Ceramide NS, synthesis method therefor, and use thereof

The synthesis of ceramide NS through the condensation reaction of oleic acid, linoleic acid, linolenic acid and sphingosine has solved the problem of insufficient research on the efficacy of ceramide NS series compounds, and has realized multiple effects in skin care, including repairing the skin barrier, tissue healing, and anti-oxidation, and has broad application prospects.

WO2025223291A1PCT designated stage Publication Date: 2025-10-30SHENZHEN DIKEMAN BIOTECHNOLOGY CO LTD
View PDF 12 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2025/089495
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-04-25
Filing Date
2025-04-17
Publication Date
2025-10-30

AI Technical Summary

Technical Problem

Current technology lacks sufficient research on the efficacy of NS series ceramide compounds, and experimental data is insufficient to provide scientific evidence for their use and efficacy claims in skin care.

Method used

Ceramide NS was synthesized by condensation reaction of oleic acid, linoleic acid, linolenic acid and sphingosine. EDCI and HOBT were used as catalysts and DCM was used as solvent. The molar ratio was controlled to obtain ceramide NS with the structure of formula I.

Benefits of technology

Ceramide NS exhibits excellent effects in repairing the skin barrier, healing skin tissue, anti-oxidation, anti-photoaging, improving collagen expression, moisturizing, soothing, and anti-inflammation, and has good bioactivity and formulation compatibility.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2025089495_30102025_PF_FP_ABST
    Figure CN2025089495_30102025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of biomedicine. Specifically, disclosed is ceramide NS. The ceramide NS is a product obtained by condensation of oleic acid, linoleic acid, linolenic acid, and sphingosine, and has a structure of formula (I), wherein R is selected from residues after condensation of oleic acid, linoleic acid, and linolenic acid. Also disclosed in the present invention are a synthesis method for and use of ceramide NS. Ceramide NS series compounds have excellent effects in repairing a skin barrier, promoting skin tissue healing, resisting oxidation, resisting photoaging, improving collagen expression, and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Ceramide NS, its synthesis methods and uses Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to ceramide NS, its synthesis method, and its uses. Background Technology

[0002] Ceramides, as an important physiological lipid in the skin, have attracted special attention from researchers due to their unique skin-care effects. Ceramides are present in all eukaryotic cells and play a crucial regulatory role in cell differentiation, proliferation, apoptosis, aging, and other vital processes. As a major component of the intercellular lipids of the stratum corneum, ceramides not only act as second messenger molecules in the sphingomyelin pathway but also play a vital role in the formation of the epidermal stratum corneum, thus possessing functions such as maintaining the skin barrier, soothing, moisturizing, anti-aging, whitening, and disease treatment.

[0003] Ceramides are a class of sphingosine lipids composed of long-chain sphingosine bases and fatty acids. The carbon chain length, degree of unsaturation, and number of hydroxyl groups in the sphingosine and fatty acid moieties can vary. Ceramides represent a class of compounds. Ceramide NPs, composed of plant sphingosine and different fatty acids, account for 22.1% of the total ceramides in the human body, and their efficacy has been extensively studied. Ceramide NS series compounds, composed of sphingosine and different fatty acids, also account for as much as 7.4% of the total ceramides, but research on their efficacy is still limited, and there is a lack of specific experimental data to support this. Therefore, studying the skin care efficacy data of ceramide NS series compounds at the cellular level, and providing a scientific basis for their use in formulations and efficacy claims, has significant research significance and practical value. Summary of the Invention

[0004] The purpose of this invention is to provide a class of ceramides NS.

[0005] Another object of the present invention is to provide a method for synthesizing ceramide NS.

[0006] Another object of the present invention is to provide the use of ceramide NS in skin care, particularly for repairing the skin barrier, healing skin tissue, anti-oxidation, anti-photoaging, increasing collagen expression, moisturizing, soothing, and anti-inflammatory purposes.

[0007] To achieve one of the above objectives, the present invention adopts the following technical solution:

[0008] Ceramide NS is a product obtained by the condensation of oleic acid, linoleic acid, linolenic acid and sphingosine, and has the structure of formula I:

[0009] R is selected from the residues formed by the condensation of oleic acid, linoleic acid, and linolenic acid.

[0010] The method for synthesizing ceramide NS includes the following steps:

[0011] The reaction of RCOOH and sphingosine yields ceramide, where RCOOH is oleic acid, linoleic acid, or linolenic acid.

[0012] Furthermore, the molar ratio of RCOOH to sphingosine is 1:(0.8–1.2).

[0013] Furthermore, EDCI and HOBT are added to the reaction, and the molar ratio of RCOOH, EDCI, and HOBT is 1:(1-1.5):(1-1.5).

[0014] Furthermore, the solvent for the reaction is DCM.

[0015] This invention demonstrates through experiments that ceramide NS has the effects of repairing the skin barrier, healing skin tissue, anti-oxidation, anti-photoaging, improving collagen expression, moisturizing, soothing, and anti-inflammatory, and can be used in cosmetics, health products, or pharmaceutical preparations.

[0016] A composition comprising ceramide NS as an active ingredient, its isomer, its pharmaceutically acceptable salt, its hydrate or its solvate, the composition having tissue repair and moisturizing effects.

[0017] The compounds of “Formula I” used in this article have two chiral centers, and therefore include chiral compounds of this structure, namely enantiomers and diastereomers.

[0018] As used herein, "pharmaceutically acceptable salt" means a salt of one aspect of the present invention that is pharmaceutically acceptable and has the desired pharmacological activity of the parent compound. Such salts include: (1) acid addition salts formed with inorganic or organic acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, etc., and organic acids such as acetic acid, propionic acid, hexanoic acid, cyclopentylpropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, hydroxysuccinic acid, maleic acid, trans-butenedioic acid, tartaric acid, citric acid, benzoic acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1, 2-Ethylenedisulfonic acid, 2-hydroxyethylsulfonic acid, benzenesulfonic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo[2,2,2]-oct-2-ene-1-carboxylic acid, glucoheponic acid, 3-phenylpropionic acid, trimethylacetic acid, tert-butylacetic acid, dodecyl sulfate, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid and mucoconic acid; or (2) a salt formed when the acidic proton present in the parent compound is substituted.

[0019] As used herein, “hydrate” refers to a compound that is bound to water. The binding of the compound to water includes non-covalent binding.

[0020] The term "solvent" as used in this article refers to a complex formed by a solute molecule or ion and a solvent molecule or ion.

[0021] As used herein, “isomer” means that the compounds of the present invention or their salts have the same chemical formula or molecular formula but different optical or spatial properties, including enantiomers and diastereomers.

[0022] Unless otherwise stated, the terms "compounds of the present invention" or "ceramide" include the compound itself, its pharmaceutically acceptable salts, its hydrates, its solvates, and its isomers.

[0023] The present invention has the following beneficial effects:

[0024] This invention reacts C18 unsaturated fatty acids with sphingosine to derive ceramide NS series compounds. Ceramide NS series compounds have excellent effects in repairing the skin barrier, promoting skin tissue healing, anti-oxidation, anti-photoaging, and improving collagen expression. They have good formulation compatibility in the preparation of corresponding ceramide complexes and have broad application prospects in the fields of cosmetics, pharmaceuticals, and health products.

[0025] Existing technologies lack systematic research on the specific efficacy and uses of NS series ceramide compounds, and experimental data are insufficient to support this. The contribution of this invention lies in filling this gap. Through a large amount of experimental data, it has been found that ceramides with unsaturated fatty acid fragments have better biological activity, while ceramides with saturated fatty acid fragments have poorer biological activity. Attached Figure Description

[0026] Figures 1, 2, 3, and 4 are bar charts showing the cell proliferation activity detection results of Example 5;

[0027] Figure 5 shows the results of the cell scratch experiment in Example 6;

[0028] Figure 6 is a bar chart showing the test results of the soothing and anti-allergic efficacy of Example 7;

[0029] Figure 7 is a bar chart showing the CAT enzyme activity detection results of Example 8;

[0030] Figures 8 and 9 are bar charts showing the results of photoaging resistance test in Example 9;

[0031] Figure 10 is a bar chart showing the results of collagen Col-1 activity detection in Example 10;

[0032] Figure 11 is a bar chart showing the results of the elastase inhibition experiment in Example 11;

[0033] Figure 12 is a bar chart showing the results of the moisturizing efficacy test in Example 12;

[0034] Figure 13 is a bar chart showing the results of the anti-inflammatory and repair efficacy test in Example 13. Detailed Implementation

[0035] The present invention will be further described below with reference to specific embodiments.

[0036] Example 1

[0037] Preparation of oleate sphingosine (NS-1)

[0038] Oleic acid (50 mmol), EDCI (60 mmol), and HOBT (60 mmol) were placed in a 250 mL round-bottom flask, followed by the addition of 100 mL of dichloromethane. The mixture was stirred at room temperature for 1 hour. Then, sphingosine (45 mmol) was added to the reaction mixture, and the mixture was stirred at room temperature for 24 hours until TLC showed complete disappearance of sphingosine. Post-treatment: Water was added to quench the reaction. The organic layer was separated, dried, filtered, and concentrated under vacuum. The residue obtained was purified by silica gel column chromatography to give product NS-1 (71% yield, 20.02 g).

[0039] 1 H NMR(400MHz,Chloroform-d)δ6.49(d,J=7.4Hz,1H),5.75(dt,J=14.1,6.7Hz,1H ),5.49(dd,J=15.4,6.4Hz,1H),5.43–5.26(m,2H),4.25(t,J=5.2Hz,1H),3.88( dd,J=8.5,5.0Hz,2H),3.77–3.60(m,1H),2.21(t,J=7.6Hz,2H),2.02(dq,J=12. 5, 6.8Hz, 6H), 1.62 (q, J = 7.2Hz, 2H), 1.50–1.07 (m, 44H), 0.88 (t, J = 6.7Hz, 6H).

[0040] Example 2

[0041] Preparation of Linoleic Sphingosine (NS-2)

[0042] Linoleic acid (50 mmol), EDCI (55 mmol), and HOBT (55 mmol) were placed in a 250 mL round-bottom flask, followed by the addition of 100 mL of dichloromethane. The mixture was stirred at room temperature for 1 hour. Then, sphingosine (55 mmol) was added to the reaction mixture, and the mixture was stirred at room temperature for 28 hours until TLC showed complete disappearance of sphingosine. Post-treatment: Water was added to quench the reaction. The organic layer was separated, dried, filtered, and concentrated under vacuum. The residue obtained was purified by silica gel column chromatography to give product NS-2 (68% yield, 19.106 g).

[0043] 1 H NMR(400MHz,Chloroform-d)δ6.52(d,J=7.4Hz,1H),5.72(dt,J=14.0,6.8Hz,1H),5. 46(dd,J=15.2,6.6Hz,1H),5.43–5.26(m,4H),4.22(t,J=5.0Hz,1H),3.86(dd,J=8.6 ,5.1Hz,2H),3.74–3.62(m,1H),2.79(t,J=6.6Hz,2H),2.30–2.18(m,2H),2.07(dq,J =12.5, 6.8Hz, 6H), 1.62 (q, J = 7.2Hz, 2H), 1.50–1.07 (m, 40H), 0.88 (t, J = 6.7Hz, 6H).

[0044] Example 3

[0045] Preparation of Linolenic Acid Sphingosine (NS-3)

[0046] Linolenic acid (50 mmol), EDCI (70 mmol), and HOBT (70 mmol) were placed in a 250 mL round-bottom flask, followed by the addition of 100 mL of dichloromethane. The mixture was stirred at room temperature for 1 hour. Then, sphingosine (50 mmol) was added to the reaction mixture, and the mixture was stirred at room temperature for 22 hours until TLC showed complete disappearance of sphingosine. Post-treatment: Water was added to quench the reaction. The organic layer was separated, dried, filtered, and concentrated under vacuum. The residue obtained was purified by silica gel column chromatography to give product NS-3 (73% yield, 20.437 g).

[0047] 1H NMR(400MHz, Methanol-d4)δ5.74–5.63(m,1H),5.49–5.42(m,1H),5.41–5.24( m,6H),4.04(t,J=7.4Hz,1H),3.85(dt,J=7.5,5.0Hz,1H),3.68(d,J=5.0Hz,2H ),2.80(t,J=6.0Hz,4H),2.24–2.14(m,2H),2.14–1.97(m,6H),1.59(dt,J=8.0 ,3.9Hz,2H),1.41–1.22(m,30H),0.97(t,J=7.6Hz,3H),0.89(t,J=7.6Hz,3H).

[0048] Example 4

[0049] Preparation of stearate sphingosine (NS-4)

[0050] Stearic acid (50 mmol), EDCI (60 mmol), and HOBT (60 mmol) were placed in a 250 mL round-bottom flask, followed by the addition of 100 mL of dichloromethane. The mixture was stirred at room temperature for 1 hour. Then, sphingosine (45 mmol) was added to the reaction mixture, and the mixture was stirred at room temperature for 24 hours until TLC showed complete disappearance of sphingosine. Post-treatment: Water was added to quench the reaction mixture. The organic layer was separated, dried, filtered, and concentrated under vacuum. The residue obtained was purified by silica gel column chromatography to give product NS-4 (70% yield, 19.809 g).

[0051] 1 H NMR (400MHz, CDCl3): δ6.23(d,J=7.3Hz,1H),5.77(dt,J=15.4,6.7Hz,1H),5.51(d d,J=15.4,6.4Hz,1H),4.3(dd,J=6.4,3.4Hz,1H),3.94(dd,J=11.3,3.7Hz,1H3.89( m,1H),3.69(dd,J=11.3,3.2Hz,1H),2.21(t,J=7.5Hz,2H),2.03(dt,J=7.2,6.7Hz, 2H), 1.62 (q, J = 7.5Hz, 2H), 1.35 (m, 2H), 1.34-1.20 (m, 48H), 0.86 (t, J = 6.9Hz, 6H).

[0052] Example 5

[0053] MTT assay for the cell proliferation activity of compounds NS-1, NS-2, NS-3, and NS-4

[0054] Human keratinocytes (HaCaT cells) and fibroblasts (L929 cells) were divided into two groups at a ratio of 1×10⁻⁶. 4 Cells were seeded at a density of 1 cell / well in 96-well plates and incubated overnight. After 24 hours, the supernatant was discarded, and 100 μL of culture medium containing different concentrations of samples (compounds NS-1, NS-2, NS-3, or NS-4) or a blank was added (three parallel sets for each concentration). Incubation continued for another 24 hours, after which the culture medium was removed, and 100 μL of thiazolyl blue (MTT) was added to each well. The absorbance at 450 nm was measured, and cell viability was calculated as A. 给药孔 / A 空白孔 ×100%.

[0055] Table 1. Results of the assay for the proliferative activity of compound NS-1 on HaCaT cells.

[0056] Table 2. Results of the assay for the proliferation activity of compound NS-1 in L929 cells.

[0057] The results of the cell proliferation activity of compound NS-1 are shown in Tables 1 and 2 and Figure 1. For HaCaT cells, the cell viability of compound NS-1 at concentrations of 31.25 mg / L, 62.5 mg / L, 125 mg / L, 250 mg / L, 500 mg / L, and 1000 mg / L were 95.77%, 94.69%, 95.77%, 95.46%, 91.54%, and 89.02%, respectively. For L929 cells, the cell viability of compound NS-1 at concentrations of 31.25 mg / L, 62.5 mg / L, 125 mg / L, 250 mg / L, 500 mg / L, and 1000 mg / L were 101.17%, 100.64%, 101.86%, 92.72%, 100.62%, and 102.38%, respectively. At concentrations up to 1000 mg / L, it showed no toxic side effects on cells and demonstrated good biocompatibility.

[0058] Table 3. Results of the assay for the proliferative activity of compound NS-2 on cells (HaCaT cells).

[0059] Table 4. Results of the assay for the proliferation activity of compound NS-2 on L929 cells.

[0060] The results of the cell proliferation activity of compound NS-2 are shown in Tables 3 and 4 and Figure 2. For HaCaT cells, the cell viability of compound NS-2 at concentrations of 31.25 mg / L, 62.5 mg / L, 125 mg / L, 250 mg / L, 500 mg / L, and 1000 mg / L were 102.47%, 102.90%, 102.47%, 99.54%, 103.75%, and 100.29%, respectively. For L929 cells, the cell viability of compound NS-2 at concentrations of 31.25 mg / L, 62.5 mg / L, 125 mg / L, 250 mg / L, 500 mg / L, and 1000 mg / L were 103.61%, 100.27%, 97.38%, 100.66%, 102.82%, and 103.79%, respectively. At concentrations up to 1000 mg / L, it showed no toxic side effects on cells and demonstrated good biocompatibility.

[0061] Table 5. Results of the assay for the proliferative activity of compound NS-3 on cells (HaCaT cells).

[0062] Table 6. Results of the assay for the proliferation activity of compound NS-3 on L929 cells.

[0063] The results of the effects of compound NS-3 on cell proliferation are shown in Tables 5 and 6 and Figure 3. For HaCaT cells, the cell viability of compound NS-3 at concentrations of 31.25 mg / L, 62.5 mg / L, 125 mg / L, 250 mg / L, 500 mg / L, and 1000 mg / L were 101.31%, 101.77%, 105.79%, 103.62%, 102.26%, and 98.29%, respectively. For L929 cells, the cell viability of compound NS-3 at concentrations of 31.25 mg / L, 62.5 mg / L, 125 mg / L, 250 mg / L, 500 mg / L, and 1000 mg / L were 89.16%, 87.45%, 89.58%, and 89.58%, respectively.

[0064] 85.30%, 91.18%, and 89.68%. At concentrations up to 1000 mg / L, it showed no toxic side effects on cells, demonstrating good biocompatibility.

[0065] Table 7 Results of the assay of compound NS-4 on cell proliferation (HaCaT cells)

[0066] Table 8. Results of the assay for the proliferation activity of compound NS-4 on L929 cells.

[0067] The results of the cell proliferation activity of compound NS-4 are shown in Tables 7 and 8 and Figure 4. For HaCaT cells, the cell viability of compound NS-4 at concentrations of 31.25 mg / L, 62.5 mg / L, 125 mg / L, 250 mg / L, 500 mg / L, and 1000 mg / L were 94.06%, 72.76%, 63.43%, 45.51%, 41.76%, and 35.91%, respectively. For L929 cells, the cell viability of compound NS-3 at concentrations of 31.25 mg / L, 62.5 mg / L, 125 mg / L, 250 mg / L, 500 mg / L, and 1000 mg / L were 79.69%, 58.11%, 45.54%, 35.70%, 36.89%, and 32.15%, respectively. NS-4 exhibits significant cytotoxicity; as the concentration increases, cell viability decreases, and its toxic side effects are dose-dependent, resulting in poor safety.

[0068] Example 6

[0069] The effects of NS-1, NS-2, NS-3, and NS-4 on cell migration were detected using the cell scratch assay.

[0070] The scratch assay is an in vitro experimental method for studying cell migration. When keratinocytes grow to a fused monolayer, an artificially created blank area (scratch) is made on the fused monolayer. Cells at the edge of the scratch gradually move into the blank area, causing the "scratch" to heal. This simulates the process of epidermal keratinocyte migration to some extent. By observing the state of cells in the scratch area at different stages, the migration ability of cells can be judged. It is an important method in in vitro experiments for studying skin wound healing and repair.

[0071] Operating steps:

[0072] 1. Marking the culture plate. First, use a marker pen to draw horizontal lines evenly on the back of the 6-well plate with a ruler, about every 0.5 to 1 cm, passing through the wells. Each well should have at least 5 lines.

[0073] 2. Seeding cells. Add approximately 5 × 10⁻⁶ cells to the wells. 5 One fibroblast L929 cell was seeded, with the principle being that the confluence rate reached 100% after overnight inoculation.

[0074] 3. Cell streaking. After 24 hours, use a micropipette tip perpendicular to the cell plane to streak along the lines previously streaked on the back of the plate on the monolayer of adherent cells (use the same tip between different wells) to create a scar model.

[0075] 4. Washing cells. After scratching, wash the cells three times with sterile PBS to remove non-adherent cells, i.e., the cells that were scratched off during the streaking process. Then replace with fresh serum-free culture medium.

[0076] 5. Cell Culture and Observation. Samples (NS-1, NS-2, NS-3, or NS-4) were diluted with DMEM medium (concentration 62.5 mg / L) and added to cell culture dishes. Cells were incubated at 37°C in a 5 wt% CO2 incubator. After 24 hours, cells were removed, observed under a microscope, and the width of the scratches was measured and photographed. The control group consisted of DMEM medium without any sample.

[0077] As shown in Figure 5, compared to the control group, the experimental group had narrower scratches, indicating that compounds NS-1, NS-2, and NS-3 have a stronger ability to promote the healing of keratinocytes (skin tissue) and have a significant repair effect on cell damage. This is because compounds NS-1, NS-2, and NS-3 enhance the interaction between cells and the extracellular matrix, and between cells themselves, thereby enhancing cell migration and movement, while NS-4 has almost no effect on tissue healing.

[0078] Example 7

[0079] TRPV1 inhibition assay to detect the soothing and anti-allergic effects of NS-1, NS-2 and NS-3

[0080] HaCaT cells were stored at a density of 1×10⁻⁶. 4 Cellular RNA was seeded per well in a 96-well plate and incubated overnight in an incubator. After 24 hours, the supernatant was discarded, and 100 μL of different concentrations of samples (compounds NS-1, NS-2, or NS-3) diluted in DMEM medium were added. The blank control group contained no sample in DMEM medium, and the positive control group contained 0.4% trans-4-tert-butylcyclohexanol. Each group was divided into three replicates, and the plates were incubated at 37°C with 5 wt% CO2. Two hours after drug administration, 50 μmol / L capsaicin was added to the experimental groups, and the plates were incubated together for 24 hours. After the reaction, cellular RNA was extracted, reverse transcribed, and the expression level of TRPV1 factor mRNA was measured using a real-time PCR instrument. Data were processed and analyzed using the 2-ΔΔCq method.

[0081] Table 9. Test results of the soothing and anti-allergic effects of compound NS-1

[0082] Table 10 Results of the soothing and anti-allergic efficacy test of compound NS-2

[0083] Table 11 Results of the soothing and anti-allergic efficacy test of compound NS-3

[0084] The results are shown in Tables 9-11 and Figure 6. The TRPV1 activity in the blank control group was set to 1. Under stimulation with capsaicin at a working concentration of 50 μmol / L, the TRPV1 level was 5.759 times the baseline level. The TRPV1 level in the positive control group (0.4% trans-tert-butylcyclohexanol) was 0.341 times that of the capsaicin model group, indicating the reliability of the method. Under the influence of compound NS-1 at concentrations of 62.5 mg / L, 125 mg / L, and 250 mg / L, the TRPV1 levels were 0.839, 0.515, and 0.274 times that of the capsaicin model group, respectively. Under the influence of compound NS-2 at concentrations of 62.5 mg / L, 125 mg / L, and 250 mg / L, the TRPV1 levels were 0.778, 0.472, and 0.183 times that of the capsaicin model group, respectively. Under the influence of compound NS-3 at concentrations of 62.5 mg / L, 125 mg / L, and 250 mg / L, the TRPV1 level was 0.776, 0.587, and 0.530 times that of the capsaicin model group, respectively.

[0085] TRPV1 belongs to the transient receptor potential (TRP) superfamily and acts as a switch for skin burning and stinging. It is closely related to the occurrence of skin sensitivity and stinging. It can achieve a soothing and anti-allergic effect by inhibiting the overexpression of TRPV1 receptors in sensitive skin and help the skin build tolerance. Compared with the model group, co-incubation of NS-1, NS-2 and NS-3 with cells can significantly reduce TRPV1 expression in a dose-dependent manner. This proves that NS-1, NS-2 and NS-3 have good soothing effects and can soothe sensitive skin.

[0086] Example 8

[0087] Intracellular CAT enzyme activity assays of NS-1, NS-2, NS-3 and NS-4

[0088] HFF-1 cells were fed at a rate of 1×10 6 Cells were seeded at a density of [number] cells / well in 6-well plates and incubated overnight in a 5% CO2 incubator at 37°C. After 24 hours, the supernatant was discarded, and 100 μL of culture medium containing different concentrations of compounds NS-1, NS-2, NS-3, or NS-4 was added. The blank control group was DMEM medium without the drug. 24 hours after drug administration, the model group, positive control (50 mg / L VC), and experimental group were all incubated with 8 mM H2O2 for 2 hours, with 3 replicates per group. After 4 hours of incubation, total protein was extracted, cells were lysed, and the supernatant was collected. Protein concentration was tested using a BCA protein concentration assay kit, and CAT (catalase) activity was tested. Antioxidant enzymes such as CAT can scavenge free radicals and reactive oxygen species produced by the body. With increasing age, the activity of antioxidant enzymes decreases, leading to an excess of free radicals and reactive oxygen species, which causes gradual aging.

[0089] Table 12 Results of intracellular CAT enzyme activity assay for compound NS-1

[0090] Table 13 Results of intracellular CAT enzyme activity assay for compound NS-2

[0091] Table 14 Results of intracellular CAT enzyme activity assay for compound NS-3

[0092] Table 15 Results of intracellular CAT enzyme activity assay for compound NS-4

[0093] The results are shown in Tables 12-15 and Figure 7. The relative CAT activity in the blank control group was set to 1, the CAT activity in the model group was 0.451, and the CAT activity in the positive control group was 0.867. At NS-1 concentrations of 31.25 mg / L, 62.5 mg / L, 125 mg / L, and 250 mg / L, the CAT activities were 0.498, 0.548, 0.552, and 0.605, respectively. At NS-2 concentrations of 31.25 mg / L, 62.5 mg / L, 125 mg / L, and 250 mg / L, the CAT activities were... The T activities were 0.498, 0.541, 0.662, and 0.539, respectively; the CAT activities of NS-3 at concentrations of 31.25 mg / L, 62.5 mg / L, 125 mg / L, and 250 mg / L were 0.460, 0.496, 0.491, and 0.567, respectively; and the CAT activities of NS-4 at concentrations of 3.91 mg / L, 7.81 mg / L, 15.625 mg / L, and 31.25 mg / L were 0.330, 0.438, 0.479, and 0.437, respectively. These results indicate that NS-1, NS-2, NS-3, and NS-4 can enhance CAT expression, thereby inhibiting the overexpression of intracellular free radicals. Higher concentrations of NS-1, NS-2, NS-3, and NS-4 significantly enhanced CAT activity and inhibited the overexpression of intracellular free radicals. At the same concentration (31.25 mg / L), NS-4 did not enhance CAT activity as much as NS-1, NS-2 and NS-3.

[0094] Example 9

[0095] Photoaging resistance tests of NS-1, NS-2, NS-3 and NS-4

[0096] MMP1, also known as interstitial collagenase or matrix metalloproteinase, belongs to the matrix metalloproteinase family. Its main substrate is fibrous collagen, which can degrade collagen fibers and gelatin in the extracellular matrix and alter the cellular microenvironment. MMP1 plays an important role in elastin; inhibiting MMP1 can increase collagen and elastin synthesis in fibroblasts, and reducing MMP activity can increase the rate of collagen synthesis.

[0097] HFF-1 cells were fed at a rate of 1×10 5 Cells were seeded at a density of 1 cell / well in 96-well plates and incubated overnight. After 24 hours, the supernatant was discarded, and 100 μL of medium containing different concentrations of NS-1, NS-2, NS-3, or NS-4 (no drug was added to the model group) was added. The negative control group received drug-free DMEM medium. Each group was divided into 3 replicates. After incubation at 37°C with 5% CO2 for 4 hours, both experimental and model groups were irradiated with UVA or UVB ultraviolet light. The distance between the UV radiation source and the cells was 15 cm, and the UVA or UVB intensity was 200 mJ / cm². 2 The irradiation time was 1.0 h, and after irradiation, the cells were incubated in an incubator for another 24 h. Intracellular MMP-1 gene expression was detected using an MMP-1 ELISA kit.

[0098] Figure 8 shows the results of MMP-1 overexpression inhibition induced by UVA. The MMP1 expression level in the negative control group was set at 1, and the expression level in the model group was 2.03. At NS-1 concentrations of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the MMP1 expression levels were 1.69, 1.41, and 1.27, respectively; at NS-2 concentrations of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the MMP1 expression levels were 1.69, 1.41, and 1.27, respectively. At different concentrations, the expression levels of MMP1 were 1.43, 1.18, and 0.99 mg / L; at concentrations of NS-3 (7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L), the expression levels of MMP1 were 1.64, 1.31, and 1.05 mg / L; and at concentrations of NS-4 (7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L), the expression levels of MMP1 were 1.38, 1.56, and 1.04 mg / L. Higher concentrations of NS-1, NS-2, and NS-3 significantly inhibited MMP1; the concentration dependence of NS-4 was not significant, and its inhibitory effect was not as strong as that of NS-2 and NS-3.

[0099] Figure 9 shows the results of UVB-induced MMP-1 overexpression inhibition. The MMP1 expression level in the negative control group was set at 1, and the expression level in the model group was 2.48. At NS-1 concentrations of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the MMP1 expression levels were 1.84, 1.78, and 1.57, respectively; at NS-2 concentrations of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the MMP1 expression levels were 1.46, 1.18, and 1.04, respectively; and at NS-3 concentrations of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the MMP1 expression level was 1.54.

[0100] The concentrations of NS-4 at 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L resulted in MMP1 expression levels of 1.24, 1.37, and 1.10, respectively. Higher concentrations of NS-1, NS-2, and NS-3 significantly inhibited MMP1 expression; however, the concentration dependence of NS-4 was not significant, and its inhibitory effect was less pronounced than that of NS-2 and NS-3.

[0101] Following ultraviolet (UV) radiation, keratinocytes promote increased MMP1 expression in fibroblasts, leading to degradation of the skin's extracellular matrix and collagen, resulting in photoaging. These results indicate that NS-1, NS-2, and NS-3 can inhibit UV-induced MMP1 production by fibroblasts, thus playing a role in preventing photoaging. Compared to the model group, NS-1, NS-2, and NS-3 significantly inhibited UV-induced MMP-1 overexpression, showing a clear dose-response relationship. While NS-4 also showed some inhibitory effect, it was generally less effective than NS-2 and NS-3.

[0102] Example 10

[0103] Collagen Col-1 activity assay of NS-1, NS-2, NS-3 and NS-4

[0104] HFF-1 cells were fed at a rate of 1×10 6 Seeds were seeded at a density of 100 cells / well in 6-well plates and incubated overnight in a 5% CO2 incubator at 37°C. After 24 hours, the supernatant was discarded, and 100 μL of medium containing different concentrations of NS-1, NS-2, NS-3, or NS-4 was added. The blank control group was DMEM medium without the drug, and the positive control was 15 mg EGCG. After 24 hours of drug administration, each group was divided into 3 replicates. The expression level of Col-1 was detected using a Col-1 kit, total RNA was extracted, and the RNA was reverse transcribed into cDNA for quantification using a real-time PCR instrument.

[0105] Primer sequences:

[0106] Col1a1-F:CGATGGATTCCCGTTCGAGT

[0107] Col1a1-R:GAGGCCTCGGTGGACATTAG

[0108] Table 16 Results of collagen-Col-1 activity assay using compound NS-1

[0109] Table 17 Results of collagen Col-1 activity assay for compound NS-2

[0110] Table 18 Results of collagen Col-1 activity assay for compound NS-3

[0111] Table 19 Results of collagen Col-1 activity assay for compound NS-4

[0112] The results are shown in Tables 16-19 and Figure 10. The relative expression level of Col-1 mRNA in the blank control group was set to 1, and the expression level in the positive control group was 1.91. At concentrations of 15.625 mg / L, 31.25 mg / L, and 62.5 mg / L, the relative expression levels of Col-1 were 0.59, 0.97, and 1.28, respectively. The relative expression levels of NS-2 at concentrations of 15.625 mg / L, 31.25 mg / L, and 62.5 mg / L were also shown. At different concentrations, the relative expression levels of Col-1 were 1.17, 1.45, and 1.58. At concentrations of NS-3 of 15.625 mg / L, 31.25 mg / L, and 62.5 mg / L, the relative expression levels of Col-1 were 1.16, 1.58, and 2.01. At concentrations of NS-4 of 15.625 mg / L, 31.25 mg / L, and 62.5 mg / L, the relative expression levels of Col-1 were 0.85, 0.98, and 0.70.

[0113] The content of collagen Col-1 is closely related to the elasticity and resilience of the skin. Compounds NS-1, NS-2, and NS-3 can increase Col-1 expression and improve skin elasticity and resilience in a significant dose-dependent manner; the higher the concentration of NS-1, NS-2, and NS-3, the more significant the increase in Col-1 content and the more pronounced the improvement in skin elasticity and resilience. NS-4 has a certain effect on increasing Col-1 expression at low concentrations, but as the concentration increases, Col-1 expression decreases, possibly due to the cytotoxic effect of NS-4. Overall, the effect of NS-4 in promoting collagen expression is not as good as that of NS-1, NS-2, and NS-3.

[0114] Example 11

[0115] Elastase inhibition assays of NS-1, NS-2, NS-3 and NS-4

[0116] Elastase inhibition method: The elastase reaction substrate N-succinyl-L-alanyl-L-alanyl-L-alanine 4-nitroaniline was dissolved in 0.1 mol / L Tis-HCl buffer solution (pH 8.0) to a concentration of 1.015 mmol / L as the working solution. 130 μL of the working solution and 10 μL of samples of different concentrations (compounds NS-1, NS-2, NS-3, or NS-4) were added to a 96-well plate. After mixing on a shaker, 15 μL of 0.5 U elastase was added, and the plate was incubated at room temperature for 30 min before measuring the absorbance at 410 nm. EGCG was used as a positive control. Elastase inhibition rate = (A3 - A1 + A2) / A3 × 100%. A1 is the absorbance of the system with sample and enzyme; A2 is the absorbance of the system with sample but no enzyme; A3 is the absorbance of the system with enzyme but no sample.

[0117] Table 20 Results of test for elastase inhibition by compound NS-1

[0118] Table 21 Results of test for the inhibitory effect of compound NS-2 on elastase

[0119] Table 22 Results of test for the inhibitory effect of compound NS-3 on elastase.

[0120] Table 23 Results of test for the inhibitory effect of compound NS-4 on elastase.

[0121] The results are shown in Tables 20-23 and Figure 11. At concentrations of 7.8125 mg / L, 15.625 mg / L, 31.25 mg / L, and 62.5 mg / L, the inhibition rates of NS-1 against elastase were 17.81%, 25.13%, 27.87%, and 34.50%, respectively. Similarly, at concentrations of NS-2, the inhibition rates against elastase were 19.27%, 25.17%, and 28.71%, respectively. The inhibition rates of NS-3 against elastase at concentrations of 7.8125 mg / L, 15.625 mg / L, 31.25 mg / L, and 62.5 mg / L were 23.09%, 32.52%, 35.14%, and 41.01%, respectively. Similarly, the inhibition rates of NS-4 against elastase at concentrations of 7.8125 mg / L, 15.625 mg / L, 31.25 mg / L, and 62.5 mg / L were 18.16%, 15.17%, 14.58%, and 7.19%, respectively.

[0122] Elastase degrades various proteins, including collagen and elastin. The degradation of elastin in skin tissue by elastase is closely related to the skin aging process. Combating elastase degradation of elastin and restoring skin elasticity is an important way to delay skin aging. NS-1, NS-2, and NS-3 all showed significant inhibitory effects on elastase at different concentrations. NS-4 showed some inhibitory effect on elastase at low concentrations, but the inhibitory effect decreased with increasing concentration, possibly due to the cytotoxic effect of NS-4. Overall, the inhibitory effect of NS-4 on elastase was not as strong as that of NS-1, NS-2, and NS-3.

[0123] Example 12

[0124] AQP3 cell assay for the moisturizing efficacy of NS-1, NS-2, NS-3 and NS-4

[0125] Aquaporin 3 (AQP3) is a transporter protein factor on the cell membrane responsible for the transport of substances such as water, glycerol, and urea. It is mainly expressed in keratinocytes and skin fibroblasts. AQP3 not only participates in skin moisturizing and barrier function, but also plays an important role in skin damage and repair, healing, and anti-aging, and is an important guarantee for maintaining normal skin morphology and function.

[0126] Human keratinocytes HaCat cells were arranged at a density of 1×10⁻⁶. 4Cells were seeded per well in 96-well plates and incubated overnight in an incubator. After 24 hours, the supernatant was discarded, and 100 μL of different concentrations of samples (compounds NS-1, NS-2, NS-3, or NS-4) diluted in DMEM medium were added. The blank control group and the model group were in DMEM medium without the drugs. Each group had 3 replicates. The experimental and model groups were dried in a clean bench at a fan speed of 0.4 m / s for 20 min, and then incubated in an environment of 5% CO2 at 37°C for 24 h. After the reaction, 50 μL of cell supernatant was collected, and the expression of AQP3 cytokines was detected using an AQP3 kit.

[0127] Table 24 Results of the moisturizing efficacy test for compound NS-1

[0128] Table 25 Results of the moisturizing efficacy test for compound NS-2

[0129] Table 26 Results of the moisturizing efficacy test for compound NS-3

[0130] Table 27 Results of the moisturizing efficacy test for compound NS-4

[0131] The results are shown in Tables 24-27 and Figure 12. The expression level of AQP3 in the blank control group was set to 1. NS-1, NS-2 and NS-3 effectively increased the expression level of AQP3 aquaporin in a concentration-dependent manner. Among them, the expression levels of NS-1 at concentrations of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L were 1.09, 1.19, and 1.22 times that of the model group, respectively; the expression levels of NS-2 at concentrations of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L were 1.05, 1.23, and 1.25 times that of the model group, respectively; the expression levels of NS-3 at concentrations of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L were 1.09, 1.26, and 1.30 times that of the model group, respectively; and the expression levels of NS-4 at concentrations of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L were 0.95, 0.80, and 1.17 times that of the model group, respectively. Although NS-4 has some ability to increase the expression of AQP3 aquaporin, the effect is far less than that of NS-1, NS-2 and NS-3.

[0132] Example 13

[0133] The anti-inflammatory and repairing effects of NS-1, NS-2, NS-3, and NS-4 were detected using the LPS-induced cell method.

[0134] Interleukin 6 (IL-6) is a cytokine most typically associated with inflammation. It plays a crucial role in host defense by regulating immune and inflammatory responses. Inflammation affects the skin barrier, increasing epidermal moisture loss and hindering keratinocyte growth, making barrier repair difficult once damaged. It also breaks down the extracellular matrix, causing skin collapse and inhibiting collagen synthesis, leading to loose skin and wrinkles. Therefore, effectively reducing IL-6 production in keratinocytes and fibroblasts induced by external damage and UV radiation, and lowering the inflammatory response, is essential for restoring the skin barrier and maintaining skin elasticity and stability.

[0135] Macrophages were RAW at a density of 1×10⁻⁶. 4 Cells were seeded per well in 96-well plates and incubated overnight in an incubator. After 24 hours, the supernatant was discarded, and 100 μL of different concentrations of samples (compounds NS-1, NS-2, NS-3, or NS-4) diluted in DMEM medium were added. The blank control group contained no sample in DMEM medium. Each group was divided into three replicates, and incubated at 37°C with 5 wt% CO2. Two hours after drug administration, 10 μg / mL LPS was added to both the lipopolysaccharide model group and the experimental group, and they were co-incubated for 24 hours. After the reaction, 50 μL of cell supernatant was collected, and the expression of intracellular IL-6 factor was detected using an IL-6 ELISA kit.

[0136] Table 28 Results of anti-inflammatory tests for compound NS-1IL-6

[0137] Table 29. Anti-inflammatory test results of compound NS-2IL-6

[0138] Table 30. Anti-inflammatory test results of compound NS-3IL-6

[0139] The results are shown in Tables 28-30 and Figure 13. The IL-6 expression level in the blank control group was set at 100. Under stimulation with LPS at a working concentration of 10 μg / mL, the IL-6 level was 378.81, the baseline level. Under the influence of NS-1 at concentrations of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the relative mRNA expression levels of IL-6 were 262.46, 173.25, and 115.36, respectively. The relative mRNA expression levels of IL-6 were 332.26, 272.97, and 294.96 at concentrations of NS-2 of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, respectively. The relative mRNA expression levels of IL-6 were 342.78, 280.61, and 242.13 at concentrations of NS-3 of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, respectively.

[0140] Co-incubation of NS-1, NS-2, and NS-3 with cells significantly reduced the expression of intracellular IL-6 inflammatory factor in a dose-dependent manner. NS-1, NS-2, and NS-3 showed significant inhibitory effects on IL-6, exhibiting good anti-inflammatory and soothing effects, and could promote the repair of inflamed and damaged skin.

[0141] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. Ceramide NS, which has the structure of Formula I: R is selected from the residues formed by the condensation of oleic acid, linoleic acid, and linolenic acid.

2. The method for synthesizing ceramide NS according to claim 1, comprising the following steps: The reaction of RCOOH and sphingosine yields ceramide, where RCOOH is oleic acid, linoleic acid, or linolenic acid.

3. The synthesis method according to claim 2, characterized in that, The molar ratio of RCOOH to sphingosine is 1:(0.8–1.2).

4. The synthesis method according to claim 2, characterized in that, The reaction involves the addition of EDCI and HOBT, with the molar ratio of RCOOH, EDCI, and HOBT being 1:(1-1.5):(1-1.5).

5. The synthesis method according to claim 2, characterized in that, The solvent for the reaction is DCM.

6. Uses of ceramide NS in cosmetics, health products or pharmaceutical preparations.

7. The use according to claim 6, characterized in that, The ceramide NS has at least one of the following effects: repairing the skin barrier, tissue healing, anti-oxidation, anti-photoaging, increasing collagen expression, moisturizing, soothing, and anti-inflammatory.

8. A composition comprising, as an active ingredient, the ceramide of claim 1, its isomer, its pharmaceutically acceptable salt, its hydrate, or its solvate.

Citation Information

Patent Citations

  • Ceramide compound containing chain carboxylic acid as well as preparation method and application of ceramide compound

    CN115304509A

  • Linolenic acid-derived ceramide as well as preparation method and application thereof

    CN115894278A

  • Olive oil ceramide as well as synthesis method and application thereof

    CN115894279A

  • Rice bran oil ceramide as well as synthesis method and application thereof

    CN115947666A

  • Grape seed oil ceramide as well as synthesis method and application thereof

    CN116023288A