucleotides in length. In some aspects, ASO molecule disclosed herein may have a nucleotide sequence that is about 2 to about 30 nucleotides in length, about 5 to about 25 nucleotides in length, or about 10 to about 20 nucleotides in length. In some aspects, a ASO molecule disclosed herein may have a nucleotide sequence that is about 10 nucleotides in length, about 11 nucleotides in length, about 12 nucleotides in length, about 13 nucleotides in length, about 14 nucleotides in length, about 15 nucleotides in length, about 14 nucleotides in length, about 15 nucleotides in length, about 16 nucleotides in length, about 17 nucleotides in length, about 18 nucleotides in length, about 19 nucleotides in length, about 20 nucleotides in length, about 21 nucleotides in length, about 22 nucleotides in length, about 23 nucleotides in length, about 24 nucleotides in length, or about 25 nucleotides in length. Each complementary sequence of the ASO may be about 2-60, about 5-50, about 10- 40, about 2-30, about 5-25, or about 10-25 nucleotides in length, but other noncomplementary sequences may be present.

[0137] In an aspect, the nucleic acid inhibitor is a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid for example a single guide RNA (sgRNA), a CRISPR-RNA (crRNA), or a trans-activating crRNA (tracrRNA) or combination thereof. In an aspect, the CRISPR related nucleic disrupts or is designed to disrupt the SNORA13 gene. In an aspect, the CRISPR related nucleic disrupts or is designed to disrupt the human SNORA13 gene. In an aspect, the CRISPR related nucleic acid is a sgRNA or a crRNA. In an aspect, the sgRNA or crRNA comprises a nucleic acid sequence that is 10 to 30 nucleotides in length and wherein the nucleic acid sequence is at least 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homologous to a nucleic acid sequence complementary 20 95635253Attorney Docket No.106546-804769 (4262) to at least 10 to 30 contiguous nucleotides of SNORA13 gene sequence. In an aspect, a sgRNA or a crRNA molecule comprises a nucleic acid sequence that is 10 to 30 nucleotides in length and wherein the nucleic acid sequence is at least 80% ((e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homologous to a nucleic acid sequence complementary to at least 10 to 30 contiguous nucleotides of human SNORA13 gene. In an aspect, the sgRNA or a crRNA molecule comprises a nucleic acid sequence that is 2 to 30 nucleotides in length and wherein the nucleic acid sequence is at least 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) homologous to a nucleic acid sequence complementary to at least 10 to 30 contiguous nucleotides of SEQ ID NO: 1. In an aspect, the sgRNA or a crRNA molecule comprises a nucleic acid sequence that is 10 to 30 nucleotides in length and wherein the nucleic acid sequence is homologous to a nucleic acid sequence complementary to at least 10 to 30 contiguous nucleotides of SEQ ID NO: 1. In an aspect, the sgRNA or a crRNA molecule comprises a nucleic acid sequence at least about 80% (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) identical to the sequence as provided in SEQ ID NO: 3 or 4. In an aspect, the sgRNA or a crRNA molecule comprises a nucleic acid sequence identical to the sequence as provided in SEQ ID NO: 3 or 4. SEQ ID NAME SEQUENCE NO:

[0138] In an aspect, the nucleic acid inhibitor is a ribozyme. Ribozymes are catalytic RNA molecules capable of cleaving other RNA molecules in a sequence-specific manner. They can be engineered to target and cleave specific RNA sequences, leading to the degradation of the target RNA molecule. In an aspect, the nucleic acid inhibitor is an aptamer. Aptamers are single-stranded RNA or DNA molecules that can bind to specific target molecules with high affinity and specificity. RNA aptamers can be designed to target specific RNA molecules and interfere with their function.

[0139] The nucleic acid inhibitor of the present disclosure may specifically disrupt gene expression of SNORA13. The term disrupting may be interchangeably expressed as reducing, inhibiting, preventing, blocking or silencing. Here, the phrase “disrupting gene expression” refers to any reduced level of gene expression comparing with an ordinary expression level. For example, the reduced level of gene expression can be from about 70% to 0% of the ordinary expression level. In other words, about 30% to 100% gene expression is downregulated, reduced, blocked, inhibited, prevented or silenced, comparing to the ordinary expression level. Specifically, the reduced level of gene expression is about 70%, 65%, 60%, 55%, 50%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 8%, 5%, 4%, 3%, 2%, 21 95635253Attorney Docket No.106546-804769 (4262) 1% or 0% of the ordinary expression level of SNORA13. The reduced level of gene expression can also be any percentage or range as recited above. On the other hand, the term “specific” or “specifically” used in combination with disrupting refers to downregulation of a target gene's expression with minimal or no binding or downregulation of other nucleic acids or their expressions.

[0140] In some aspects, the current disclosure also encompasses use of gene editing systems for example CRISPR based systems for inhibiting gene expression of SNORA13. As such, the current disclosure also encompasses compositions comprising a nucleic acid sequence related to a cluster regularly interspaced short palindromic repeats (CRISPR) system, for example a single guide RNA (sgRNA), a CRISPR-RNA (crRNA), a trans-activating crRNA (tracrRNA), and further a plasmid DNA (pDNA) or a viral vector encoding nucleic acid sequence related to a cluster regularly interspaced short palindromic repeats (CRISPR) system, that specifically target SNORA13 or variants thereof. In some aspects, the gene editing system comprises at least an sgRNA targeting SNORA13 as provided herein and an RNA guided endonuclease for example Cas9. In an aspect, the current disclosure also encompasses small molecule inhibitors of SNORA13. In an aspect, a small molecule inhibitor can be a known drug. In an aspect, the small molecule inhibitor can be a novel drug. In an aspect, the small molecule inhibitor specifically binds to SNORA13. In an aspect, the small molecule inhibitor indirectly impacts the synthesis, level or activity of SNORA13. Activators

[0141] In an aspect, a disclosed composition can comprise an agent that can increase SNORA13 levels, gene expression, or enhance SNORA13 activity, or any combination thereof. In an aspect, a disclosed agent is an activator of SNORA13. As used herein, the term “activator” includes an agent that enhances SNORA13 levels in a cell, enhances gene expression of SNORA13, or directly or indirectly enhances SNORA13 activity, or any combination thereof. In an aspects, the activator result in an increase in the levels of SNORA13 by about 1.5 fold to about 100 fold. In an aspects, the enhancement can result from increased expression (e.g., express more than 1.5-fold – 1000 fold of the level of an unmodified cell) or level or both. In an aspect, the increased levels can also result from greater stability of lower degradation of SNORA13. Levels can be measured directly using any standard RNA-based assay, or indirectly using protein-based, and / or antibody-based detection method (e.g., RT-PCR, in situ hybridization, ELISA, flow cytometry, immunocytochemistry, and the like). Methods known in the art for the detection and quantification of RNA expression suitable for use herein can include, but are not limited to 22 95635253Attorney Docket No.106546-804769 (4262) northern blotting and in situ hybridization, RNAse protection assays, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), real-time quantitative reverse transcription PCR (RT-qPCR or qPCR), sequencing-based gene expression analysis (e.g., Serial Analysis of Gene Expression (SAGE)), gene expression analysis by massively parallel signature sequencing (MPSS), and the like. Detectable levels are defined as being higher that the limit of detection (LOD), which is the lowest concentration that can be measured (detected) with statistical significance by means of a given detection method.

[0142] In an aspect, an activator may comprise a nucleic acid activator. In an aspect, the nucleic acid activator comprises an RNA sequence at least about 80% identical (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) to a wild type SNORA13 or a variant or derivative thereof. In an aspect, the RNA sequence is identical to a wild type SNORA13 or a variant or derivative thereof. In an aspect, the RNA sequence is identical to an engineered SNORA13 or a variant or derivative thereof. In an aspect, the nucleic acid activator comprises an RNA sequence at least about 80% identical (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) to human SNORA13 or a variant or derivative thereof. In an aspect, the RNA sequence is identical to human SNORA13 or a variant or derivative thereof. In an aspect, the nucleic acid activator comprises an RNA sequence at least about 80% identical (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) to SEQ ID NO: 2. In an aspect, the RNA sequence is identical to SEQ ID NO: 2.

[0143] In an aspect, the activator may comprise a nucleic acid activator comprising a nucleic acid sequence encoding SNORA13. In an aspect, the nucleic acid activator comprises a nucleic acid sequence at least about 80% identical (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) to a wild-type SNORA13 gene or a variant or derivative thereof. In an aspect, the nucleic acid activator comprises a nucleic acid sequence at least about 80% identical (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) to huma SNORA13 gene or a variant or derivative thereof. In an aspect, the nucleic acid activator comprises a nucleic acid sequence at least about 80% identical (e.g., about 80%, about 85%, about 90%, about 95%, or about 99%) to SEQ ID NO: 1 or a derivative thereof. In an aspect, the nucleic acid activator comprises a nucleic acid sequence as provided in SEQ ID NO: 1 or a variant or a derivative thereof.

[0144] In an aspect, the nucleic acid activator may comprise a nucleic acid sequence that encodes an effector that enhances the expression or activity of SNORA13. As used herein, the term effector includes any biomolecule, for example a protein, a nucleic acid, or a combination thereof, that directly or indirectly impacts the level of SNORA13, or the activity of SNORA13. In an aspect, the effector may be an RNA. In an aspect. the effector may be a 23 95635253Attorney Docket No.106546-804769 (4262) protein. In an aspect, a disclosed effector may be a transcription factor that enhances the expression of SNORA13. In an aspect, the effector may be an RNA binding protein that interacts with SNORA13 and enhances its stability, and or persistence in the cell. In an aspect, the effector may be an RNA that binds to and stabilizes SNORA13. In an aspect, the effector may be an RNA chaperone that impacts the SNORA13 folding or structure. In an aspect, the effector may be a protein that impacts the degradation of SNORA13. Modified nucleic acids, polynucleotides, and vectors

[0145] In an aspect, a nucleic acid inhibitor or activator molecule disclosed herein may have one or more chemical modifications. Non-limiting examples of chemical modifications can include terminal cap moieties, phosphate backbone modifications, and the like. Examples of classes of terminal cap moieties include, without limitation, inverted deoxy abasic residues, glyceryl modifications, 4′,5′-methylene nucleotides, 1-(β-D-erythrofuranosyl) nucleotides, 4′- thio nucleotides, carbocyclic nucleotides, 1,5-anhydrohexitol nucleotides, L-nucleotides, α- nucleotides, modified base nucleotides, threo pentofuranosyl nucleotides, acyclic 3′,4′-seco nucleotides, acyclic 3,4-dihydroxybutyl nucleotides, acyclic 3,5-dihydroxypentyl nucleotides, 3′-3′-inverted nucleotide moieties, 3′-3′-inverted abasic moieties, 3′-2′-inverted nucleotide moieties, 3′-2′-inverted abasic moieties, 5′-5′-inverted nucleotide moieties, 5′-5′-inverted abasic moieties, 3′-5′-inverted deoxy abasic moieties, 5′-amino-alkyl phosphate, 1,3-diamino- 2-propyl phosphate, 3 aminopropyl phosphate, 6-aminohexyl phosphate, 1,2-aminododecyl phosphate, hydroxypropyl phosphate, 1,4-butanediol phosphate, 3′-phosphoramidate, 5′ phosphoramidate, hexylphosphate, aminohexyl phosphate, 3′-phosphate, 5′-amino, 3′- phosphorothioate, 5′-phosphorothioate, phosphorodithioate, and bridging or non-bridging methylphosphonate or 5′-mercapto moieties. Non-limiting examples of phosphate backbone modifications (i.e., resulting in modified internucleotide linkages) include phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, morpholino, amidate, carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and alkylsilyl substitutions. Such chemical modifications can occur at the 5′- end and / or 3′-end of the sense strand, antisense strand, or both strands of the nucleic acid inhibitor or activator. In an aspect, the nucleic acid may comprise a locked nucleic acid (LNA) or a bridged nucleic acid. A locked nucleic acid (LNA), also known as bridged nucleic acid (BNA), is a modified RNA nucleotide in which the ribose moiety is modified with an extra bridge connecting the 2' oxygen and 4' carbon. The bridge "locks" the ribose in the 3'-endo (North) conformation, which is often found in the A-form duplexes. This structure provides for increased stability against enzymatic degradation. LNA also offers improved specificity and affinity in base-pairing as a monomer or a constituent of an oligonucleotide. LNA nucleotides can be mixed with DNA or RNA residues in a nucleic acid sequence. 24 95635253Attorney Docket No.106546-804769 (4262)

[0146] Chemical modification of a nucleic acid inhibitor or activator molecule disclosed herein may comprise modification of at least one ribosugar or deoxyribose sugar moiety of its nucleotide sequence. The ribosugar or deoxy sugar moiety may be modified with 22′-O- methyl (2′OMe), 2′-deoxy-2′-fluoro (2′F), 2′-deoxy, 5-C-methyl, 2′-O-(2-methoxyethyl) (MOE), 4′-thio, 2′-amino, 2′-C-allyl, or any combination thereof. In an aspect, the chemical modification may comprise highly nuclease resistant 2′,4′-constrained MOE (cMOE) or ethyl bicyclic nucleic acids (cET BNA). In some aspects, a nucleic acid inhibitor or activator molecule disclosed herein may have less than about 10% to about 70% (e.g., about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%) of ribosugar moieties of the total nucleotide sequence modified.

[0147] Chemical modification of a nucleic acid inhibitor or activator molecule disclosed herein may comprise attaching a conjugate to the nucleic acid inhibitor or activator molecule. The type of conjugate used and the extent of conjugation to the nucleic acid inhibitor or activator can be evaluated for improved pharmacokinetic profiles, bioavailability, and / or stability of the nucleic acid inhibitor or activator while retaining activity. As such, one skilled in the art can screen nucleic acid inhibitor or activator molecules having various conjugates attached thereto to identify nucleic acid inhibitor or activator conjugates having improved properties using any of a variety of well-known in vitro cell culture or in vivo animal models including the negative-controlled expression studies described above. The conjugate can be attached at the 5′- and / or the 3′-end of the sense and / or the antisense strand of the nucleic acid inhibitor or activator via a covalent attachment such as a nucleic acid or non-nucleic acid linker. The conjugate can be attached to the nucleic acid inhibitor or activator through a carbamate group or other linking group (see, e.g., U.S. Patent Publication Nos.20050074771, 20050043219, and 20050158727, the content of each of which is incorporated by reference herein in its entirety). A conjugate may be added to nucleic acid inhibitor or activator for any of a number of purposes. For example, the conjugate may be a molecular entity that facilitates the delivery of nucleic acid inhibitor or activator into a cell or may be a molecule that comprises a drug or label. Examples of conjugate molecules suitable for attachment to nucleic acid inhibitor or activator of the present disclosure include, without limitation, steroids such as cholesterol, glycols such as polyethylene glycol (PEG), human serum albumin (HSA), fatty acids, carotenoids, terpenes, bile acids, folates (e.g., folic acid, folate analogs and derivatives thereof), sugars (e.g., galactose, galactosamine, N-acetyl galactosamine, glucose, mannose, fructose, fucose, etc.), phospholipids, peptides, ligands for cellular receptors capable of mediating cellular uptake, and combinations thereof. Other examples include the lipophilic moiety, vitamin, polymer, peptide, protein, nucleic acid, small molecule, oligosaccharide, carbohydrate cluster, intercalator, minor groove binder, cleaving agent, and cross-linking 25 95635253Attorney Docket No.106546-804769 (4262) agent conjugate molecules described in e.g., U.S. Patent Publication Nos.20050119470 and 20050107325, the content of each of which is incorporated by reference herein in its entirety. Other examples include the 2′-O-alkyl amine, 2′-O-alkoxyalkyl amine, polyamine, C5-cationic modified pyrimidine, cationic peptide, guanidinium group, amidininium group, cationic amino acid conjugate molecules, and the like. Additional examples of conjugate molecules include a hydrophobic group, a membrane active compound, a cell penetrating compound, a cell targeting signal, an interaction modifier, or a steric stabilizer as described in U.S. Patent Publication No.20040167090, incorporated by reference herein in its entirety.

[0148] In certain aspects, nucleic acid inhibitor or activator molecules disclosed herein may be conjugated to at least one targeting ligand. Targeting ligands contemplated herein include ligands suitable for targeting nucleic acid inhibitor or activator molecules to a particular cell type, tissue, organ or system. In an aspect, the targeting ligand may be specific to a cancer cell.

[0149] In an aspect, the present disclosure also provides for methods of making the nucleic acid inhibitor or activators disclosed herein. Making of nucleic acid inhibitor or activator can be through chemical synthesis or the nucleic acid may be encoded by a plasmid and transcribed or may be vectored by a transposon, or virus engineered to express the nucleic acid inhibitor or activator. A nucleic acid activator or inhibitor may be a single stranded molecule with complementary sequences that self-hybridize into duplexes with hairpin loops. An inhibitor or activator nucleic acid can also be generated by cleavage of parent dsRNA through the use of an appropriate enzyme such as E. coli RNase III or Dicer. A parent dsRNA may be any double stranded RNA duplex from which an inhibitor or activator nucleic acid may be produced, such as a full or partial mRNA transcript. Use of cell lysates or in vitro processing may further involve the subsequent isolation of the short, nucleotide inhibitor or activator nucleic acids (e.g., about 2-25 nucleotides in length) from the lysate, etc., Chemical synthesis proceeds by making a single stranded RNA oligomers, two single stranded RNA-oligomers followed by the annealing of the two single stranded oligomers into a double stranded RNA, a single stranded DNA or two single stranded DNA-oligomers followed by the annealing of the two single stranded oligomers into a double stranded DNA. Methods of chemical synthesis are diverse and can be easily adapted to synthesis different inhibitor or activator nucleic acids. In an aspect, various modified nucleotides can be incorporated during synthesis.

[0150] In an aspect, the nucleic acid sequence encoding the inhibitor or activator is operably linked to one or more transcription regulatory sequences. “Transcriptional regulatory elements” refer to any nucleotide sequence that influences transcription initiation and rate, or stability and / or mobility of a transcript product. Regulatory sequences include, but are not limited to, promoters, promoter control elements, enhancers, protein binding sequences, 5′ 26 95635253Attorney Docket No.106546-804769 (4262) and 3′ UTRs, transcriptional start sites, termination sequences, polyadenylation sequences, introns, etc. Such transcriptional regulatory sequences can be located either 5′-, 3′-, or within the coding region of the gene and can be either promote (positive regulatory element) or repress (negative regulatory element) gene transcription.

[0151] In an aspect, the transcription regulatory sequence is a promoter, an enhancer or both. A regulatory sequence can be a promoter. A disclosed promoter can comprise a ubiquitous promoter, a constitutive promoter, or a tissue specific promoter. In an aspect, a disclosed promoter can be operably linked to a disclosed nucleic acid sequence. Promoters are known to the art. In an aspect, a disclosed promoter can be a promoter / enhancer. An enhancer element is a nucleic acid sequence that functions to enhance transcription. As used herein, the terms “enhance” and “enhancement” with respect to nucleic acid expression, refers to an increase and / or prolongation of steady-state levels of the indicated nucleic acid, e.g., by at least about 2%, 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 2-fold, 2.5-fold, 3-fold, 5-fold, 10-fold, 15-fold, 20-fold, 30-fold, 50-fold, 100-fold or more. Promoter / enhancers are known to the art. In an aspect, a disclosed promoter can be an endogenous promoter. In an aspect, a disclosed endogenous promoter can be an endogenous promoter / enhancer. In an aspect, a disclosed promoter or a disclosed promoter / enhancer can be used for constitutive and efficient expression of a disclosed snoRNA. In an aspect, a disclosed promoter or a disclosed promoter / enhancer can be used for constitutive and efficient expression of a disclosed snoRNA. A promoter can be an inducible promoter (e.g., a heat shock promoter, tetracycline-regulated promoter, steroid-regulated promoter, metal-regulated promoter, estrogen receptor-regulated promoter, etc.). The promoter can be a constitutive promoter (e.g., CMV promoter, UBC promoter, CAG promoter). In some cases, the promoter can be a spatially restricted and / or temporally restricted promoter (e.g., a tissue specific promoter, a cell type specific promoter, etc.).

[0152] The promoter can be chosen so that it will function in the target cell(s) of interest. Tissue-specific promoters refer to promoters that have activity in only certain cell types. The use of a tissue-specific promoter in a nucleic acid expression cassette can restrict unwanted transgene expression in the unaffected tissues as well as facilitate persistent transgene expression by escaping from transgene induced host immune responses. Tissue specific promoters include, but are not limited to, immune cell specific, neuron-specific promoters, muscle-specific promoters, liver-specific promoters, skeletal muscle-specific promoters, and heart-specific promoters.

[0153] In other aspects, the promoter can be a constitutive promoter. Constitutive promoters refer to promoters that allow for continual transcription of its associated gene. Constitutive promoters are always active and can be used to express genes in a wide range of cells and 27 95635253Attorney Docket No.106546-804769 (4262) tissues. Examples of constitutive promoters include, but are not limited to, a CMV major immediate-early enhancer / chicken beta-actin promoter, a cytomegalovirus (CMV) major immediate-early promoter, an Elongation Factor 1- ^ (EF1- ^) promoter, a simian vacuolating virus 40 (SV40) promoter, an AmpR promoter, a P ^K promoter, a human ubiquitin C gene (Ubc) promoter, a MFG promoter, a human beta actin promoter, a CAG promoter, a EGR1 promoter, a FerH promoter, a FerL promoter, a GRP78 promoter, a GRP94 promoter, a HSP70 promoter, a ^-kin promoter, a murine phosphoglycerate kinase (mPGK) or human PGK (hPGK) promoter, a ROSA promoter, human Ubiquitin B promoter, a Rous sarcoma virus promoter, or any other natural or synthetic ubiquitous promoters. In an aspect, the constitutively active promoter can comprise human ^-actin, human elongation factor-1 ^, chicken ^-actin combined with cytomegalovirus early enhancer, cytomegalovirus (CMV), simian virus 40, or herpes simplex virus thymidine kinase.

[0154] Inducible promoters refer to promoters that can be regulated by positive or negative control. Factors that can regulate an inducible promoter include, but are not limited to, chemical agents (e.g., the metallothionein promoter or a hormone inducible promoter), temperature, and light.

[0155] The promoters can be operably linked to one or more (e.g., 2, 3, 4, 5, 6, 7, or 8) enhancer elements (e.g., a neuron-specific promoter fused to a cytomegalovirus enhancer) or combined to form a tandem promoter (e.g., neuron-specific / constitutive tandem promoter). When two or more tissue-specific promoters are present, the isolated nucleic acid can be targeted to two or more different tissues at the same time.

[0156] As discussed above, a disclosed promoter can be an endogenous promoter. Endogenous refers to a disclosed promoter or disclosed promoter / enhancer that is naturally linked with its gene. In an aspect, a disclosed endogenous promoter can generally be obtained from a non-coding region upstream of a transcription initiation site of a gene (such as, for example, a disclosed snoRNA). In an aspect, a disclosed endogenous promoter can be used for constitutive and efficient expression of a disclosed transgene (e.g., a nucleic acid sequence encoding a snoRNA). In an aspect, a disclosed endogenous promoter can be an endogenous promoter / enhancer.

[0157] As discussed above, a disclosed promoter can be an exogenous promoter. Exogenous (or heterologous) refers to a disclosed promoter or a disclosed promoter / enhancer that can be placed in juxtaposition to a gene by means of molecular biology techniques such that the transcription of that gene can be directed by the linked promoter or linked promoter / enhancer

[0158] In an aspect, a disclosed composition can comprise a nucleic acid inhibitor or 28 95635253Attorney Docket No.106546-804769 (4262) activator, or a polynucleotide comprising a nucleic acid sequence that encodes a nucleic acid inhibitor or activator of SNORA13. In an aspect the current disclosure also encompasses a polynucleotide comprising a nucleic acid sequence encoding an effectors (protein or RNA). In an aspect, the polynucleotide encoding the nucleic acid sequence may be a vector, for example a plasmid vector, a viral vector, or a transposon. In some aspects the current disclosure also encompasses vectors that facilitate transfer of nucleic acids encoding the activators or inhibitors disclosed herein, such as, but not limited to, plasmids, transposons, cosmids, chromosomes, artificial chromosomes, viruses, virions, and the like. A vector may also be a chemical vector, such as a lipid complex or naked DNA. In some aspects the vector may be a viral vector. A viral vector may comprise an expression construct as described herein.

[0159] As used herein, the term “viral vector” can refer to a nucleic acid vector construct that includes at least one element of viral origin and has the capacity to be packaged into a viral vector particle and encodes at least an exogenous polynucleotide. In certain aspects, the vector and / or particle can be utilized for the purpose of transferring any nucleic acids into cells either in vitro or in vivo. Numerous viral vectors are known in the art. The term virion can refer to a single infective viral particle. “Viral vector,” “viral vector particle,” and “viral particle” also refer to a complete virus particle with its DNA or RNA core and protein coat as it exists outside the cell. Non-limiting examples of viral vectors for use herein can include adenoviruses, adeno- associated viruses (AAV), herpesviruses, retroviruses, lentiviruses, integrase defective lentiviruses (IDLV), and the like. In some aspects, a viral vector disclosed herein can be a lentiviral vector. Examples of lentiviruses include, but are not limited to, human lentiviruses such as HIV (in particular HIV-1 or HIV-2), simian immunodeficiency virus (SIV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), Caprine Arthritis Encephalitis Virus (CAEV), visna and progressive pneumonia viruses of sheep, baboon pseudotype viruses, bovine immunodeficiency virus (BIV), and the like. In some aspects, nucleic acid molecules and / or vectors described herein can be prepared by conventional recombinant technology known to one of skill in the art. In other aspects, nucleic acid molecules and / or vectors described herein can be prepared by a gene editing method known in the art (e.g., by CRISPR).

[0160] In certain aspects, the current disclosure also encompasses a cell engineered to express any of the nucleic acid molecules and / or vectors described herein. In an aspect, cells can be engineered in vitro, ex vivo or in vitro. In some aspects, vectors, viral particles, and the like as contemplated herein may be encapsulated into a suitable delivery system for delivery to a subject. Delivery systems may include but are not restricted to liposomes, a lipidoid, a lipoplex, a nanoparticle, a lipid nanoparticle, a polymeric compound, a peptide, a protein, a 29 95635253Attorney Docket No.106546-804769 (4262) cell, a nanoparticle mimic, a nanotube, or a conjugate. Pharmaceutical composition (i) Pharmaceutically acceptable carriers and excipients

[0161] As used herein a “pharmaceutical composition” refers to a preparation of a disclosed composition with one or more other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

[0162] Hereinafter, the phrases “physiologically acceptable carrier” and “pharmaceutically acceptable carrier” are interchangeably used herein to refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases.

[0163] In certain aspects, compositions disclosed herein may further compromise one or more pharmaceutically acceptable diluent(s), excipient(s), and / or carrier(s). As used herein, a pharmaceutically acceptable diluent, excipient, or carrier, refers to a material suitable for administration to a subject without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained. Pharmaceutically acceptable diluents, carriers, and excipients can include, but are not limited to, physiological saline, Ringer’s solution, phosphate solution or buffer, buffered saline, and other carriers known in the art.

[0164] In some aspects, pharmaceutical compositions herein may also include stabilizers, anti-oxidants, colorants, other medicinal or pharmaceutical agents, carriers, adjuvants, preserving agents, stabilizing agents, wetting agents, emulsifying agents, solution promoters, salts, solubilizers, antifoaming agents, antioxidants, dispersing agents, surfactants, or any combination thereof. Herein, the term “excipient” refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols. Techniques for formulation and administration of drugs may be found in “Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, Pa., latest edition, which is incorporated herein by reference.

[0165] In certain aspects, pharmaceutical compositions described herein may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries to facilitate processing of genetically modified endothelial progenitor cells into preparations which can be used pharmaceutically. In some aspects, any of the well- 30 95635253Attorney Docket No.106546-804769 (4262) known techniques, carriers, and excipients may be used as suitable and / or as understood in the art.

[0166] In certain aspects, pharmaceutical compositions described herein may be an aqueous suspension comprising one or more polymers as suspending agents. In some aspects, polymers that may comprise pharmaceutical compositions described herein include: water-soluble polymers such as cellulosic polymers, e.g., hydroxypropyl methylcellulose; water-insoluble polymers such as cross-linked carboxyl-containing polymers; mucoadhesive polymers, selected from, for example, carboxymethylcellulose, carbomer (acrylic acid polymer), poly(methylmethacrylate), polyacrylamide, polycarbophil, acrylic acid / butyl acrylate copolymer, sodium alginate, and dextran; or a combination thereof. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, or at least about 50% total amount of polymers as suspending agent(s) by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of polymers as suspending agent(s) by total weight of the composition.

[0167] In certain aspects, pharmaceutical compositions disclosed herein may comprise a viscous formulation. In some aspects, viscosity of composition herein may be increased by the addition of one or more gelling or thickening agents. In some aspects, compositions disclosed herein may comprise one or more gelling or thickening agents in an amount to provide a sufficiently viscous formulation to remain on treated tissue. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, or at least about 50% total amount of gelling or thickening agent(s) by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of gelling or thickening agent(s) by total weight of the composition. In some aspects, suitable thickening agents for use herein can be hydroxypropyl methylcellulose, hydroxyethyl cellulose, polyvinylpyrrolidone, carboxymethyl cellulose, polyvinyl alcohol, sodium chondroitin sulfate, sodium hyaluronate. In other aspects, viscosity enhancing agents can be acacia (gum arabic), agar, aluminum magnesium silicate, sodium alginate, sodium stearate, bladderwrack, bentonite, carbomer, carrageenan, Carbopol, xanthan, cellulose, microcrystalline cellulose (MCC), ceratonia, chitin, carboxymethylated chitosan, chondrus, dextrose, furcellaran, gelatin, Ghatti gum, guar gum, hectorite, lactose, sucrose, maltodextrin, mannitol, sorbitol, honey, maize starch, wheat starch, rice starch, 31 95635253Attorney Docket No.106546-804769 (4262) potato starch, gelatin, sterculia gum, xanthum gum, gum tragacanth, ethyl cellulose, ethylhydroxyethyl cellulose, ethylmethyl cellulose, methyl cellulose, hydroxyethyl cellulose, hydroxyethylmethyl cellulose, hydroxypropyl cellulose, poly(hydroxyethyl methacrylate), oxypolygelatin, pectin, polygeline, povidone, propylene carbonate, methyl vinyl ether / maleic anhydride copolymer (PVM / MA), poly(methoxyethyl methacrylate), poly(methoxyethoxyethyl methacrylate), hydroxypropyl cellulose, hydroxypropylmethyl-cellulose (HPMC), sodium carboxymethyl-cellulose (CMC), silicon dioxide, polyvinylpyrrolidone (PVP: povidone), Splenda® (dextrose, maltodextrin and sucralose), or any combination thereof.

[0168] In certain aspects, pharmaceutical compositions disclosed herein may comprise additional agents or additives selected from a group including surface-active agents, detergents, solvents, acidifying agents, alkalizing agents, buffering agents, tonicity modifying agents, ionic additives effective to increase the ionic strength of the solution, antimicrobial agents, antibiotic agents, antifungal agents, antioxidants, preservatives, electrolytes, antifoaming agents, oils, stabilizers, enhancing agents, and the like. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, or at least about 50% total amount of one or more agents by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more agents by total weight of the composition. In some aspects, one or more of these agents may be added to improve the performance, efficacy, safety, shelf- life and / or other property of the muscarinic antagonist composition of the present disclosure. In some aspects, additives may be biocompatible, without being harsh, abrasive, and / or allergenic.

[0169] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more acidifying agents. As used herein, “acidifying agents” refers to compounds used to provide an acidic medium. Such compounds include, by way of example and without limitation, acetic acid, amino acid, citric acid, fumaric acid and other alpha hydroxy acids, such as hydrochloric acid, ascorbic acid, and nitric acid and others known to those of ordinary skill in the art. In some aspects, any pharmaceutically acceptable organic or inorganic acid may be used. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% total amount of one or more acidifying agents by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more acidifying agents 32 95635253Attorney Docket No.106546-804769 (4262) by total weight of the composition.

[0170] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more alkalizing agents. As used herein, “alkalizing agents” are compounds used to provide alkaline medium. Such compounds include, by way of example and without limitation, ammonia solution, ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium borate, sodium carbonate, sodium bicarbonate, sodium hydroxide, triethanolamine, and trolamine and others known to those of ordinary skill in the art. In some aspects, any pharmaceutically acceptable organic or inorganic base can be used. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% total amount of one or more alkalizing agents by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more alkalizing agents by total weight of the composition.

[0171] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more antioxidants. As used herein, “antioxidants” are agents that inhibit oxidation and thus can be used to prevent the deterioration of preparations by the oxidative process. Such compounds include, by way of example and without limitation, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, hypophophorous acid, monothioglycerol, propyl gallate, sodium ascorbate, sodium bisulfite, sodium formaldehyde sulfoxylate, sodium metabisulfite and other materials known to one of ordinary skill in the art. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% total amount of one or more antioxidants by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more antioxidants by total weight of the composition.

[0172] In certain aspects, pharmaceutical compositions disclosed herein may comprise a buffer system. As used herein, a “buffer system” is a composition comprised of one or more buffering agents wherein “buffering agents” are compounds used to resist change in pH upon dilution or addition of acid or alkali. Buffering agents include, by way of example and without limitation, potassium metaphosphate, potassium phosphate, monobasic sodium acetate and sodium citrate anhydrous and dihydrate and other materials known to one of ordinary skill in the art. In some aspects, any pharmaceutically acceptable organic or inorganic buffer can be 33 95635253Attorney Docket No.106546-804769 (4262) used. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% total amount of one or more buffering agents by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more buffering agents by total weight of the composition.

[0173] In some aspects, the amount of one or more buffering agents may depend on the desired pH level of a composition. In some aspects, pharmaceutical compositions disclosed herein may have a pH of about 6 to about 9. In some aspects, pharmaceutical compositions disclosed herein may have a pH greater than about 8, greater than about 7.5, greater than about 7, greater than about 6.5, or greater than about 6.

[0174] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more preservatives. As used herein, “preservatives” refers to agents or combination of agents that inhibits, reduces or eliminates bacterial growth in a pharmaceutical dosage form. Non-limiting examples of preservatives include Nipagin, Nipasol, isopropyl alcohol and a combination thereof. In some aspects, any pharmaceutically acceptable preservative can be used. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% total amount of one or more preservatives by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more preservatives by total weight of the composition.

[0175] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more surface-acting reagents or detergents. In some aspects, surface-acting reagents or detergents may be synthetic, natural, or semi-synthetic. In some aspects, compositions disclosed herein may comprise anionic detergents, cationic detergents, zwitterionic detergents, ampholytic detergents, amphoteric detergents, nonionic detergents having a steroid skeleton, or a combination thereof. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% total amount of one or more surface-acting reagents or detergents by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more surface-acting reagents or detergents by total weight of the 34 95635253Attorney Docket No.106546-804769 (4262) composition.

[0176] In certain aspects, pharmaceutical compositions disclosed herein may comprise one or more stabilizers. As used herein, a “stabilizer” refers to a compound used to stabilize an active agent (for example a composition as disclosed herein) against physical, chemical, or biochemical process that would otherwise reduce the therapeutic activity of the agent. Suitable stabilizers include, by way of example and without limitation, succinic anhydride, albumin, sialic acid, creatinine, glycine and other amino acids, niacinamide, sodium acetyltryptophonate, zinc oxide, sucrose, glucose, lactose, sorbitol, mannitol, glycerol, polyethylene glycols, sodium caprylate and sodium saccharin and others known to those of ordinary skill in the art. In some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% total amount of one or more stabilizers by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more stabilizers by total weight of the composition.

[0177] In some aspects, pharmaceutical compositions disclosed herein may comprise one or more tonicity agents. As used herein, a “tonicity agents” refers to a compound that can be used to adjust the tonicity of the liquid formulation. Suitable tonicity agents include, but are not limited to, glycerin, lactose, mannitol, dextrose, sodium chloride, sodium sulfate, sorbitol, trehalose and others known to those or ordinary skill in the art. Osmolarity in a composition may be expressed in milliosmoles per liter (mOsm / L). Osmolarity may be measured using methods commonly known in the art. In some aspects, a vapor pressure depression method is used to calculate the osmolarity of the compositions disclosed herein. In some aspects, the amount of one or more tonicity agents comprising a pharmaceutical composition disclosed herein may result in a composition osmolarity of about 150 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 350 mOsm / L, about 280 mOsm / L to about 370 mOsm / L or about 250 mOsm / L to about 320 mOsm / L. In some aspects, a composition herein may have an osmolality ranging from about 100 mOsm / kg to about 1000 mOsm / kg, from about 200 mOsm / kg to about 800 mOsm / kg, from about 250 mOsm / kg to about 500 mOsm / kg, or from about 250 mOsm / kg to about 320 mOsm / kg, or from about 250 mOsm / kg to about 350 mOsm / kg or from about 280 mOsm / kg to about 320 mOsm / kg. In some aspects, a pharmaceutical composition described herein may have an osmolarity of about 100 mOsm / L to about 1000 mOsm / L, about 200 mOsm / L to about 800 mOsm / L, about 250 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 350 mOsm / L, about 250 mOsm / L to about 320 mOsm / L, or about 280 mOsm / L to about 320 mOsm / L. In 35 95635253Attorney Docket No.106546-804769 (4262) some aspects, pharmaceutical compositions disclosed herein may comprise at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50% total amount of one or more tonicity modifiers by total weight of the composition. In some aspects, pharmaceutical compositions disclosed herein may comprise about 5% to about 99%, about 10%, about 95%, or about 15% to about 90% total amount of one or more tonicity modifiers by total weight of the composition. (ii) Dosage formulations

[0178] In certain aspects, the present disclosure provides compositions formulated for one or more routes of administration. Suitable routes of administration may, for example, include oral, rectal, transmucosal, transnasal, intestinal, and / or parenteral delivery. In some aspects, compositions herein formulated can be formulated for parenteral delivery. In some aspects, compositions herein formulated can be formulated intramuscular, subcutaneous, intramedullary, intravenous, intraperitoneal, and / or intranasal injections.

[0179] In certain aspects, one may administer a composition herein in a local or systemic manner, for example, via local injection of the pharmaceutical composition directly into a tissue region of a patient. In some aspects, a pharmaceutical composition disclosed herein can be administered parenterally, e.g., by intravenous injection, intracerebroventricular injection, intra-cisterna magna injection, intra-parenchymal injection, or a combination thereof. In some aspects, a pharmaceutical composition disclosed herein can administered to subject as disclosed herein. In some aspects, a pharmaceutical composition disclosed herein can administered to human patient. In some aspects, a pharmaceutical composition disclosed herein can administered to a human patient via at least two administration routes. In some aspects, the combination of administration routes by be intracerebroventricular injection and intravenous injection; intrathecal injection and intravenous injection; intra-cisterna magna injection and intravenous injection; and / or intra-parenchymal injection and intravenous injection.

[0180] In certain aspects, pharmaceutical compositions of the present disclosure may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

[0181] In certain aspects, pharmaceutical compositions for use in accordance with the present disclosure thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. 36 95635253Attorney Docket No.106546-804769 (4262) Proper formulation is dependent upon the route of administration chosen. For injection, the active ingredients of a pharmaceutical composition herein may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, physiological salt buffer, or any combination thereof.

[0182] In certain aspects, pharmaceutical compositions described herein may be formulated in the form of a nanoparticle. The nanoparticle may have a monolayer enclosing the nanoparticle core, wherein the siRNA molecule is disposed within the nanoparticle core. In an aspect, the nanoparticle core includes a solid lipid (i.e., lipid that remains solid at room temperature and body temperature) or a liquid lipid (i.e., oil, which remains liquid at room temperature and body temperature, for example, vegetable oil or a lipid extracted from human adipose tissue). In particular, aspects of the present disclosure include nanoparticles and compositions for the controlled and / or sustained release (e.g., release at a predetermined rate to maintain a certain concentration for a certain period of time) of an agent, such as a snoRNA from the nanoparticle.

[0183] In certain aspects, pharmaceutical compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection herein may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. In some aspects, compositions herein may be suspensions, solutions or emulsions in oily or aqueous vehicles, and / or may contain formulatory agents such as suspending, stabilizing and / or dispersing agents.

[0184] In certain aspects, pharmaceutical compositions herein formulated for parenteral administration may include aqueous solutions of the active preparation (e.g., a snoRNA molecule) in water-soluble form. In some aspects, compositions herein comprising suspensions of the active preparation may be prepared as oily or water-based injection suspensions. Suitable lipophilic solvents and / or vehicles for use herein may include, but are not limited to, fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. In some aspects, compositions herein comprising aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, and / or dextran. In some aspects, compositions herein comprising a suspension may also contain one or more suitable stabilizers and / or agents which increase the solubility of the active ingredients (e.g., a snoRNA molecule) to allow for the preparation of highly concentrated solutions.

[0185] In some aspects, compositions herein may comprise the active ingredient in a powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water-based solution, before use. 37 95635253Attorney Docket No.106546-804769 (4262)

[0186] Pharmaceutical compositions suitable for use in context of the present disclosure may include compositions wherein the active ingredients can be contained in an amount effective to achieve the intended purpose. In some aspects, a therapeutically effective amount means an amount of active ingredients (e.g., a snoRNA molecule) effective to prevent, slow, alleviate or ameliorate symptoms of a disorder (e.g., liver disease) or prolong the survival of the subject being treated.

[0187] Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0188] For any preparation used in the methods of the present disclosure, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays and or screening platforms disclosed herein. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.

[0189] In some aspects, toxicity and therapeutic efficacy of the active ingredients disclosed herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. In some aspects, data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in a human subject. In some aspects, a dosage for use herein may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in “The Pharmacological Basis of Therapeutics,” Ch. 1).

[0190] In certain aspects, dosage amounts and / or dosing intervals may be adjusted individually to brain or blood levels of the active ingredient that are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC). In some aspects, the MEC for an active ingredient (e.g., a snoRNA molecule or composition disclosed herein) may vary for each preparation, but can be estimated from in vitro data. In some aspects, dosages necessary to achieve the MEC herein may depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.

[0191] In certain aspects, depending on the severity and responsiveness of the condition to be treated, dosing with compositions herein can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks or until cure is affected or diminution of the disease state is achieved.

[0192] In certain aspects, amounts of a composition herein to be administered will be dependent on the subject being treated, the severity of the affliction, the manner of 38 95635253Attorney Docket No.106546-804769 (4262) administration, the judgment of the prescribing physician, and the like. In some aspects, effective doses may be extrapolated from dose-responsive curves derived from in vitro or in vivo test systems.

[0193] In some aspect, the pharmaceutical composition may comprise one or more active agents in addition to the compositions disclosed herein. Non limiting examples of additional active agents include but are not restricted to antibiotics, anti-pyrectics, antimicrobials, antifungals, NSAIDs, chemotherapeutic and anticancer agents. III. Methods

[0194] In an aspect, the current disclosure also encompasses method of using the disclosed compositions for treatment of various diseases, disorders, or conditions in a subject in need thereof. In an aspect, the subject may have altered ribosome biogenesis or ribosomopathy. In an aspect, the subject may exhibit symptoms of a ribosomopathy. Ribosomopathies, for example, represent a spectrum of diseases caused by haploinsufficiency for ribosomal proteins or loss-of-function of ribosome biogenesis factors. Despite the universal requirement for translation in cellular functions, these diseases are characterized by tissue-specific defects that frequently include hematopoietic and skeletal abnormalities, as well as a predisposition to malignancy later in life. The term “ribosomopathy” or “ribosomopathies” refers to any disease or malfunction of ribosomes. Ribosomes are small organelles found in all cells which are involved in the production of proteins by translating messenger RNA. Ribosomopathies are generally considered to be disorders of ribosome biogenesis, which can result in impaired protein synthesis and cellular dysfunction. The symptoms and severity of ribosomopathies can vary widely depending on the specific gene affected and the nature of the mutation. A disease or malfunction of ribosomes include (i) disease of ribosomal biogenesis proteins, (ii) disease of small nucleolar ribonucleoproteins, and (iii) diseases of ribosomal proteins (as discussed above in the definition of “ribosomal protein disorder”), and are all reviewed in Freed et al., Mol. Biosyst. 2010; 6(3); 481-493 entitled “When ribosomes go bad: diseases of ribosome biogenesis,” which is incorporated herein in its entirety by reference. Diseases of ribosomal biogenesis proteins include, but are not limited to Treacher Collins syndrome (TCS), male infertility due to a mutation in UTP14c, native American Indian childhood cirrhosis (NAIC), Bowen-Conradi syndrome (BCS), alopecia neurological defect and endrocrinopathy syndrome (ANE, candidate gene for primary open angle glaucoma (POAG), and modifier of neurofibromatosis type I (NF1), cancer, a neurodegenerative disease (e.g. Alzheimer’s or Parkinson’s disease), an age related disorder, Diamond-Blackfan anemia (DBA), Shwachman-Diamond syndrome (SDS), X-linked dyskeratosis congenita, Cartilage Hair Hypoplasia (CHH), atherosclerosis, myocardial ischemia or a combination thereof. In an aspect, the current disclosure provides unexpected results that shows inhibition of SNORA13 39 95635253Attorney Docket No.106546-804769 (4262) has the dual effect of increasing ribosome production while simultaneously reducing nucleolar stress and p53 activation. In an aspect, the current disclosure encompasses methods for targeting SNORA13 gene or SNORA13 as an effective approach for reversing the molecular defects present in these disorders. Thus, in an aspect, the current disclosure encompasses methods of making and using, a disclosed inhibitor composition that targets SNORA13 expression or levels, in a subject in need thereof, to treat a disease.

[0195] Altered ribosome biogenesis has been found in numerous human cancers, including those of the breast, pancreas, bladder, brain and many other tissues. In an aspect, the subject in need of treatment, has a cancer. In an aspect, the subject is diagnosed with a cancer. In an aspect, the subject has a non-hematological solid tumor. Non-limiting examples of solid cancer are a Adrenocortical carcinoma (ACC), Bladder Urothelial Carcinoma (BLCA), Brain Lower Grade Glioma (LGG), Breast invasive carcinoma (BRCA), Colon adenocarcinoma (COAD), Cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC), Cholangiocarcinoma (CHOL), Esophageal carcinoma (ESCA), Glioblastoma multiforme (GBM), Head and Neck squamous cell carcinoma (HNSC), Kidney Chromophobe (KICH), Kidney renal clear cell carcinoma (KIRC), Kidney renal papillary cell carcinoma (KIRP), Liver hepatocellular carcinoma (LIHC), Lung adenocarcinoma (LUAD), Lung squamous cell carcinoma (LUSC), Mesothelioma (MESO), Ovarian serous cystadenocarcinoma (OV), Pancreatic adenocarcinoma (PAAD), Pheochromocytoma and Paraganglioma (PCPG), Prostate adenocarcinoma (PRAD), Rectum adenocarcinoma (READ), Sarcoma (SARC), Skin Cutaneous Melanoma (SKCM), Stomach adenocarcinoma (STAD), Testicular Germ Cell Tumors (TGCT), Thyroid carcinoma (THCA), Uterine Carcinosarcoma (UCS), Uterine Corpus Endometrial Carcinoma (UCEC), and Uveal Melanoma (UVM). The cancer may be a hematologic malignancy. Hematologic malignancies include leukemias, lymphomas, multiple myeloma, and subtypes thereof. Lymphomas can be classified various ways, often based on the underlying type of malignant cell, including Hodgkin’s lymphoma (often cancers of Reed- Sternberg cells, but also sometimes originating in B cells; all other lymphomas are non- Hodgkin’s lymphomas), B-cell lymphomas, T-cell lymphomas, mantle cell lymphomas, Burkitt’s lymphoma, follicular lymphoma, and others as defined herein and known in the art.

[0196] In an aspect, the subject has or exhibits symptoms of a ribosomopathy other than cancer. In an aspect, the ribosomopathy is characterized by production of lower-than-normal intact functional ribosomes. In an aspect, inhibition of SNORA13 could be used to treat any condition associated with under-production of ribosomes. This includes all ribosomopathies, but also aging-associated conditions such as muscle wasting and neurodegeneration. Inhibiting SNORA13 could also help tissue regeneration such as in wound healing. In an aspect, other manifestations of ribosomopathies for example hematopoietic abnormalities 40 95635253Attorney Docket No.106546-804769 (4262) including anemia, bone marrow failure, skeletal abnormalities, growth insufficiency, pancreatic insufficiency, microcephaly and other neurologic deficits, cardiac defects, alopecia, liver failure, may also be treated by modulating SNORA13.

[0197] In an aspect, the current disclosure also encompasses treatment of a disease, disorder or condition, characterized by a higher-than-normal levels or ribosomal subunit production. The production of ribosomes is tightly regulated by cellular processes to maintain protein synthesis at an appropriate level. However, certain conditions or diseases may lead to an increased demand for protein synthesis, resulting in higher ribosome production. In an aspect, the disease is a cancer, age-related disease or a degenerative disease, infectious diseases, myelodysplastic syndrome (MDS), or hypertrophic cardiomyopathy. In an aspect, the current disclosure encompasses a method of treating a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a disclosed activator of SNORA13.

[0198] In another aspect, the disclosure encompasses treatment of senescence or a senescence associated pathology. The senescence associated pathology is selected from replicative senescence and DNA damage-induced senescence. Non-limiting examples of senescence associated pathology include lung fibrosis, atherosclerosis, Alzheimer's disease, diabetes, liver fibrosis, chronic kidney disease, cardiac fibrosis, Parkinson’s disease, age- related tissue decline, age-related organ decline, degenerative disease, cancer, cataracts, macular degeneration, glaucoma, atherosclerosis, acute coronary syndrome, myocardial infarction, stroke, recovery after stroke, PSD-95 decrease, hypertension, idiopathic pulmonary fibrosis (IPF), chronic obstructive pulmonary disease (COPD), type 1 diabetes, obesity, fat dysfunction, coronary artery disease, cerebrovascular disease, periodontal disease, cancer treatment-related disability, chemotherapy treatment-related disability, chemotherapy treatment-related frailty, frailty, radiotherapy and other radiation related disability, chemotherapy treatment-related frailty, cancer treatment-related atrophy, cancer treatment- related fibrosis, brain injury, heart injury, and therapy-related myelodysplastic syndrome, accelerated aging, accelerated aging disease, Hutchinson-Gilford progeria syndrome, Werner syndrome, Cockayne syndrome, xeroderma pigmentosum, ataxia telangiectasia, Fanconi anemia, dyskeratosis congenital, aplastic anemia, idiopathic pulmonary fibrosis, atherosclerosis, cardiovascular disease, adult cancer, arthritis, osteoporosis, hypertension, neurodegeneration, stroke, atrophic gastritis, osteoarthritis, NASH, camptocormia, chronic obstructive pulmonary disease, coronary artery disease, dopamine dysregulation syndrome, metabolic syndrome, effort incontinence, Hashimoto's thyroiditis, heart failure, late life depression, immunosenescence, myocardial infarction, acute coronary syndrome, sarcopenia, sarcopenic obesity, senile osteoporosis, and urinary incontinence. 41 95635253Attorney Docket No.106546-804769 (4262)

[0199] Thus, aspects of the present disclosure encompass a method for treating a subject in need thereof. The terms “treat,” "treating," or "treatment" as used herein, refers to the provision of medical care by a trained and licensed professional to a subject in need thereof. The medical care may be a therapeutic treatment, and / or a prophylactic or preventative measure. The object of therapeutic and prophylactic treatments is to prevent or slow down (lessen) an undesired physiological change or disease / disorder. Beneficial or desired clinical results of therapeutic or prophylactic treatments include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, a delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. “Treatment” can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the disease, condition, or disorder as well as those prone to have the disease, condition or disorder or those in which the disease, condition or disorder is to be prevented.

[0200] The actual dosage amount of a composition of the present disclosure administered to an animal or a patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.

[0201] Any suitable mode of administration can be used to administer the compositions provided herein in a subject in need thereof. Exemplary modes include, but are not limited to, intravenous injection. Other modes include, without limitation, intratumoural, intradermal, subcutaneous, intramuscular (i.m.), intraperitoneal (i.p.), intraarterial, intramedullary, intracardiac, intra-articular (joint), intrasynovial (joint fluid area), intracranial, intraspinal, and intrathecal (spinal fluids). Any known device useful for parenteral injection of infusion of the formulations can be used to affect such administration.

[0202] Methods described herein are generally performed on a subject in need thereof. A subject in need of the therapeutic methods described herein can be a subject having, diagnosed with, suspected of having, or at risk for developing for example a cancer or a proliferative disease, disorder, or condition. A determination of the need for treatment will typically be assessed by a history, physical exam, or diagnostic tests consistent with the disease or condition at issue. Diagnosis of the various conditions treatable by the methods described herein is within the skill of the art. The subject can be an animal subject, including a mammal, such as horses, cows, dogs, cats, sheep, pigs, mice, rats, monkeys, hamsters, guinea pigs, and humans or chickens. For example, the subject can be a human subject. 42 95635253Attorney Docket No.106546-804769 (4262)

[0203] The amount of a composition described herein that can be combined with a pharmaceutically acceptable carrier to produce a single dosage form will vary depending upon the host treated and the particular mode of administration. It will be appreciated by those skilled in the art that the unit content of agent contained in an individual dose of each dosage form need not in itself constitute a therapeutically effective amount, as the necessary therapeutically effective amount could be reached by administration of a number of individual doses.

[0204] Toxicity and therapeutic efficacy of compositions described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals for determining the LD50 (the dose lethal to 50% of the population) and the ED50, (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index that can be expressed as the ratio LD50 / ED50, where larger therapeutic indices are generally understood in the art to be optimal.

[0205] The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the subject; the time of administration; the route of administration; the rate of excretion of the composition employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts (see e.g., Koda-Kimble et al. (2004) Applied Therapeutics: The Clinical Use of Drugs, Lippincott Williams & Wilkins, ISBN 0781748453; Winter (2003) Basic Clinical Pharmacokinetics, 4th ed., Lippincott Williams & Wilkins, ISBN 0781741475; Sharqel (2004) Applied Biopharmaceutics & Pharmacokinetics, McGraw- Hill / Appleton & Lange, ISBN 0071375503). For example, it is well within the skill of the art to start doses of the composition at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose may be divided into multiple doses for purposes of administration. Consequently, single dose compositions may contain such amounts or submultiples thereof to make up the daily dose. It will be understood, however, that the total daily usage of the compounds and compositions of the present disclosure will be decided by an attending physician within the scope of sound medical judgment. EXAMPLES

[0206] The following examples are included to demonstrate preferred aspects of the disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventor to function well in 43 95635253Attorney Docket No.106546-804769 (4262) the practice of the present disclosure, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific aspects which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the present disclosure.

[0207] In one aspect, the current disclosure is based on the unexpected finding that knocking down of SNORA13, a ribosome biogenesis factor, impacts oncogene-induced senescence in human cells. Using a genome-wide CRISPR interference (CRISPRi) screen in a well-established model of HRASG12V-driven senescence, it was discovered that SNORA13, a highly conserved H / ACA box small nucleolar RNA (snoRNA), is essential for this pathway. Although this snoRNA guides the pseudouridylation of a highly conserved nucleotide in 18S rRNA located in the decoding center of the ribosome, it was found that loss of SNORA13 had little effect on translation. Rather, loss of this snoRNA accelerated 60S ribosomal subunit biogenesis, thereby decreasing nucleolar stress and consequent p53 activation induced by aberrant oncogene activity. Remarkably, these effects on ribosome biogenesis were genetically separable from SNORA13-guided pseudouridylation of 18S rRNA and could be attributed to a direct interaction of SNORA13 with RPL23, which regulates the rate of 60S subunit assembly. Together, these findings revealed a non-canonical function for an H / ACA box snoRNA as a regulator of ribosome biogenesis and the p53 pathway that potently impacts cellular senescence. Example 1: A CRISPRi screen for noncoding RNAs that are required for oncogene- induced senescence nominates EPB41L4A-AS1

[0208] To identify noncoding RNAs that are essential for oncogene-induced senescence (OIS), a genome-wide CRISPRi screen was performed using a model in which TERT- immortalized human fibroblasts undergo senescence upon induction of a tamoxifen-inducible HRASG12Vtransgene (BJ-HRASG12Vcells). These cells were engineered to express a catalytically-inactive Cas9 protein fused to the KRAB transcription repressor domain (dCas9KRAB), which directs transcriptional silencing when guided to target loci by single guide RNAs (sgRNAs). CRISPRi-mediated silencing of p53 enabled escape from senescence in multiple independent dCas9KRAB-expressing BJ-HRASG12Vsubclones that were used in the screen (FIG.1A).

[0209] BJ-HRASG12V-dCas9KRABcells were infected with a previously described lentiviral library consisting of 68,009 sgRNAs targeting 6701 fibroblast-expressed noncoding RNAs (FIG. 1B). Upon addition of tamoxifen, most cells entered a senescent state and stopped proliferating. Cells expressing sgRNAs targeting essential mediators of senescence, however, 44 95635253Attorney Docket No.106546-804769 (4262) continued to proliferate under these conditions, resulting in sgRNA enrichment. High- throughput sequencing was used to determine sgRNA abundance in cells grown in the presence tamoxifen for three weeks and the MAGeCK algorithm was used to identify significant hits, representing noncoding RNA loci that were targeted by multiple sgRNAs enriched in tamoxifen-treated versus untreated cells (FIG. 1C). Only four hits reached a stringent enrichment and statistical significance threshold (log2fold enrichment >2; p<10-6). Interestingly, for three of these hits, the nearest transcription unit to the enriched sgRNAs was a protein-coding gene (CCNC, CDKN1A, and FOXF1). All three of these genes have previously been reported to encode strong regulators of senescence or p53 activity, thus demonstrating that the screen successfully identified known mediators of senescence. The remaining highly-ranked hit was a poorly-characterized noncoding RNA known as EPB41L4A- AS1.

[0210] It was hypothesized that EPB41L4A-AS1 may be essential for OIS because it serves as a host transcript for a highly conserved H / ACA box snoRNA, SNORA13 (FIG. 1D). To validate this result, EPB41L4A-AS1 was knocked down using CRISPRi and cells were grown in the presence or absence of tamoxifen. As expected, this resulted in a strong decrease in the levels of both EPB41L4A-AS1 and SNORA13 (FIG. 1E and 1F). Under normal growth conditions (HRASG12V-off state), knockdown of EPB41L4A-AS1 had no effect on proliferation (FIG. 1G left). Upon induction of HRASG12V, however, cells with reduced EPB41L4A-AS1 expression failed to enter a senescent state and continued to proliferate (FIG. 1G right). In addition to sustained growth, loss of EPB41L4A-AS1 prevented the acquisition of phenotypic markers of senescence, including an enlarged and flattened cell morphology and the presence of SA- ^-gal activity (FIG.1H). EdU labeling further demonstrated that cells with knockdown of EPB41L4A-AS1 maintained active proliferation and DNA replication in the presence of HRASG12V. Importantly, we confirmed that induction of the HRASG12Vtransgene occurred normally in EPB41L4A-AS1 knockdown cells (FIG. 1I). These results suggested that EPB41L4A-AS1, and / or the encoded snoRNA, are required for OIS. Example 2: SNORA13 is required for multiple forms of senescence

[0211] To determine whether the spliced EPB41L4A-AS1 transcript or the encoded snoRNA were required for senescence, CRISPR with dual sgRNAs was used to delete SNORA13, leaving the rest of the transcript intact (FIG. 2A). Homozygous knockout clones exhibited complete loss of SNORA13 but maintained normal expression of the spliced EPB41L4A-AS1 transcript (FIG. 2B and 2C). As observed in cells with knockdown of EPB41L4A-AS1, SNORA13 knockout cells proliferated normally in the absence of HRASG12Vexpression (FIG. 2D, left). Moreover, like EPB41L4A-AS1-deficient cells, SNORA13 knockout cells failed to enter a senescent state in the presence of oncogenic stress, as indicated by continued 45 95635253Attorney Docket No.106546-804769 (4262) proliferation, active DNA replication, and the absence of senescence-associated cell morphology or SA- ^-gal activity (FIG.2D, 2G and 2E).

[0212] The requirement for SNORA13 in OIS was further verified through a series of rescue experiments. The complete EPB41L4A-AS1 gene locus, including all introns and SNORA13, was expressed in trans in SNORA13 knockout cells using a PiggyBac transposon expression vector (FIG.2F-2H). In parallel, a similar construct lacking only the SNORA13 sequence was introduced. While neither construct affected proliferation in the absence of oncogenic stress (FIG. 2I), only the SNORA13-containing construct was able to rescue senescence upon induction of HRASG12V(FIG.2J and 2K). Altogether, these data supported a requirement for SNORA13 in oncogene-induced senescence.

[0213] To determine whether SNORA13 is required for other forms of senescence, the snoRNA was depleted in primary human fibroblasts which were then subjected to prolonged passaging. Loss of SNORA13 in this context delayed the onset of replicative senescence, as demonstrated by increased proliferation at late passage numbers, diminished SA-β-gal activity, and reduced expression of well-known senescence markers p21 and p16 (FIGs.2L- 2SM). Similarly, induction of senescence by DNA damage was significantly attenuated in SNORA13-deficient cells (FIGs. 2T-2W). Altogether, these results established that loss of SNORA13 impairs multiple senescence pathways in human cells. Example 3: SNORA13 guides the pseudouridylation of 18S:1248U

[0214] To begin to elucidate the mechanism through which SNORA13 participates in senescence, we first examined its subcellular localization. As demonstrated both by cellular fractionation and RNA fluorescence in situ hybridization (FISH), SNORA13 localized predominantly to the nucleolus, as expected for an RNA of this class (FIG.3A and FIG.3B). Induction of oncogenic stress did not affect the localization or overall expression of this snoRNA (FIG.3A-3C).

[0215] SNORA13 is a member of the H / ACA box family of snoRNAs, whose canonical function is to guide the pseudouridylation of target RNAs. Specifically, SNORA13 has been predicted to guide the pseudouridylation of nucleotide 1248 of human 18S rRNA (18S.1248U). This nucleotide is located in the decoding center of the ribosome and, in addition to undergoing conversion to pseudouridine ( ^), is known to be further modified by the enzymes EMG1 and TSR3 to produce 1-methyl-3- ^-amino- ^-carboxyl-propyl pseudouridine (m1acp3^) (FIG.3D). It was confirmed that SNORA13 is required for pseudouridylation of 18S.1248U using multiple assays. As described previously, the bulky acp3adduct on this nucleotide causes base misincorporation during reverse transcription, leading to disruption of a HinF1 restriction site at this position in PCR products that span this sequence. As expected, the majority of RT- 46 95635253Attorney Docket No.106546-804769 (4262) PCR products encompassing this site are resistant to HinF1 cleavage in wild-type cells, but cleavage is increased in TSR3 knockout cells due to loss of the acp3modification (FIG. 3E lanes 1 and 2). A similar strategy can be used to detect pseudouridine at this position in TSR3 knockout cells. Treatment with N-cyclohexyl-N′-(2-morpholinoethyl)carbodiimide metho-p- toluenesulfonate (CMC) will add a large, alkaline-resistant adduct specifically to pseudouridine residues, again resulting in nucleotide misincorporation during reverse transcription and a consequent loss of cleavage by HinF1 (FIG. 3E lane 3). Deletion of SNORA13 in TSR3 knockout cells resulted in complete digestion of the PCR product amplified from CMC-treated RNA (FIG.3E lane 4), thus demonstrating that SNORA13 is required for pseudouridylation of 18S.1248U. This result was further confirmed using a primer extension assay that detects reverse transcriptase stalling due to the acp3modification or the CMC modification of ^ at this site (FIG.3F). Example 4: Loss of SNORA13 has a minimal effect on translation

[0216] Since the m1acp3^ modification of 18S:1248U is conserved in all eukaryotes, and the modified nucleotide is located in the decoding center of the ribosome where it makes contact with the P site tRNA, it was initially hypothesized that loss of SNORA13 may impact the translation of mRNAs that encode regulators of senescence. To investigate this possibility, global translation rates were examined by monitoring the incorporation of puromycin, or its analog O-propargyl-puromycin (OP-puro), into nascent peptides by western blotting or flow cytometry, respectively. We observed no detectable change in global translation upon loss of SNORA13 under normal growth conditions (FIG. 4A and 4B). Increase in translation in SNORA13 knockout cells was detectable in the presence of oncogenic stress, but this was most likely a secondary consequence of the sustained proliferation of these cells relative to wild-type cells, since loss of p53 also led to an increase in translation under these conditions (FIG.4C and 4D). In addition, loss of SNORA13 had no overt effect on translation fidelity, as measured by reporter assays in which amino acid misincorporation allows stop codon readthrough (FIG.4E).

[0217] The possibility that loss of SNORA13 affects the translation of specific mRNAs that regulate senescence was considered next. Ribosome profiling and RNA sequencing (RNA- seq) were performed on wild-type and SNORA13 knockout BJ-HRASG12Vcells with or without oncogenic stress. Surprisingly, only a small number of transcripts exhibited significantly altered translation efficiency in SNORA13-deficient cells (FIG. 4F). Furthermore, CRISPR- mediated knockout of genes whose translation was decreased in SNORA13 knockout cells did not result in escape from senescence in wild-type cells (FIG.4G and FIG.4H). Similarly, inactivation of genes whose translation was increased in SNORA13 knockout cells did not reactivate the senescence program in these cells (FIG.4I and 4J). These data argued against 47 95635253Attorney Docket No.106546-804769 (4262) a major role for a SNORA13-dependent translation program as a driver of senescence.

[0218] Because the 18S:1248(m1acp3^) nucleotide directly contacts the P site tRNA, the translational efficiency of each codon in SNORA13 wild-type and knockout cells was also examined. In the presence of oncogenic stress, transcripts enriched for codons with an A or U at the third position (AU3 codons) exhibited an increase in translational efficiency in SNORA13 knockout cells, while transcripts enriched for codons with G or C at the third position (GC3 codons) were translated less efficiently (FIG. 4K). However, several observations suggested that this effect was a secondary consequence of sustained proliferation of SNORA13 knockout cells in the presence of oncogenic stress. First, it has been reported that mRNAs enriched for AU3 codons are preferentially translated in proliferating cells. Indeed, increased translation of transcripts enriched for AU3 codons in proliferating wild-type BJ- HRASG12Vcells compared to senescent cells was observed (FIG.4L). Moreover, analysis of a previously published ribosome profiling dataset from p53-deficient BJ-HRASG12Vcells revealed that loss of p53 also led to a similar pattern of codon usage upon activation of oncogenic stress (FIG.4M). Finally, the loss of SNORA13 had minimal effects on codon usage under normal growth conditions (FIG.4N). Altogether, these results indicated that SNORA13 is unlikely to regulate senescence by altering global, transcript, or codon-specific translation rates. Example 5: SNORA13 negatively regulates 60S ribosomal subunit biogenesis

[0219] In addition to the aforementioned analyses of translation, the abundance of ribosomal subunits and translating ribosomes in SNORA13-deficient BJ-HRASG12Vcells using sucrose gradient fractionation was also examined. Unexpectedly, this revealed an increase in the steady-state abundance of free 60S subunits and 80S monosomes, but no change in the levels of free 40S subunits, in SNORA13 knockout cells with or without activation of oncogenic HRASG12V(FIG.5A). This effect was reversed by exogenous expression of SNORA13 (FIG. 5B). We did not detect an increase in the production of nascent rRNA (FIG. 5C) or altered rRNA processing (FIG.5D), suggesting that a distinct step in 60S subunit assembly might be accelerated in SNORA13-deficient cells.

[0220] To monitor the rate of 60S subunit biogenesis, HEK293T cell line expressing an endogenous SNAP-tagged large ribosomal subunit protein (RPL28) that enables selective labeling of newly-formed ribosomal subunits was utilized. Lentivirally-delivered CRISPR components were used to generate SNORA13 knockout pools (FIG. 5E), which exhibited elevated levels of 60S subunits and 80S monosomes, as observed in BJ-HRASG12Vcells (FIG. 5F and 5G, upper panels). SNAP-tagged RPL28 were pulse labeled and monitored for the abundance of newly-synthesized, fluorescently-labeled 60S subunits by sucrose gradient fractionation (FIG.5F and 5G, lower panels). A strong increase in the abundance of newly- 48 95635253Attorney Docket No.106546-804769 (4262) assembled 60S subunits that were efficiently incorporated into 80S monosomes and translating polysomes were detected. In addition, fluorescent microscopy was used to monitor the rate of disappearance of labeled RPL28 from nucleoli, indicative of 60S assembly and export to the cytoplasm (FIG. 5H). Whereas most newly-labeled RPL28 was retained in nucleoli at one hour after labeling in wild-type cells, significantly less nucleolar RPL28 remained in SNORA13-depleted cells at this timepoint. These experiments demonstrated that deficiency of SNORA13 resulted in accelerated 60S subunit biogenesis.

[0221] The finding that SNORA13 functions as a strong negative regulator of ribosome biogenesis was furthered experiment to find whether this activity contributes to downregulation of ribosome production in physiologic settings. For example, in cells starved of amino acids, mTOR signaling is inhibited, resulting in downregulation of ribosome biogenesis at multiple levels including rRNA transcription and translation of mRNAs encoding ribosomal proteins. Interestingly, we observed a strong upregulation of SNORA13 expression after amino acid starvation or rapamycin treatment (FIGs.5I-5J). Moreover, depletion of SNORA13 resulted in a relative preservation of 60S subunit production in amino acid-starved cells, as revealed by sucrose gradient analyses of steady-state and newly-synthesized 60S subunits (FIGs.5K-5L). Thus, SNORA13 activity is required for maximal repression of ribosome biogenesis after nutrient depletion Example 6: SNORA13 regulates p53 activity through the nucleolar stress response pathway

[0222] Given the finding that altered translation was unlikely to explain the role of SNORA13 in senescence, additional mechanistic insight were sought by analyzing RNA-seq data from wild-type and SNORA13 knockout BJ-HRASG12Vcells. Interestingly, Gene Set Enrichment Analysis (GSEA) revealed a highly significant decrease in the activity of the p53 pathway in SNORA13 knockout cells, with or without induction of oncogenic stress (FIG.6A). Accordingly, the key p53 target gene CDKN1A, which encodes the cell-cycle inhibitor p21, displayed reduced baseline expression, and significantly diminished induction after tamoxifen treatment, in SNORA13 knockout cells (FIG. 6B and 6C). Although SNORA13-deficient cells did not exhibit a strong reduction in the overall abundance of p53, a large fraction of the protein localized to the cytoplasm after induction of oncogenic stress, in contrast to the strong nuclear accumulation of p53 that occurred in wild-type cells under these conditions (FIG. 6C-6E). Consistent with these findings, nuclear p53 activity was reduced in SNORA13 knockout cells, as demonstrated by chromatin immunoprecipitation (ChIP), which documented significantly decreased binding of p53 to both response elements (REs) in the CDKN1A promoter (FIG. 6F). Together, the data suggested that MDM2, which is normally inhibited in the presence of oncogenic stress, remained partially active in SNORA13 knockout cells, preventing p53 49 95635253Attorney Docket No.106546-804769 (4262) nuclear accumulation and transactivation of p53 target genes.

[0223] Oncogenic stress results in MDM2 inhibition and consequent p53 activation in part by perturbing ribosome biogenesis, leading to activation of the nucleolar stress response in which free RPs, including RPL5, RPL11 and RPL23, directly bind and inhibit MDM2. It was hypothesized that the acceleration of 60S ribosomal subunit biogenesis that occurs in SNORA13 knockout cells may diminish nucleolar stress by increasing the rate of incorporation of RPs into maturing ribosomes, thereby decreasing the concentration of free RPs that could otherwise inhibit MDM2. In keeping with this model, a marked decrease was observed in the accumulation of non-ribosome associated RPs in SNORA13-deficient BJ-HRASG12Vcells after induction of oncogenic stress (FIG. 6G). Furthermore, immunoprecipitation experiments confirmed the interaction of MDM2 with RPL5, RPL11, and RPL23 in wild-type cells under these conditions (FIG.6H). These interactions were greatly diminished in SNORA13 knockout cells, with a concomitant increase in binding of MDM2 to p53.

[0224] These observations suggested that in the presence of oncogenic stress, loss of SNORA13 prevented inhibition of MDM2 by free RPs. As a result, sustained MDM2-mediated inhibition of p53 enabled escape from senescence. This model was further tested by knocking down MDM2 using short-interfering RNA (siRNA) or inhibiting MDM2 with the small molecule Nutlin-3. Both strategies restored nuclear accumulation of p53 and rescued senescence in SNORA13 knockout cells (FIG.6I, 6J, 6K, 6L). Collectively, these data demonstrated that loss of SNORA13 reduced the levels of free large ribosomal subunit proteins, thus impairing activation of the nucleolar stress response pathway and the p53-mediated senescence program. Example 7: Senescence and 18S rRNA modification are genetically separable functions of SNORA13

[0225] SNORA13 guides the pseudouridylation of a nucleotide in 18S rRNA, the core constituent of the 40S ribosomal subunit, yet loss of this snoRNA lead to a selective increase in the biogenesis of the 60S subunit. These observations suggested that SNORA13 may perform a non-canonical function, distinct from guiding pseudouridylation, that regulates 60S assembly. Alternatively, it remained possible that the effects on the large subunit were a secondary consequence of guiding the modification of an early rRNA precursor, since 18S and 28S rRNA are derived from a common primary transcript. To investigate these possibilities, rescue experiments with SNORA13 mutants that were unable to guide pseudouridylation were performed. Wild-type SNORA13, or mutants with deletion or substitutions in the H and ACA boxes which prevent assembly of the H / ACA box snoRNP required to guide nucleotide modification, were expressed in SNORA13 knockout cells using 50 95635253Attorney Docket No.106546-804769 (4262) an RNA polymerase III promoter (FIG. 7A and 7B). The RT-PCR / HinF1 cleavage assay described above (FIG. 3E) confirmed that wild-type SNORA13 expressed in this manner appropriately guided pseudouridylation of 18S:1248U, whereas the H / ACA box mutants exhibited no detectable pseudouridylation activity (FIG.7C).

[0226] Despite their inability to guide the 18S rRNA modification, the SNORA13 mutants rescued senescence in SNORA13 knockout cells. Upon induction of HRASG12V, both SNORA13 wild-type and mutant-expressing cells exhibited greatly reduced DNA replication and proliferation, as well as restoration of senescence-associated cell morphology and SA- ^- gal activity (FIG.7D and 7E). Moreover, expression of the SNORA13 mutants restored 60S ribosomal subunit abundance to wild-type levels (FIG.7F).

[0227] As an additional line of evidence that modification of 18S rRNA:1248U does not regulate senescence, we depleted EMG1 and TSR3, which catalyze N1 methylation and addition of acp to this nucleotide, respectively (FIG.3D and 7G). In contrast to cells lacking SNORA13, cells deficient in these factors entered senescence upon activation of HRASG12Vexpression. (FIG.7H). Overall, these data demonstrated that SNORA13 regulates ribosome biogenesis and senescence through a non-canonical mechanism that is distinct from guiding pseudouridylation. Example 8: SNORA13 directly interacts with ribosomal protein RPL23 and inhibits RPL23:28S rRNA interaction

[0228] To investigate potential non-canonical functions of SNORA13, the endogenous SNORA13 RNP was purified from UV-crosslinked cells using antisense oligonucleotides (ASOs) and subjected to mass spectrometry to identify interacting proteins (FIG.8A, 8B and 8C, Table 2). Table 2: Interacting partners of SNORA13 Accessi log2 P.Valu Description Gene PS Abun Abun Abun Abun Abun Abun on FC e name Ms dance dance dance dance dance danc N A1 O 3 66 8 5151 95635253Attorney Docket No.106546-804769 (4262) Q9UBB6 2.84 0.0165 Neurochondrin NCDN 2 10178 97517 15879 50013 OS=Homo 0.30 .77 8.74 .40 sapiens OX=9606 78 86 51 9 39 37 1 06 2 49 38 7 19 852 95635253Attorney Docket No.106546-804769 (4262) OX=9606 GN=ATP1A1 PE=1 SV=1 P25398 2.07 0.1057 40S ribosomal RPS12 4 99239 19031 91664 16102 15754 18249 85 53 02 61 49 04 8 61 2153 95635253Attorney Docket No.106546-804769 (4262) GN=RPS27L PE=1 SV=3 P46783 2.16 0.1612 40S ribosomal RPS10 5 97021 49631 13815 14311 13373 83016 protein S10 1.75 4.56 1.36 4.98 5.17 .11 52 42 0 49 04 26 08 31 1 02 5 87 0 0754 95635253Attorney Docket No.106546-804769 (4262) OS=Homo sapiens OX=9606 GN=SERBP1 22 2 83 9 83 01 5. 73 2 57 40 3 50 3 91 855 95635253Attorney Docket No.106546-804769 (4262) sapiens OX=9606 GN=ACACA PE=1 SV=2 30 77 32 92 88 .4 22 2 01 .6 19 3 17 956 95635253Attorney Docket No.106546-804769 (4262) A0A087 1.97 0.2811 Collagen COL1A2 4 78769 35555 18974 22192 69029 65825 WTA8 alpha-2(I) 95.21 90.58 6.18 67.42 6.84 .65 chain OS=Homo 83 27 3 75 2 70 04 11 66 0 5657 95635253Attorney Docket No.106546-804769 (4262) B3KVL5 -0.59 0.3120 Zinc finger ZCCHC1 4 61096 52647 15821 71210 40622 82707 CCHC domain- 0 5.30 4.92 0.21 1.61 0.15 4.39 containing protein 10 32 62 8. 72 0 35 9 06 6 75 8 00 1 5558 95635253Attorney Docket No.106546-804769 (4262) OS=Homo sapiens OX=9606 GN=LAMC1 37 4 66 1 25 .0 86 7 68 9 49 44 0 81 3 8959 95635253Attorney Docket No.106546-804769 (4262) sapiens OX=9606 GN=PFKL PE=1 SV=6 40 06 6 62 77 7 08 7 04 3 39 1. 32 1 7460 95635253Attorney Docket No.106546-804769 (4262) GN=ZRANB2 PE=1 SV=2 P25705 1.22 0.3924 ATP synthase ATP5A1 31 67169 27983 20379 25504 86220 94220 subunit alpha 50.20 43.13 541.9 51.04 4.06 65.77 23 .2 15 5 78 0 66 83 7 41 56 5 96 8 98 161 95635253Attorney Docket No.106546-804769 (4262) O43776 1.62 0.4046 Asparagine-- NARS 5 88076 50663 46487 98121 18722 tRNA ligase, 8.43 5.69 08.14 .09 96.29 cytoplasmic OS=Homo 57 64 0 65 43 43 37 93 18 262 95635253Attorney Docket No.106546-804769 (4262) O43242 1.19 0.4263 26S PSMD3 9 79227 46752 35679 71261 21435 11858 proteasome 4.61 9.97 40.03 0.92 7.04 21.14 non-ATPase regulatory 06 3 55 5 51 99 68 24 2 35 2 33 363 95635253Attorney Docket No.106546-804769 (4262) DDX1 OS=Homo sapiens OX=9606 12 1 80 0 19 50 1 08 2 47 .5 30 0 59 8 17 5.64 95635253Attorney Docket No.106546-804769 (4262) GN=SRSF11 PE=1 SV=1 P27105 1.33 0.4674 Stomatin STOM 14 10248 25381 56598 72596 36926 16741 OS=Homo 57.25 3.07 26.35 9.87 6.75 14.04 62 4. 71 02 2 46 9 29 37 8 90 .265 95635253Attorney Docket No.106546-804769 (4262) P06733 1.02 0.4783 Alpha-enolase ENO1 12 40202 52029 24004 21341 25477 11699 OS=Homo 97.82 96.18 521.0 52.09 92.25 983.4 sapiens 0 6 OX=9606 61 9 24 0 75 22 5. 75 .4 17 7 86 8 49 90 .4 67 166 95635253Attorney Docket No.106546-804769 (4262) GN=COL12A1 PE=1 SV=2 P18077 1.04 0.4993 60S ribosomal RPL35A 5 10572 49992 55791 95494 68939 18306 protein L35a 30.03 0.62 17.17 9.09 2.02 66.20 72 42 5 25 .0 19 7 92 2 77 8 34 .0 89 7 4167 95635253Attorney Docket No.106546-804769 (4262) sapiens OX=9606 GN=ACTR1A PE=1 SV=1 09 39 .8 30 8 30 9 30 64 .4 55 .2 49 0 3568 95635253Attorney Docket No.106546-804769 (4262) GN=TOPORS PE=1 SV=1 P04406 0.69 0.5267 Glyceraldehyd GAPDH 45 29680 20783 10916 33179 19377 46482 e-3-phosphate 036.9 397.0 9714. 002.6 156.9 763.2 71 9 57 3 58 .2 55 .3 53 9 50 9 28 1 73 569 95635253Attorney Docket No.106546-804769 (4262) OX=9606 GN=NQO1 PE=1 SV=1 Q12906 1.35 0.5363 Interleukin ILF3 3 55638 19035 24246 15412 84468 80658 00 .5 57 .7 20 8 09 6 68 9 39 3 13 8 03 370 95635253Attorney Docket No.106546-804769 (4262) GN=RRS1 PE=1 SV=2 Q8TA86 0.45 0.5441 Retinitis RP9 13 41355 67052 13757 50967 37677 91705 pigmentosa 9 60.20 84.00 303.4 77.38 02.90 29.20 50 9 48 6 37 7 12 79 6 43 77 1 16 271 95635253Attorney Docket No.106546-804769 (4262) GN=RACK1 PE=1 SV=3 P23634 1.00 0.5489 Plasma ATP2B4 8 50030 78316 53048 53988 37085 23750 membrane 4.24 3.01 60.70 1.00 7.78 25.07 84 3 91 65 4 02 1 82 .8 60 15 0 52 772 95635253Attorney Docket No.106546-804769 (4262) P46063 0.83 0.5552 ATP- RECQL 4 50638 26014 24190 56780 19365 10278 dependent 2.20 7.14 29.51 8.47 0.84 97.25 DNA helicase Q1 OS=Homo 81 0. 17 7 79 3. 07 58 4 49 4 76 .6 24 3 14 873 95635253Attorney Docket No.106546-804769 (4262) GN=PRDX1 PE=1 SV=1 Q14697 1.14 0.5666 Neutral alpha- GANAB 22 19717 24721 34759 30312 13469 13349 glucosidase 39.14 32.10 642.3 44.66 76.96 980.7 64 9 13 3 81 0 85 37 0 78 8 08 3 41 974 95635253Attorney Docket No.106546-804769 (4262) GN=SEC23A PE=1 SV=1 P04844 0.69 0.5729 Dolichyl- RPN2 14 22251 22712 12771 42334 21268 43220 diphosphooligo 89.29 62.03 801.1 52.02 18.06 31.78 82 9 35 1 07 .3 69 .5 23 7 67 6 96 4 55 9 4475 95635253Attorney Docket No.106546-804769 (4262) OS=Homo sapiens OX=9606 GN=HMGA2 06 6 54 0. 87 72 4 54 2 06 5 38 0 9376 95635253Attorney Docket No.106546-804769 (4262) P51149 1.12 0.5988 Ras-related RAB7A 7 20528 26463 72674 67676 29969 25717 protein Rab-7a 0.50 4.92 36.60 9.54 5.40 48.32 OS=Homo sapiens 62 .5 08 7 01 01 9 25 10 .2 63 .0 49 7 38 9 97 277 95635253Attorney Docket No.106546-804769 (4262) OS=Homo sapiens OX=9606 GN=CCT7 18 .2 68 8 32 7 25 0 26 3 39 17 .6 88 5778 95635253Attorney Docket No.106546-804769 (4262) GN=SH3BGRL 3 PE=1 SV=1 P52565 0.35 0.6264 Rho GDP- ARHGDI 7 10249 40450 11659 11661 23939 62729 dissociation A 18.40 0.74 98.91 24.73 8.35 0.43 78 1 20 2 55 59 1 55 .8 92 .0 22 5179 95635253Attorney Docket No.106546-804769 (4262) GN=RBMX2 PE=1 SV=1 P23528 0.61 0.6408 Cofilin-1 CFL1 7 19220 81015 81765 22148 72696 41842 OS=Homo 34.16 4.51 52.12 67.63 6.41 60.88 97 4 22 08 8 43 8 56 90 .9 09 6 82 480 95635253Attorney Docket No.106546-804769 (4262) GN=ANXA6 PE=1 SV=3 Q9BR76 0.91 0.6578 Coronin-1B CORO1 2 13677 68745 20975 11459 11096 OS=Homo B 2.72 .41 76.92 1.75 88.81 38 .1 01 5 10 30 .2 71 07 4 69 8 50 .0 50 3.81 95635253Attorney Docket No.106546-804769 (4262) OS=Homo sapiens OX=9606 GN=SRSF7 06 13 70 .6 69 36 9 17 .8 88 66 0 79 97 8182 95635253Attorney Docket No.106546-804769 (4262) GN=H1-4 PE=1 SV=2 Q9BRL6 -0.45 0.7009 Serine / arginine SRSF8 33 13171 64735 85737 13724 13112 11359 -rich splicing 8346. 861.1 8.26 4357. 6475. 65.74 01 85 9 72 92 6 82 1 08 8 68 56 .5 07 683 95635253Attorney Docket No.106546-804769 (4262) GN=RPL24 PE=1 SV=1 P04843 0.37 0.7150 Dolichyl- RPN1 29 56619 35746 21422 11173 46116 78831 diphosphooligo 33.61 78.19 637.8 812.4 31.52 79.44 34 .2 98 95 2 18 4 67 3. 92 1 92 .284 95635253Attorney Docket No.106546-804769 (4262) 4B; HIST1H 4H; HIST1H 76 1 89 1 17 13 8 93 8 62 4 53 .5 80 .285 95635253Attorney Docket No.106546-804769 (4262) sapiens OX=9606 GN=GPATCH 8 PE=1 SV=2 66 5 60 05 69 5 84 0 03 49 17 50 16 1. 56 486 95635253Attorney Docket No.106546-804769 (4262) GN=RPL10A PE=1 SV=2 B4DY08 0.20 0.7707 Heterogeneou HNRNP 9 19655 12022 19905 28466 76831 86496 s nuclear C 26.15 02.70 05.49 15.66 7.99 0.61 06 75 .3 48 8 93 3. 53 50 6 82 1 82 2.87 95635253Attorney Docket No.106546-804769 (4262) Q9H307 -0.22 0.7890 Pinin PNN 22 30715 44321 61254 49920 32932 11787 OS=Homo 25.70 58.14 9.95 81.05 95.88 20.06 sapiens OX=9606 51 2 43 50 8 09 88 1. 92 0. 02 5 09 95 1688 95635253Attorney Docket No.106546-804769 (4262) GN=NPM1 PE=1 SV=2 Q9UQ35 0.21 0.8258 Serine / arginine SRRM2 976 27309 22980 19512 23719 18934 24398 repetitive 61863 29533 8934. 24182 62766 8667. 30 69 88 79 3 89 3 80 0 94 .0 80 5989 95635253Attorney Docket No.106546-804769 (4262) GN=PPIB PE=1 SV=2 P84243 -0.42 0.8473 Histone H3.3 H3F3A; 18 19312 28128 52276 33371 72760 69418 OS=Homo H3F3AP 4.95 9.28 448.3 7.98 7.87 161.1 75 .7 84 84 8 70 82 9 41 .0 13 6. 67 09 .390 95635253Attorney Docket No.106546-804769 (4262) GN=PRPF4B PE=1 SV=3 Q01081 0.08 0.8647 Splicing factor U2AF1; 38 17206 23469 86777 19842 15654 11150 U2AF 35 kDa LOC102 387.5 330.7 33.73 417.5 351.5 265.2 31 .5 74 2 50 .9 64 02 .8 08 79 6 5391 95635253Attorney Docket No.106546-804769 (4262) F8WCT1 -0.13 0.9109 ADP- ARL6IP4 69 69431 12187 22513 96334 11269 27761 ribosylation 141.4 0690. 7.12 808.6 0505. 7.19 factor-like 5 13 4 08 protein 6- 77 .5 34 90 .9 21 88 .1 51 8 22 59 .192 95635253Attorney Docket No.106546-804769 (4262) GN=SRSF3 PE=1 SV=1 Q12972 -0.10 0.9375 Nuclear PPP1R8 5 10537 23901 40092 31607 96031 inhibitor of 0.06 4.86 .25 4.63 .16 46 .3 49 59 .5 71 33 3. 53 5 93 35 893 95635253Attorney Docket No.106546-804769 (4262) Q9Y5S9 -0.03 0.9693 RNA-binding RBM8A; 9 21258 34848 81416 12001 58883 15739 protein 8A LOC101 99.62 2.30 7.61 13.26 0.31 88.73 OS=Homo 060541 sapiens 32 08 89 .5 36 9 38 .5 63 9 72 1 99 06 .494 95635253Attorney Docket No.106546-804769 (4262) OS=Homo sapiens OX=9606 GN=RNPS1 63 2 18 79 37 71[ ] ecoey o , a coe o s o co po e , o -ype ces, but not SNORA13 knockout cells, confirmed the successful retrieval of direct SNORA13 interactors (FIG.8D). Only a small number of significantly enriched candidate interacting proteins were identified, among which was the large ribosomal subunit component RPL23.

[0230] To validate a potential SNORA13:RPL23 interaction, UV crosslinking and RNA immunoprecipitation (UV-RIP) was used to query interactions between various large and small 95 95635253Attorney Docket No.106546-804769 (4262) ribosomal subunit proteins and SNORA13 or, as a negative control, SNORA25. This revealed highly-specific enrichment of SNORA13 upon immunoprecipitation of RPL23, but not other ribosomal proteins (FIG.8E and 8F). The specificity of this interaction was further confirmed by pull-down of the endogenous SNORA13 RNP from UV crosslinked cells under denaturing conditions using ASOs, which again detected co-purification of only RPL23 (FIG.8G). These results strongly suggested that SNORA13 interacts directly with RPL23, and that this interaction occurs outside the context of assembled ribosomal subunits.

[0231] To further establish that RPL23 interacts directly with SNORA13, recombinant RPL23 was purified from insect cells and binding assays were performed with in vitro transcribed SNORA13 (FIG. 8H and 8I). Consistent with the results using intact cells, recombinant RPL23 formed a complex with SNORA13 but not SNORA25. Further supporting the functional importance of this interaction, the SNORA13 H / ACA box mutants that rescued senescence but could not support pseudouridylation (FIG.7A-7H) were able to bind RPL23 both in cells and in vitro (FIG.8J and 8K).

[0232] It was hypothesized that SNORA13 may competitively inhibit association of RPL23 with 28S rRNA, thereby slowing the rate of 60S subunit biogenesis. To test this model, competitive binding assays were performed using the 3' terminal 682 nucleotide segment of 28S rRNA that extensively interacts with RPL23 in the intact 60S subunit (28S rRNA4389-5070) (FIG.8L). The RPL23:28S rRNA4389-5070complex formed readily in vitro and, consistent with our model, was disrupted by increasing concentrations of SNORA13 (FIG.8M). Specifically, it was found that an approximately 15-fold excess of SNORA13 was required to titrate the majority of RPL23 from 28S rRNA4389-5070. Copy number analysis in BJ-HRASG12Vfibroblasts demonstrated that SNORA13 is expressed at approximately 1500 copies per cell (FIG.8N), while 32S pre-rRNA, the pre-rRNA intermediate in pre-60S subunits at the time of RPL23 incorporation, is present at approximately 110 copies per cell (FIG.8O). Thus, the endogenous stoichiometry of SNORA13 and 32S pre-rRNA is consistent with the results of in vitro competitive titration assays. Based on these findings, it is proposed that SNORA13 negatively regulates ribosome biogenesis by inhibiting the incorporation of RPL23 into maturing 60S subunits, thereby enhancing activation of the nucleolar stress response in the presence of oncogenic stress. Example 9: Discussion

[0233] snoRNAs represent a highly abundant and diverse class of noncoding RNAs that play central roles in ribosome biogenesis. Two major activities are known to be carried out by snoRNAs during this process: i) guiding the installation of nucleotide modifications (pseudouridylation and 2'-O-methylation) in rRNA; and ii) directing specific steps in pre-rRNA 96 95635253Attorney Docket No.106546-804769 (4262) processing and folding. Here a third role for snoRNAs in ribosome biogenesis was idenitified: the regulation of ribosomal protein incorporation into maturing ribosomal subunits. These findings expand the understanding of how ribosome biogenesis is orchestrated by this class of noncoding RNAs and reveal unanticipated connections between snoRNAs, the nucleolar stress response, and the p53 pathway.

[0234] Through a genome-wide screen, it was unexpectedly discovered in the current disclosure that SNORA13 is essential for oncogene-induced senescence. As a member of the H / ACA box family, it was confirmed that this snoRNA guides the pseudouridylation of a highly conserved, hypermodified nucleotide in the decoding center of the ribosome (18S:1248m1acp3^) that makes contact with the P site tRNA during translation elongation. The equivalent nucleotide in rRNA carries distinctive chemical modifications in diverse kingdoms of life, including N2-methylguanosine (m2G) in bacteria, acp3-uridine in archaea, and m1acp3^ in eukaryotes, suggesting an important role for this modified nucleotide in decoding. On this basis, it was hypothesized that altered translation of specific mRNAs could underlie the failure of SNORA13-deficient cells to activate the senescence program. Nevertheless, it was found that loss of SNORA13 had little, if any, detectable effect on global or transcript- specific translation in human fibroblasts. Instead, loss of SNORA13 resulted in a robust increase in the rate of 60S ribosomal subunit assembly. Surprisingly, regulation of ribosome biogenesis and senescence by SNORA13 was genetically separable from the pseudouridylation function of this snoRNA and was attributable to a direct interaction with RPL23. SNORA13 is over an order of magnitude more abundant than pre-rRNA intermediates, enabling it to competitively inhibit incorporation of RPL23 into maturing 60S subunits. As a result of its ability to slow the rate of an early step in ribosome biogenesis, it is proposed here SNORA13 increases the concentration of non-ribosome associated RPs. This consequently enhances activation of the nucleolar stress response, an important mechanism of inducing p53 in the presence of various forms of stress, including aberrant oncogene activation (FIG. 9A). This model provides a parsimonious link between the primary function of SNORA13 as a negative regulator of 60S ribosomal subunit biogenesis and its role in promoting p53 activation and oncogene-induced senescence.

[0235] Although SNORA13 potently regulates 60S ribosomal subunit assembly, its target for pseudouridylation is 18S rRNA, the core constituent of the 40S subunit. Both of these functions appear to be deeply conserved in eukaryotes, as deletion of the Saccharomyces cerevisiae ortholog of SNORA13, snR35, results in loss of pseudouridylation of the corresponding nucleotide in 18S rRNA as well as a dramatic increase in the steady-state abundance of 60S subunits. These observations raise the question of why this dual function of SNORA13 evolved. One possibility is that SNORA13 plays a role in coordinating biogenesis 97 95635253Attorney Docket No.106546-804769 (4262) of the 40S and 60S subunits. For example, high levels of 18S rRNA precursors undergoing SNORA13-guided pseudouridylation might sequester this snoRNA, preventing it from interacting with RPL23 and, as a result, enhancing 60S biogenesis. On the other hand, reduced levels of 18S precursors could release a pool of SNORA13 that could delay 60S assembly. In this manner, SNORA13 could balance ribosomal subunit abundance. Additionally, regulation of SNORA13 expression could provide a mechanism to tune ribosome production to meet cellular demand under various growth or stress conditions.

[0236] Oncogene-induced senescence is a well-established tumor suppressor mechanism. Given the requirement for SNORA13 in this pathway, downregulation or deletion of this snoRNA might be expected to be a recurrent feature in human malignancies. Interestingly, SNORA13 is located on human chromosome 5q22.1, within 1 MB of the well-known tumor suppressor APC. Accordingly, deletion and loss-of-heterozygosity of this genomic locus is a common feature of many tumor types and decreased expression of EPB41L4A-AS1 is associated with reduced survival in many cancers. These observations raise the possibility that co-deletion of SNORA13 and APC provides a selective advantage in tumors. Intriguingly, loss of the acp modification on 18S:1248m1acp3^ was also recently reported to be a common feature of human tumors. Like SNORA13, TSR3, the enzyme that installs acp on this nucleotide, is non-essential and its deletion does not affect bulk translation rates in cell lines. Ribosome profiling of TSR3-deficient cells, however, revealed an increase in translation of RPs. Together with the current finding that loss of SNORA13 increases 60S ribosome assembly, these observations suggest that the hypermodified 18S:1248m1acp3^ nucleotide represents a nexus for pathways that regulate distinct steps in ribosome biogenesis. Coordination of the activity of TSR3 and SNORA13, which would be reflected in the modification status of 18S:1248m1acp3^, provides a means to congruently orchestrate RP production and RP incorporation into maturing ribosomes. The frequent loss of the 18S:1248m1acp3^ modification in human tumors may result from reduced activity of TSR3 and SNORA13 that is driven by an enhanced demand for ribosomes in rapidly proliferating cancer cells.

[0237] As a non-essential gene product whose loss of function increases ribosome biogenesis, SNORA13 represents an attractive therapeutic target in conditions where increasing ribosome biogenesis would be advantageous. Ribosomopathies, for example, represent a spectrum of diseases caused by haploinsufficiency for ribosomal proteins or loss- of-function of ribosome biogenesis factors. Despite the universal requirement for translation in cellular functions, these diseases are characterized by tissue-specific defects that frequently include hematopoietic and skeletal abnormalities, as well as a predisposition to malignancy later in life. Reduced levels of functional ribosomes, leading to impaired translation of tissue- 98 95635253Attorney Docket No.106546-804769 (4262) specific mRNAs, as well as cell type-specific sensitivity to activation of p53 through the nucleolar stress response, are believed to underlie the tissue specificity of ribosomopathy phenotypes. It is shown herein that inhibition of SNORA13 has the dual effect of increasing ribosome production while simultaneously reducing nucleolar stress and p53 activation. As such, targeting SNORA13 may be an effective approach for reversing the molecular defects present in these disorders. ASOs that guide RNase-H-dependent cleavage of targeted RNAs have entered clinical use and could be leveraged for the development of specific SNORA13 inhibitors. Thus, further study of SNORA13 promises to illuminate our understanding of the biological roles of snoRNAs in normal physiology and the potential utility of targeting this class of noncoding RNAs in disease. Example 10: Methods used in Examples 1-9 EXPERIMENTAL MODEL AND SUBJECT DETAILS

[0238] BJ-HRASG12V cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) (Invitrogen) supplemented with 20% Medium 199 (Gibco), 10% fetal bovine serum (Sigma- Aldrich), and 1X Antibiotic-Antimycotic (Gibco). HEK293T and HEK293T-RPL28-SNAP cells were cultured in DMEM medium supplemented with 10% fetal bovine serum and 1X Antibiotic- Antimycotic. BJ-RASG12V cells were a gift from Reuven Agami. HEK293T cells were obtained from ATCC. Cell lines were confirmed to be free of mycoplasma contamination. METHOD DETAILS Table 3: Key resource table REAGENT or RESOURCE SOURCE IDENTIFIER Antib di99 95635253Attorney Docket No.106546-804769 (4262) Anti-Digoxigenin Roche Cat# 11333062910 Normal mouse IgG Santa Cruz Cat# sc-2025100 95635253Attorney Docket No.106546-804769 (4262) SNAP-Cell Block New England Biolabs Cat# S9106S SNAP-Cell TMR-Star New England Biolabs Cat# S9105S101 95635253Attorney Docket No.106546-804769 (4262) Deposited Data CRISPRi screen This paper GSE232859102 95635253Attorney Docket No.106546-804769 (4262) CRISPRi non-coding library Addgene (Jonathan Cat# 86541 (CRiNCL) - Unique to HFF Weissman) pCRISPRia-v2 Addgene (Jonathan Cat# 84832

[0239] BJ-HRASG12V-dCas9KRABcells were generated by infecting BJ-HRASG12Vcells with a dCas9KRAB-mCherry lentivirus (Addgene #60954) and sorting for single cell clones stably expressing high mCherry. Two independent clones were chosen for screening. Genome-wide CRISPRi screening

[0240] CRISPRi-based genome-scale screening of functional noncoding RNAs was performed using a previously described library. A lentiviral library with 68,009 guides targeting 6701 noncoding RNAs expressed in human fibroblasts was assembled by combining CRiNCL sublibraries Addgene #86538, Addgene #86550, and Addgene #86541. The screen was performed in replicate using two independent BJ-HRASG12V-dCas9KRABcell lines. Previously reported methods with the following modifications were used. For each replicate, 8x107cells 103 95635253Attorney Docket No.106546-804769 (4262) were seeded into forty 15 cm dishes in medium containing 8 µg / mL of polybrene (Millipore) and lentiviral library at a multiplicity of infection of ~0.3. Cells were cultured for 2 days after infection, then treated for 4 days with 2 µg / mL puromycin, and then allowed to recover for 2 days. At least 2.1x107cells were then plated for each replicate, representing ~300x coverage of the library, and treatment with 100 nM (Z)-4-Hydroxytamoxifen (Sigma) was initiated. This timepoint was designated “day 0”. Cells were maintained in continuous tamoxifen for 21 days, with passaging every 3 days, each time plating at least 2.1x107cells to maintain a minimum of 300x library coverage. Cells were harvested at day 0 and day 21 for genomic DNA isolation.

[0241] Genomic DNA was extracted using the MasterPure Complete DNA Purification kit (Lucigen). Sequencing libraries were generated with two sequential rounds of PCR using Herculase II Fusion DNA polymerase (Agilent). 6.6 µg of genomic DNA (representing ~106cells) was used in each 100 µl reaction for the first round of PCR. A total of 20 first-round PCR reactions were performed per replicate with 18 cycles of amplification (primer sequences provided in Table 4). Table 4 SEQ Oligonucleotide Sequence (5' -> 3') Comments ID name / description r g 1 g 2104 95635253Attorney Docket No.106546-804769 (4262) P57nt stagger AATGATACGGCGACCACCGAGATCTAC ACTCTTTCCCTACACGACGCTCTTCCGA TCTACGCAACATCCCTTGGAGAACCACC g 2 r105 95635253Attorney Docket No.106546-804769 (4262) 47S pre-rRNA qRT- TGTCAGGCGTTCTCGTCTC 31 PCR fwd primer 47S pre-rRNA qRT- AGCACGACGTCACCACATC106 95635253Attorney Docket No.106546-804769 (4262) STARD7 qRT-PCR CCTTCGCACTTGTGCATGTG 58 rev primer NID1 qRT-PCR fwd ACCAATCGGGCGGAATG s107 95635253Attorney Docket No.106546-804769 (4262) 86sgNT_1 AAAAAGCTTCCGCCTGATGG CRISPR 87sgNT_2 AAAACAGGACGATGTGCGGC sgRNAs (guides for d e e ot108 95635253Attorney Docket No.106546-804769 (4262) SNORA13 NB AGGTATCAAATTTAAGGGCAGGAAAAGG 126 probe_2 CT U6 NB probe GCAGGGGCCATGCTAATCTTCTCTGTAT r I f r R r -109 95635253Attorney Docket No.106546-804769 (4262) amplification rev primer EPB41L4A-AS1 AAAGGCGTAAATTAAACGCTTTGCAGCC 1 d e110 95635253Attorney Docket No.106546-804769 (4262) SNORA13 WT AACTGTTACTTATGCAGCTCCTAC transcription 158 template rev primer templates SNORA13 H / ACA AACACATACTTATGCAGCTCCTAC r P-111 95635253Attorney Docket No.106546-804769 (4262) s8630 (Invitrogen) siMDM2 2 N / A MDM2 - ) 1 )the pooled reaction product and primers containing barcodes and Illumina sequencing adaptors (sequences provided in Table 4) were used in the second round of PCR (11 – 13 cycles). Agencourt AMPure XP beads (Beckman Coulter Life Sciences) were used to purify PCR products. The amplicons were sequenced on an Illumina NextSeq500 with 75 bp single-end reads. Approximately 2.3x107reads were obtained from each replicate. sgRNA sequences were extracted from fastq files through an in-house Galaxy script and normalized read counts were calculated. MAGeCK analysis was used to identify genes targeted by sgRNAs enriched in the day 21 versus day 0 populations. CRISPRi-mediated gene knockdown

[0243] sgRNAs targeting genes of interest or control sgRNAs (sequences provided in Table 4) were cloned into pCRISPRia-v2 (Addgene #84832). For validation of hits in the CRISPRi screen, BJ-HRASG12V-dCas9KRABcells transduced with the pCRISPRia-v2 vectors were selected in medium containing 2 µg / mL puromycin for 4 days. Cells were then allowed to recover for 2 days before tamoxifen treatment to induce HRASG12Vexpression and subsequent phenotypic analyses. RNA extraction and qRT-PCR

[0244] Total RNA was isolated from cells using Trizol (Invitrogen) and further purified using the miRNeasy Mini kit (Qiagen) with on-column DNase digestion. cDNA was generated from reverse transcription of 1 µg total RNA using the Primescript RT Master Mix (Takara) according to the manufacturer’s instructions. SYBR Green PCR master Mix (Applied Biosystems) was used for qPCR. Expression levels were normalized to GAPDH. Primer sequences used for qRT-PCR are provided in Table 4. Northern blot analysis 112 95635253Attorney Docket No.106546-804769 (4262)

[0245] For snoRNA northern blots, total RNA (10-15 μg) was separated on 8% TBE-Urea polyacrylamide gels and transferred to BrightStar-Plus nylon membranes (Invitrogen). For pre- rRNA northern blots, total RNA (10-15 μg) was separated on 1.2% formaldehyde-agarose gels and transferred using the iBlot Dry Blotting System (Invitrogen). Membranes were crosslinked using a 254 nm UV crosslinker at 120 mJ / cm2and prehybridized with ULTRAhyb-Oligo hybridization buffer (Invitrogen). Blots were hybridized overnight with near-infrared (IR) fluorescent probes (IDT) and imaged using a LI-COR Odyssey imager. U6 snRNA or ACTB was used as a loading control. For SNORA13 and 32S pre-rRNA copy number analysis, total RNA from a defined number of cells was run alongside a standard curve of in vitro transcribed SNORA13 or a fragment of 32S pre-rRNA containing the probe sequence, respectively. In vitro transcription was performed with the HiScribe T7 High Yield RNA Synthesis Kit (NEB). Probe sequences are provided in Table 4. Cell proliferation assay

[0246] BJ-HRASG12Vcells were seeded at a density of 6x105cells / 10 cm dish in 10 mL medium containing vehicle or 100 nM (Z)-4-Hydroxytamoxifen (Sigma). Cells were passaged every 3 days and re-seeded at 6x105cells / 10 cm dish after each passage. Cell number at each passage was determined using a Countess cell counter (Invitrogen) and cumulative cell numbers were plotted. All growth curves were performed with 3 biological replicates. Senescence-associated β-galactosidase staining

[0247] Cellular senescence was assayed 15 days after induction of HRASG12Vusing a senescence-associated β-galactosidase staining kit (Cell Signaling) according to the manufacturer’s instructions. Briefly, BJ cells were seeded in 4-well chamber slides (50,000 cells / well). After 48 hours, cells were fixed and incubated with β-galactosidase staining solution at pH 6.0, 37° C, overnight. The cells were then washed twice with 1× PBS and imaged. EdU incorporation assay

[0248] EdU incorporation assays were performed using the Click-iT Plus EdU Alexa Fluor 594 Imaging Kit (Invitrogen) according to the manufacturer's instructions. After 15 days of tamoxifen treatment, BJ cells were seeded in 4-well chamber slides (50,000 cells / well) and cultured for 48 hours. Half of the medium was then replaced with fresh medium containing 20 μM EdU and cells were incubated for 3 hours. Cells were then fixed with formaldehyde and permeabilized with 0.5% Triton X-100. A reaction cocktail and Hoechst were used to detect EdU and nuclei. Cells were imaged on a Zeiss LSM700 microscope. Western blotting 113 95635253Attorney Docket No.106546-804769 (4262)

[0249] Cells were lysed in 1× NuPAGE LDS Sample Buffer (Invitrogen) for 10 minutes at 70° C. Proteins were separated on 4-12% Bis-Tris NuPAGE gels (Thermo Fisher Scientific) and wet transferred onto nitrocellulose membranes (0.45 μm, ThermoFisher). Blocking was performed in TBST containing 5% non-fat milk for 1 hour at room temperature. Membranes were incubated with primary antibodies overnight at 4° C, followed by incubation with IR dye- labeled secondary antibodies for 1 hour at 4° C. A LI-COR Odyssey imager was used for imaging blots. All antibodies are listed in the Key Resources Table. CRISPR-Cas9 mediated gene knockout

[0250] sgRNAs targeting genes of interest or control sgRNAs (sequences provided in Table 4) were cloned into lentiCRISPR_v2 (Addgene #52961). Knockout pools were generated by transducing cells with lentiCRISPR_v2 vectors. Cells were selected in medium containing 1-2 µg / mL puromycin for 7 days before further analysis. To generate clonal SNORA13 KO cell lines, BJ-HRASG12Vcells were transfected with pX458 (Addgene #48138) expressing Cas9, GFP, and sgRNAs targeting the genomic sequence flanking SNORA13. 48 hours after transfection, the brightest 10% of cells were collected using FACS. Single cell clones were then expanded and screened for deletion at the targeted locus. Cloning and stable expression of rescue constructs

[0251] PiggyBac expression vector XLone-GFP (Addgene #96930) was modified by replacing the blasticidin resistance gene with a hygromycin resistance gene. Unspliced EPB41L4A-AS1 with or without SNORA13 in the intron was then inserted into this vector between the KpnI and SpeI sites using NEBuilder HiFi DNA Assembly Master Mix (NEB) according to the manufacturer’s instructions. EPB41L4A-AS1 was amplified from genomic DNA as two separate fragments with overhangs for HiFi cloning. Stable expression of EPB41L4A-AS1 with or without SNORA13 was achieved by transfecting WT or SNORA13 KO BJ-HRASG12Vcells with XLone-EPB41L4A-AS1 (+SNORA13) or XLone-EPB41L4A-AS1 (−SNORA13) plasmids together with pCMV-hyPBase plasmid which encodes the PiggyBac transposase. Transfected cells were selected in 100 μg / mL hygromycin and expanded for 1 month before analysis.

[0252] For expression of SNORA13 with mutations in the H / ACA box, a lentiviral pol III expression vector was used. DNA oligos corresponding to the sequence of WT or mutant SNORA13 was cloned into AgeI- and EcoRI-digested pLKO.1-scrambled (Addgene #136035) using NEBuilder HiFi assembly. WT or SNORA13 KO BJ-HRASG12Vcells were transduced with pLKO.1-SNORA13 (WT or mutant) lentivirus followed by selection in 2 µg / mL puromycin for 7 days. Clonal cell lines were then derived and screened for SNORA13 expression by northern blot. Sequences of all primers used for cloning are provided in Table 4. 114 95635253Attorney Docket No.106546-804769 (4262) Detection of 18S:1248m1acp3^ by RT-PCR / HinFI cleavage

[0253] Detection of 18S:1248m1acp3^ by RT-PCR / HinFI cleavage was performed. Briefly, total RNA was treated with freshly made 0.2 M CMC in BEU buffer (50 mM bicine, pH 8.3, 4 mM EDTA, and 7 M urea) or BEU buffer only. Reverse transcription was carried out with 200 ng CMC-treated or mock-treated RNA using SuperScript IV reverse transcriptase (Invitrogen). cDNA was diluted and used as template for PCR. Amplicons were digested with HinFI and separated on a 2% agarose gel. Primer sequences are provided in Table 4. Detection of 18S:1248m1acp3^ by primer extension

[0254] Primer extension was performed with AMV reverse transcriptase (NEB).1 μg CMC- treated or mock-treated total RNA and 2 pmol IR labeled primer were mixed in the supplied AMV reverse transcriptase buffer and denatured at 65° C for 5 minutes. RT reactions were incubated at 42 °C for 1 hour. Reaction products were separated on a 12.5% polyacrylamide gel at 4° C and visualized with a LI-COR Odyssey imager. Primer sequence provided in Table 4. Analysis of global translation by puromycin incorporation

[0255] The SUnSET method was used as previously described to monitor global translation rates. Briefly, 8x105cells were seeded in a 10 cm dish 48 hours before adding media containing 10 µg / mL puromycin. Cells were collected 1 hour later. Puromycin incorporated into nascent peptides was detected by western blotting with anti-puromycin antibody (Sigma).

[0256] The O-propargyl-puromycin (OP-puro) incorporation assay was performed using the Protein Synthesis Assay Kit (Cayman Chemical) according to the manufacturer's instructions. For each sample, 1x106cells were resuspended in 0.5 mL of OP-puro working solution for 1 hour at 37° C. Cells were then stained with 1 mL of 5 FAM-Azide staining solution in the dark at room temperature for 30 minutes followed by flow cytometry analysis. RPL28-SNAP labeling and pulse-chase analysis

[0257] A previously described HEK293T cell line expressing an endogenous RPL28-SNAP fusion protein was used. Cells were incubated with SNAP-Cell Block (NEB) at a final concentration of 10 µM in growth medium for 30 minutes to block pre-existing ribosomes. Cells were then washed twice with complete medium and cultured for 12 hours (for imaging studies) or 18 hours (for polysome analyses). To label newly synthesized ribosomes, cells were incubated with 3 µM SNAP-Cell TMR-Star (NEB) for imaging or SNAP-Cell Oregon Green (NEB) for polysome fractionation in growth medium for 30 minutes. Cells were then washed three times with complete medium and incubated in fresh medium for 30 minutes. The medium 115 95635253Attorney Docket No.106546-804769 (4262) was then replaced one more time to remove unreacted SNAP-tag substrate that diffused out of the cells. For microscopy studies, cells were imaged at 0 and 1 hour after the final medium change on a Zeiss LSM980 confocal microscope. For polysome fractionation, cells were incubated with 100 µg / mL cycloheximide (Sigma) immediately after final medium change for 5 minutes and then collected. Polysome fractionation

[0258] Polysome fractionation was performed using known methods with the following modifications. 1.5x107cells per sample were seeded 24 hours before lysis. Cells were incubated with 100 µg / mL cycloheximide (Sigma) in growth medium for 5 minutes and then washed twice with ice-cold 1x PBS containing 100 µg / mL cycloheximide. Cells were scraped in 5 mL of ice-cold 1x PBS containing 100 µg / mL cycloheximide and collected by centrifugation. Cell pellets were lysed in hypotonic buffer (5 mM Tris-HCl, pH 7.5, 2.5 mM MgCl2, 1.5 mM KCl, 1x EDTA-free protease inhibitor cocktail, 100 µg / mL cycloheximide, 2 mM DTT, 200 U / mL RNAse inhibitor, 0.5% Triton X-100, and 0.5% sodium deoxycholate). Lysates were centrifuged at 16,000 g for 7 minutes at 4° C. Supernatants (~500 µL) were collected, diluted with lysis buffer as needed so all samples had an equivalent OD260, and then loaded onto a 5–50% sucrose gradient. Gradients were ultra-centrifuged at 222,228 g (36,000 rpm) for 2 hours at 4° C using a TH-641 rotor (Thermo Scientific). Samples were fractionated on a Piston Fractionator (BioComp) to evaluate polysome profiles. For total ribosome analysis, UV absorbance at 260 nm was used. For analysis of newly synthesized ribosomes in HEK293T RPL28-SNAP cells, a fluorescence detector was used. For detection of ribosome-associated and ribosome-free ribosomal proteins, proteins were concentrated from sucrose gradient fractions corresponding to 60S ribosome fractions and ribosome-free fractions using trichloroacetic acid (TCA) precipitation and resuspended in 1× NuPAGE LDS Sample Buffer (Invitrogen) for western blotting. Subcellular fractionation

[0259] Cell pellets were resuspended in 1 mL ice-cold Buffer A (10 mM HEPES, pH 8.0, 1.5 mM MgCl2, 10 mM KCl, and 0.5 mM DTT) and incubated on ice for 5 minutes, followed by lysis with a Dounce homogenizer. After centrifugation at 1000 rpm for 5 minutes, the supernatant was collected as the cytoplasmic fraction. Pellets were resuspended in 750 µL Buffer S1 (250 mM sucrose and 10 mM MgCl2) and overlaid onto a 1 mL cushion of Buffer S2 (350 mM sucrose and 0.5 mM MgCl2), followed by centrifugation at 2500 rpm for 10 minutes. The supernatant was discarded and pellets (nuclei) were resuspended in 1 mL Buffer S2 and sonicated for 60 seconds total, with 10 second pulses. Sonicated samples were overlaid onto 1 mL Buffer S3 (880 mM sucrose and 0.5 mM MgCl2) and centrifuged at 13,000 rpm for 20 116 95635253Attorney Docket No.106546-804769 (4262) minutes. The supernatant was collected as the nucleoplasmic fraction and the pellet contained the nucleolar fraction. 1x Protease Inhibitor Cocktail and 200 U / mL RNase inhibitor were added freshly to all buffers before use. All centrifugations were performed at 4° C. RNA was extracted from each fraction using Trizol in combination with the miRNeasy mini kit (Qiagen) with an on-column DNase digestion. For western blotting, sonicated samples (nuclei) were used without further fractionation. RNA-fluorescence in situ hybridization (FISH)

[0260] RNA FISH was performed as previously described, with minor modifications. DIG- labeled anti-sense RNA probes for human SNORA13 were synthesized by in vitro transcription with a DIG-labeling mix (Roche) and purified with Micro Bio-Spin P-30 chromatography columns (Bio-Rad). Primers used for amplification of the DNA template for in vitro transcription are provided in Table 4.2x105cells were grown on poly-L-lysine (Sigma) coated coverslips in 6-well plates for 48 hours. Cells were washed twice with DEPC-treated PBS and fixed with 4% paraformaldehyde for 10 minutes. Cells were then washed once with DEPC-treated PBS and permeabilized with 0.5% Triton X-100 for 10 minutes. After washing twice with DEPC- treated PBS, cells were incubated with pre-hybridization buffer (50% formamide, 2X SSC, 1X Denhardt’s solution, 10 mM EDTA, 0.1 mg / mL yeast tRNA, 0.01% Tween-20) for 1 hour.10 ng / µL DIG-labeled RNA probes in hybridization buffer (prehybridization buffer with 5% dextran sulfate) were denatured at 75º C for 10 minutes and added to slides for hybridization at 37° C for 18 hours. Samples were washed, treated with RNase A, and blocked with blocking reagent (Roche) after hybridization. DIG-labeled probes were detected by incubation with mouse monoclonal anti-DIG primary antibody (Roche) followed by incubation with Cy3-labeled goat anti-mouse IgG secondary antibody (EMD Millipore). The nucleolus was labeled using anti- nucleolin antibody (Abcam). Samples were mounted with SlowFade Diamond Antifade Mountant with DAPI (Thermo Fisher Scientific) and imaged on a Zeiss LSM700 microscope. Measurement of nascent rRNA

[0261] Nascent RNA was pulse labeled for 30 minutes with media containing 0.5 mM 5- ethynyluridine (EU). Total RNA was isolated and labeled RNA was purified using the Click-iT Nascent RNA Capture kit (Invitrogen) according to the manufacturer's instructions. SuperScript VILO cDNA synthesis kit (Invitrogen) was used for cDNA synthesis and qRT-PCR was performed (primer sequences provided in Table 4). Dual luciferase assay for measuring translation fidelity

[0262] The dual luciferase assay for measuring stop codon readthrough was performed. Briefly, pGL3-Renilla-Ter-firefly or pGL3-Renilla-noTer-firefly plasmids were generated by 117 95635253Attorney Docket No.106546-804769 (4262) cloning a Renilla luciferase ORF with or without a TAA termination codon upstream of a firefly luciferase ORF in pGL3-Control (Promega). Untreated or tamoxifen-treated BJ-HRASG12Vcells (WT or SNORA13 KO) were seeded into 6-well plates (1.3x105cells / well). After 24 hours, cells were transfected with 2.5 μg pGL3-Renilla-Ter-firefly or pGL3-Renilla-noTer-firefly plasmids using Lipofectamine 3000 transfection reagent (Invitrogen). 72 hours after transfection, the Dual-Luciferase Reporter Assay System (Promega) was used to determine luciferase activity. For normalization, firefly activity was first normalized to Renilla activity in each sample and then firefly / Renilla activity in pGL3-Renilla-Ter-firefly transfected cells was normalized to firefly / Renilla activity in pGL3-Renilla-noTer-firefly plasmid cells. Immunolocalization of p53

[0263] BJ-HRASG12Vcells (WT or SNORA13 KO) were treated for 5 days with 100 nM (Z)- 4-Hydroxytamoxifen and then seeded on poly-L-lysine coated coverslips in 6-well plates (1.3x105cell / well). Immunofluorescence for p53 was performed 48 hours later using previously-described methods. Briefly, cells were fixed with 4% paraformaldehyde for 15 minutes and permeabilized with 0.3% Triton X-100 for 15 minutes. Samples were washed with PBS and blocked in blocking buffer (5% FBS and 0.3% Triton X-100 in PBS) for 30 minutes followed by p53 primary antibody (Santa Cruz) incubation in blocking buffer overnight at 4º C. Samples were washed three times with PBS and incubated with goat anti-mouse IgG cross- adsorbed secondary antibody (Invitrogen) in blocking buffer for 1 hour. Nuclei were stained with DAPI for 1 minute and samples were mounted with SlowFade Diamond Antifade Mountant (Thermo Fisher Scientific). Cells were imaged on a Zeiss LSM980 confocal microscope. Chromatin immunoprecipitation (ChIP)

[0264] ChIP was performed using standard methods. Briefly, 1x107cells per IP were crosslinked with 37% formaldehyde. Cells were lysed in 1 mL lysis buffer (150 mM NaCl, 1% NP-40, 0.5% deoxycholate, 0.1% SDS, 50 mM Tris, 5 mM EDTA, pH 8.0, and 1x protease inhibitor cocktail). DNA was sheared by sonication to yield fragments of 300-1,000 bp. Lysates were cleared by centrifugation at 16,000 g for 10 minutes. Protein G Dynabeads (Invitrogen) were preincubated with p53 mouse monoclonal antibody (Santa Cruz) for 1 hour and added to lysates for overnight rotation at 4° C. Samples were eluted with elution buffer (50 mM Glycine, pH 2.8), treated with RNAse A, and reverse crosslinked at 65° C overnight. DNA was purified with the PCR Purification Kit (Qiagen) and used as a template for qPCR (primer sequences provided in Table 4). MDM2 immunoprecipitation 118 95635253Attorney Docket No.106546-804769 (4262)

[0265] 5x106tamoxifen-treated BJ-HRASG12Vcells (WT or SNORA13 KO) were lysed in 1 mL IP buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM EDTA and 0.5% NP-40) for 30 minutes on ice. Lysates were centrifuged at 16,000 g for 10 minutes, and supernatant was collected. The cleared lysates were incubated with 2 μg MDM2 mouse monoclonal antibody (Sigma) for 4 hours at 4° C and rotated at 4° C overnight after adding Protein G Dynabeads (Invitrogen). Samples were washed four times with IP buffer, eluted with NuPAGE LDS Sample Buffer (Invitrogen), and analyzed by western blotting. MDM2 inhibition

[0266] For siRNA-mediated MDM2 inhibition, BJ-HRASG12Vcells (WT or SNORA13 KO) were reverse transfected with 20 nM control siRNA or pre-designed siRNAs targeting MDM2 (Invitrogen) using Lipofectamine RNAiMAX (Thermo Fisher Scientific) according to the manufacturer’s instructions. MDM2 mRNA levels were analyzed by qRT-PCR 72 hours post- transfection. For MDM2 inhibition with Nutlin-3, cells were treated with vehicle or 1 μM Nutlin- 3. For cell proliferation assays, cells were transfected with siRNA or treated with fresh Nutlin- 3 every 3 days when passaged. RNA Antisense Purification and mass spectrometry (RAP-MS)

[0267] RAP-MS was performed using known methods with the following modifications: 1. Three biological replicates were performed for both wild-type and SNORA13 knockout BJ-HRASG12Vcells grown in the absence of tamoxifen. Pull-downs from SNORA13 knockout cells served as the negative control. 2. A pool of five 60-nucleotide 5' biotinylated antisense oligos (IDT) were used to pull- down SNORA13.10 μg of pooled oligos per 2x108cells were used for each pull-down. 3. Cells were cultured in normal growth medium and crosslinked using a Spectrolinker XL-1500 (Spectronics) at 254 nm with 0.4 J / cm2. 4. For cell lysis, cell suspensions were sonicated with a Bioruptor (Diagenode) for 15 cycles (30 sec ON and 45 sec OFF) and treated with TurboDNase (Invitrogen) for 30 minutes. 5. On-bead peptide digestion was performed for mass spectrometry without elution. 6. Only proteins detected in all 3 wild-type replicates were considered as candidate interactors. UV crosslinking and RNA immunoprecipitation (UV-RIP) 119 95635253Attorney Docket No.106546-804769 (4262)

[0268] UV-RIP was performed using known methods with the following modifications.2x107BJ-HRASG12Vcells were washed with cold PBS and UV crosslinked on ice at 254 nm with 0.4 J / cm2. Cells were scraped in cold PBS and pelleted by centrifugation. Cell pellets were lysed in 1 mL cold lysis buffer (50 mM Tris-HCl, 100 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate, 1x Protease Inhibitor Cocktail, 400 U / mL RNase inhibitor) for 30 minutes on ice. Lysates were centrifuged at 14,000 g for 10 minutes at 4º C.3.75 mg pre-washed Protein G Dynabeads (Invitrogen) coupled with antibody was added to cleared lysate and rotated for 2 hours at 4º C. Beads were washed three times with 900 µL cold High Salt Wash Buffer (50 mM Tris-HCl, 1M NaCl, 1 mM EDTA, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate) and then washed three times with 500 µL wash buffer (20 mM Tris-HCl, 10 mM MgCl2, 0.2% Tween-20). After the final wash, each sample was resuspended in 100 µL wash buffer.30 µL of the sample was used for western blotting. The remainder was treated with proteinase K (NEB) followed by RNA extraction with Trizol. snoRNA levels were determined by qRT-PCR (primer sequences provided in Table 4). All antibodies are listed in the Key Resources Table (Table 3). SNORA13 pull-down for detecting interactors by western blotting

[0269] Endogenous SNORA13 was purified with antisense probes after UV crosslinking as described above for RAP-MS, except 1 μg of pooled oligos and 2x107cells were used. After final wash, proteins were eluted from streptavidin-coated magnetic beads by incubation in NuPAGE LDS Sample Buffer (Invitrogen) for 10 minutes at 70° C and analyzed by western blotting. Sense probes and SNORA13 KO cells served as negative controls. All antibodies are listed in the Key Resources Table (Table 3). Expression and purification of MBP-RPL23 from insect cells

[0270] A maltose binding protein (MBP)-RPL23 fusion protein sequence was cloned as two separate fragments into the EcoRI site of pFastBac Dual expression vector (Gibco). The full- length human RPL23 sequence was amplified by PCR from cDNA. The MBP sequence was PCR amplified from plasmid MTTH-SNAP. Recombinant viruses were generated and amplified using Bac-to-Bac Baculovirus Expression Systems (Gibco) according to the manufacturer's instructions. Sf9 cells and Cellfectin II transfection reagent (Gibco) were used to produce baculovirus.5 mL of P2 viruses were used to infect 500 mL of Sf9 cells at a density of 2x106cells / mL for protein expression. After 72 hours, cells were collected by centrifugation, resuspended in lysis buffer (20 mM Tris-HCl, pH 7.5, 200 mM NaCl, 1 mM PMSF, 1 mM DTT, 1 mM EDTA, 2 µg / mL RNase A, 5 U / mL RNase T1, and 1x EDTA-free Protease Inhibitor Cocktail) and sonicated on ice. Lysates were centrifuged at 22,000 g for 30 minutes at 4 ºC. The cleared lysates were incubated with Amylose Resin (NEB) and washed twice with 10 120 95635253Attorney Docket No.106546-804769 (4262) column volumes of wash buffer (20 mM Tris-HCl, pH 7.5, 200 mM NaCl, 1 mM DTT, and 1 mM EDTA). Protein was eluted with elution buffer (wash buffer containing 10 mM maltose) and centrifuged in a bench-top centrifuge at 15,000 RPM to remove aggregates. The concentration of protein was measured by absorbance at 280 nm on Nanodrop. Electrophoretic mobility shift assay (EMSA)

[0271] EMSAs were performed using purified MBP-RPL23 protein and biotin-labeled RNAs synthesized by in vitro transcription with HiScribe T7 High Yield RNA Synthesis Kit (NEB). DNA templates for in vitro transcription were PCR amplified from cDNA (primer sequences provided in Table 4). 50 ng biotin-labeled snoRNA was incubated with increasing concentrations of MBP-RPL23 (0-2 μM) in EMSA buffer (10 mM HEPES, pH 7.3, 20 mM KCl, 1 mM MgCl2, 1 mM DTT, 5% glycerol, and 100 ng / μL tRNA) with or without 500 ng unlabeled snoRNA for 30 minutes at room temperature. Following incubation, 5% Ficoll-400 was added, and samples were separated on a native 6% TBE-polyacrylamide gel (Invitrogen). Samples were transferred to a BrightStar-Plus nylon membrane (Invitrogen) and UV crosslinked at 254 nm with 120 mJ / cm2. Membrane was blocked in blocking buffer (0.5% SDS and 1% BSA in 1x PBS) for 30 minutes. Biotin-labeled RNA was detected using streptavidin-conjugated IR Dye (LI-COR) diluted in blocking buffer (1:300) for 1 hour. A LI-COR Odyssey imager was used for imaging. In vitro RPL23:28S rRNA competitive binding assay

[0272] The biotin-labeled 28S rRNA fragment (nucleotides 4389-5070 of human 28S rRNA) was in vitro transcribed from a PCR-generated template using HiScribe T7 High Yield RNA Synthesis Kit (NEB) and gel purified. Primers for amplification are provided in Table 4.2 μM RPL23, 0.5 μM labeled 28S rRNA fragment, and increasing concentrations of unlabeled SNORA13 were mixed in EMSA buffer and incubated for 30 minutes at room temperature. After adding 5% Ficoll-400, samples were separated on a 1.5% agarose gel, transferred to a nylon membrane using the iBlot Dry Blotting System (Invitrogen), and UV crosslinked at 254 nm with 120 mJ / cm2. Membrane was blocked in blocking buffer (0.5% SDS and 1% BSA in 1x PBS) for 30 minutes. Biotin-labeled RNA was detected using streptavidin-conjugated IR Dye (LI-COR) diluted in blocking buffer (1:300) for 1 hour. A LI-COR Odyssey imager was used for imaging. RNA-seq and Ribosome Profiling

[0273] For RNA-seq and ribosome profiling, BJ-HRASG12Vcells (WT and SNORA13 KO) were harvested after treatment with vehicle or 100 nM (Z)-4-Hydroxytamoxifen for 7 days. For RNA-seq, total RNA was isolated and sequencing libraries were generated with the Stranded 121 95635253Attorney Docket No.106546-804769 (4262) Total RNA Library Prep Kit (Illumina) and sequenced on a HiSeq 4000 (Illumina) with 150 bp paired-end reads. Reads were mapped to GRCh38 using STAR, read counts were generated using featureCounts, and edgeR was used to analyze differential gene expression.

[0274] Ribosome profiling was performed as described, with the following modifications: 1. Ribosome footprints were size selected by gel electrophoresis using standard methods. For library preparation, fragments between 24-35nt were excised. 2. After linker ligation, samples were not pooled. The subsequent steps were performed individually for each sample. 3. 3ʹ linker-ligated RNA fragments were separated from unligated linker by gel electrophoresis and purified by gel extraction. 4. Ribosomal RNA was depleted using standard methods.

[0275] For analysis of reads from ribosome profiling, the adaptor, inline barcode, and the random-mer incorporated into the library amplicon were trimmed. Then, using STAR, reads mapping to known rRNA, tRNA, and snRNA sequences were removed, and reads that did not map to these noncoding RNA databases were subsequently mapped to GRCh38. To analyze changes in mRNA translation efficiency, a statistical test for differential translation efficiency using both mRNA abundance and ribosome occupancy was performed using RiboDiff. Only transcripts with more than 50 reads in both ribosome profiling and RNA-seq were analyzed in RiboDiff. Statistical analysis

[0276] All experiments were repeated with a minimum of three biological replicates. All values are reported as mean ± SD in each figure. 122 95635253

Claims

Attorney Docket No.106546-804769 (4262) CLAIMS What is claimed is:

1. A nucleic acid inhibitor, comprising a nucleic acid sequence that reduces the expression, level or activity of SNORA13.

2. The nucleic acid inhibitor of claim 1, wherein the nucleic acid sequence specifically targets the SNORA13 gene.

3. The nucleic acid inhibitor of claim 1, wherein the nucleic acid sequence specifically targets the SNORA13.

4. The nucleic acid inhibitor of any one of claims 2 or 3, wherein the nucleic acid sequence comprises an antisense oligonucleotide (ASO), siRNA, miRNA, a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid, a single guide RNA (sgRNA), a CRISPR-RNA (crRNA), a trans-activating crRNA (tracrRNA), or an aptamer.

5. The nucleic acid inhibitor of claim 2, wherein the nucleic acid sequence is a cluster regularly interspaced short palindromic repeats (CRISPR) related nucleic acid, a single guide RNA (sgRNA), a CRISPR-RNA (crRNA), or a trans-activating crRNA (tracrRNA).

6. The nucleic acid inhibitor of claim 5, wherein the sgRNA, crRNA, or tracrRNA comprises a nucleic acid sequence at least 80% homologous to a nucleic acid sequence complementary to at least 10 contiguous nucleotides of SEQ ID NO:

1.

7. The nucleic acid inhibitor of claim 6, wherein the sgRNA has a sequence at least 80% identical to any one of SEQ ID NO: 3 or 4.

8. The nucleic acid inhibitor of claim 4, wherein the nucleic acid sequence comprises an antisense oligonucleotide (ASO), an siRNA, or a miRNA.

9. The nucleic acid inhibitor of claim 8, wherein the ASO is double stranded or single stranded.

10. The nucleic acid inhibitor of claim 8, wherein the nucleic acid sequence is at least 80% homologous to a nucleic acid sequence complementary to at least 10 to 30 contiguous nucleotides of SEQ ID NO:

2.

11. The nucleic acid inhibitor of any one of claims 1-10, wherein the nucleic acid inhibitor further comprises at least one chemical modification.

12. The nucleic acid inhibitor of claim 11, wherein the nucleic acid inhibitor comprises a modification at least one ribosugar moiety of its nucleotide sequence. 123 95635253Attorney Docket No.106546-804769 (4262) 13. The nucleic acid inhibitor of claim 12, wherein at least one ribosugar moiety is modified with 2 2′-O-methyl (2′OMe), 2′-deoxy-2′-fluoro (2′F), 2′-deoxy, 5-C-methyl, 2′-O-(2- methoxyethyl) (MOE), 4′-thio, 2′-amino, 2′-C-allyl, cMOE, 2'-O-ethyl (cET), or is a locked nucleic acid (LNA) or any combination thereof.

14. A nucleic acid activator of SNORA13, wherein the nucleic acid activator comprises or encodes an effector that enhances the expression, level, or activity of SNORA13.

15. The nucleic acid activator of claim 14, wherein the effector comprises a nucleic acid sequence at least about 80% identical to a nucleic acid sequence as provided in SEQ ID NO:

2.

16. The nucleic acid activator of claim 14, wherein the effector is an RNA.

17. The nucleic acid activator of claim 16, comprising a nucleic acid sequence encoding SNORA13 or a variant, or a derivative thereof.

18. The nucleic acid activator of claim 14, wherein the nucleic acid sequence is at least 80% identical to a nucleic acid sequence provided in SEQ ID NO:

1.

19. The nucleic acid activator of any one of claims 14-18, wherein the nucleic acid activator further comprises at least one chemical modification.

20. The nucleic acid activator of claim 19, wherein the nucleic acid activator comprises a modification at least one ribosugar moiety of its nucleotide sequence.

21. The nucleic acid activator of claim 20, wherein at least one ribosugar moiety is modified with 2 2′-O-methyl (2′OMe), 2′-deoxy-2′-fluoro (2′F), 2′-deoxy, 5-C-methyl, 2′-O-(2- methoxyethyl) (MOE), 4′-thio, 2′-amino, 2′-C-allyl, cMOE, 2'-O-ethyl (cET), or is a locked nucleic acid (LNA) or any combination thereof.

22. A pharmaceutical composition comprising a nucleic acid inhibitor of any one of claim 1-13 or a nucleic acid activator of any one of claims 14-21 and at least one pharmaceutically acceptable delivery agent.

23. The pharmaceutical composition of claim 22, wherein the wherein the delivery agent comprises a lipidoid, a liposome, a lipoplex, a nanoparticle, a lipid nanoparticle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, or a conjugate.

24. Use of the pharmaceutical composition of any one of claims 22 or 23, for the treatment of a ribosomopathy, a cancer, or a senescence associated pathology.

25. A method of treating a subject in need thereof, comprising administering to the subject a pharmaceutical composition of any one of claims 22-23. 124 95635253Attorney Docket No.106546-804769 (4262) 26. The method of claim 25, wherein the subject is diagnosed with or is at risk of developing a ribosomopathy, a cancer, or a senescence associated pathology.

27. The method of claim 26, wherein the ribosomopathy is an inflammation, tumor, hypertrophy, hematopoietic abnormality, anemia, bone marrow failure, skeletal abnormalities, growth insufficiency, pancreatic insufficiency, microcephaly and other neurologic deficits, cardiac defects, alopecia, liver failure, neurodegeneration, wound healing, Diamond-Blackfan anemia (DBA), Shwachman-Diamond syndrome (SDS), X- linked dyskeratosis congenita (DC), cartilage hair hypoplasia (CHH), Treacher Collins syndrome (TCS), muscle wasting, or an age-related disorder.

28. The method of claim 27, wherein the cancer is hematological or a non-hematological cancer.

29. The method of any one of claims 25-28, wherein the subject is a mammal.

30. The use of claim 24 or method of claim 26, wherein the senescence in the senescence associated pathology is selected from replicative senescence and DNA damage-induced senescence.

31. The use of claim 24 or method of claim 26, wherein the senescence associated pathology is selected from the group consisting of lung fibrosis, atherosclerosis, Alzheimer's disease, diabetes, liver fibrosis, chronic kidney disease, cardiac fibrosis, Parkinson’s disease, age- related tissue decline, age-related organ decline, degenerative disease, cancer, cataracts, macular degeneration, glaucoma, atherosclerosis, acute coronary syndrome, myocardial infarction, stroke, recovery after stroke, PSD-95 decrease, hypertension, idiopathic pulmonary fibrosis (IPF), chronic obstructive pulmonary disease (COPD), type 1 diabetes, obesity, fat dysfunction, coronary artery disease, cerebrovascular disease, periodontal disease, cancer treatment-related disability, chemotherapy treatment-related disability, chemotherapy treatment-related frailty, frailty, radiotherapy and other radiation related disability, chemotherapy treatment-related frailty, cancer treatment-related atrophy, cancer treatment-related fibrosis, brain injury, heart injury, and therapy-related myelodysplastic syndrome, accelerated aging, accelerated aging disease, Hutchinson- Gilford progeria syndrome, Werner syndrome, Cockayne syndrome, exroderma pigmentosum, ataxia telangiectasia, Fanconi anemia, dyskeratosis congenital, aplastic anemia, idiopathic pulmonary fibrosis, atherosclerosis, cardiovascular disease, adult cancer, arthritis, osteoporosis, hypertension, neurodegeneration, stroke, atrophic gastritis, osteoarthritis, NASH, camptocormia, chronic obstructive pulmonary disease, coronary artery disease, dopamine dysregulation syndrome, metabolic syndrome, effort incontinence, Hashimoto's thyroiditis, heart failure, late life depression, 125 95635253Attorney Docket No.106546-804769 (4262) immunosenescence, myocardial infarction, acute coronary syndrome, sarcopenia, sarcopenic obesity, senile osteoporosis, and urinary incontinence. 126 95635253

Images