Nucleic acid inhibitors of ceramide synthesis and uses thereof

Abstract

This disclosure relates to nucleic acid inhibitors, specifically small interfering RNA (siRNAs), of serine palmitoyltransferase long chain base subunit 2 (SPTLC2) and use thereof for treating fatty liver diseases. A lipid nanoparticle composition comprising the nucleic acid inhibitor and a pharmaceutically acceptable carrier is also provided.

Description

[0001] NUCLEIC ACID INHIBITORS OF CERAMIDE SYNTHESIS

[0002] AND USES THEREOF

[0003] Technical field

[0004] The present invention relates, in general terms, to compositions for treating metabolic diseases, and in particular to nucleic acid inhibitors for treating fatty liver and other metabolic diseases, and uses thereof.

[0005] Background

[0006] The global prevalence of obesity-related metabolic disorders such as type 2 diabetes mellitus, fatty liver disease and cardiovascular diseases has increased dramatically since the early twenty-first century. Recent studies have implicated increased production and deposition of ceramides as a driver of various cellular defects behind many of these metabolic diseases. However, there is as yet no approved pharmaceutical intervention for targeting dysfunctional ceramide synthesis.

[0007] One metabolic disease with known associations with ceramide synthesis pathways is fatty liver disease. Non-alcoholic fatty liver disease (NAFLD) is a chronic liver disease that starts as fatty deposits in the liver (hepatic steatosis) and may progress to liver inflammation (steatohepatitis). eventually leading to cirrhosis, fibrosis and liver failure. There are currently no approved drugs for treating fatty liver disease, and treatment is largely focused on managing factors associated with the condition. For modulating ceramide synthesis in fatty liver, myriocin is the most investigated pathway inhibitor, and it has shown some therapeutic benefit in prcclinical animal models of non-alcoholic steatohepatitis (NASH). However, myriocin has low water solubility, so its therapeutic effect via oral administration is limited and slow. Further, long-term administration of large doses of myriocin may cause various adverse side effects. There is thus a need for other therapeutic options to prevent aberrant ceramide synthesis in various metabolic pathologies, including the more severe forms of fatty liver disease.

[0008] It would be desirable to overcome or alleviate at least one of the above-described problems, or at least to provide a useful alternative. Summary

[0009] Disclosed herein is a method of treating a metabolic disease in a subject, the method comprising administering to the subject an effective amount of a nucleic acid inhibitor of serine palmitoyltransferase long chain base subunit 2 (SPTLC2).

[0010] Disclosed herein is a nucleic acid inhibitor of serine palmitoyltransferase long chain base subunit 2 (SPTLC2) for use in treating a subject with a metabolic disease.

[0011] Also disclosed herein is the use of a nucleic acid inhibitor of serine palmitoyltransferase long chain base subunit 2 (SPTLC2) in the manufacture of a medicament for treating a subject with a metabolic disease.

[0012] Disclosed herein is a method of inhibiting ceramide synthesis in a cell, the method comprising contacting the cell with an effective amount of a nucleic acid inhibitor of SPTLC2.

[0013] Disclosed herein is a nucleic acid inhibitor of SPTLC2, wherein the nucleic acid inhibitor comprises, encodes or binds to a sequence selected from a nucleic acid sequence having at least 70% sequence identity to any one of SEQ ID NOs: 3—10, or a complementary sequence thereof.

[0014] Disclosed herein is a pharmaceutical composition comprising a nucleic acid inhibitor as defined herein and a pharmaceutically acceptable earner.

[0015] Disclosed herein is a lipid nanoparticle (LNP) composition comprising a nucleic acid inhibitor as defined herein and a pharmaceutically acceptable carrier.

[0016] Disclosed herein is a nucleic acid inhibitor, pharmaceutical composition or lipid nanoparticle (LNP) composition as defined herein, for use as a medicament.

[0017] Brief description of the drawings

[0018] Embodiments of the present invention will now be described, by way of non-limiting example, with reference to the drawings in which:

[0019] Figure 1 shows that ceramide levels and hepatic de novo ceramide synthesis correlate with NASH severity in patients. (A) Human plasma levels of total ceramides. (B) Heat map of human plasma ceramides (presented as fold change vs healthy group). (C) Schematic illustration of ceramide synthesis pathways. (D) Heatmap of hepatic expression levels of ceramide de novo synthesis pathway associated genes (presented as fold change vs healthy group). (E) Hepatic Sptlc2 expression levels in a human cohort. (F) Immunohistochemistry staining of SPTLC2 expression in healthy and NASH human liver paraffin sections showing SPTLC2 in brown and nucleus in blue, scale bar = 100 pm. (G) Violin plot shown Sptlc2 expression across different hepatic cell clusters in healthy and NASH human snRNA-seq, n=3. *P < 0.05, **p < 0.01, ***p < 0.001.

[0020] Figure 2 shows that de novo synthesis of ceramide is activated in NASH models. (A) H&E, Oil Red O (ORO) and Masson Trichromc staining of mouse liver tissue, scale bar = 100 pm. (B) Serum ALT levels. (C) Serum AST levels. (D) Hepatic Tnf-a mRNA level. (E) Hepatic Il-ip mRNA level. (F) Hepatic total ceramide in NASH mice. (G) Heat map of hepatic ceramide (presented as fold change vs healthy group) and ceramide fold changes in comparation with control. (H, I) Hepatic mRNA or protein expression levels of SPTLC2 (72kDa) in different stages of MCD diet-induced NASH. (J, K) Hepatic expression of Sptlc2mRNA in CD-HFD or STAM mouse models. N = 3 mice / group. *P< 0.05, **P < 0.01, ***p < 0.001.

[0021] Figure 3 shows SPTLC2 siRNA screening, LNP-SPTLC2 siRNA formulation, characterization and in vitro test. (A) Screening of 7 SPTLC2 siRNA molecules in Hepa 1- 6 cell line. (B) Screening of 7 SPTLC2 siRNA in Hep G2 cell line. (C) Schematic of LNO generation. (D) Size, PDI and zeta potential distribution of LNPs. (E) LNP size change in 28 days. (F) LNP PDI change in 28 days. (G) Dosc-dcpcndcnt knockdown efficiency of LNP-SPTLC2 siRNA in Hepa1 -6. (H) Dose dependent increase of SPTLC2 mRNA expression in Hepal-6 cells treated with different concentration of oleic acid (OA). (1) ORO staining of Hepa1 -6 cells treated with OA and LNPs. N = 3 / Group. *P < 0.05, **p < 0.01 , ***p < 0.001.

[0022] Figure 4 shows that LNPs can deliver siRNA to hepatocytes to knock down SPTLC2 efficiently in vivo. (A) Whole body I VIS imaging of mice injected with control and LNPs loaded Cy5-labcllcd siRNA. (B) A representative 1V1S image showing accumulation of LNPs in different organs. (C) Flow cytometry analysis showing cellular uptake of Cy5- siRNA in hepatocytes. (D) Delivery efficiency of Cy5 labelled-siRNA in different liver cells in vivo (NASH mice). Data is presented as percentage of Cy5 positive cells of respective cell types based on FACS analysis. EC, endothelial cells, HSCs, hepatic stellate cells, DCs, dendritic cells. (E) Time response of LNP-SPTLC2 siRNA in NASH mice on MCD diet for 4 weeks (mRNA). (F) Time response of LNP-SPTLC2 siRNA in NASH mice on MCD diet for 4 weeks (Western blot). (G) Time response of LNP-SPTLC2 siRNA in NASH mice on MCD diet for 4 weeks (protein). (H) Time response of LNP-siRNA once per week and twice per week in healthy mice. N = 3 mice / group. *P < 0.05, **p < 0.01. ***p < 0.001.

[0023] Figure 5 shows that LNP-SPTLC2 siRNA lowers hepatic ceramides and alleviates NASH in MCD diet model.. (A) Schematic illustration of the experimental design. (B) Hepatic levels of total sphingomyelins and ceramides in NASH mice after treatment. (C) Species of ceramides that are decreased in the liver after treatment. (D) Liver histology analysis by H&E staining (scale bar = 200 pm), ORO staining (scale bar = 500 pm) and Masson’s trichrome staining (scale bar = 100 pm). (E) Quantification of lipid content by ORO staining and fibrotic area by MT staining. (F) Liver markers for inflammation (IL-ip, TNF-a and Ccl2). (G) Serum AST and ALT levels (H) Liver markers for fibrosis (TGF-P, Collal, Col3al and TIMP-1). (I) Serum inflammatory markers level (IL-ip and TNF-a). N = 7 mice / group. *P < 0.05, **p < 0.01, ***p < 0.001.

[0024] Figure 6 shows that intensive doses of LNP-SPTLC2 siRNA achieves optimal therapeutic efficacy in NASH. (A) Schematic of the experimental design. (B) Hepatic levels of total sphingomyelins and ceramides in NASH mice after treatment. (C) Species of ceramides which are decreased in the liver after treatment. (D) Liver histology analysis by H&E staining(scalc bar = 200 pm), ORO staining (scale bar = 500 pm) and Masson’s trichromc staining (scale bar = 100 pm). (E) Quantification of lipid content by ORO staining and fibrotic area by MT staining. (F) Liver markers for inflammation (IL-ip, TNF-a and Ccl2). and liver markers for fibrosis (TGF-P, Coll al , Col3a1 and TIMP-1 ). (G) Serum AST and ALT levels. (H) MR imaging for evaluation of treatment efficacy (n=3). N = 5 micc / group except H. *P < 0.05, **p < 0.01, ***p < 0.001. Figure 7 shows treatment efficacy of LNP-SPTLC2 siRNA in CD-HFD diet induced obese NASH. (A) Schematic of the experimental design. (B) Hepatic levels of total sphingomyelins and ceramides in NASH mice after treatment. (C) Species of ceramides that decreased in the liver after treatment. (D) Liver histology analysis by H&E staining (scale bar = 100 pm) and ORO staining. (E) Quantification of lipid content by ORO staining. (F) Liver markers for inflammation (IL- 1 p, TNF-a and Ccl2). (G) Serum AST and AST levels. *P < 0.05, **p < 0.01, ***p < 0.001.

[0025] Figure 8 shows an exemplary biological pathway in which lowering ceramide levels ameliorates liver steatosis by reducing hepatic lipid uptake and lipogenesis. (A) Schematic showing how lowering hepatic ceramides via injection of LNP-SPTLC2 siRNA can ameliorate liver steatosis. (B) SPTLC2 knockdown inhibits expression of CD36, FATP2 and FATP5 in Hcpa 1-6 cells incubated with olcic acid (OA). SPTLC2 siRNA was transfected by LNP, mRNA was extracted 24 hours after transfection. Gene expression was normalized by Gapdh. (C) Hepatic CD36, FATP2 and FATP5 levels in MCD dict-induccd NASH. (D) Hepatic SREBP-lc, ACC1 and Fas levels in MCD diet induced NASH. (E) Western blot analysis of hepatic SREBP-lc (125kDa) and CD36 (85 kDa) protein levels in diet induced NASH. (F) Heat map of hepatic TG levels. (G) Quantification of s abundant TG species in NASH livers. N=5 mice / group *P < 0.05, **p < 0.01, ***p < 0.001.

[0026] Figure 9 shows hepatic expression levels of ceramide synthesis pathway associated genes.

[0027] (A) Hepatic expression of SMase mRNA in different stages of MCD diet-induced NASH.

[0028] (B) Hepatic expression of GCase mRNA in different stages of MCD diet-induced NASH.

[0029] (C) Hepatic expression of Degsl mRNA in different stages of MCD diet-induced NASH.

[0030] (D) Hepatic expression of Cers2 mRNA in different stages of MCD diet- induced NASH. N = 3 mice / group. *P < 0.05, **p < 0.01, ***p < 0.001

[0031] Figure 10 shows gene knockdown efficiency and therapeutic effects of LNP-SPTLC2 siRNA in MCD diet-induced NASH after one dose per week treatment. (A) Hepatic SPTLC2 expression levels. (B, C) After treatment, plasma levels of total sphingomyelins and ceramides in NASH mice (one dose / week). N - 7 mice / group. **P < 0.01 , ***p < 0.001 .

[0032] Figure 11 shows gene knockdown efficiency and therapeutic effects of LNP-SPTLC2 siRNA in MCD diet-induced NASH after two doses per week treatment. (A) Hepatic SPTLC2 expression levels. (B) Comparison of knockdown efficiency between one dose and two doses treatment. (C, D) After treatment, plasma levels of total sphingomyelins and ceramides in NASH mice (two doses / week). (E) Liver MPO activity. N = 5 mice / group. **P < 0.01, ***p < 0.001.

[0033] Figure 12 shows weight development of the CD-HFD model, gene knockdown efficiency, and therapeutic effects of LNP-SPTLC2 siRNA in CD-HFD diet-induced NASH after two doses per week treatment. (A) Body weight development of CD-HFD diet-induced NASH model. (B) Hepatic SPTLC2 expression levels. (C, D) After treatment, plasma levels of total sphingomyelins and ceramides in NASH mice (two doses / week). N = 7 mice / treatment group. *P < 0.05, **p < 0.01, ***p < 0.001.

[0034] Detailed description

[0035] The present disclosure provides nucleic acid inhibitors for targeting serine palmitoyltransferase (SPT), the rate-limiting enzyme in de novo ceramide biosynthesis. Also provided are methods of using the nucleic acid inhibitors to treat metabolic diseases, especially metabolic diseases characterised by increased lipid deposition and / or ceramide synthesis, such as fatty liver disease.

[0036] The inventors have found that elevated hepatic ceramide levels in fatty liver disease is driven by an upregulation in de novo ceramide synthesis, which can be suppressed using nucleic acid inhibitors that target SPT. The nucleic acid inhibitors may be formulated for increased uptake in specific cells and tissues, and may thus be advantageous in providing targeted inhibition of ceramide synthesis at lower doses and without the side effects seen with conventional small molecule SPT inhibitors like myriocin.

[0037] The target may be one or more of the three SPT subunits, SPT long chain base subunit 1 (SPTLC1), long chain base subunit 2 (SPTLC2) and long chain base subunit 3 (SPTLC3). SPT is a heterodimeric complex consisting of an essential subunit SPTLC1 (required for enzyme activity) and a catalytic subunit, which may be SPTLC2 or SPTLC3. While SPTLC1 is generally present in all tissues, the tissue and / or organ distribution is different for SPTLC2 and SPTLC3. For example, SPTLC2 is predominantly expressed in the liver and SPTLC3 may be found in other non-liver tissues. Selectively targeting SPTLC2 offers the advantage of more precisely treating liver-related metabolic diseases while minimising potential off- targct effects in other tissues.

[0038] The inventors have found that delivery of siRNA targeting SPTLC2 to the liver of mice led to liver-specific reduction in ceramide levels and prevented NASH development in a mouse model of NAFLD. Thus, the nucleic acid inhibitors of the present disclosure may be applied as targeted therapies for treating NASH or NAFLD by inhibiting ceramide de novo synthesis. The siRNA-based approach offers advantages over permanent gene knockout strategies, as it allows for transient inhibition and potentially reduces the risk of off-target effects.

[0039] Accordingly, this disclosure provides nucleic acid inhibitors of SPTLC2, and methods of inhibiting ceramide synthesis, inhibiting ceramide deposition and / or treating metabolic diseases using the nucleic acid inhibitors.

[0040] As used herein, the term “nucleic acid inhibitor” refers to a nucleic acid molecule capable of inhibiting the expression of a target gene, e.g., SPTLC2. The nucleic acid inhibitor may inhibit gene expression at the DNA or RNA level. By way of example and not intending any limitation, the nucleic acid inhibitor may inhibit gene transcription and / or translation from an RNA product of the gene, induce exon skipping or otherwise interfere with RNA splicing, or mediate sequence-specific cleavage, degradation or editing of a gene or an RNA product of the gene. The nucleic acid inhibitor may mediate inhibition on its own or together with another biomolecule, e.g., a polypeptide or another nucleic acid molecule. Further, the nucleic acid inhibitor may undergo biochemical or enzymatic processing in a cell or tissue to attain a functional inhibitory format or state.

[0041] The terms “polynucleotide”, “nucleic acid” and “nucleic acid molecule” are used interchangeably herein to refer to polymers of nucleotides, and include but are not limited to single- and double-stranded DNA and RNA, DNA / RN A hybrids including polynucleotide chains of regularly and / or irregularly alternating deoxyribosyl moieties and ribosyl moieties, and modifications of these kinds of polynucleotides, wherein the attachment of various entities or moieties to the nucleotide units at any position are included.

[0042] The term “nucleotide” refers to a ribonucleotide or a deoxyribonucleotide or modified form thereof, as well as an analogue thereof. Nucleotides include species that comprise purines, e.g., adenine, hypoxanthine, guanine, and their derivatives and analogues, as well as pyrimidines, e.g., cytosine, uracil, thymine, and their derivatives and analogues.

[0043] Nucleotide analogues include nucleotides having modifications in the chemical structure of the base, sugar and / or phosphate, including, but not limited to, 5-position pyrimidine modifications, 8-position purine modifications, modifications at cytosine exocyclic amines, and substitution of 5-bromo-uracil; and 2’ -position sugar modifications, including but not limited to, sugar-modified ribonucleotides in which the 2’ -OH is replaced by a group such as an H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, wherein R is an alkyl moiety. Nucleotide analogs are also meant to include nucleotides with bases such as inosine, queuosine, xanthine, sugars such as 2’-methyl ribose, non-natural phosphodiester linkages such as methylphosphonates, phosphorothioates and peptides.

[0044] Modified bases refer to nucleotide bases such as, for example, adenine, guanine, cytosine, thymine, uracil, xanthine, inosine, and queuosine that have been modified by the replacement or addition of one or more atoms or groups. Some examples of types of modifications that can comprise nucleotides that are modified with respect to the base moieties include but are not limited to, alkylated, halogenated, thiolated, aminated, amidated, or acetylated bases, individually or in combination. More specific examples include, for example, 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6- methylguanine, N,N, -dimethyladenine, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1 -methylinosine, 3 -methyluridine, 5-methylcytidine, 5 -methyluridine and other nucleotides having a modification at the 5 position, 5-(2-amino)propyl uridine, 5-halocytidine, 5- halouridine, 4-acetylcytidine, 1 -methyladenosine, 2-methyladenosine, 3-methylcytidine, 6- methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5- methylaminoethyluridine, 5-methyloxyuridine, deazanucleotides such as 7-deaza- adenosine, 6-azouridine, 6-azocytidine, 6-azothymidine, 5-methyl-2-thiouridine, other thio bases such as 2-thiouridinc and 4-thiouridinc and 2-thiocytidinc, dihydrouridinc, pseudouridine, queuosine, archaeosine, naphthyl and substituted naphthyl groups, any O- and N-alkylated purines and pyrimidines such as N6-methyladenosine, 5- methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridine-4-one, pyridine-2-one, phenyl and modified phenyl groups such as aminophcnol or 2,4,6-trimcthoxy benzene, modified cytosines that act as G-clamp nucleotides, 8-substituted adenines and guanines, 5- substituted uracils and thymines, azapyrimidines, carboxyhydroxyalkyl nucleotides, carboxyalkylammoalkyl nucleotides, and alkylcarbonylalkylated nucleotides. Modified nucleotides also include those nucleotides that arc modified with respect to the sugar moiety, as well as nucleotides having sugars or analogs thereof that are not ribosyl. For example, the sugar moieties may be, or be based on, mannoses, arabinoses, glucopyranoses, galactopyranoses, 4'-thioribose, and other sugars, heterocycles, or carbocycles.

[0045] The term “nucleotide” is also meant to include what are known in the art as universal bases. By way of example, universal bases include but are not limited to 3 -nitropyrrole, 5- nitroindole, or nebularine. The term “nucleotide” is also meant to include the N3’ to P5’ phosphoramidate, resulting from the substitution of a ribosyl 3’ oxygen with an amine group. Further, the term nucleotide also includes those species that have a detectable label, such as for example a radioactive or fluorescent moiety, or mass label attached to the nucleotide.

[0046] The terms "identical” or percent "identity” in the context of two or more nucleic acids or polypeptides, refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned (introducing gaps, if necessary) for maximum correspondence. The percent identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software that can be used to obtain alignments of amino acid or nucleotide sequences are well-known in the art. These include, but are not limited to, BLAST, Clustal Omega, T-COFFEE, and MAFFT. In some embodiments, two nucleic acids or polypeptides described herein are substantially identical, meaning they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using a sequence comparison algorithm or by visual inspection.

[0047] The terms “treating”, “treatment” and the like include relieving, reducing, alleviating, ameliorating or otherwise inhibiting the effects of the metabolic disease for at least a period of time. It is also to be understood that terms “treating”, “treatment” and the like do not imply that the disease, or a symptom thereof, is permanently relieved, reduced, alleviated, ameliorated or otherwise inhibited and therefore also encompasses the temporary relief, reduction, alleviation, amelioration or otherwise inhibition of the disease, or of a symptom thereof.

[0048] As used herein a “therapeutically effective amount” or “effective amount” is an amount that is non-toxic to the subject and sufficient to effect desired outcomes in a subject (i.e., achieve therapeutic efficacy). For purposes of this disclosure, a therapeutically effective amount of a nucleic acid inhibitor or composition is an amount that is sufficient to palliate, ameliorate, stabilise, reverse, prevent, slow or delay the progression of a disease state. A therapeutically effective amount can be administered in one or more administrations.

[0049] The terms “patient”, “subject”, “host” or “individual” used interchangeably herein, refer to any subject, particularly a vertebrate subject, and even more particularly a mammalian subject, for whom therapy or prophylaxis is desired. Suitable vertebrate animals that fall within the scope of the invention include, but are not restricted to, any member of the subphylum Chordata including primates (e.g., humans, monkeys and apes, and includes species of monkeys such from the genus Macaca (e.g., cynomologus monkeys such as Macaca fascicularis, and / or rhesus monkeys Macaca mulato)) and baboon {Papio ursinus), as well as marmosets (species from the genus Callithrix), squirrel monkeys (species from the genus Saimiri) and tamarins (species from the genus Saguinus), as well as species of apes such as chimpanzees Pan troglodytes)), rodents (e.g., mice rats, guinea pigs), lagomorphs (e.g., rabbits, hares), bovines (e.g., cattle), ovines (e.g., sheep), caprines (e.g., goats), porcines (e.g., pigs), equines (e.g., horses), canines (e.g., dogs), felines (e.g., cats), avians (e.g., chickens, turkeys, ducks, geese, companion birds such as canaries, budgerigars etc.), marine mammals (e.g., dolphins, whales), reptiles (snakes, frogs, lizards etc.), and fish. A preferred subject is a human in need of treatment for a metabolic disease, including through inhibiting or reversing increased synthesis of ceramides. However, it will be understood that the aforementioned terms do not imply that symptoms are present.

[0050] As used herein, a “pharmaceutically acceptable carrier” refers to any organic or inorganic carrier substance suitable for administration which is able to complex, encapsulate or otherwise interact with a nucleic acid inhibitor without affecting the activity of the nucleic acid inhibitor.

[0051] The term “pharmaceutical composition” or “pharmaceutical formulation” refers to a preparation which is in such form as to permit the biological activity of the active ingrcdicnt(s) to be effective, and which contains no additional components which arc unacceptably toxic to a subject to which the composition or formulation would be administered. Such formulations are sterile. “Pharmaceutically acceptable” carriers and excipients (vehicles, additives) are those which can reasonably be administered to a subject mammal to provide an effective dose of the active ingredient employed.

[0052] Metabolic diseases

[0053] Metabolic diseases herein may be characterised by increased lipid deposition, tissue inflammation and / or increased ceramide synthesis.

[0054] In one embodiment, the metabolic disease is characterised by increased lipid deposition. The lipid deposition may be systemic (i.e., affecting multiple tissues and organs) or specific to one or more cell type, tissue or organ, e.g., liver, adipose tissue and / or cardiovascular system. In one embodiment, the increased lipid deposition is an increased deposition of sphingolipids and / or ceramides. In one embodiment, the metabolic disease is characterised by increased lipid deposition in the liver.

[0055] In one embodiment, the metabolic disease is characterised by increased ceramide synthesis. Metabolic diseases characterised by increased ceramide synthesis include, but are not limited to, type 2 diabetes mellitus, hypertriglyceridemia, obesity-related cardiovascular diseases (e.g., atherosclerosis, hypertension, vascular endothelial dysfunction, cardiomyopathies), fatty liver disease (e.g., non-alcoholic fatty liver disease), tissue-specific obesity-induced insulin resistance, and obesity-related lipodystrophy.

[0056] Tn one embodiment, the metabolic disease is fatty liver disease. Tn one embodiment, the fatty liver disease is non-alcoholic steatohepatitis (NASH) or non-alcoholic fatty liver disease (NAFLD).

[0057] The terms "non-alcoholic fatty liver disease”, "NAFLD", "metabolic-associated fatty liver disease”, "MAFLD”, "metabolic dysfunction-associated steatotic liver disease" and "MASLD" are used interchangeably herein to refer to all diseases of the liver caused by steatosis that are not a result of the excessive consumption of alcohol. NAFLDs include, but are not limited to, simple nonalcoholic fatty liver ("NAFL”) also known as metabolic dysfunction-associated steatotic liver ("MASL"), non-alcoholic steatohepatitis ("NASH") also known as metabolic dysfunction-associated steatohepatitis (MASH), NAFL with attendant liver fibrosis, NAFL with attendant liver cirrhosis, NASH with attendant liver fibrosis, NASH with attendant liver cirrhosis, fatty liver disease resulting from obesity, diabetes, insulin resistance, hypertriglyceridemia or lipodystrophy. Diagnosis is typically made through blood tests, imaging scans and liver biopsy to detect the presence and extent of fat accumulation in the liver and / or liver damage.

[0058] Nucleic acid inhibitors

[0059] Non-limiting examples of nucleic acid inhibitors include antisense compounds (e.g., antisense oligonucleotides (ASOs), gaptners and the like); nucleic acid molecules mediating RNA interference, including but not limited to short hairpin RNA (shRNA), microRNA (miRNA) and precursors, and small interfering RNA (siRNA) and variants and precursors of such (e.g., small segmented siRNA, small interfering ribonucleic neutrals, Dicer substrate siRNA, etc.); and guide RNAs (gRNAs) mediating sequence-specific base editing, gene or RNA editing, or DNA or RNA cleavage in association with a Cas protein. The term “nucleic acid inhibitor” also includes vectors (e.g., plasmid vectors, viral vectors, etc.) encoding a nucleic acid inhibitor.

[0060] In some embodiments, the nucleic acid inhibitor is a small interfering RNA (siRNA), antisense nucleic acid molecule, or a short hairpin RNA (shRNA).

[0061] Tn some embodiments, the nucleic acid inhibitor mediates RNA interference (RNAi) of SPTLC2 expression.

[0062] The term “RNA interference” or “RNAi” is used herein consistently with its meaning in the art to refer to a phenomenon whereby double-stranded RNA (dsRNA) triggers the inhibition of gene expression (also referred to as “silencing” or “knockdown”) through sequencespecific degradation or translational repression of a corresponding mRNA having complementarity to a strand of the dsRNA (or through another mechanism yet to be disclosed). It will be appreciated that the complementarity between the strand of the dsRNA and the mRNA need not be 100% but need only be sufficient to mediate inhibition of a target gene. For example, the degree of complementarity is such that the strand can cither (i) guide cleavage of the mRNA in the RNA-induced silencing complex (RISC); or (ii) cause translational repression of the mRNA. In certain embodiments the double-stranded portion of the RNA is 30 nucleotides in length or less, e.g., between 15 and 30 nucleotides in length.

[0063] In mammalian cells, RNAi may be achieved by introducing an appropriate doublestranded nucleic acid into the cells or expressing a nucleic acid in cells that is then processed intracellularly to yield dsRNA therein. Exemplary nucleic acids capable of mediating RNAi are a short hairpin RNA (shRNA), a short interfering RNA (siRNA), and a micro RNA (miRNA) precursor. These terms are well known and are used herein consistently with their meaning in the art. siRNAs typically comprise two separate nucleic acid strands that are hybridised to each other to form a duplex. They can be synthesised in vitro, e.g., using standard nucleic acid synthesis techniques. They can comprise a wide variety of modified nucleosides, nucleoside analogs and can comprise chemically or biologically modified bases, modified backbones, etc. Any modification recognised in the art as being useful for RNAi can be used. Some modifications result in increased stability, cell uptake, potency, etc. In certain embodiments the siRNA comprises a duplex of between 15-30 nucleotides in length and one or two 3’ overhangs of 1-5 nucleotides in length, which may be composed of dcoxyribonuclcotidcs. shRNAs comprise a single nucleic acid strand that contains two complementary portions separated by a predominantly non-self-complementary region. The complementary portions hybridise to form a duplex structure and the non-self- complementary region forms a loop connecting the 3’ end of one strand of the duplex and the 5’ end of the other strand. shRNAs undergo intracellular processing to generate siRNAs. siRNAs may be constructed in vitro using synthetic oligonucleotides or appropriate transcription enzymes or in vivo using appropriate transcription enzymes or expression vectors. The siRNAs include a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson-Crick base -pairing interactions to form the base pairs. The sense strand or passenger strand comprises the target mRNA nucleotide sequence, while the antisense strand or guide strand comprises a nucleotide sequence that is the reverse complement of the target mRNA sequence. The sense and antisense strands of the present siRNA may be complementary single-stranded (ss) RNA molecules that form a double- stranded (ds) siRNA or a D A polynucleotide encoding two complementary portions that may include a hairpin structure linking the complementary base pairs to form the siRNA. Preferably, the duplex regions of the siRNA formed by the ds RNA or encoded by the DNA polypeptide include about 15-30 base pairs, more preferably, about 20-30 base pairs. For example, the duplex region of the siRNA formed by the ds RNA or encoded by the DNA polypeptide may be 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs. Tn one embodiment, the duplex region of the siRNA formed by the ds RNA or encoded by the DNA polypeptide is 25 base pairs in length. Duplexes of this length have the advantage of being more optimal for Dicer processing and are thus more potent in RNAi compared to shorter (e.g., 21 base pair duplex) siRNAs.

[0064] The siRNA of the invention derived from dsRNA may include partially purified RNA, substantially pure RNA, synthetic RNA, or rccombinantly produced RNA, as well as altered RNA that differs from naturally-occurring RNA by the addition, deletion, substitution and / or alteration of one or more nucleotides. Such alterations can include addition of nonnucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the siRNA, including modifications that make the siRNA resistant to nuclease digestion.

[0065] One or both strands of the siRNA of the invention may include a 3’ overhang. As used herein, a “3’ overhang” refers to at least one unpaired nucleotide extending from the 3’ end of an RNA strand. Thus in an embodiment, the siRNA may include at least one 3’ overhang of from 1 to 5 nucleotides (which includes ribonucleotides and / or deoxynucleotides) in length.

[0066] Both strands of the siRNA molecule may include a 3’ overhang, the length of the overhangs can be the same or different for each strand. Preferably, the 3’ overhang is present on the sense strand of the siRNA, and is 2 nucleotides in length. The 3’ overhangs may also be stabilised against degradation. For example, the overhangs may be stabilised by including purine nucleotides, such as adenosine or guanosine nucleotides, by substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine nucleotides in the 3’ overhangs with 2 ’-deoxy thymidine is tolerated and does not affect the efficiency of RNAi degradation. In particular, the absence of a 2’ hydroxyl in the 2’-deoxythymidine may significantly enhance the nuclease resistance of the 3’ overhang in biological media. The RNA duplex portion of the siRNA may be part of a hairpin structure. The hairpin structure may further contain a loop portion positioned between the two sequences that form the duplex. The loop can vary in length. In some embodiments, the loop may be 5, 6, 7, 8, 9, 10, 11, 12 or 13 nucleotides in length. The hairpin structure may also contain 3’ or 5’ overhang portions. In some embodiments, the overhang is a 3’ or a 5’ overhang that is 1 to 5 nucleotides in length.

[0067] An siRNA molecule may comprise one or more non-nucleotides in one or both nucleic acid strands. A non- nucleotide may be any subunit, functional group, or other molecular entity capable of being incorporated into a nucleic acid molecule in the place of one or more nucleotide units that is not or does not comprise a commonly recognised nucleotide base such as adenosine, guanine, cytosine, uracil, or thymine, or a commonly recognised sugar such as ribose or deoxyribose.

[0068] Chemical modification of siRNA may comprise attaching a conjugate to a siRNA molecule. The conjugate can be attached at the 5’ and / or the 3’ end of the sense and / or the antisense shand of the siRNA via a covalent attachment such as a nucleic acid or non-nucleic acid linker. The conjugate can be attached to the siRNA through a carbamate group or other lurking group. A conjugate may be added to siRNA for any of a number of purposes. For example, the conjugate may be a molecular entity that facilitates the delivery of siRNA into a cell or may be a molecule that comprises a drug or label. Examples of conjugate molecules suitable for attachment to siRNA of the present disclosure include, without limitation, steroids such as cholesterol, glycols such as polyethylene glycol (PEG), human serum albumin (HSA), fatty acids, carotenoids, terpenes, bile acids, folates (e.g., folic acid, folate analogs and derivatives thereof), sugars (e.g., galactose, galactosamine, N-acetyl galactosamine, glucose, mannose, fructose, fucose, etc.), phospholipids, peptides, ligands for cellular receptors capable of mediating cellular uptake, and combinations thereof. Other examples include a lipophilic moiety, a hydrophobic group, vitamin, polymer, polyamine, peptide, protein, nucleic acid, small molecule, oligosaccharide, carbohydrate cluster, intercalates, minor groove binder, cleaving agent, cross-linking agent, membrane active compound, cell penetrating compound, cell targeting signal, or stcric stabiliser conjugate molecules. The type of conjugate used and the extent of conjugation to the siRNA can be evaluated for improved pharmacokinetic profiles, bioavailability, and / or stability of the siRNA while retaining activity. As such, one skilled in the art can screen siRNA molecules having various conjugates attached thereto to identify siRNA conjugates having improved properties using any of a variety of well-known in vitro cell culture or in vivo animal models including the negative-controlled expression studies described above.

[0069] In some embodiments, the nucleic acid inhibitor is an antisense nucleic acid molecule.

[0070] The antisense nucleic acid molecule may be an antisense oligonucleotide (ASO). ASOs are single-stranded DNA or RNA nucleic acid molecules which are complementary to at least a portion of a target nucleotide sequence (e.g., of RNA encoding a target gene described herein). ASOs can modify expression of RNA molecules comprising their target nucleotide sequence by altering splicing, or by recruiting RNase H to degrade RNA comprising the target nucleotide sequence. R ase H recognises nucleic acid complex molecules formed when the ASO binds to RNA comprising its target nucleotide sequence.

[0071] ASOs may comprise 10 to 40 (e.g., 15 to 30, 20 to 25, 21 to 23) nucleotides in length. ASOs may be designed as chimeras, comprising a mix of bases with different chemisties, or as gapmers, comprising a central DNA portion flanked by “wings” of modified nucleotides. ASOs may comprise alterations to the sugar-phosphate backbone in order to increase their stability and / or reduce or prevent RNAse H degradation, such as phosphorothioate linkages, phosphorodiamidate linkages such as phosphorodiamidate morpholino linkages (PMOs), and may comprise, e.g., peptide nucleic acids (PNAs), locked nucleic acids (LNAs), methoxyethyl nucleotide modifications, e.g. 2’-O-methyl (2’-0Me) and 2’-O-methoxyethyl (MOE) ribose modifications and / or 5 ’-methylcytosine modifications.

[0072] The gene, mRNA or cDNA sequence of SPTLC2 may be used to design a nucleic acid inhibitor according to methods known in the art. Such sequences may be accessed on known databases of genomic information, for example, the GcnBank and RcfScq databases maintained by the National Center for Biotechnology Information (NCBI), USA. The nucleotide sequence of human SPTLC2 mRNA and mouse SPTLC2 mRNA are provided as SEQ ID NO:1 and SEQ ID NO:2 respectively. The SPTLC2 mRNA sequence can be used to design a nucleic acid inhibitor or a silencing RNAi modulator or antisense molecule which inhibits SPTLC2 expression for use in the methods and compositions disclosed herein. Human SPTLC2 mRNA

[0073] AGCCGCCGCCGCTGCCACCGCCTACAGAGCCTGCCTIGCGCCTGGTGCTGCCAGGAAGATGCGGCC

[0074] GGAGCCCGGAGGCTGCTGCTGCCGCCGCACGGTGCGGGCGAATGGCTGCGTGGCGAACGGGGAAGT

[0075] ACGGAACGGGTACGTGAGGAGCAGCGCTGCAGCCGCAGCCGCAGCCGCCGCCGGCCAGATCCATCA

[0076] TGTTACACAAAAIGGAGGACTATATAAAAGACCGTTIAAIGAAGCTTTTGAAGAAACACCAAIGCT

[0077] GGTTGCTGTGCTCACGTATGTGGGGTATGGCGTACTCACCCTCTTTGGATATCTTCGAGATTTCTT

[0078] GAGGTATTGGAGAATTGAAAAGTGTCACCATGCAACAGAAAGAGAAGAACAAAAGGACTTTGIGTC

[0079] ATTGTATCAAGATTTTGAAAACTTTTATACAAGGAATCTGTACATGAGGATAAGAGACAACTGGAA

[0080] TCGGCCAATCTGTAGTGTGCCTGGAGCCAGGGTGGACATCATGGAGAGACAGTCTCATGATTATAA

[0081] CTGGTCCTTCAAGTATACAGGGAATATAATAAAGGGTGTTATAAACATGGGTTCCTACAACTATCT

[0082] TGGATTTGCACGGAATACTGGATCATGTCAAGAAGCAGCCGCCAAAGTCCTTGAGGAGTATGGAGC

[0083] TGGAGTGTGCAGTACTCGGCAGGAAATTGGAAACCTGGACAAGCATGAAGAACTAGAGGAGCIIGT

[0084] AGCAAGGTTCTTAGGAGTAGAAGCTGCTATGGCGTATGGCATGGGATTTGCAACGAATTCAATGAA

[0085] CATTCCTGCTCTTGTTGGCAAAGGTTGCCTGATTCTGAGTGATGAACTGAATCATGCATCACTGGT

[0086] TCTGGGAGCCAGACTGTCAGGAGCAACCATTAGAATCTTCAAACACAACAATATGCAAAGCCTAGA

[0087] GAAGCTATTGAAAGATGCCATTGTTTATGGTCAGCCTCGGACACGAAGGCCCTGGAAGAAAATTCT

[0088] CATCCTTGTGGAAGGAATATATAGCATGGAGGGATCTATTGTTCGTCTTCCTGAAGTGATTGCCCT

[0089] CAAGAAGAAATACAAGGCATACTTGTATCTGGATGAGGCTCACAGCATTGGCGCCCTGGGCCCCAC

[0090] AGGCCGGGGTGTGGTGGAGTACTTTGGCCTGGATCCCGAGGATGTGGATGTTATGATGGGAACGTT

[0091] CACAAAGAGTTTIGGTGCTTCTGGAGGATATATTGGAGGCAAGAAGGAGCTGATAGACTACCIGCG

[0092] AACACATTCTCATAGTGCAGTGTATGCCACGTCATTGTCACCTCCTGTAGTGGAGCAGATCATCAC

[0093] CTCCATGAAGTGCATCAIGGGGCAGGATGGCACCAGCCIIGGTAAAGAGTGTGTACAACAGTIAGC

[0094] TGAAAACACCAGGTATTTCAGGAGACGCCTGAAAGAGATGGGCTTCATCATCTATGGAAATGAAGA

[0095] CTCTCCAGTAGTGCCTTTGATGCTCTACATGCCTGCCAAAATTGGCGCCTTTGGACGGGAGATGCT

[0096] GAAGCGGAACATCGGTGTCGTTGTGGTTGGATTTCCIGCCACCCCAATTATTGAGTCCAGAGCCAG

[0097] GTTTTGCCTGTCAGCAGCTCATACCAAAGAAATACTTGATACTGCTTTAAAGGAGATAGATGAAGT

[0098] TGGGGACCTATTGCAGCTGAAGTATTCCCGTCATCGGTTGGTACCTCTACTGGACAGGCCCTTTGA

[0099] CGAGACGACGTATGAAGAAACAGAAGACTGAGCCTTTTTGGTGCTCCCTCAGAGGAACTCTCCCTC

[0100] ACCCAGGACAGCCTGTGGCCTTTGTGAGCCAGTTCCAGGAACCACACTTCTGTGGCCATCTCACGT

[0101] GAAAGACATTGCCTCAGCTACTGAAGGTGGCCACCTCCACTCTAAATGACATTTTGTAAATAGIAA

[0102] AAAACTGCTTCTAATCCTTCCTTTGCTAAATCTCACCTTTAAAAACGAAGGTGACTCACTTTGCTT

[0103] TTTCAGTCCATTAAAAAAACATTTTATTTTGCAACCATTCTACTTGTGAAATCACGCTGACCCTAG

[0104] CCTGTCTCTGGCTAACCACACAGGCCATTCCCCTCTCCCAGCACCTTGCAGACTTGGGCCCATCAA

[0105] GAGCTACTGCTGGCCCTGGCTCCGCAGCCTGGATACTTACCTGGCCCTCCTCCCTAGGGAGCAAGT

[0106] GCCTTCCACTTACTTCCCATCCAGGTCTCAGAGGTCICAAGGCCAACCTTGGAATCCTTATTIAAC

[0107] CATTCAAGTAATCAACGGAAGTTTTCACCCTTTAATCTTAAGTTTAGCCTTTTAAGAAAAACAGTA

[0108] AGCGATGACTGCTGAAAGGCTCATTGTGTAATCTCCCAAGGGTTTGGTCTTATTCCATTTTCTTCT GGTCACCAGATGATTTCTTCCTTTACCATCAAATACTTCTTCATAATGGTCACAGTCTGAGGATGT

[0109] GCGCAAATTCTGGTTCTTCCCAAGCTCTAACCGTAACACGTCCCACCCCCTTTTTAAAGCACTTAC

[0110] TGT TT TCAGAGCACCCATATCCCACCCTGGTGAGAAGGCCACT CT CACATCTGAGTGT TGGGTACA

[0111] AAGCTGCTCCGTAGAGTGATGTGCACTCCTGGTGGGTGAGGGGCAGGGGCAGTGGCAGTGTGCAAA

[0112] GAATTGATTACTCCTTGCAGAGCCTGTGGCTTGCATTTCCTACTGCTTTCTACGTTTGAAAATTAT

[0113] GACAGTCTCTGGCTAGGTCTGGGTCCAGATTAGGATTTAAACTGATAAAGGAAACTGTTGGTAAAT

[0114] CCTCTGCTCAGAAAGCATTTATCATGTTCCTATTTAAGGATTAGGTTTATTAATTTAGGCCTCTTA

[0115] GAAGCTAACCCACTTAAATATTACTCTTCTGAATGCTAGTTCTCTTTTATTCTTGATGTCCTAAGT

[0116] CAATTGAATCTGGCATCTGGGGCTAGGGTCTGCCTGTCTACATATTTTTTATTTTTTTCTGAGAAA

[0117] TTCTGAACACATAGATCTCTTTCCTAAACTGACATTTTCTATTTTGACTGTTTTCATACTATAACC

[0118] AGGTAAAGGGACTTCTTTCAGAGAGCTTTATACTGCCTGACCAAAGAACAAATCTGAAAATCACCA

[0119] TTTTAAAGTTATTTTTTCAGTTGAACCAAAGTTTAAGTGAAGAGGACTTTTGGCATATTATACCCA

[0120] GGATCAGTTTGTCTTTTTGTATCCATCAAGTATTACAGGAGAAGGATTGGGAACAGAATGGAAAAA

[0121] CAGTGTATGAAAGTCATGTTACAGGCCGAGTGCGGTGGCTCACACCTGTAATCCTAGCACTTTGGG

[0122] AGGCTGAGGCAGGTGGCTCACTTGAGGTCAGGAATTCAAGACCAGCCTGGCCAACATGGTGAAACC

[0123] CCGTCTCTACTAAAAAGACAAAAAATTAGCTGGGCGTGGTGGCGGGCACCTATAATCCCACCTACT

[0124] TGGTAGGCTGAGGCAGGAGAATCGCTTGAACCCAGGAGGCGGAGGTTGCAGTGAGACGAGATTGTG

[0125] CCACTGCACTCTAGCCTGGGTGACAGAGCAAAACTGTGTCTCAAAAAAAAAAGTCATGTTACACAT

[0126] TTAAGTTTTTGAAATTGCTCCTTTTATCGGTAAAGATTCTCAATCCAAATTCTCCTGGGTGTGTTG

[0127] TCATCAGCTGTGATATGTTTGTGCACATTACGTATAGCAGAGGATGTAAGCAATATTATTGTTTGT

[0128] GAAGTTTTGTTTTTAATGTCTTGAGTATGAGTTATGTTTAGTCACTGTCAGCATCTGAGAACTTTA

[0129] ATAAGCCCTTGAGATATTCCAAAGTTTTATTTTACTTTTTTAAAGAACAGAAAAAGATGAATGAAA

[0130] GAACCAAGGAGAGATGCAGAGACTATATTTAGCATGTATAGGTTAAAGTAAGAAGGAGGTTGTGGT

[0131] AACTAAATAGGAGTCCTATAAAATCAAATACATTGTCAACCTTTTCTGCACATCTAGTTTCCTACC

[0132] ATAGAATCCCACTGGAATACCACATAGCTTTTGCACTGCAGTTACTATTTACTAATGTAAACGTAG

[0133] GGTTTGTAAAAGTCACAAACTTATAAGCAATGAACTTACCTGCTAGTCTTTTTATTTTGGCTTGCA

[0134] TGAAGTCACTGCAAATTCAAATGTCAGTACCGGCATTTAAAATATATCTATATCACTTTGTTGGTA

[0135] CAAAGTTATTTCAAGATAAGTGTAATTTTGTTACAAGTTTATTTTGAAGAGACAAATCTCCTGTGA

[0136] TCTATGCAGGACCTCTGTACTTTCTAAAGAACAAAATGTTATGTAGACATTATACATGGTTGGTTG

[0137] TCTCTTCTTGAAACTGTAATGTAAATCTAGGGTCCAGTCATATCCTAGGTATCATCATTTATCCAA

[0138] GTACTTGGAGGAATACAAGTATATATAAATACAGTCATTGAGAATAAGTCGATTTGAGGCATACAA

[0139] GAGTAGTTTCTTACACAGTTTAACACGGCCTGATTCAAGACTCTGATAGGATTCAAACAGATACCG

[0140] GTTAACCATGACTACCAAAACTGATCATCTGAGTCGATTGATAGAGGTGTGACTAGTCCTTAGCAC

[0141] TTTTTCTCATTCCTCTTTTTATTCAGCATTGCTGTTACCTATTTCAGGTTTATAAGACCTCTTTCA

[0142] GCAGATCACATCAGAAGCCAGGAAATGCATAGCTAGGAGATGTCAAAAGCCCATATGAGGAGTGGA

[0143] CCAAGCAGCAGTGGCGGTTTCTCCTCGCATCTTTTTTTTTTTAAGCTTTAACTTAGCAGGGGCATG

[0144] GACTTTATAGCACTTTTTCAACTTTTTGCTTTGCTTTGGATAAGAAATCCTTACCTTTAAAAAAAG

[0145] CTTCTAGTCTCCATAACCCCCAAAGTACTGCTTATTTGTTTGAAGAATCCAGCCATCGTAGTGCTT TAGTCACTATCGTAAACATTCATGATAGGGCAAGGATTTTAAAACAGGATTCTTGCTTCTGTAGTC

[0146] ATCAAGGTGAACAGAAGCATCCTACACAACCACTAAGGGCTCTAIGTTTGTGTCATGCCTCTICAA

[0147] ACACCAAGGAGTTGAACATGCTTCCAGTGATTTGTCTCCGTAATGCCTTCTTCCTTTATTTGGCCT

[0148] TTCTTTCTTTCTGTACCTTCAAGTTCTTGATTTTTAAAATTCCAACTCTAGAGAAAACCAATATAT

[0149] GGTGGTGCTGGGCTTTGAAGATAGCATATCAGACGCCTIGGTTCTGTTTGTACACTTAGCCTIACA

[0150] TTTCAGGAGGAGGCTTTTCATTAGGGGCTTAAGCTAGCTCCTTTGGCTTTTAAAAAAAATTTTTTT

[0151] TCAAATTTCTTCATTACCTAAGGGAGCCTGCATCTAAAIITCTCAACTAGTTCAGCCTAGCTGAAI

[0152] TTTCTAGTGTGTTATACACTTTGCTTCCTTCTTATTGGTGAAAACCAGGGGGATGAGTGGCTTCCA

[0153] TGGAGAGATTTCCTGATTTCTCAGGGAGGAAAAAAGTGATGACATTTACCACTACTTTTATGTTTT

[0154] TCCCCTTTTTCCAAATTGATAAGGATTTCTGGTTCCIAGTGATCCGGGATTGGGCAACAGTGCAGA

[0155] ACTGCCAGTCATGCCGTAGGCCGTGAAGAAAGAATGTGAGTAACTGTTGTTTTGCAAGGATTTGTA

[0156] GGGTTATGGGCAGTTGTTGTTTGAAGCATTGCTATGACCTAATTCCCAAGGTATCTTTCCTCTCTT

[0157] GGTGTTCTAGGTAAGCCAATGAGCTTTAATCTCTACTTGCTATAACCGTGTGCTTAGAAAAAGAGG

[0158] TGAGAGTAGTGGTTTTCCTTCAAACTGTCCACATTCATGAAGATTATGAATTGTTAGGACAGCCAG

[0159] GGCAAGATAGACCCTGTCTCTACAAAAATTTTTTTCIAAATTAACCGGGCATGGTGGTGCCTGCCT

[0160] GTAGTCCCACCTGTGTGGGAGAATCACTTGAGCCTGGGAGGTCAAGGCTGCAGTGAGCCATGATTG

[0161] CACCCCTGCACTCCAGCCTGGGTGACAGAGTGAGACCCTGGCTCAATAAGAGGGGGAAAAAAAATT

[0162] GTTAGGAGCTGGGTGCGGATGCAGCCTGCAATCCCAGCTACTTGAGAGGCTGAGGCCGGAGGATTG

[0163] CTTAAACCCAAGAATTTGAGCGTAGCCTGGGCAACACAGCAAGACCCCATCTAAGAAAAAAATGTT

[0164] TTTTAAATCAGCTTAGCCCAAAGGGGTTGTGAATGGGGAGGTATAAAAAGCAAAGATTATTTIIIG

[0165] GCTACTAAGCCAAGAACTTACAGGGATTTTTTTTTTCAGTCCCAGAACCTACAGATACCCTGCTAC

[0166] TTGCTTCACGTGGATGCTCAGTGCCCAGCAGCCATCTTAATACATTAAACCAGTTTAAAAAATACC

[0167] TTCCATGTGGAGAAAAACATGTCTTTTTCTCGCCTCAACTTTATCCACATGAAATATGTGCCCATG

[0168] GCTGGGCGCAGTGGCTCACCTGTAATCCCAACACTTTGGGAGGCTGAAGCAGGCAGATTGCTTGAG

[0169] GCCAGGAGTTCGAGAACAGTCTGGCCAACATGGCGAAACCTCATCTCTACTAAAATTACAAAAAII

[0170] AGCCGGGCATGGTGGCACATGCCTGTAATCCCAGCTACGTCAGGAGGCTGAGGCACAGGAATTGCT

[0171] TGAACCCAAGAGGCAGAGGATGCAATGAGCCAAGATCACACCACTGCACTCCAGCCTTGGCGACAG

[0172] AGGGAGACTCTGTCTCAAAAAAAAAAAAAAAAGGTGIGCCCAGGCCCCTAGCCATTGCCATGIGCC

[0173] CAGCCAGAGAGCCAAATTAGAGGGCTGGCTTCCCTATCACACAGAATAAATGCTAGTGCTAGCCAA

[0174] TGATCCCTTTGCTTTTAATGTATAGAAAATACTGTTGTICCTTTIGTCATTTCCAGTGACATCIGT

[0175] TTTCTAAGCAGCTCTTTTCTAGGGAGGAAACCAAAGGGGCTAGGTTAAGACCCTAATAGAAATGTT

[0176] TTTTCTAATCTCTGGTGAGTCTGGAAGTGTCACATTCACAGTCCACCCTTGGGAGTGGCTTGGTGG

[0177] AGCTGGGGACAAGGTTTTGTTTACTACATAGTGCACATGATAAATGGCCTTAAACTGTGATTCTTT

[0178] CTGGTAGGATAAGTTATAATAAACTGACCCTAAAGAATGCAATGGCTTTTAAACTGCAGTTACTGT

[0179] GTTCTTAATGAAGCAATACCCAAAGCTCTGTTCTTTTGGAGCACTTGAGGGGAGCTTGAATGAAAG

[0180] GTGCAGATAAGAGCAGTACCTTGATCTTATGCTTTCTGAGTGTCCTGCCTTGTTGCCATCTGCATG

[0181] GATGAGTGAATGCTTCTATGCACGAGGAGACTCAAGCCAACTCAGAGTCTGCTTTTTCCAACGCTC

[0182] TTCCCAGGTTTCTTTTGCAAAGCTTGGTCATTTGGCCCAGGTCTICCTGGAAAGTGGAGTACAIGT CACTGACTAGGGTGGCGTGGTGTCTTTACCCTTAACATTAAGTCTTGTTACCTCAGTGATGTGAAG

[0183] CCAATGGTTGGAATTATAAAAAGCATCCTTGCTGGTICTICACAGGACACTGGAACCCACCCIGTC

[0184] AATTCAGCTAGCATGTCCACACAGTCTTGATGATCCCTCTCTGTAACAGGCAGCTAACATTAAGAG

[0185] AAGGGGGAAAGAGAAGAAGAGAGCAATAGCTTATGGGAGAGCTGAGATCTTACTTCGTTGACCCAT

[0186] ATTTTTCCCCTGACCAAGTTACCTGTAAACTGGAATIIGCAAGGGGATGCTGTGATGATAACCCCT

[0187] TTCTATTGCTGTAATGTTCATATAACCTGGGAAACTGAGAGAAGGGGATGTGTAAATAAAAGCTTA

[0188] AACATTTTAGTAATGTGTTAAAATGTCACTCTCTCTIACCCTGTITCCCTTTTTTGCCAGATGAIG

[0189] ATT TT TTTATTT T TAT T T TGTACTTTACTGGATGAC TGTGAAGCGATGAGTATTGGGT TGGGGTAG

[0190] GTGTGTTGATTTTGAGAGTGCATGTTAAGAACTGAAGGGGAACTACTTGAGATGACTTAAGAAGCA

[0191] TCCCATGCAAATATCTTGTTTTGCCCTAATAAAATATTCAGAAAGATA (SEQ ID NO: 1)

[0192] Mouse SPTLC2 mRNA sequence

[0193] GGCTGCCGGGCTICGGCGAGCCCCGTCTTCTCGGGTGGCCCCGCCCTCGCGTGACGGCCGGACCGG

[0194] GAATTGGCAGCGGCGCTGCAGCCATTTCCGGTTTCGGAGAGGTGGGTGCGGTGCGGAGCGGGAGTT

[0195] GGCTCCGCCGCCACCTCCAGAGCCTGTCCTGCTGCCGGGTGCTGCCGGGAGGATGCGGCCGGAGCC

[0196] CGGAGGCTGCTGCTGCCGCCGCCCGATGCGGGCGAACGGCTGCGTCAAGAACGGGGAAGTGAGGAA

[0197] CGGGTACTTGAGGAGCAGCACCGCCACCGTCGCGGCTGCCGGCCAGATTCATCATGTAACAGAAAA

[0198] TGGAGGACTGTACAAAAGACCGTTTAATGAAGCTTTIGAAGAAACACCCATGCTGGTTGCTGIGCT

[0199] CACATATGTGGGCTATGGCGTACTCACCCTCTTTGGATATCTTCGAGATTTCTTGAGGCATTGGAG

[0200] AATTGAAAAGTGCCACCATGCAACAGAAAGAGAAGAACAAAAGGACTTTGTGTCCTTGTATCAGGA

[0201] TTTTGAAAACTTCTATACAAGGAACCTCTACATGAGAATCAGAGACAACTGGAATCGACCTATCTG

[0202] TAGTGTGCCTGGAGCCAAGGTGGATATCATGGAGAGAAAATCTCATGACTATAACTGGTCATTCAA

[0203] GTACACAGGGAATATAATTAAAGGTGTAATAAACATGGGTTCCTACAACTATCTTGGATTTGCGAG

[0204] GAACACTGGATCATGTCAGGAAGCAGCTGCTGAAGTCCTCAAGGAGTATGGAGCAGGGGTGTGCAG

[0205] CACTCGTCAGGAAATTGGAAACCTGGACAAGCATGAAGAACTAGAGAAATTGGTAGCAAGGTTCTT

[0206] AGGTGTGGAAGCTGCTATGACCTATGGCATGGGATTTGCAACAAATTCAATGAACATTCCTGCTCT

[0207] TGTTGGCAAAGGTTGCCTGATTCTGAGTGATGAGCTGAACCATGCGTCACTGGTTCTAGGAGCCAG

[0208] ACTGTCAGGAGCAACCAITCGAATCTTCAAACACAACAAIATGCAAAGCTTAGAGAAGCTTTIAAA

[0209] AGATGCCATTGTTTATGGTCAGCCTCGGACAAGAAGACCCTGGAAGAAAATCTTAATCCTTGTGGA

[0210] AGGCATATATAGTATGGAGGGGTCTATTGTTCGCCTTCCTGAAGTGATTGCTCTCAAGAAGAAATA

[0211] CAAGGCATACTTGTATCTGGATGAGGCTCACAGCATTGGGGCTCTTGGCCCTTCAGGGCGAGGCGT

[0212] GGTAGATTACTTTGGCCTGGATCCTGAGGATGTAGATGTTATGATGGGAACATTCACAAAGAGCTT

[0213] CGGTGCTTCAGGAGGATACATCGGAGGCAAGAAGGAGCTGATAGACTACCTGCGCACACATTCICA

[0214] CAGTGCTGTGTATGCCACGTCGATGTCACCGCCTGTGATGGAACAGATTATCACCTCCATGAAGTG

[0215] CATCATGGGGCAGGATGGCACCAGTCTTGGCAAAGAATGTATACAGCAGTTGGCTGAGAACACCAG

[0216] GTATTTCAGGAGACGCCTGAAGGAAATGGGGTTCATCATCTATGGCAATGAAGACTCCCCGGTGGT

[0217] GCCTTTGATGCTCTACATGCCGGCCAAAATTGGCGCCTTTGGAAGAGAGATGCTGAAGCGGAACAT TGGTGTAGTTGTGGTGGGATTTCCTGCTACCCCGATCATTGAGTCCAGAGCCAGATTTTGCCTGTC AGCAGCTCATACCAAAGAAATACTTGACACTGCTTTGAAGGAGATAGATGAAGTTGGGGATCTGCT GCAGCTAAAGTACTCTCGCCACCGGCTGGTGCCTCTACTGGACAGGCCCTTTGATGAGACTACCTA TGAAGAGACAGAAGACTGAGCCTTTCTGGTGCTCCCTAGAGGGGGATAATTCCTCCCAGGACAGTG TGTGGCCTTTCTGAGCCAATTCCAGGAACCACACTTCAGTGACCACTTCATGTGAAAGACATTTCT GAAGCTACTGAAGGTGGCCACCTTCACTCCAAATGGCATTTTGTAAATAGTAAAAAAACCAAACTG CTTCACATTCTTCCTCTGTTTGCTAAGTCTCACACACACACACACACATATGATTACTTTGTCCAT TAAAAATGTTTTATTTTATAACTATTCTACTTGTGAAATCACGCTGACCCTTGCCTGTGGCTTCTG GAACAGGCATTCCCCGCTGCAGTCACCTCATAGGCTTGGATCCATCAAGACCTACTTCAGGCCCCG GCTCTCCAACCGAGAGAGACTCACTGGCCCTCTCCCTAGGGAGCAAGTGCCTTCTGCTGACTTTCC GCCCAGGTCTGAGGTTGCCCCCCTTGTAATCCCTATTTAACCAGTCAAGTCAATCAACCAAAGCAC TCTGTCTTTAGTCTTAAGGTAAATGTTACCAAGGCCAGAAGGCTTATGTGACTCCCCGTGGCCAAG GACCTCCTAAGACTGGTCTCTCTCTTTCTGTTCTGCTCACCAAATAATTTATTCATTATCAGAGCT TTCTTCATATGGTCGGTCATAGGCTGAAGATGTATCCAACGTTTAGGTTCTCCCTGAGATCTAAGC CTAATGGTTCCCACCTCTAAAGTTACGACAGCCTCTTGCTGGTTCTGGGTCCAGGTTAAGATTTGA CCCTTAAAGGCAAGTGTTGGTCAATCTTTTGCTCATGTTCCACTTCACCATTAGTGGTATAAGTTT TCCGCGTAGACGCTGACCCACCTGAACAGTGCTCTTCCAAAGGCCAATTCTCCTCCTCCTCCTGGG CTAGGAAGATTTTGCCCAGCACCTGGGGCTGGCTTATCTTGTGCTTCCATTGTATTTTTCCCCCTT TGAGGAATTCTGATCAAATACCTCTTTCTTAAACTGGAATAGCCTGTTTTCCTGTCACCGCGGGGT CAGGGACTTCATICAGAGCTTTGTGCTGCTTGACCAAAGACACAICTGAAGAGCACCATTTTAAAG TTTTGTTTTTTTTCTTTTGACCAAAGCTTAATTGAAGAGAACTTTTGGCTTTATTTATTGTGCTGA AGATGAATTTATCTTTTAGTAGCAATCACGTGTTAGAAGGAAGGACTGAGAACAGAATGGGGGGAA AAACTATTTAGAAGTACATTTTGTATGCCATTCTTTAAAATGATTCTTATTACTGATAAAGATCCC AAACCAAGTCCTTCTGAGGACCTGTCAGCTGCAGTACAAGGACAAGAAGAGAGGCAGTGTCATTTG TGAAGCTCTGTTTTCATGCCCTGGATCTGTTATCTTTGGCCCTCTTGGCATCTGTGAGCTTTTAGC CCTTGGCATGTTCTAAAGTTGTATGTGAGTTTTTTAAAGAGTAGAAATGGGTGAACAGGCTGGGTG TGGTAACCTATGCCTTTAATCCTATATCTCAGAAGGCAGAGGCAGGCTGATCTCAGTTTGAGGTCA GCCTGGTCTGCATAGTGAAACCTGAAGAGGGAGACAGAGAATAAAAAGATTCCATAACTAAGTCCT ATAAAGCTCAAATACCT TCCT TCCTCACATTCCATC T TAGAAT CCCACTGGAGTACTAAGTAT ITT GCACAGCAC T TAG TAT T T AAT GATGCAGACCTAATAGGGC T T GCAAAAGT AACAAGCC T TAAGCAG TGAACGCGCCTGCTAGTCTTTTAGCTCACATGAAATCACTTCAAATTAAAATGCTCTTACGGGCAT CTAAATTTTTCTGTATGTATCTCTTGGTGCAAAGTTTATTTTGGGCTAAACGTAACTAAGTTAAAG ATTTTTGTTATTGTTTGTCGGGTTGGTTGGGTTTTTTGTTTTGTTTTGAAGAGACAAAACCCCTGT GTTCTACCCTTGATCTCTACTTCCGAGAGGACAAAATGGTTTATACACTTTATATGTGGCTGTTTT TTTGTAAATCTGTAATAGAAATCTCTGGCCCAATTATGTCATAAGTGACTATAATCCAAAAATCAT AGTGAATAGAGATAGTGAATAGAGACCTGGGCCCTAAATAGATAGATTCAGGCATTCCTAAGTCAG CCATCACCACCAAAGCCGACTGTACTTTGCCTCATGCTTTTCATTTAGCATTGTCCTTACTCCTGT

[0218] GTTTGTAAGACCCACTTCACAGCCCACGTCAGGAACCAGAAGATAATCAGAATCATGCAGAAGATT T1

[0219] TGGCCCGAGGGGCAAGGGCAGGGAATAAATATCTCCTCTTCATAGTAACCTTGTTTAAAGGATCTA

[0220] GCCTTGGAGCTGAAGAGAGGGCTTAGTGGTTGGGGACACTGACTICTTTTTCAGAGGACCCGGGTI

[0221] CAAATCTCAGCACCCACGGGGTAGCCCACAACTGTCTGTAACTCCAAGATTTGATGCTCTCACATA

[0222] GACATACATGTAGGCAAAATACATAAACTAAAGGTAAATAAATAAAACTTGGTGGGAAAAAAATAA

[0223] CCAGCCCCCTTCCACCCTTCATTCACAGTCTTCACTICTGACTCAAACCCTCTCGTAGGCTGAAGG

[0224] GTAGAGCGTCCTCAGAGAGATCTGCCTCTGAGCCTGGACTGACATTCTGGATTCTGCCTCCAGAGG

[0225] ACACTGACAAGTGCTGGTGCACCATATGGGGAGCTGIAGGGCAGACAACCTGCTCCTTGCATGCAC

[0226] AACCATGCACTTTGGTGTTTCTTCCCTTATTAGTTAAGGGTATCCATATCTGAGTCTCTGATGACT

[0227] GGCAAGGTATATAGCCACATTACCTGGTGTGTAATATATCTTGCAAAAAGCAAGATAAACATCTGG

[0228] CTTAGATTTCTTGACTTIAGACAAAGGGGGAAATGAIACCTGCTACCACCTGTTTTTCCAAACIGA

[0229] TGAATCTACCTAATTGCAGTATTTTGACAAAACCCATAGAAATGTAAATAAATGGTTGCTGTGGGA

[0230] TCAAGTATGGTACACACCTGTAATCTCAGAAGGCAGAAGCAAGCAGATCTAGAATTATAAATTATT

[0231] CTGTGTTACAAAGTGAGACTCTACAGAAGGAACAAAAAGAGAGTGGACTATTGCTATGACTTAATG

[0232] TCAGGACGCTGTTCTCCCAGTGTTCTAGGTAAGACACAGCTGCGTGTTCGTGCCTCTCTGCTTCCA

[0233] ACATGGGGTTAGTTAAGAAAAGGAGAGCAGTAGGCTIICCTCTCTTCCTGTGCCAAGCTGATCAGG

[0234] AGCTGTCAAGTATTTCTCACAAATAAAACCACGTTAGCCTGGGGCTATGAAGGGGGAGTTATTAAA

[0235] ATCGGGGGTTAGTTAAGAAAAGGAGAGCAGTAGGCTTTCCTCTCTTCCTGTGCCAAGCTGATCAGG

[0236] AGCTGTCAAGTATTTCTCACAAATAAAACCACGTTAGCCTGGGGCTATGAAGGGGGAGTTATTAAA

[0237] ATCGGGATTCTGCTTGGCAGTTTATCAAAGAATATATAGTGCCTCCACCCCACCCCCTCCAGTTCC

[0238] AGAACCTATGGAIAACCTCTTACCTGCTTACTAGTAIACTCAGTACCCAGCAGGCATCTTAAICCA

[0239] TTAAGCTGGTTAATCAAAACACCTTCCAAGTGGAGAAAAGCATATCCTTCCTCCCCTCTGCCTTAT

[0240] CCACGTGAAGTGTGTGCTCGGGCTTCTAGCCAGCGCACAGGGAACAGAGGGAGGCCCACCAGGGAT

[0241] CCTGGCTTGCCTACCGAAGGCTATTGCTGCTGTAGTTTTCAGTGACTTCTGTCTTCTAAGATGCTT

[0242] TTTCCTGTAGATTGAAAGGTTTCTAGGAAGAAAACAAACGGGAACTTGCTTAGGCCCTAATGATGA

[0243] GCGTTTTCCTCTTTGTGGAGTCTGAAGGCTCACATTCACAGTTTACCCTTAGGAGCAGCCTGGIGG

[0244] GCGGGAGCTGTGAGCTTGTTTGCTACGATGTGGCCTTAAAACTGTTACTGTTTCCAGTGTGATGAA

[0245] TTCTAATAAGTCAACCCTGAAGAATGCTGTGGCTCTTGTCCCGTGTCACTGCTTTTGTGTAAAGCT

[0246] TTGTTCTTTGGGAGCAGTTATTGGAGACGGAATGAAAGGTGCTTGCAAGAACAGCACCCTGAIGTG

[0247] CTCAGTGTCTGTTTCCTGCGCCCTCTGCACTCTTTCCGTGTGCAAGGAACTCCAGTTAACTCAAAG

[0248] TCCAGCACAGGTCCCAGGTAATTCGTGTACACATCCIGAGTAGAGAATGTACCAAGGGTGGTGGAG

[0249] TTATCGTCCCCCTTAACACTGTATGTCAGGATTAGTTTAGCCAATAGTTGGAATTAAGAGCTTCCT

[0250] TACTAGTTTGTTCTTCACAGGACATAGAAACCTCTCCTGTTTGTTTAGCCTGCATGCCCACAGTCT

[0251] TGATGATCCCTCTCTGTACAAAGGCAGCTAACAATAAGGGACGGGGGAAGAGAAGAGAACAGGTGT

[0252] CTGTGGGAGAGTTGAATTAGAGTGATCTTGTAGATCCACGTTTTCCCACTGACCAAGTTACTGTAG

[0253] GCTGGAGTCTGCAAGGTGTACTGTGTCGTGAACCCTTTTCATTCTTGTAATGTTCTTATCATCTGG

[0254] GAATGTGAGATTTTTAATTTTAGGAATAATCTTACAAATAATCACTCTTCTGTAGCCGTCTTGCCA

[0255] GATGTTTTATTTTTCTTTATTTTATTTTATTTTATATTGGATGACTGTGAAGCTATACATAGTAGG TTATGGAGGATATCAATTTTCAGAGTGCATGTTAAGAAATAAAGCGAACCTACTTGAGATGAATCA TCCCATAAATATIGTTTIGCCCTAATAAAATATTCAGAAATAGAAAAAAAAAAAAAAAA

[0256] (SEQ ID NO: 2)

[0257] Disclosed herein is a nucleic acid inhibitor of SPTLC2, wherein the nucleic acid inhibitor comprises, encodes or binds to a sequence selected from a nucleic acid sequence having at least 70% sequence identity (such as at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity) to any one of SEQ ID NOs: 3—16, or a complementary sequence thereof.

[0258] In some embodiments, the nucleic acid inhibitor comprises, encodes or binds to a sequence selected from a nucleic acid sequence having at least 70% sequence identity (such as at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity) to any one of SEQ ID NOs: 3—10, or a complementary sequence thereof. In one embodiment, the nucleic acid inhibitor comprises, encodes or binds to a sequence selected from a nucleic acid sequence in any one of SEQ ID NOs: 3—10, or a complementary sequence thereof.

[0259] The nucleic acid inhibitor may be an siRNA, shRNA or antisense molecule comprising one or more nucleic acid strands with a sequence selected from a nucleic acid sequence having at least 70% sequence identity (such as at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity) to any one of SEQ ID NOs: 3-23.

[0260] In one embodiment, the nucleic acid inhibitor is an siRNA, shR A or antisense molecule comprising one or more nucleic acid strands with a sequence selected from a nucleic acid sequence having at least 70% sequence identity (such as at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity) to any one of SEQ ID NOs: 3-23. In one embodiment, the nucleic acid inhibitor is an siRNA, shRNA or antisense molecule comprising one or more nucleic acid strands with a sequence selected from a nucleic acid sequence in any one of SEQ ID NOs: 3—23. In one embodiment, the nucleic acid inhibitor is an siRNA or shRNA molecule comprising one or more nucleic acid strands with a sequence selected from a nucleic acid sequence having at least 70% sequence identity (such as at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity) to any one of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, and 17-23. In one embodiment, the nucleic acid inhibitor is an siRNA molecule comprising one or more nucleic acid strands with a sequence selected from a nucleic acid sequence in any one of SEQ ID NOs: 4, 6, 8, 10. 12, 14, 16, and 17—23.

[0261] In one embodiment, the nucleic acid inhibitor is an siRNA molecule comprising two nucleic acid shands with a nucleic acid sequence in SEQ ID NO: 3 and SEQ ID NO: 4; SEQ ID NO: 5 and SEQ ID NO: 6; SEQ ID NO: 7 and SEQ ID NO: 8; SEQ ID NO: 9 and SEQ ID NO: 10; SEQ ID NO: 11 and SEQ ID NO: 12; SEQ ID NO: 13 and SEQ ID NO: 14; or SEQ ID NO: 15 and SEQ ID NO: 16 respectively.

[0262] In one embodiment, the nucleic acid inhibitor is an siRNA molecule comprising two nucleic acid strands with a nucleic acid sequence in SEQ ID NO: 17 and SEQ ID NO: 4; SEQ ID NO: 18 and SEQ ID NO: 6; SEQ ID NO: 19 and SEQ ID NO: 8; SEQ ID NO: 20 and SEQ ID NO: 10; SEQ ID NO: 21 and SEQ ID NO: 12; SEQ ID NO: 22 and SEQ ID NO: 14; or SEQ ID NO: 23 and SEQ ID NO: 16 respectively.

[0263] Table 1. Inhibitory RNA sequences.

[0264] The nucleic acid inhibitor of this disclosure may be obtained using techniques known to those of skill in the art. For example, the siRNA, shRNA or antisense nucleic acid may be chemically synthesised using appropriately protected ribonucleoside phosphoramidites and a conventional DNA / RNA synthesiser. siRNAs may be synthesised as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions.

[0265] The nucleic acid inhibitor of this disclosure may also be expressed from a vector, such as a recombinant plasmid or a viral vector. siRNA may be expressed as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions. Selection of vectors suitable for expressing siRNA, shRNA or antisense nucleic acid of the invention, methods for inserting nucleic acid sequences for expressing the nucleic acid inhibitor into the plasmid, and methods of delivering the recombinant plasmid to the cells of interest are within those of skill in the art.

[0266] The nucleic acid inhibitor of this disclosure may be a polynucleotide sequence cloned into a plasmid vector and expressed using any suitable promoter. Suitable promoters for expressing nucleic acid inhibitors of the invention from a plasmid include, but are not limited to, the Hl and U6 RNA pol III promoter sequences and viral promoters including the viral LTR, adenovirus, SV40, and CMV promoters. Additional promoters known to one skilled in the art may also be used, including tissue-specific, inducible or controllable promoters for expression of the siRNA in a particular tissue or in a particular intracellular environment. The vector may also include additional regulatory or structural elements, including, but not limited to introns, enhancers, and polyadenylation sequences. These elements may be included in the DNA as desired to obtain optimal performance of the nucleic acid inhibitor in the cell and may or may not be necessary for the function of the DNA. Optionally, a selectable marker gene or a reporter gene may be included either with the polynucleotide encoding the nucleic acid inhibitor or as a separate plasmid for delivery to the target cells. Additional elements known to one skilled in the art may also be included.

[0267] The nucleic acid inhibitor may also be expressed from a polynucleotide sequence cloned into a viral vector that may include the elements described above. Suitable viral vectors for gene delivery to a cell include, but are not limited to, replication-deficient viruses that are capable of directing synthesis of all virion proteins, but arc incapable of making infections particles. Exemplary viruses include, but are not limited to lend viruses, adenoviruses, adeno- associatcd viruses, retroviruses, and alphaviruscs.

[0268] The recombinant DNA can be readily introduced into the host cells, e.g., mammalian, bacterial, yeast or insect cells by transfection with an expression vector composed of DNA encoding the nucleic acid inhibitor by any procedure useful for the introduction into a particular cell, e.g., physical or biological methods, to yield a cell having the recombinant DNA stably integrated into its genome or existing as a episomal element, so that the DNA molecules, or sequences of the present invention are expressed by the host cell. Preferably, the DNA is introduced into host cells via a vector. The host cell is preferably of eukaryotic origin, e.g., plant, mammalian, insect, yeast or fungal sources, but host cells of non- eukaryotic origin may also be employed. Physical methods to introduce a preselected DNA or RNA duplex into a host cell include, but are not limited to, calcium phosphate precipitation, lipofection, DEAE-dextran, particle bombardment, microinjection, electroporation, immunoliposomes, lipids, cationic lipids, phospholipids, or liposomes and the like. One skilled in the art will understand that any method may be used to deliver the DNA or RNA duplex into the cell. Biological methods to introduce the nucleotide of interest into a host cell include the use of DNA and RNA viral vectors. Delivery of the recombinant nucleotides to the host cell may be confirmed by a variety of assays known to one of skill in the art. Assays include Southern and Northern blotting, RT-PCR, PCR, ELISA, and Western blotting, by way of example. Carriers and

[0269] This disclosure also provides pharmaceutical compositions comprising the nucleic acid inhibitor as defined herein and a pharmaceutically acceptable carrier. In some embodiments, the nucleic acid inhibitor is provided in the pharmaceutically acceptable carrier.

[0270] Nucleic acid inhibitors herein may be provided in a pharmaceutically acceptable carrier for storage and / or delivery. Non-limiting examples of pharmaceutically acceptable carriers include viral vectors, polymer-based carriers, protein-based carriers, lipid-based carriers and extracellular vesicles. The pharmaceutically acceptable carrier may be a polymer-based carrier system such as a cationic polymer-nucleic acid complex (i.e., polyplex). The carrier can be a cyclodcxtrin-bascd carrier system such as a cyclodcxtrin polymer-nucleic acid complex. The carrier may be a protein-based carrier system such as a cationic peptidenucleic acid complex. The carrier may be a lipid-based carrier system, including but not limited to micelles, liposomes, cationic lipid-nucleic acid complexes (i.e., lipoplexes), lipid nanoparticles (LNPs), virosomes and extracellular vesicles such as exosomes. The carrier may be a viral vector.

[0271] In some embodiments, the pharmaceutically acceptable carrier is a lipid nanoparticle (LNP), a polymeric nanoparticle, an extracellular vesicle or a viral vector.

[0272] In one embodiment, the nucleic acid inhibitor is provided in a lipid nanoparticle (LNP). As used herein, the term “lipid nanoparticle” refers to a nanoparticle made from lipids (e.g., a cationic or ionisable lipid, a non-cationic lipid, a conjugated lipid and cholesterol), wherein the nucleic acid is fully encapsulated within the lipid. LNPs may contain multiple lipid layers as well as microdomains of lipids and nucleic acids and may thus be distinguished from lipoplexes (in which the nucleic acid is not encapsulated), micelles (which only contain a lipid monolayer) and liposomes (which only contain a lipid bilayer).

[0273] The inventors have found that LNP formulations can enhance the stability of SPTLC2 nucleic acid inhibitors (e.g., siRNA, shRNA or antisense molecules) and facilitate targeted delivery to and release of SPTLC2 nucleic acid inhibitors from a tissue or organ, following intravenous administration. LNPs may be particularly advantageous for delivery of SPTLC2 nucleic acid inhibitors (e.g., SPTLC2 siRNA, shRNA or antisense molecules) to the liver or into hepatocytes to treat metabolic liver diseases like NAFLD and NASH. Furthermore, LNPs may provide a simple and reproducible method of formulating SPTLC2 nucleic acid inhibitors (e.g., SPTLC2 siRNA, shRNA or antisense molecules) for administration to a subject.

[0274] LNPs may contain one or more lipid conjugates. The term “lipid conjugate” refers to a conjugated lipid that inhibits aggregation of lipid particles. Such lipid conjugates include, but are not limited to, polyamide oligomers (e.g., ATTA-lipid conjugates), PEG-lipid conjugates (such as PEG coupled to dialkyloxypropyls, PEG coupled to diacylglycerols, PEG coupled to cholesterol, PEG coupled to phosphatidylethanolamines), PEG conjugated to ceramides, cationic PEG lipids, and mixtures thereof. PEG can be conjugated directly to the lipid or may be linked to the lipid via a linker moiety. Any linker moiety suitable for coupling the PEG to a lipid can be used including, e.g., non-ester containing linker moieties and cstcr-containing linker moieties. In preferred embodiments, non-ester containing linker moieties are used.

[0275] LNPs may contain one or more non-cationic lipid, which may be amphipathic or neutral lipids. The term “amphipathic lipid” refers, in part, to any suitable material wherein the hydrophobic portion of the lipid material orients into a hydrophobic phase, while the hydrophilic portion orients toward the aqueous phase. Hydrophilic characteristics derive from the presence of polar or charged groups such as carbohydrates, phosphate, carboxylic, sulfato, amino, sulfhydryl, nitro, hydroxyl, and other like groups. Hydrophobicity can be conferred by the inclusion of apolar groups that include, but are not limited to, long-chain saturated and unsaturated aliphatic hydrocarbon groups and such groups substituted by one or more aromatic, cycloaliphatic, or heterocyclic group(s). Examples of amphipathic compounds include, but are not limited to, phospholipids, aminolipids, and sphingolipids.

[0276] Representative examples of phospholipids include, but are not limited to, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylcthanolaminc, dipalmitoylphosphatidylcholinc, dioleoylphosphatidylcholine, distearoylphosphatidylcholine, and dilinoleoylphosphatidylcholine. Other compounds lacking in phosphorus, such as sphingolipid, glycosphingolipid families, diacylglycerols, and P-acyloxyacids, are also within the group designated as amphipathic lipids. Additionally, the amphipathic lipids described above can be mixed with other lipids including triglycerides and sterols.

[0277] The term “neutral lipid” refers to any of a number of lipid species that exist either in an uncharged or neutral zwitterionic form at a selected pH. At physiological pH, such lipids include, for example, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin, cholesterol, cerebrosides, and diacylglycerols.

[0278] The term “non-cationic lipid” refers to any amphipathic lipid as well as any other neutral lipid or anionic lipid.

[0279] The term “anionic lipid” refers to any lipid that is negatively charged at physiological pH. These lipids include, but are not limited to, phosphatidylglycerols, cardiolipins, diacylphosphatidy Iscrincs, diacylphosphatidic acids, N-dodccanoyl phosphatidylethanolamines, N-succinyl phosphatidylethanolamines, N- glutarylphosphatidylethanolamines, lysylphosphatidylglycerols, palmitoyloleyolphosphatidylglycerol (POPG), and other anionic modifying groups joined to neutral lipids.

[0280] LNPs may contain one or more cationic lipids. The term “cationic lipid” refers to any of a number of lipid species that carry a net positive charge at a selected pH, such as physiological pH (e.g., pH of about 7.0). It has been surprisingly found that cationic lipids comprising alkyl chains with multiple sites of unsaturation, e.g., at least two or three sites of unsaturation, are particularly useful for forming lipid particles with increased membrane fluidity. Non-limiting examples of cationic lipids include N,N-dioleyl-N,N- dimethyl ammonium chloride (DODAC), 1 ,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), l,2-distcaryloxy-N,N-dimcthylaminopropanc (DSDMA), N-(l-(2,3- dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-distearyl-N,N- dimethylammonium bromide (DDAB), N-(l-(2,3-dioleoyloxy)propyl)-N,N,N- trimethylammonium chloride (DOTAP), 3-(N-(N’,N’-dimethylaminoethane)- carbamoyljcholcstcrol (DC -Choi), N-(l,2-dimyristyloxyprop-3-yl)-N,N-dimcthyl-N- hydroxyethyl ammonium bromide (DMIRIE), 2,3-dioleyloxy-N-[2(spermine- carboxamido)ethyl]-N,N-dimethyl-l-propanaminiumtrifluoroacetate (DOSPA), dioctadecylamidoglycyl spermine (DOGS), 3-dimethylamino-2-(cholest-5-en-3-beta- oxybutan-4-oxy)- 1 -(cis,cis-9, 12-octadccadicnoxy)propanc (CLinDMA), 2- 15 ’ -(cholcst-5- en-3.beta.-oxy)-3’oxapentoxy)-3-dimethy-l-(cis,cis-9’, l-2’-octadecadienoxy)propane (CpLinDMA), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-N,N’- dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP), 1 ,2-N,N’ -Dilinoleylcarbamyl-3- dimethylaminopropane (DLincarbDAP), l,2-Dilinoleoylcarbamyl-3- dimethylaminopropane (DLinCDAP), and mixtures thereof. In some cases, the cationic lipids comprise a protonatable tertiary amine (e.g., pH titratable) head group, C18 alkyl chains, ether linkages between the head group and alkyl chains, and 0 to 3 double bonds. Such lipids include, e.g., DSDMA, DLinDMA, DLenDMA, and DODMA.

[0281] The term “hydrophobic lipid” refers to compounds having apolar groups that include, but arc not limited to, long-chain saturated and unsaturated aliphatic hydrocarbon groups and such groups optionally substituted by one or more aromatic, cycloaliphatic, or heterocyclic group(s). Suitable examples include, but arc not limited to, diacylglyccrol, dialkylglyccrol, N-N-dialkylamino, l,2-diacyloxy-3-aminopropane, and l,2-dialkyl-3-aminopropane.

[0282] Disclosed herein is a lipid nanoparticle (LNP) composition comprising the nucleic acid inhibitor as defined herein and a pharmaceutically acceptable excipient.

[0283] The pharmaceutically acceptable excipient may be any organic or inorganic carrier substance suitable for administration which does not deleteriously react with the nucleic acid inhibitor. Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

[0284] In some embodiments, the LNP comprises a lipid composition of about 45% to about 55% molar proportion of a cationic lipid. The LNP may comprise a lipid composition of about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, or about 55% of a cationic lipid. In one embodiment, the LNP comprises a lipid composition of about 50% molar proportion of a cationic lipid. In one embodiment, the cationic lipid is (6Z,9Z,28Z,3 lZ)-heptatriaconta-6,9,28,31-tetraen-19-yl 4- (dimethylamino)butanoate (DLin-MC3-DMA). In some embodiments, the LNP comprises a lipid composition of about 35% to about 40% molar proportion of cholesterol or a cholesterol derivative. The LNP may comprise a lipid composition of about 35%, about 36%, about 37%, about 38%, about 39%, or about 40% molar proportion of a cholesterol or cholesterol derivative. In one embodiment, the LNP comprises a lipid composition of about 38.5% molar proportion of a cholesterol or cholesterol derivative. In one embodiment, the cholesterol or cholesterol derivative is cholesterol.

[0285] In some embodiments, the LNP comprises a lipid composition of about 5% to about 15% molar proportion of a non-cationic lipid, e.g., a phospholipid. The LNP may comprise a lipid composition of about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, or about 15% molar proportion of a non-cationic lipid. Tn one embodiment, the LNP comprises a lipid composition of about 10% molar proportion of a non-cationic lipid. In one embodiment, the non-cationic lipid is distearoylphosphatidylcholine (DSPC).

[0286] In some embodiments, the LNP comprises a lipid composition of about 1% to about 2% molar proportion of a conjugated lipid, e.g., a PEG -conjugated lipid. The LNP may comprise a lipid composition of about 1%, about 1.1%, about 1.2%, about 1.3%, about 1.4%, about 1.5%, about 1.6%, about 1.7%, about 1.8%, about 1.9%, or about 2% molar proportion of a conjugated lipid. In one embodiment, the LNP comprises a lipid composition of about 1.5% of a conjugated lipid. In one embodiment, the conjugated lipid is PEGylated myristoyl diglyceride (DMG-PEG).

[0287] In one embodiment, the LNP comprises a lipid composition of about 45% to about 55% molar proportion of a cationic lipid, about 35% to about 40% molar proportion of cholesterol or a cholesterol derivative, about 5% to about 15% molar proportion of a non-cationic lipid, and about 1 % to about 2% molar proportion of a conjugated lipid. Tn one embodiment, the LNP comprises a lipid composition of about 45% to about 55% molar proportion of (6Z,9Z,28Z, 1 Z)-heptatriaconta-6,9,28, 1 -tetraen-1 -yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), about 35% to about 40% molar proportion of cholesterol, about 5% to about 15% molar proportion of distearoylphosphatidylcholine (DSPC), and about 1% to about 2% molar proportion of PEGylated myristoyl diglyceride (DMG-PEG). In one embodiment, the nucleic acid inhibitor is provided in a polymeric nanoparticlc. The polymeric nanoparticle may comprise a polycationic polymer such as, for example, polyethyleneimine (PEI), poly (P-amino esters), poly(amidoamine) (PAMAM), cationic polyacrylates and cationic poly(amino acids).

[0288] In one embodiment, the nucleic acid inhibitor is provided in an extracellular vesicle. The extracellular vesicle may be an exosome.

[0289] In one embodiment, the nucleic acid inhibitor is provided in a viral vector. The viral vector is preferably an recombinant virus. Both replication-competent and replication-defective viruses may be used. Exemplary viruses include, but are not limited to retroviruses including Moloney murine leukemia virus (MMLV) and lentiviruscs, adenoviruses and adeno- associated viruses, and alphaviruses (e.g., Semliki Forest virus (SFV)). In some embodiments, the viral vector is an adenovirus, an adcno-associatcd virus (AAV) or a lentivirus.

[0290] Ceramide detection

[0291] In some embodiments, methods herein comprise detecting the ceramide level in a sample from the subject, and administering the nucleic acid inhibitor of SPTLC2 to the subject when there is an increase in ceramide level as compared to a reference.

[0292] Ceramide molecules consist of a sphingoid base (SB) and a fatty acid (FA) chain. The nomenclature of ceramides is typically presented as a first pair of numbers corresponding to the SB and a second pair of numbers corresponding to the FA. For example, in the Cer(dl8:l / 18:O) molecule, the first number pair (dl8:l) refers to the SB and the second number pair (18:0) refers to the FA. In SB and FA nomenclature, the first number of each pair refers to the number of carbon atoms in the SB or FA chain, while the second number refers to the number of carbon-carbon double bonds of the SB or FA chain. Thus, in Ccr(dl8:l / 18:O), the SB has 18 carbon atoms and one carbon-carbon double bond, while the FA has 18 carbon atoms and no carbon-carbon double bonds. FAs can be saturated or unsaturated depending on whether they have double bonds in their structure. For example, the FA 16:1 is an unsaturated FA with 16 carbon atoms and one carbon-carbon double bond, while the FA 18:0 is a saturated FA with 18 carbon atoms and no carbon-carbon double bonds.

[0293] In de novo ceramide synthesis, the first double bond to the SB is formed in carbon 4, forming SBs d!6:l and d 18: 1. The second double bond of the SB is most commonly located in carbon 14, forming SB dl8:2. The double bond in the FA chain may be in various positions depending on the length of the FA chain and the number of carbon-carbon double bonds. For example, in the 22: 1 FA, the most common double bond position is in carbon 13. In the 23: 1 FA, the most common double bond position is in carbon 14. In the 24:1 FA, the most common double bond position is in position 15. In the 24:2 and 26:2 FAs, the most common double bond positions are in carbons 5 and 9.

[0294] Detecting the ceramide level may comprise detecting the concentration of one or more ceramides in the sample. In some embodiments, the method comprises measuring the concentrations of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 ceramides in the sample. The ceramides to be detected can include but are not limited to dl8:0 / 16:0, dl8:0 / 20:0, dl8:0 / 22:0, dl8:0 / 24:0, dl8:0 / 24:l, dl8:l / 16:0, dl8:l / 18:O, dl8:l / 20:0, dl8:l / 21:0, dl8:l / 22:0, dl8:l / 23:0, dl8:l / 24:0, dl8:l / 24:l, dl8:l / 26:l, dl8:2 / 22:0, dl8:2 / 24:l. In some embodiments, the ceramides to be detected comprise dl8:0 / 16:0, dl8:0 / 20:0, dl8:0 / 24:l, dl8:l / 18:O, dl8:l / 24:0, dl8:l / 24:l, dl8:l / 26:l and dl8:2 / 24:l. In some embodiments, the ceramides to be detected comprise dl8:0 / 22:0, d!8:0 / 24:0, dl8: 1 / 18:0, dl8:l / 20:0, dl8: 1 / 21:0, dl8:l / 22:0, dl8: 1 / 23:0 and dl 8: 1 / 24:0.

[0295] The sample may be any biological sample taken from a subject. The sample may be a tissue sample from the liver, pancreas, stomach, gastrointestinal tract, lung, bladder, kidney, ovary, testis, skin, breast, prostate, brain, oesophagus, placenta, spleen, bone marrow, heart, pancreas, lymph node, and combinations thereof. The sample may also be isolated from a biological fluid from a subject, c.g., from a liquid biopsy. Non-limiting examples of biological fluids include intravascular fluid (e.g., blood, plasma, serum, lymph), urine, saliva, sputum, cerebrospinal fluid, pleural fluid, nipple aspirate, fluid of the respiratory, intestinal, and genitourinary tracts, synovial fluid, vaginal secretion, tear fluid, pus, breast milk, semen, fluid from ascites, cyst or tumour, amniotic fluid, or combinations thereof. The biological fluid is preferably extracted from a peripheral location in the subject. The sample may be a freshly harvested or an archived or stored sample. In some embodiments, the sample is a liver sample or a blood sample.

[0296] The sample may be pre-treated to isolate ceramides for analysis. The pre-treatment may include treatments to release or separate lipids or to remove excessive material or waste. Suitable pre-treatment techniques comprise centrifugation, extraction, fractioning, ultrafiltration, separation (e.g., by binding to paramagnetic beads and applying magnetic force), protein precipitation followed by filtration and purification and / or enrichment of compounds. Other pre-treatments steps may be required to provide the lipids in a form or concentration suitable for lipid analysis, e.g., derivatisation in preparation for mass spectrometry. Ceramides and other lipids may be extracted in an extraction step which comprises mixing of the sample with a suitable extraction solvent. The extraction solvent is generally able to solubilise the lipids in the sample while precipitating the proteins. The extraction solvent may be a non-phase separating solvent. Suitable solvents include but are not limited to dichloromcthanc (DCM), chloroform, tert-butyl methyl ether (tBME), ethyl ethanoate, iso-octane, methanol, ethanol, isopropanol, dimethyl sulfoxide (DMSO), and combinations thereof.

[0297] The reference may be the ceramide level from a sample (e.g., a liver or blood sample) from a subject of the same species without metabolic disease, or an average ceramide level in samples from a population of subjects of the same species (e.g., of varying ages, ethnic backgrounds and genders) without metabolic disease. Alternatively, the reference may be the ceramide level in a sample from the same subject before the onset or suspected onset of a metabolic disease, before the start of a treatment regimen (e.g., treatment with a nucleic acid inhibitor of SPTLC2), or at a different time-point during the course of a metabolic disease or during the course of treatment for the metabolic disease.

[0298] The terms “increased” and “increase” arc used herein to mean an increase by a statistically significant amount. In some embodiments, the terms “increased” and “increase” can mean an increase of at least 10% as compared to a reference, for example an increase of at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, at least about a 3-fold, at least about a 4-fold, at least about a 5 -fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level.

[0299] Ceramide levels may be determined by a lipid separation step followed by a mass spectrometry step. The lipid separation step yields a time-resolved separation of the lipids in the sample. Suitable lipid separation techniques include all chromatographic separation techniques such as liquid chromatography (LC), high performance liquid chromatography (HPLC), gas chromatography (GC), thin layer chromatography, and size exclusion or affinity chromatography. Moreover, determination via ion mobility chromatography, preferably in combination with electrospray / MS / MS is envisaged. These techniques are well known in the art. Preferably, the chromatography is reverse phase chromatography, e.g., reverse phase LC and / or HPLC.

[0300] Preferably, mass spectrometry is used for lipid analysis following chromatographic lipid separation, in particular gas chromatography mass spectrometry (GC-MS), liquid chromatography mass spectrometry (LC-MS), direct infusion mass spectrometry or Fourier transform ion-cyclotron-resonance mass spectrometry (FT-ICR-MS), capillary electrophoresis mass spectrometry (CE-MS), high-performance liquid chromatography coupled mass spectrometry (HPLC-MS), quadrupole mass spectrometry, any sequentially coupled mass spectrometry, such as MS-MS or MS-MS-MS, inductively coupled plasma mass spectrometry (ICP-MS), pyrolysis mass spectrometry (Py-MS), ion mobility mass spectrometry or time of flight mass spectrometry (TOF).

[0301] As an alternative or in addition to mass spectrometry techniques, the following techniques may be used for compound determination: nuclear magnetic resonance (NMR), magnetic resonance imaging (MRI), Fourier transform infrared analysis (FT-IR), ultraviolet (UV) spectroscopy, refraction index (RI), fluorescent detection, radiochemical detection, electrochemical detection, light scattering (LS), dispersive Raman spectroscopy or flame ionisation detection (FID). The ceramide may also be determined by its binding to a specific ligand, e.g., to an aptamer, an antibody or the like. These techniques are well known to the person skilled in the art.

[0302] Methods of treatment Disclosed herein is a nucleic acid inhibitor, vector, pharmaceutical composition or lipid nanoparticlc (LNP) composition as defined herein, for use as a medicament.

[0303] Disclosed herein is a method of treating a metabolic disease in a subject, the method comprising administering to the subject an effective amount of a nucleic acid inhibitor of serine palmitoyltransferase long chain base subunit 2 (SPTLC2).

[0304] Disclosed herein is a nucleic acid inhibitor of SPTLC2, for use in treating a subject with a metabolic disease.

[0305] Also disclosed herein is the use of a nucleic acid inhibitor of SPTLC2 in the manufacture of a medicament for treating a subject with a metabolic disease.

[0306] The nucleic acid inhibitor is as defined herein. The metabolic disease may be characterised by increased lipid deposition, inflammation and / or ceramide synthesis. The metabolic disease may be fatty liver disease, such as NAFLD or NASH.

[0307] Dosage regimens may be adjusted to provide the optimum desired response (e.g., a therapeutic response). For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. An inhibitor or composition of the present disclosure can be administered on multiple occasions. Intervals between single dosages can be daily, weekly, monthly or yearly. Intervals can also be irregular as indicated by clinical assessment in the subject. Alternatively, the inhibitor or composition can be administered as a sustained release formulation, in which case less frequent administration is required. Dosage and frequency vary depending on the half-life of the inhibitor or active agent in the subject.

[0308] It is to be noted that dosage values may vary with the type and severity of the disease or condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens may be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the inhibitor or composition, and that dosage ranges set forth herein are exemplary only and are not intended to limit the scope or practice of the claimed composition. 31

[0309] Disclosed herein is a method of inhibiting ceramide synthesis and / or deposition in a cell, the method comprising contacting the cell with an effective amount of a nucleic acid inhibitor of SPTLC2.

[0310] The method may inhibit de novo ceramide synthesis in the cell by inhibiting gene expression of SPTLC2. Inhibition of ceramide synthesis or deposition may be determined using any method known in the art. For example, lipidomics or mass spectrometry may be used to measure the levels of various lipids (intermediates or end products) in the de novo ceramide synthesis pathway. Alternatively, ceramides may be stained with colorimetric or fluorescent dyes for visualisation on microscopy.

[0311] The term “inhibit” is used consistently with its use in the art, i.c., meaning to cause or facilitate a qualitative or quantitative decrease in ceramide synthesis in the cell. The inhibition may be a decrease in ceramide synthesis of at least 5% as compared to a reference level (e.g., the level of ceramide synthesis in a cell not treated with the nucleic acid inhibitor). The decrease may be, for example, a decrease of at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or up to and including a 100% decrease or any decrease between 5—100% as compared to a reference level.

[0312] As used herein, the term “contacting” is not intended to include the in vivo exposure of cells to a nucleic acid inhibitor disclosed herein that may occur naturally in a subject (i.c., exposure that may occur as a result of a natural physiological process). The step of contacting a cell with a nucleic acid inhibitor as disclosed herein can be conducted in any suitable manner. For example, a cell may be treated in adherent culture, or in suspension culture. It is understood that a cell can be contacted with a nucleic acid inhibitor herein and can also be simultaneously or subsequently contacted with another agent, such as another inhibitor of ceramide synthesis or another drug. As used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (or).

[0313] As used in this application, the singular form “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “an agent” includes a plurality of agents, including mixtures thereof.

[0314] Throughout this specification and the claims which follow, unless the context requires otherwise, the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[0315] Throughout this specification and the claims which follow, unless the context requires otherwise, the phrase "consisting essentially of", and variations such as "consists essentially of will be understood to indicate that the recited element(s) is / are essential i.e. necessary elements of the invention. The phrase allows for the presence of other non-recited elements which do not materially affect the characteristics of the invention but excludes additional unspecified elements which would affect the basic and novel characteristics of the method defined.

[0316] The reference in this specification to any prior publication (or information derived from it), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

[0317] Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described, ft is to be understood that the invention includes all such variations and modifications, which fall within the spirit and scope. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features. Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0318] Certain embodiments of the invention will now be described with reference to the following examples which are intended for the purpose of illustration only and are not intended to limit the scope of the generality hereinbefore described.

[0319] EXAMPLES

[0320] General methods

[0321] Cell culture

[0322] Hepa 1-6 cell line (ATCC® CRL-1830™) and Hep G2 cell line (ATCC® HB-8065™) were used for in vitro experiments. Hepa 1-6 is a murine hepatoma derived from the BW7756 hepatoma tumor that arose spontaneously in C57L / J mice. Hep G2 is a cell line exhibiting epithelial-like morphology that was isolated from a hepatocellular carcinoma of a 15-year- old, White, male youth with liver cancer. Hepal-6 and Hep G2 were cultured in a culture medium (90% DMEM + 10% FBS + 1% Penicillin-Streptomycin).

[0323] Hepa 1-6 cells were grown to approximately 70% confluence in 96-well plates and were incubated with different concentrations (0.1, 0.5, andl.O mM) of OA (Sodium oleate; Sigma)-bovine serum albumin (BSA) for 24 h to induce steatosis.',

[0324] Clinical cohort

[0325] 117 patients and 24 healthy donors from Asia were included in this cohort under the Ensemble of Multi-disciplinary Systems and Integrated Omics for NAFLD (EMULSION) program. This cohort was approved by the Singapore National Healthcare Group Domain Specific Review Board. Patients were grouped into Control, NALFD, and NASH groups based on NAFLD Activity Score (NAS) ranked by experienced clinicians and pathologists (Control:!): NAFLD: 1-2 and NASH>2). Plasma was subsequently obtained by centrifugation at 4000g for 10 minutes and stored at -80°C until further lipidomic analysis. Healthy liver and NASH F2 liver paraffin sections ( n=3) were obtained from the National University Hospital ( UH), Singapore. All samples were distinguished as healthy and NASH F2 stage by experienced clinicians and pathologists.

[0326] Human liver RNA-seq data was sourced from the European NAFLD Registry (NCT04442334). The discovery cohort consisted of 216 snap-frozen biopsy samples obtained from 206 patients diagnosed with NAFLD in France, Germany. Italy, or the United Kingdom. Additionally, it included 10 healthy obese control cases, selected from patients undergoing bariatric surgery in France, who exhibited no biochemical or histological signs of NAFLD. These selections were made based on their participation in the study and the availability of adequate high-quality RNA for liver biopsy sequencing.

[0327] We acquired hepatic single-nucleus RNA sequencing (snRNA-scq) data from the publicly available Gene Expression Omnibus dataset GSE189600. The raw fastq files of snRNA-seq were mapped to Homo sapiens genome assembly GRCh38 (hg38) using CcllRangcr (3.0.2). For the human snRNA-seq, the fastq files of targeted libraries were directly combined with the input libraries. Unique molecular identifiers (UMI) count matrices were imported into Seurat (3.2.0) to generate Seurat object to each experiment. snRNA-seq were sequenced on GPL24676 Illumina NextSeq6000. The analysis were based on R 4.3.1.

[0328] Animal models

[0329] Two NASH models were generated: the methionine and choline-deficient diet (MCD) model, and the choline deficiency with high-fat diet (CD-HFD) model. In brief, 8-week-old mice were fed with MCD diet (TD90262, Teklad Mills, Madison, WI) for 8 weeks to develop NASH; 4- week-old mice were fed with CD-HFD diet (Research Diets; D05010402) for 54 weeks to develop NASH.

[0330] C57 / BL6J wild-type (WT) male mice were purchased from InVivos (Singapore). All animal experiments involving animal handling were performed with prior approval and in accordance with the protocols (R19-1229) and guidelines of the National University of Singapore’s Institutional Animal Care and Use Committee (IACUC). All studies were approved by IACUC and conformed to the guidelines on the care and use of animals for scientific purposes (NACLAR, Singapore, 2004) and the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIIH Publication, 8th Edition, 2011)

[0331] RNA & cholesterol concentration detection

[0332] The total RNA concentration was determined using the Quant-It™ Ribogreen RNA Assay kit in the presence of 0.5% (v / v) Triton X-100 (RNAtx-100) whereas free / unencapsulated siRNA (RNAPBS) was determined in TE (Tris-EDTA buffer) or PBS. The encapsulation efficiency was then calculated using the following formula ((RNAtx-100- RNAPBS) / RNAtx-100) x 100.

[0333] The cholesterol concentration was determined using LabAssay Cholesterol (DAKO, JP). Sample concentration was determined using a reference calibration curve.

[0334] Haematoxylin and Eosin (H&E) staining

[0335] Tissue sections were stained for 5 min in Mayer’s haematoxylin, followed by 5 min in running tap water, 1 min in 0.5% eosin and 10 dips in distilled water. All tissues were covered with a cover glass using VectaMount® AQ (Vector Laboratories Inc., Burlingame, USA) as mounting medium.

[0336] Oil Red O staining

[0337] Tissue sections were washed twice in PBS and once in milliQ water before incubation in 0.3% Oil Red O (Sigma Aldrich, Missouri, USA) working solution for one hour. The slides were drained and washed in 60% isopropanol until no background of Oil Red O was present anymore, followed by two washes in milliQ water before counterstaining of the nucleus with Mayer’s haematoxylin for 1 min. After the final washes in running tap water for 5 min, tissue sections were mounted with a cover glass using VectaMount® AQ.

[0338] Masson’s Trichrome Staining

[0339] Paraffin-embedded tissue sections were deparaffinized in xylene and rehydrated through a graded alcohol series (100%, 95%, and 70% ethanol). Slides were rinsed in distilled water and then incubated in Bouin’s solution at 56°C for 1 hour. After rinsing in running tap water to remove excess picric acid, the slides were stained in Weigert’s iron hematoxylin solution for 10 minutes. Excess stain was washed off under running tap water, followed by a brief dip in acid alcohol to differentiate the nuclei. Slides were then stained in Masson's trichrome solution for 15 minutes. After staining, slides were rinsed in distilled water and differentiated in 1 % acetic acid solution. They were then dehydrated through graded alcohol and cleared in xylene before mounting with a cover glass using VectaMount® AQ.

[0340] Immunohistochemistry staining

[0341] Antigens were retrieved by boiling paraffin-embedded tissue sections in sodium citrate buffer (pH 6.0). Tissue sections were incubated in 3% hydrogen peroxide solution (Sigma- Aldrich, 516813) to block endogenous peroxidase activity and then in 3% bovine scrum albumin (BSA) for 30 min at room temperature to block nonspecific binding. Tissue was stained with primary antibodies (SPTLC2 antibody, PA5-31130, 1:500) overnight at 4°C followed by horseradish peroxidase-conjugated secondary antibodies (Goat anti rabbit-IgG H&L-HRP conjugated, A24549, 1 :500). Afterward, tissue sections were incubated with 3,3'- diaminobenzidine (Sigma-Aldrich, D12384) and hematoxylin and then were mounted with a cover glass using VectaMount® AQ.

[0342] Serum ALT, AST test

[0343] Blood was collected from mice to obtain serum for analysis. Liver enzymes, alanine and aspartate aminotransferases (ALT and AST) were determined colorimetrically follow the kit protocol (Abeam, abl05134, abl05135). qRT-PCR

[0344] Total mRNA was extracted from cells or liver tissues by using RNeasy Mini Kit (QIAGEN). The concentrations were measured using NanoDrop 2000 spectrophotometer (ThermoFisher, Delaware, USA). RNA was reverse transcribed to cDNA templates using QuantiTect- Rcvcrsc- Transcription Kit (QIAGEN Mainz, Germany). qPCR was performed in triplicates using iTaq Universal SYBR Green Supermix (Bio-Rad) in a real-time thermal cycler, QuantStudio 7 (ThermoFisher, California, USA). Target genes include SPTLC2, SPTLC3, Degsl, Degs2, Cers2, Cers6, TNF-a and IL-ip, CCL2, Collal, Col3al, TIMP-1 and TGF- P- GADPH was used as the housekeeping gene and mRNA expression icvcis were normalized to control.

[0345] Western blot

[0346] To quantify the protein content, proteins were extracted from liver tissue with RIPA buffer containing protease and phosphatase inhibitors (ThermoFisher, Illinois, USA). 15 pg of proteins reduced by 1 ,4-dithiothreitol were separated by SDS-PAGE gel. Proteins were blotted on a PVDF membrane using an iBlot 2 Gel Transfer Device (Invitrogen, California, US). The membrane was blocked for 1 hour using a blocking buffer consisting of 5% Blotting Grade Blocker (Bio-rad) in TBS-Tween (0.1% v / v Tween 20). Primary antibodies including SPTLC2 (PA5-31130), SREBP-lc (ab28481), CD36 (ab64014). Primary incubation with antibodies was performed overnight at 4 degrees in blocking buffer. Only Rb anti-GAPDH was incubated for 1 hour at RT. After primary incubation, the blot was washed 3 times with TBS-Tween. Secondary antibody was incubated for 1 hour at RT in blocking buffer. Before imaging, blot was washed 4 times using TBS-Tween. The blot was imaged using Bio-Rad ChemDoc Touch. To this end, membranes were incubated with Immobilon Western Chemiluminscent HRP Primary and then imaged. Exposure time was optimized per antibody and it was made sure that the loaded amount of protein was in the linear range.

[0347] Data analysis

[0348] All statistical analyses for LC-MS / MS were performed in R 4.0.2. Pearson’s correlation coefficients were calculated between all pairs of lipid species. Statistical significance was calculated using ANOVA with Tukey post-hoc analysis. To account for the false discovery rate, p-valucs were corrected for multiple comparisons using the Bcnjamini and Hochberg procedure.

[0349] All results were presented as means ± SEM unless stated otherwise. Kruskal-Wallis test with multiple comparisons was performed to determine the difference in cardiac troponin I concentrations at different time points. Spearman's rank correlation coefficient was calculated to test the correlation between groups. P-values < 0.05 were considered as statistical significance.

[0350] Example 1: Lipidomic profiling identifies elevated liver ceramides in NASH with associated upregulation of ceramide de novo synthesis

[0351] High-throughput lipidomics is a widely used method to investigate metabolic phenotypes in specific conditions. Here, liver ceramide levels in a cohort of NAFLD / NASH patients were screened.

[0352] Approximately 10 mg of frozen liver tissue samples were homogenized with 5 mm stainless steel beads (QIAGEN, Hilden, Germany) in 100 pL of PBS on ice using TissueLyser LT (QIAGEN) with 2 min of 25 oscillation / s for three times. The protein concentrations were determined by Pierce Detergent Compatible Bradford Assay (Thermo Fisher Scientific) following the manufacture’s instruction. All samples were kept at -80°C until further usage.

[0353] 10 pL tissue homogenate or 10 pL of plasma were mixed with 100 pL butanol / methanol (1: 1, v:v; Merck Millipore, Massachusetts, USA) spiked with the following internal standards: 400 nM PE 17:0 / 17:0, 2.4 nM Cer dl8:l / 8:0, 200 nM PC 13:0 / 13:0, 1.7 nM HexCer dl8: 1 / 8:0, 400 nM LPC 13:0, 400 nM LPE 14:0, 400 nM PS 17:0 / 17:0, 3.6 nM SM dl8: 1 / 6:0, 0.8 nM SPH dl8: 1 d7 and 0.8 nM SPH dl8:0 d7 from Avanti Polar Lipids; 400 nMTG 12:0 / 12:0 / 12:0 from Sigma Aldrich. The samples were sonicated for 30 min followed by centrifugation at 14,000 g for 10 min at 22°C. The supernatant was used for analysis. The samples were analyzed using an Agilent 1290 series UHPLC system connected to an Agilent 6495 QQQ mass spectrometer after separation on aZORBAX Eclipse plus Cl 8 column (2.1 x 50 mm. 1.8 pm, 95 A, Agilent) at 40 °C. The injection volume was 2 pL. Solvent A consisted of 60% water / 40% acetonitrile (v / v) with 10 mM ammonium formate; solvent B consisted of 90% isopropanol / 10% acetonitrile (v / v) with 10 mM ammonium formate. The gradient started with a flow rate of 0.4 mL / min at 20% B and increased to 60% B at 2 min, 100% B at 7 min, held at 100% B until 9 min, followed by equilibration with 20% B from 9.01 min until 10.8 min. The column effluent was introduced to the mass spectrometer via an AJS-ES1 ion source operating under the following conditions: gas temperature, 200 °C; gas flow, 14 L / min; nebulizer, 20 psi; sheath gas temperature, 250 °C; sheath gas flow, 11 L / min; capillary, 3500 V. Mass spectrometry analysis was performed in positive ion mode with dynamic multiple reaction monitoring (dMRM). Mass spectrometry settings, LC-MS gradient, and MRM transitions for each lipid class were adapted from a published method (Sieber-Ruckstuhl, N. S. et al., Sei Rep 9, 6015 (2019)). Relative quantification of lipids was based on one-point calibration with class-specific internal standards and was further normalized to the total protein content within each sample.

[0354] Pooled quality control (QC) samples were prepared and analyzed every 10 samples. The average signal-to-noise (S / N) ratio and the coefficient of variation (CV) of each individual lipid in the QC samples were then calculated. Lipids with S / N ratio below 10 and CV higher than 30% were excluded. A dilution series of QC samples were prepared and measured at the start and end of the experiment, respectively. The Pearson correlation test was used to assess the linearity of the dilution curves. Lipid peaks with R2 lower than 0.8 were excluded.

[0355] Ceramide levels and hepatic ceramide de novo synthesis correlate with NASH severity in patients

[0356] Plasma ceramide levels were markedly higher in NAFLD / NASH patients compared to healthy subjects (Fig. 1A-B). Notably, NASH patients exhibited higher plasma ceramide levels than those with NAFLD, indicating an escalation of ceramide levels during the progression of NAFLD.

[0357] There are three synthesis pathways of ceramides, including de novo synthesis pathway, sphingomyelin hydrolysis pathway and salvage pathway (Figure 1C).

[0358] The gene expression levels for genes associated with ceramide synthesis was analysed from liver samples of human subjects at different stages of NASH. In this cohort, human samples were divided into different groups based on the clinical SAF score (steatosis, activity, and fibrosis). Compared to healthy subjects, patients with NAFLD or various stages of NASH showed markedly higher hepatic expression levels of ceramide de novo synthesis pathway- associated genes, including SPTLC2, a subunit of the rate-limiting enzyme, SPT (Fig. 1D- F). The liver is composed of both hepatocytes and nonparenchymal cells (NPCs). To identify the primary cell types responsible for the elevation of SPTLC2 in the liver during the progression of NASH, hepatic single-nucleus RNA sequencing (snRNA-seq) data obtained from healthy subjects and NASH patients available on the Gene Expression Omnibus (dataset GSE189600) was analyzed. The snRNA-seq findings revealed a striking upregulation of SPTLC2 in the hepatocytes and hepatic stellate cells (Fig. 1G). Given that hepatocytes comprise more than 70% of liver cellular composition, these data suggest that hepatocyte SPTLC2 expression progressively increases in NASH, which may explain the increase of ceramide in this pathology.

[0359] Ceramide de novo synthesis is activated in NASH models

[0360] To ascertain if the elevation of ceramide levels during NAFLD progression is recapitulated in animal models, a widely used NASH animal model was established by feeding C57BL / 6 mice with MCD diet to induce steatosis and abnormal liver function. Histological analysis is the golden standard for NASH diagnosis.

[0361] MCD diet-fed mice developed steatosis, inflammation, and mild to moderate fibrosis in the liver, accompanied by elevation of serum levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) (Fig. 2A-E), which indicated the establishment of NASH within 8 weeks. Similar to human patients, as shown in Fig. 2F, total hepatic ceramides increased while NAFLD was progressing from steatosis (4 weeks diet) to NASH (8 weeks diet). Lipidomic analysis showed that multiple lipids increased after NASH diet feeding compared with normal diet (Figure 2G). In particular, the levels of multiple ceramides, including Cer dl8:O / 16:O, dl8:0 / 20:0, dl8:0 / 24:l, dl8:l / 18:O, dl8:l / 24:0, dl8:l / 24:l, d!8: 1 / 26:1 and d!8:2 / 24:l increased significantly in the liver tissue of MCD mice. These results suggest that MCD diet-induced NASH model is suitable for investigating the role of ceramides in human NASH.

[0362] All three pathways were also investigated in the MCD NASH model, and it was found that the expression level of sphingomyelinase (SMase) and glucosylceramidase (GCase) did not change appreciably with NASH development (Figure 9A-B). In contrast, it was found that expression of SPTLC2, Degsl and Cers2, three genes associated with ceramide de novo synthesis pathway, significantly increased in the liver of NASH mice (Fig. 2H, Fig. 9C-D). Moreover, liver levels of SPTLC2 mRNA were two times higher in NASH mice on MCD diet at 4 weeks and three times higher at 8 weeks (Figure 2H). SPTLC2 mRNA levels showed the greatest increase compared to other ceramide de novo synthesis enzymes. As shown by Western biot, SPTLC2 protein level in the liver increased 3 times compared to control mice (Figure 21). These data indicated that ceramide de novo synthesis was activated in NASH mouse liver, and SPTLC2 had the most obvious increase.

[0363] To examine if ceramide de novo synthesis is universally activated in NASH animal models, hepatic expression of SPTLC2 was also evaluated in two other well-established NASH animal models, choline-deficient high-fat diet (CD-HFD) and streptozotocin treated high-fat diet stelic (STAM) mouse models. Similar to the MCD model, hepatic expression of SPTLC2 was elevated in NASH mice of both CD-HFD and STAM models (Fig. 2J-K).

[0364] In summary, data from human and animal models provide compelling evidence that the hepatic ceramide de novo synthesis pathway is activated and contributes to excessive production of ceramides in NASH. Moreover, SPTLC2, the subunit of the rate-limiting enzyme SPT, emerges as a promising therapeutic target for lowering ceramides and thereby alleviating NASH.

[0365] Example 2: LNP formulations for siRNA

[0366] Lipid nanoparticles (LNP) were used to deliver siRNA into cells in vitro and in vivo to investigate knockdown of target genes. The LNPs have the following lipid composition: DLin-MC3-DMA : Cholesterol : DSPC : DMG-PEG at a molar ratio of 0.5 : 0.385 : 0.1 : 0.015.

[0367] Lipid nanoparticles were prepared by microfluidic mixing using a T-connector (1 / 16 OD) with appropriate tubing (Fig. 3C), which ensured a controlled mixing environment and reproducible production of LNPs. The flow was provided by two PHD Ultra Syringe Pumps ( Harvard Apparatus, Texas, US). A lipid solution in 100% ethanol (containing DLin-MC3- DMA, cholesterol, DSPC, and DMG-PEG) was mixed with a siRNA solution in sodium acetate (20 mM, pH 4) at a flow rate of 12 mL / min (ratio 1:3, lipid mix: siRNA solution). After production, samples were dialyzed in PBS, sterile filtered (0.2 pM membrane), and concentrated using Amicon Ccntrifugational Spin filters (ThermoFisher, Catalog number87730) with a membrane cutoff of 10 kD. Nanoparticles were characterized for size and size distribution (polydisperse index, PDI) by dynamic light scattering (DLS) at an angle of 173° on a Zctasizcr Ultra (Malvern, Worcestershire, UK). Zeta potential was measured by electrophoretic light scattering (ELS) on a Zetasizer Ultra, using the same solutions as for DLS. Each sample was measured three times (DLS) and five times (ELS), and data were acquired with ZX explorer Software, version 7.10.

[0368] For identification in the DHB positive and norharmane negative data set, a MS tolerance of 0 amu + 3 ppm (0 amu + 5 ppm for norharmane positive mode) and MS / MS tolerance of 0.25 amu + 0 ppm were used. MS / MS identification with a minimum chain length of 12 and the sum-composition was retained with 50 matches, and peaks lower than 10% of the base peak were excluded. All lipid identifications were reported to the sum-composition level.

[0369] The encapsulation efficiency of siRNA into LNPs was determined to be 54+3%, indicating successful encapsulation (Fig. 3D). Moreover, the LNPs exhibited homogenous size distribution and neutral surface charge (Fig. 3D). Furthermore, the LNPs demonstrated stability at 4°C, as the size and polydispersity index (PDI) remained unchanged for 21 days (Fig. 3E-F).

[0370] Example 3: SPTLC2 knockdown using LNP-encapsulated siRNA reduces hepatocyte lipid accumulation

[0371] Targeting SPTLC2 could be a promising approach for treating NASH. To identify the most effective siRNA sequence for silencing SPTLC2, seven siRNA sequences were designed and introduced into Hepa 1-6 and Hep G2 cells using Lipofectamine RNAiMAX.

[0372] The sequences are:

[0373] SPT.S1:

[0374] 5’ rGrGrArArArCrCrUrGrGrArCrArArGrCrArUrGrArArGrAAC 3’ (SEQ ID NO: 17)

[0375] 5’ rGrUrUrCrUrUrCrArUrGrCrUrUrGrUrCrCrArGrGrUrUrUrCrCrArA 3’ (SEQ ID NO: 4)

[0376] SPT.S2:

[0377] 5’ rGrArCrCrArArAr-GrCrUrUrArArUrUrGrArArGrArGrArACT 3’ (SEQ ID NO: 21) 5’ rArGrUrUrCrUrCrUrUrCrArArUrUrArArGrCrUrUrUrGrGrUrCrArA 3’ (SEQ ID NO:

[0378] 12)

[0379] SPT.S3:

[0380] 5’ rUrArCrUrUrGrArGrArUrGrArCrUrUrArArGrArArGrCrATC 3’ (SEQ ID NO: 18) 5’ iGrArUrGrCrUrUrCrUrUrArArGrUiCrArUrCrUrCrArArGrUrArGrU 3’ (SEQ ID NO: 6)

[0381] SPT.S4:

[0382] 5’ rGrArUrArArGrArGrCrArGrUrArCrCrUrUrGrArUrCrUrUAT 3’ (SEQ ID NO: 19)

[0383] 5’ rArUrArArGrArUrCrArArGrGrUrArCrUrGrCrUrCrUrUrArUrCrUrG 3’ (SEQ ID NO: 8)

[0384] SPT.S5:

[0385] 5’ rGrGrArUrArArGrArArArUrCrCrUrUrArCrCrUrUrUrArAAA 3’ (SEQ ID NO: 20) 5’ rUrUrUrUrArArArGrGrUrArArGrGrArUrUrUrCrUrUrArUrCrCrArA 3’ (SEQ ID NO: 10)

[0386] SPT.S6:

[0387] 5’ rGrArGrCrArGrUrArCrCrUrUrGrArUrCrUrUrArUrGrCrUTT 3’ (SEQ ID NO: 22)

[0388] 5’ TArArArGrCrArUrArArGrArUrCrArArGrGrUrArCrUrGrCrUrCrUrU 3’ (SEQ ID NO: 14)

[0389] SPT.S7:

[0390] 5’ rGrCrUrUrUrGrGrArUrArArGrArArArUrCrCrUrUrArCrCTT 3’ (SEQ ID NO: 23) 5’ rArArGrGrUrArArGrGrArUrUrUrCrUrUrArUrCrCrArArAiGrCrArA 3’ (SEQ ID NO: 16)

[0391] The levels of SPTLC2 mRNA was quantified through qPCR analysis (Fig. 3A-B). The SPT.S1 design was shown to exhibit the highest gene silencing efficacy among the seven sequences in both murine Hepa 1 -6 and human Hep G2 cells.

[0392] Given that Lipofectamine RNAiMAX is unsuitable for in vivo applications, a lipid nanoparticle (LNP) delivery system was also developed for siRNA transfection. Hepal-6 cells treated with siRNA-loaded LNPs showed dose-dependent silencing (Fig. 3G), although the maximal knockdown efficiency (78.0%) was slightly lower than that achieved with RNAiMAX. qPCR analysis of in vitro steatosis model in which Hepal-6 cells were treated with varying concentrations of oleic acid (OA) demonstrated that the expression level of SPTLC2 increased with increasing OA concentration (Fig. 3H). However, treatment with LNP- SPTLC2 siRNA resulted in smaller and fewer lipid droplets in Hepal-6 cells, indicating that reduction of SPTLC2 expression led to decreased cellular lipid accumulation in vitro (Fig. 31). siRNA-LNPs mediate efficient SPTLC2 knockdown in vivo

[0393] To test whether the LNPs could target the liver and deliver siRNA into hepatocytes in vivo, Cy5-labcllcd siRNA was encapsulated into LNPs and injected into the tail vein of mice. Biodistribution was determined through IVIS imaging and flow cytometry. As shown in Figure 4, most of LNPs accumulated in the liver while much less accumulated in other organs like the heart, spleen, kidney and lung one hour after injection (Figure 4A-B). Flow cytometry data showed that around 77% of hepatocytes in NASH liver were transfected one hour after injection of LNPs, which was much higher than other cell types in the liver (Figure 4C-D). These results indicated that LNPs were able to deliver siRNA to hepatocytes effectively.

[0394] To ascertain the duration of siRNA-mediated gene silencing in the liver, a time-response experiment was conducted in NASH mice. LNP-siRNA was injected into NASH mice (4 weeks on MCD diet), and organs were harvested at Day 2, 7 and 14 post-injection. Compared with NASH mice injected with LNP-Scrambled siRNA, those injected with a single dose of LNP-SPTLC2 siRNA showed maximal SPTLC2 knockdown at Day 2. SPTLC2 rnRNA levels started to increase from Day 7 and was fully recovered 14 days after injection (Fig. 4E). In terms of SPTLC2 protein levels, Western blotting analysis corroborated a modest decrease (20%) at 2 days and a maximal reduction (50%) at 7 days post-injection (Fig. 4F- G). The protein level was recovered to 80% at 14 days post-injection. To determine the administration frequency required for efficient SPTLC2 gene silencing, LNPs were injected into two groups of mice, at a single dose per week (Day 0, 7, etc.) and 2 doses per week (Day 0, 3, 7, 10, etc.). The results showed that 2 days after a single dose of LNP-siRNA, SPTLC2 mRNA levels decreased significantly, reaching 30% compared to the control (LNP-scrambled RNA), but recovered to 70% 7 days after injection. In contrast, injecting LNP-SPTLC2 siRNA twice a week constantly lowering SPTLC2 mRNA level in mouse liver (Figure 4H).

[0395] LNP-SPTLC2 siRNA treatment reduces liver ceramide levels, steatosis, inflammation and fibrosis in NASH mouse

[0396] To test the treatment efficacy of SPTLC2 LNP-siRNA in NASH, a single dose of LNP- siRNA was administered weekly to NASH mice over 4 weeks (Figure 5A). SPTLC2 gene expression was reduced by 36% at 7 days after the final administration (Fig. 10A). Based on the lipidomics result, it was confirmed that ceramide and sphingomyelin levels can be reduced by using LNP-STPLC2 siRNA to block ceramide de novo synthesis (Figure 5B-C, 10B-C).

[0397] At the end point, liver tissue and plasma were collected for therapeutic evaluation. Compared with NASH mice injected with scrambled LNP-siRNA, the liver sections from mice injected LNP-SPTLC2 siRNA had fewer lipid droplets, immune infiltration and fibrosis (Figure 5D- E). Knockdown of SPTLC2 also reduced the expression levels of inflammation markers, including IL-ip, TNF-a and Ccl2 (Figure 5F). Moreover, reduction of serum IL- 13, TNF-a level in treated group also indicated that inflammation was alleviated (Figure 5G). In addition to the Masson's trichrome staining, amelioration of fibrosis was also indicated by decreased expression of liver fibrogenic genes, including TGF- , Collal , Col3al and TIMP- 1 , in treated NASH mice (Fig. 5H). In addition, after LNP-SPTLC2 siRNA treatment, mice showed significantly lower levels of AST and ALT, two important biomarkers of liver injury, indicating that liver injury was alleviated by knocking down SPTLC2 gene in NASH (Figure 51). In summary, knockdown of SPTLC2 reduces liver steatosis, inflammation and fibrosis in NASH.

[0398] The effects of sustained SPTLC2 silencing in MCD mice was evaluated by intravenous administration of two doses of LNP-SPTLC2 weekly for 4 weeks (Fig. 6A). This dosing regimen resulted in a sustained silencing of hepatic SPTLC2 by 60% and a more pronounced reduction in liver sphingomyelins and ceramides compared to the oncc-a-wcck regimen (Fig. 6B-C and Fig. 11 A-D). Lipid deposition and fibrosis in the liver were reduced (Fig. 6D-E), and gene expression of the cytokines II- 113, Tnf-a and Ccl2 were decreased to a greater extent compared to the once-a-week regimen, indicating further alleviation of liver inflammation with sustained silencing of SPTLC2 (Fig. 6F). Similarly, the expression of liver fibrogenic genes, including TGF-p, Collal, Col3al and TIMP-1. was also reduced (Fig. 6F), and a greater reduction in serum AST and ALT levels was achieved (Fig. 6G).

[0399] To assess the therapeutic efficacy of LNP-SPTLC2 siRNA by non-invasive diagnosis, we employed the MPO-responsive USIO-DA-PEG-5HT nanoprobes developed for MR imaging, which serves as an indicator of inflammation in NASH (Fig. 6H). The nanoprobes aggregated at the sites of inflammation in the NASH liver, triggered by myeloperoxidase (MPO) activity. This gave rise to a reduction in the natural T1 signal of dispersed nanoprobes (Rl), and an increase in the T2 signal of aggregated nanoprobes (R2) in NASH livers. The livers of mice with NASH showed a higher R2 / R1 ratio compared to the healthy livers of control mice. The R2 / R1 ratio of the LNP-SPTLC2 siRNA treatment group was significantly lower than the NASH group injected with LNP-scrambled siRNA. This result indicated a lower level of MPO in the SPTLC2-siRNA treatment group. To validate the results, we determined MPO activity in liver tissue lysate. Liver MPO activity in siRNA-treated mice was shown to be much lower than in NASH mice treated with scrambled RNA (Fig. 1 IE).

[0400] Validation of LNP-SPTLC2 siRNA treatment efficacy in chronically obese NASH model

[0401] Considering that NASH is often associated with obesity and diabetes while the MCD diet leads to loss of body weight, it was desired to investigate whether SPTLC2 siRNA treatment could be effective in a clinically relevant obese mouse model, the CD-HFD model induced by feeding mice a choline-deficient high fat diet for 1 year (Figure 7A). In this model, mice gained weight (Fig. 12A) and NASH is usually established within 26 weeks on the diet. Mice were fed a CD-HFD diet for 54 weeks to achieve severe NASH before initiating the treatment. The mice were then treated with 2 weekly doses of LNP-SPTLC2 siRNA for a total of 4 weeks (total of 8 doses) and euthanized 3 days after the last dose. Even 3 days after the last dose, the expression of SPTLC2 in the liver remained reduced by 30% (Fig. 12B). Similar to that in MCD diet induced NASH, hepatic SPTLC2 knockdown led to notable reduction in liver levels of sphingomyelins and ceramides (Figure 7B-C, 12C-D). Remarkably, liver steatosis was markedly reduced in treated mice, as evidenced by liver H&E staining and ORO staining (Figure 7D-E). Inflammation was also reduced in the treatment group, as indicated by lower levels of IL-ip, TNF-a and Ccl2 (Figure 7F). Lower serum levels of AST and ALT were also achieved upon treatment (Figure 7G). Thus, hepatic inhibition of ceramide de novo synthesis by LNP-SPTLC2 siRNA is also efficacious in the treatment of obese NASH induced by CD-HFD diet.

[0402] Lowering ceramides ameliorates liver steatosis by inhibiting hepatic lipids uptake and lipogenesis

[0403] Hepatocytes employ various receptors and transporters to facilitate the uptake of fatty acids, such as fatty acid transporter proteins 2 and 5 (FATP2 and FATP5) and the fatty acid translocase CD36. Dysrcgulatcd de novo lipogenesis, a process of producing new fatty acids within the liver, also contributes to liver steatosis. De novo lipogenesis is reported to increase by 3-5 times in patients with NAFLD. The sterol regulatory element-binding protein-lc (SREBP-lc), a master regulator of triglyceride and cholesterol synthesis, is known to be upregulated in the liver of both NAFLD animal models and NAFLD patients. Interestingly, ceramides have been shown to induce the expression and activation of SREBP-lc. In our study, we demonstrated the mechanism of reducing steatosis in NASH liver by lowering the ceramide level (Fig. 8A).

[0404] It was shown that lowering ceramides by LNP-SPTLC2 siRNA resulted in the downregulation of CD36, FATP2, and FATP5 both in vitro and in vivo (Fig. 8B-C and E). These results suggest that lowering hepatic ceramides inhibits fatty acid uptake. Additionally, the crucial transcription factor SREBP-1 c, responsible for regulating the expression of genes involved in lipogenesis and glycolysis, was reduced upon SPTLC2 knockdown (Fig. 8D-E). Accordingly, expression of downstream genes regulated by SREBP-l c, such as Accl and Fas, also decreased after treatment (Fig. 8D). As a result, the levels of triglycerides, the main products of de novo lipogenesis, were lower in treated mice (Fig. 8F-G). These findings support the hypothesis that lowering liver ceramide levels suppresses de novo lipogenesis by downregulating SREBP-lc and its target genes. In conclusion, this treatment effectively inhibits hepatic lipid uptake and lipogenesis, thereby preventing steatosis (Fig. 8H). Example 4: Discussion

[0405] NASH has emerged as a critical liver disease with limited treatment options, making it imperative to explore novel therapeutic avenues. Recent findings suggest that ceramides are crucially involved in every phase of NAFLD progression. Consequently, reducing ceramide levels has the potential to alleviate NAFLD-related pathologies across various stages of the disease. This study showed that various ceramides were elevated in NASH patients and in three mouse models of NASH. The increase in ceramides was correlated with an upregulation of several enzymes involved in the ceramide de novo synthesis pathway, such as SPTLC2 and CerS2. These findings indicate that activation of the hepatic ceramide de novo synthesis pathway contributes to excessive ceramide production in NASH. Single-cell RNAscq analysis showed that SPTLC2, a subunit of the rate-limiting enzyme involved in ceramide de novo synthesis (SPT), was specifically upregulated in hepatocytes and HSCs.

[0406] Myriocin, the most extensively studied inhibitor of ceramide de novo synthesis, has shown therapeutic potential in preclinical animal models of NAFLD. However, its practical application faces challenges due to its hydrophobic nature, resulting in limited bioavailability when administered orally. Moreover, escalating the oral dosage of myriocin has been associated with gastrointestinal toxicity, thereby constraining its translational use in clinical settings.

[0407] As an alternative approach to small molecules like myriocin, siRNA was employed to temporarily reduce the expression of SPTLC2 using a lipid nanoparticle (LNP) delivery system. A transfection efficiency of 70-80% was achieved in hepatocytes with a LNP-siRNA formulation, and a 70% hepatic knockdown of the target gene, SPTLC2, could be sustained in vivo with a two-dose-per-week regimen. It was shown that knocking down SPTLC2 slowed liver steatosis and NASH progression by decreasing ccramidc-associatcd lipid uptake and lipogenesis in the liver. Achieving a 100% knockdown may be challenging due to several factors, including siRNA stability, cellular uptake, and off-target effects. Improvements in siRNA delivery systems, chemical modifications of siRNA molecules, and targeting strategics can potentially further enhance knockdown efficiency. To assess the therapeutic effectiveness of LNP-SPTLC2 siRNA in NASH, LNP-SPTLC2 siRNA treatment of MCD diet-induced NASH mice was investigated. Utilizing LC-MS / MS- based lipidomics analysis, a reduction in ceramide levels was observed in both the liver and plasma. Furthermore, liver tissue analyses showed significant reduction in steatosis, inflammation, and fibrosis. Notably, it was shown that administering two doses of SPTLC2 siRNA per week can maintain maximal silencing of SPTLC2 in the liver. The rationale for using two doses instead of a single dose can be attributed to the dynamic nature of RNA interference and the need for sustained target gene suppression. It has been well-documented that a single dose of siRNA may lead to transient gene knockdown, and may not be sufficient to sustain therapeutic benefits over time. Conversely, multiple doses can sustain silencing to extend the therapeutic effect.

[0408] Treatment efficacy was evaluated using a non-invasivc diagnostic technique which relies on T1 - and T2-switchable MR imaging and USIO nanoprobes. The advantages of MR imaging include its non-invasivc nature, quantitative capabilities, and the ability to distinguish NASH from simple steatosis. It allows for serial monitoring of disease progression and treatment response in live animals.

[0409] The efficacy of LNP-SPLC2 siRNA treatment was confirmed in a clinically relevant mouse model of obesity, the CD-HFD model. The term “clinically relevant” in this context refers to the ability of the CD-HFD model to capture the multifactorial nature of NASH more closely. This includes features like insulin resistance, obesity, and atherosclerosis, which are commonly seen in NASH patients. By validating siRNA therapy in the CD-HFD model, it can be shown that the therapy is more broadly applicable to different NASH phenotypes, addressing a wider range of disease aspects.

[0410] This study reinforces the pivotal role of ceramides in liver lipid metabolism. It shows that ceramides regulate essential lipid-related proteins and enzymes, including CD36, FATP2, FATP5, SREBP-1 c, ACC1 , and FAS, thus inhibiting ceramide synthesis can reduce lipid uptake and lipogenesis in the liver. This underscores the potential of ceramides as valuable targets for innovative therapeutic approaches against NAFLD.

[0411] It will be appreciated that many further modifications and permutations of various aspects of the described embodiments are possible. Accordingly, the described aspects are intended to embrace all such alterations, modifications, and variations that fall within the spirit and scope of the appended claims.

Claims

CLAIMS1. A method of treating a metabolic disease in a subject, the method comprising administering to the subject an effective amount of a nucleic acid inhibitor of serine palmitoyltransferase long chain base subunit 2 (SPTLC2).

2. The method of claim 1, wherein the metabolic disease is characterised by increased lipid deposition and / or ceramide synthesis.

3. The method of claim 2, wherein the increased lipid deposition is an increased deposition of sphingolipids and / or ceramides.

4. The method of any one of claims 1 to 3, wherein the metabolic disease is fatty liver disease.

5. The method of claim 4, wherein the fatty liver disease is non-alcoholic steatohepatitis (NASH) or non-alcoholic fatty liver disease (NAFLD).

6. The method of any one of claims 1 to 5, wherein the nucleic acid inhibitor is a small interfering RNA (siRNA), antisense nucleic acid molecule, or a short hairpin RNA (shRNA).

7. The method of any one of claims 1 to 6, wherein the nucleic acid inhibitor comprises, encodes or binds to a sequence selected from a nucleic acid sequence having at least 70% sequence identity to any one of SEQ ID NO: 3—10, or a complementary sequence thereof.

8. The method of any one of claims 1 to 7, wherein the nucleic acid inhibitor is provided in a pharmaceutically acceptable carrier.

9. The method of claim 8, wherein the pharmaceutically acceptable carrier is a lipid nanoparticle (LNP), a polymeric nanoparticle or an extracellular vesicle.

10. The method of claim 9, wherein the pharmaceutically acceptable carrier is a lipid nanoparticle.

11. The method of any one of claims 1 to 10, wherein the subject is a mammalian subject.

12. The method of claim 11. wherein the mammalian subject is a human.

13. The method of any one of claims 1 to 12, further comprising detecting the ceramide level in a sample from the subject, and administering the nucleic acid inhibitor of SPTLC2 to the subject when there is an increase in ceramide level as compared to a reference.

14. A nucleic acid inhibitor of serine palmitoyltransferase long chain base subunit 2 (SPTLC2), for use in treating a subject with a metabolic disease.

15. Use of a nucleic acid inhibitor of serine palmitoyltransferase long chain base subunit 2 (SPTLC2) in the manufacture of a medicament for treating a subject with a metabolic disease.

16. A method of inhibiting ceramide synthesis and / or deposition in a cell, the method comprising contacting the cell with an effective amount of a nucleic acid inhibitor of SPTLC2.

17. A nucleic acid inhibitor of SPTLC2, wherein the nucleic acid inhibitor comprises, encodes or binds to a sequence selected from a nucleic acid sequence having at least 70% sequence identity to any one of SEQ ID NO: 3-10, or a complementary sequence thereof.

18. The nucleic acid inhibitor of claim 17, wherein the nucleic acid inhibitor is a small interfering RNA (siRNA), antisense nucleic acid molecule, or a short hairpin RNA (shRNA).

19. A pharmaceutical composition comprising the nucleic acid inhibitor of claim 17 or 18 and a pharmaceutically acceptable carrier.

20. A lipid nanoparticle (LNP) composition comprising the nucleic acid inhibitor of claim 17 or 18 and a pharmaceutically acceptable excipient.

21. A nucleic acid inhibitor of claim 17 or 18, a pharmaceutical composition of claim 19 or a lipid nanoparticlc (LNP) composition of claim 20, for use as a medicament.

Images