Compositions and methods for the management and treatment of phenylketonuria

Abstract

Compositions and methods for effecting base editing to correct mutations in the phenylalanine hydroxylase gene, thereby curing phenylketonuria, are disclosed.

Description

[0001]COMPOSITIONS AND METHODS FOR THE MANAGEMENT AND TREATMENT OF PHENYLKETONURIA By Kiran Musunuru Xiao Wang Dominique Brooks Aidan Quigley Rebecca Ahrens-Nicklas CROSS-REFERENCE TO RELATED APPLICATION This application claims priority of US Provisional application number 63 / 520,273 filed August 17, 2023, the entire contents being incorporated herein by reference as though set forth in full. GRANT SUPPORT STATEMENT This invention was made with government support under U19-NS132301, R01- HL148769, and R35-HL145203 awarded by the National Institutes of Health. The government has certain rights in the invention. FIELD OF THE INVENTION This invention relates to the fields of genetic engineering and correction of genetic errors using base editing therapy. More specifically, the invention provides compositions and methods for correcting gene mutations which cause phenylketonuria. INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED IN ELECTRONIC FORM The Contents of the electronic sequence listing (UPNK-117-PCT.xml; Size: 98,844 bytes; and Date of Creation: August 19, 2024) is herein incorporated by reference in its entirety. BACKGROUND OF THE INVENTION Several publications and patent documents are cited throughout the specification in order to describe the state of the art to which this invention pertains. Each of these citations is incorporated herein by reference as though set forth in full. Phenylketonuria (PKU) is an autosomal recessive inborn error of metabolism caused by a deficiency in the hepatic enzyme phenylalanine hydroxylase (PAH). If left untreated, the main clinical feature is intellectual disability. Treatment, which includes a low phenylalanine diet supplemented with amino acid formulas, commences soon after diagnosis within the first weeks of life. Although dietary treatment has been successful in preventing intellectual disability in early treated PKU patients, there are major issues with dietary compliance due to the palatability of the diet. Other potential issues associated with dietary therapy include nutritional deficiencies particularly in vitamins D and B12. Suboptimal outcomes in cognitive and executive functioning have been reported in patients who adhere poorly to dietary therapy. Other approaches include administration of oral medication, e.g., sapropterin, a cofactor of PAH, and an injectable enzyme substitution therapy (pegvaliase). Many PKU patients have limited responses to, or limited access to the medical therapies and, as a result, have impaired cognitive development and develop a range of neuropsychiatric problems. Durable and, ideally, curative therapies are needed to address the unmet medical needs of PKU patients. Although the liver is spared from toxicity, the PAH gene is largely expressed in hepatocytes, and correction of the primary genetic defect solely within the liver would be curative in PKU patients. It is an object of the invention to provide an effective and lasting treatment of PKU which reduces or eliminates PKU symptoms. SUMMARY OF THE INVENTION The present invention provides compositions and methods for effecting a durable cure of a subset of patients with phenylketonuria via the direct correction of causative mutations for this disease, particularly the c.1222C>T mutation, also known as p.Arg408Trp mutation and R408W mutation, which is the most common mutation associated with PKU worldwide. In accordance with one aspect of the invention methods for editing a phenylalanine hydroxylase (PAH) encoding polynucleotide comprising a c.1222C>T (p.Arg408Trp), c.1066– 11G>A, c.782G>A (p.Arg261Gln), or c.728G>A (p.Arg243Gln) mutation is provided. An exemplary method comprises contacting the PAH polynucleotide with a base editor and one or more guide polynucleotides, thereby forming a base editor complex, said base editor complex comprising a polynucleotide programmable DNA binding domain and an adenosine deaminase domain, wherein said one or more guide polynucleotides target said base editor complex to said mutation and effect an A•T to G•C base change thereby correcting said mutation. In certain embodiments, the mutation is c.1222C>T (p.Arg408Trp) and said guide polynucleotide has a sequence with at least 90% identity to SEQ ID NO: 7, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 1, SEQ ID NO: 9, or SEQ ID NO: 11, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer sequence. In certain embodiments, the mutation is c.1222C>T (p.Arg408Trp) and said guide polynucleotide comprises a nucleic acid sequence complementary to a PAH encoding nucleic acid sequence with at least 90% identity to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO: 12. In certain embodiments, the patient has a second mutation in a different allele in a second PAH encoding polynucleotide selected from c.842C>T (p.Pro281Leu), c.1066–11G>A, c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln). In certain embodiments, the mutation is c.1066–11G>A and said guide polynucleotide has a sequence with at least 90% identity to SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, or SEQ ID NO: 25, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer sequence. In certain embodiments, the mutation is c.1066–11G>A and said guide polynucleotide comprises a nucleic acid sequence complementary to a PAH encoding nucleic acid sequence with at least 90% identity to SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, or SEQ ID NO: 26. In certain embodiments, the patient has a second mutation in a different allele in a second PAH encoding polynucleotide selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln). In certain embodiments, the mutation is c.782G>A (p.Arg261Gln) and said guide polynucleotide has a sequence with at least 90% identity to SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer sequence. In certain embodiments, the mutation is c.782G>A (p.Arg261Gln) and said guide polynucleotide comprises a nucleic acid sequence complementary to a PAH encoding nucleic acid sequence with at least 90% identity to SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, or SEQ ID NO: 40. In certain embodiments, the patient has a second mutation in a different allele in a second PAH encoding polynucleotide selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.1066– 11G>A, c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln). In certain embodiments, the mutation is c.728G>A (p.Arg243Gln) and said guide polynucleotide has a sequence with at least 90% identity to SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, or SEQ ID NO: 53, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer sequence. In certain embodiments, the mutation in c.728G>A (p.Arg243Gln) and said guide polynucleotide comprises a nucleic acid sequence complementary to a PAH encoding nucleic acid sequence with at least 90% identity to SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, or SEQ ID NO: 54. In certain embodiments, the patient has a second mutation in a different allele in a second PAH encoding polynucleotide selected from c.842C>T (p.Pro281Leu), c 122C>T (p.Arg408Trp), c.1066– 11G>A, c.782G>A (p.Arg261Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln). In certain embodiments, the contacting is done in a cell, a eukaryotic cell, a mammalian cell, or human cell. Contacting may be performed in vitro or in vivo. The polynucleotide programmable DNA binding domain can be a Streptococcus pyogenes Cas9 (SpCas9) or Staphylococcus aureus Cas9 (SaCas9) or a variant thereof. In certain aspects, the polynucleotide programmable DNA binding domain comprises a modified SpCas9 having an altered protospacer-adjacent motif (PAM) specificity, including without limitation, a modified SpCas9 having specificity for the nucleic acid sequence 5’-NGC-3’, 5’-NCA-3’, 5’-NAA-3’, 5’-NAG-3’, 5’-NGT-3’, or 5’-NGN-3’. The polynucleotide programmable DNA binding domain may be nuclease inactive or nickase variant. In the base editing methods disclosed the adenosine deaminase domain is capable of deaminating adenosine in deoxyribonucleic acid (DNA). The adenosine deaminase can be a TadA deaminase or a variant thereof. In another embodiment, the base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to a nucleic acid sequence comprising the mutation associated with PKU. Also provided is a cell produced by introducing into the cell, or a progenitor cell thereof: a) a base editor, or a polynucleotide encoding said base editor, wherein said base editor comprises a polynucleotide programmable DNA binding domain and an adenosine deaminase domain; and b) one or more guide polynucleotides that target the base editor to a mutation site and effect an A•T to G•C alteration of a c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), or c.728G>A (p.Arg243Gln) mutation, thereby treating PKU. In certain embodiments, the cell is a hepatocyte. In certain embodiments, the hepatocyte expresses a PAH polypeptide. In certain embodiments, the cell is from a subject having PKU. In certain embodiments, the polynucleotide programmable DNA binding domain is a Streptococcus pyogenes Cas9 (SpCas9) or variant thereof. In certain aspects, the polynucleotide programmable DNA binding domain comprises a modified SpCas9 having an altered protospacer-adjacent motif (PAM) specificity, including without limitation, a modified SpCas9 having specificity for the nucleic acid sequence 5’-NGC-3’, 5’-NCA-3’, 5’-NAA-3’, 5’-NAG-3’, 5’-NGT-3’, or 5’- NGN-3’. The polynucleotide programmable DNA binding domain may be nuclease inactive or nickase variant. In the base editing methods disclosed the adenosine deaminase domain is capable of deaminating adenosine in deoxyribonucleic acid (DNA). The adenosine deaminase can be a TadA deaminase or a variant thereof. In another embodiment, the base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to a nucleic acid sequence comprising the mutation associated with PKU. Another embodiment of the invention comprises a plurality of adenosine base editor / guide polynucleotides editing complex for correction of a mutation causing PKU. An exemplary editing complex includes (i) a modified SpCas9 or SaCas9; (ii) an adenosine deaminase or functional fragment thereof; and (iii) a guide polynucleotide that targets the base editor to effect an A•T to G•C alteration of a c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), or c.728G>A (p.Arg243Gln)) mutation associated with PKU. In certain embodiments, the mutation is c.1222C>T (p.Arg408Trp) and said guide polynucleotide has a sequence with at least 90% identity to SEQ ID NO: 7, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 1, SEQ ID NO: 9, or SEQ ID NO: 11, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer sequence. In certain embodiments, the mutation is c.1222C>T (p.Arg408Trp) and said guide polynucleotide comprises a nucleic acid sequence complementary to a PAH encoding nucleic acid sequence with at least 90% identity to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO: 12. In certain embodiments, the patient has a second mutation in a different allele in a second PAH encoding polynucleotide selected from c.842C>T (p.Pro281Leu), c.1066–11G>A, c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln). In particularly preferred embodiments, the guide polynucleotide has a sequence of SEQ ID NO: 7. In another preferred embodiment. The base editor has a sequence of SEQ ID NO: 78. In certain embodiments, the mutation is c.1066–11G>A and said guide polynucleotide has a sequence with at least 90% identity to SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, or SEQ ID NO: 25, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer sequence. In certain embodiments, the mutation is c.1066–11G>A and said guide polynucleotide comprises a nucleic acid sequence complementary to a PAH encoding nucleic acid sequence with at least 90% identity to SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, or SEQ ID NO: 26. In certain embodiments, the patient has a second mutation in a different allele in a second PAH encoding polynucleotide selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln). In certain embodiments, the mutation is c.782G>A (p.Arg261Gln) and said guide polynucleotide has a sequence with at least 90% identity to SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer sequence. In certain embodiments, the mutation is c.782G>A (p.Arg261Gln) and said guide polynucleotide comprises a nucleic acid sequence complementary to a PAH encoding nucleic acid sequence with at least 90% identity to SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, or SEQ ID NO: 40. In certain embodiments, the patient has a second mutation in a different allele in a second PAH encoding polynucleotide selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.1066– 11G>A, c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln). In certain embodiments, the mutation is c.728G>A (p.Arg243Gln) and said guide polynucleotide has a sequence with at least 90% identity to SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, or SEQ ID NO: 53, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer sequence. In certain embodiments, the mutation in c.728G>A (p.Arg243Gln) and said guide polynucleotide comprises a nucleic acid sequence complementary to a PAH encoding nucleic acid sequence with at least 90% identity to SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, or SEQ ID NO: 54. In certain embodiments, the patient has a second mutation in a different allele in a second PAH encoding polynucleotide selected from c.842C>T (p.Pro281Leu), c 122C>T (p.Arg408Trp), c.1066– 11G>A, c.782G>A (p.Arg261Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln). Another aspect of the invention includes a method of treating PKU in a subject comprising administering to said subject an effective amount of the adenosine base editor / guide polynucleotide sets described above. Subjects to be treated include mammals and humans. The base editor, or polynucleotide encoding said base editor, and said one or more guide polynucleotides can be delivered to a cell of the subject, particularly a liver cell. In one delivery method, the base editor / guide polynucleotide set can be encapsulated in a lipid nanoparticle formulation and delivered to the liver of said subject. In certain aspects, the formulation comprises ionizable cationic lipid, 1,2-distearoyl-sn-glycero-3-phosphocholine, cholesterol, and a PEG-lipid. In an alternative delivery method, the base editor / guide polynucleotide set is delivered to hepatocytes in a single or dual AAV vector system as described herein. In yet another approach, the base editor / guide polynucleotide set can be delivered to hepatocytes in vivo or in vitro in virus-like particles. In another aspect of the invention, a transgenic mouse comprising a humanized PAH gene comprising at least one of a c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), or c.728G>A (p.Arg243Gln) mutation. In certain embodiments, the mouse further comprises at least one additional mutation selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln), wherein the first mutation and the at least one additional mutation are not the same. In another aspect of the invention, methods of identifying an effective adenosine base editor (ABE) / guide polynucleotide editing complex for correction of a target mutation are provided. An exemplary method comprises a) contacting a cell harboring a control mutation with a control ABE / guide polynucleotide editing complex that edits the control mutation; b) contacting a cell harboring a target mutation with a test ABE / guide polynucleotide editing complex that edits the target mutation; c) comparing the corrective activity of the control ABE / guide polynucleotide editing complex with the corrective activity of the at least one test ABE / guide polynucleotide editing complex; and e) identifying a test ABE / guide polynucleotide editing complex having at least 50%, least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% of the corrective activity of the control ABE / guide polynucleotide editing complex. In certain embodiments, the test ABE / guide polynucleotide editing complex has greater corrective activity than the control ABE / guide polynucleotide editing complex. In certain embodiments, the screening methods further comprise comparing the level of bystander editing of the test ABE / guide polynucleotide editing complex and the bystander editing of the control ABE / guide polynucleotide editing complex. In certain embodiments, the test ABE / guide polynucleotide editing complex has about the same or less bystander editing than the control ABE / guide polynucleotide editing complex. In certain embodiments, the methods further comprise selecting the test ABE / guide polynucleotide editing complex without untolerated bystander editing and without nonsynonymous bystander editing. In certain embodiments, the control mutation is c.842C>T (p.Pro281Leu) or c.1222C>T (p.Arg408Trp). In certain embodiments, the control ABE / guide polynucleotide editing complex has a guide polynucleotide of SEQ ID NO: 7 and a base editor has a sequence of SEQ ID NO: 78. In certain embodiments, the target mutation and / or control mutation are mutations associated with PKU. In certain embodiments, the target mutation is selected from c.1222C>T (p.Arg408Trp), c.1066– 11G>A, c.782G>A (p.Arg261Gln), and c.728G>A (p.Arg243Gln). In certain embodiments the test ABE / guide polynucleotide editing complex comprises at least one guide polynucleotide selected from Table 1 and / or at least one base editor selected from Table 2. Still other aspects and advantages of these compositions and methods are readily apparent and described further in the following detailed description of the invention. BRIEF DESCRIPTION OF THE DRAWINGS Figures 1A – 1B. (Fig. 1A) Adenine base editors (ABEs) are composed of a dead (d) or nickase (n) Cas9 (d / nCas9) fused to one or two TadA, either a TadA evolved to edit adenine in DNA (TadA*) or both a TadA* and a wild-type TadA. ABEs convert A:T into G:C base pairs in the editing window (for example, nucleotide 4 to 7 in the protospacer, in purple). Cas9 is guided by the sgRNA to the protospacer [which is followed by the PAM (protospacer adjacent motif)] and unwinds the DNA, and the deaminase converts the target base. (Fig. 1B) Cytosine base editors (CBEs), composed of a nickase Cas9 (nCas9) fused to a deaminase and one (in BE3s) or two (in BE4s) UGI (uracil glycosylase inhibitor), convert C•G into T•A base pairs in the editing window (nucleotide 4 to 8 in the protospacer, in green). Undesired events (bystander edits, in blue, and unwanted base conversion, in yellow) of CBEs and ABEs are shown in (Figs. 1A, 1B), respectively. The addition of the second UGI in CBEs (in BE4) and the removal of TadA in ABEs (ABE8) are highlighted with a gray dotted line. The gradient color of the editing window in the upper panels of (Figs. 1A, 1B) represents the enlarged editing window observed with novel BEs. Figure 2. Lifetime recorded measurements of blood phenylalanine levels in PKU patients with PAH R408W variants. Figure 3. Intervals between measurements of blood phenylalanine levels in PKU patients with PAH R408W variants. Figure 4A – 4C. (Fig. 4A) Schematic of the genomic site of the PAH c.1222C>T (R408W) variant, adapted from the UCSC Genome Browser (GRCh38 / hg38)(SEQ ID NO: 81). The vertical blue bar indicates the G altered to A (in red) by the variant on the antisense strand. The target protospacers for six gRNAs designated PAH1 (SEQ ID NO: 2), PAH2 (SEQ ID NO: 4), PAH3 (SEQ ID NO: 6), PAH4 (SEQ ID NO: 8), PAH5 (SEQ ID NO: 10), and PAH6 (SEQ ID NO: 12) are indicated with thick green horizontal bars, with the thin portions of the bars indicating PAMs. The black arrows indicate sites of potential bystander adenine editing. (Fig. 4B) Sanger sequencing chromatogram of the genomic site of the PAH R408W variant in wild- type HuH-7 cells. The blue arrow indicates the position of the variant. (Fig. 4C) Chromatogram of the site in R408W homozygous HuH-7 cell line. The red arrow indicates the position of the variant. Figure 5A – 5B. Adenine base editing to correct the PAH c.1222C>T variant in HuH-7 human hepatoma cells. (Fig. 5A) Corrective A-to-G editing following transient transfection of R408W homozygous HuH-7 cells with plasmids encoding varied ABE / gRNA sets. (Fig. 5B) Sanger sequencing chromatogram of the genomic site of the variant in R408W homozygous HuH-7 cells treated with SpRY-ABE8e / PAH4 set. The blue arrow indicates the position of the variant. Figure 6. A-to-G editing observed in dose-response study with R408W homozygous HuH-7 cells treated with LNPs formulated with SpRY-ABE8.8 mRNA and PAH4 gRNA. The editing percentage includes all outcomes in which corrective editing of the R408W variant was achieved, irrespective of bystander editing (n = 3 biological replicates; mean ± standard deviation for each dose). Figure 7. Scheme to generate exon-humanized PKU mice with the PAH c.1222C>T (R408W) variant. Figures 8A – 8B. Generation of minimally humanized PKU mice with the PAH c.1222C>T (R408W) variant. (Fig. 7A) Sanger sequencing chromatograms showing the generation of a humanized mouse model via Cas9-mediated homology-directed repair in mouse zygotes. At the top is sequence from a wild-type C57BL / 6J mouse. At the bottom is sequence from a mouse homozygous for the humanized R408W allele. The red arrow indicates the site of the R408W variant, and the black arrows indicate the sites of synonymous changes that humanize the local region of the mouse Pah gene. (Fig. 7B) Age-matched littermates that are homozygous or heterozygous for the humanized R408W allele. On the left is a homozygous mouse with PKU as evidenced by hypopigmentation of the fur, and on the right is a control heterozygous mice with normal fur color. Figures 9A – 9B. Adenine base editing for correction of the PAH R408W variant in humanized PKU mice in vivo. (Fig. 9A) Short-term changes in the blood phenylalanine level in homozygous PKU mice following treatment with SpRY-ABE8.8 / PAH4 LNPs, comparing levels at various time points up to 7 days following treatment to levels in untreated control PKU and non-PKU colony mates (n = 1 sample per animal at each time point). (Fig. 9B) A-to-G editing of the PAH R408W variant in the whole liver (n = 8 samples per animal). Figure 10A – 10D. Adenine base editing to correct the PAH c.1066–11G>A (Fig. 10A), c.782G>A (Fig. 10B), c.728G>A (Fig. 10C), and c.1315+1G>A (Fig. 10D) variants in lentivirus- infected HuH-7 human hepatoma cells. The top horizontal dotted line indicates the editing efficiency of the P281L standard, and the bottom horizontal line indicates the editing efficiency of the R408W standard. DETAILED DESCRIPTION OF THE INVENTION In vivo gene editing is an emerging therapeutic approach to making DNA modifications in the body of a patient, such as in the liver. Gene-editing methods include CRISPR-Cas9 and - Cas12 nucleases, CRISPR cytosine base editors, CRISPR adenine base editors, and CRISPR prime editors. CRISPR base editors are an attractive gene-editing modality because they function efficiently for introducing precise targeted alterations without the need for double-strand breaks, in contrast to CRISPR-Cas9 and other gene-editing nucleases (e.g., Cas12). Adenine base editors (ABEs) can induce targeted A→G edits in DNA (T→C on the opposing strand). Each ABE uses its core Cas9 nickase protein with a guide RNA (gRNA) to engage a double-strand protospacer DNA sequence, flanked by a protospacer-adjacent motif (PAM) sequence on its 3′ end. Because ABEs do not make double-strand breaks, they have a minimal risk of inducing large deletions, chromosomal abnormalities, and chromothripsis (shattering); instead, each ABE uses an evolved deoxyadenosine deaminase domain—typically fused to the N-terminal end of the Cas9 nickase— to chemically modify an adenosine nucleoside on one DNA strand, which (in combination with nicking of the other strand) enables highly precise and efficient A→G transition mutations at the targeted site. The activity window of each ABE typically ranges across several positions within the protospacer DNA sequence (e.g., the ABE8.8 window ranges from position 3 to position 9, with peak editing observed at position 6 of the protospacer), with different ABEs having different windows. ABEs have the potential to edit any adenine within the window, which could include a desired target adenine but also undesired additional adenines (bystander edits). Published ABEs with Streptococcus pyogenes Cas9 nickase include so-called eighth-generation ABEs (harboring optimized deaminase domains resulting from eight rounds of molecular evolution)— the most commonly used to date are ABE8.8, ABE8.20, and ABE8e—and circularly permuted or inlaid ABEs, in which the deaminase domain is embedded within a loop of the Cas9 nickase protein, rather than fused to the N-terminal end, which has the effect of shifting the editing window further towards the 3’ end of the protospacer sequence. Similar ABEs with Cas9 nickase from other bacterial species (e.g., Staphylococcus aureus) have been reported. As a general rule, ABEs display highly variable levels of activity across different genomic loci in different cell types, and empirical testing is mandatory to determine whether a given ABE with a given gRNA will edit efficiently at a given target site in a given cell type. The present invention provides compositions and methods for adenine base editing to permanently correct the most common pathogenic variant, the PAH c.1222C>T (R408W) variant, in human hepatocytes. Other pathologic variants can be permanently corrected using cytosine base editing. The PAH c.1222C>T variant has its highest prevalence in populations in Eastern Europe but is widespread across the globe and affects a large proportion of PKU patients in the United States. Patients homozygous for this variant do not typically respond to sapropterin, limiting their treatment options and making a curative in vivo base editing therapy particularly compelling. Definitions: As employed above and throughout the disclosure, the following terms and abbreviations, unless otherwise indicated, shall be understood to have the following meanings. In the present disclosure the singular forms "a," "an," and "the" include the plural reference, and reference to a particular numerical value includes at least that particular value, unless the context clearly indicates otherwise. Thus, for example, a reference to "a compound" is a reference to one or more of such compounds and equivalents thereof known to those skilled in the art, and so forth. The term "plurality", as used herein, means more than one. When a range of values is expressed, another embodiment includes from the one particular and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about," it is understood that the particular value forms another embodiment. All ranges are inclusive and combinable. A "monogenic disease" or a "monogenic disorder" is a condition determined by the interaction of a single pair of genes. This is in contrast to a polygenic condition wherein several genes are involved. In humans, monogenic diseases occur less frequently than the polygenic disease. It is also less complicated than the latter and may follow a pattern based on Mendelian inheritance. Monogenic disorders can adversely impact a number of biological systems. Phenylketonuria (PKU) is a classic "monogenic" autosomal recessive disease in which mutation at the human phenylalanine hydroxylase (PAH) locus impairs the function of the enzyme phenylalanine hydroxylase (enzymic phenotype), thereby causing the attendant hyperphenylalaninemia (metabolic phenotype) and the resultant intellectual disability (cognitive phenotype). Other symptoms include seizures, tremors, hyperactivity, stunted growth, or shaking and trembling, skin conditions including eczema, as well as musty odor of the urine, breath, or skin. 0.45 million individuals have PKU, with global prevalence 1:23,930 live births (range 1:4,500 [Italy]–1:125,000 [Japan]). More than 1280 variants in the phenylalanine hydroxylase PAH gene are responsible for a broad spectrum of phenylketonuria (PKU) phenotypes. While genotype–phenotype correlation is ~88%, additional factors play a role. These include tetrahydrobiopterin (BH4), the PAH co-chaperone DNAJC12, phosphorylation of the PAH residues, and epigenetic factors. There is presently no cure for PKU, with the exception of liver transplantation. Here the direct correction of the causative mutation PAH c.1222C>T via base editing, also known as p.Arg408Trp and R408W, in liver cells is described. This is the most common PKU associated gene mutation worldwide. Subjects harboring this mutation do not typically respond well to BH4supplementation therapy. The term "deaminase" or "deaminase domain" refers to a protein or enzyme that catalyzes a deamination reaction. In some embodiments, the deaminase is an adenosine deaminase, which catalyzes the hydrolytic deamination of adenine or adenosine. In some embodiments, the deaminase or deaminase domain is an adenosine deaminase, catalyzing the hydrolytic deamination of adenosine or deoxyadenosine to inosine or deoxyinosine, respectively. In some embodiments, the adenosine deaminase catalyzes the hydrolytic deamination of adenine or adenosine in deoxyribonucleic acid (DNA). The adenosine deaminases (e.g., engineered adenosine deaminases, evolved adenosine deaminases) provided herein may be from any organism, such as a bacterium. In some embodiments, the deaminase or deaminase domain is a variant of a naturally- occurring deaminase from an organism. In some embodiments, the deaminase or deaminase domain does not occur in nature. For example, in some embodiments, the deaminase or deaminase domain is at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical to a naturally-occurring deaminase. In some embodiments, the adenosine deaminase is from a bacterium, such as E. coli, S. aureus, S. typhi, S. putrefaciens, H. influenzae, or C. crescentus. In some embodiments, the adenosine deaminase is a TadA deaminase. In some embodiments, the TadA deaminase is an E. coli TadA deaminase (ecTadA). In some embodiments, the TadA deaminase is a truncated E. coli TadA deaminase. For example, the truncated ecTadA may be missing one or more N-terminal amino acids relative to a full-length ecTadA. In some embodiments, the truncated ecTadA may be missing 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 6, 17, 18, 19, or 20 N-terminal amino acid residues relative to the full length ecTadA. In some embodiments, the truncated ecTadA may be missing 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 6, 17, 18, 19, or 20 C-terminal amino acid residues relative to the full length ecTadA. In some embodiments, the ecTadA deaminase does not comprise an N- terminal methionine. It should be appreciated, however, that additional adenosine deaminases useful in the present application would be apparent to the skilled artisan and are within the scope of this disclosure. The term "base editor (BE)" or "nucleobase editor (NBE)" refers to an agent comprising a polypeptide that is capable of making a modification to a base (e.g., A, T, C, G, or U) within a nucleic acid sequence (e.g., DNA or RNA). In some embodiments, the base editor is capable of deaminating a base within a nucleic acid. In some embodiments, the base editor is capable of deaminating a base within a DNA molecule. In some embodiments, the base editor is capable of deaminating an adenine (A) in DNA. In some embodiments, the base editor is a fusion protein comprising a nucleic acid programmable DNA binding protein (napDNAbp) fused to an adenosine deaminase. In some embodiments, the base editor is a Cas9 protein fused to an adenosine deaminase. In some embodiments, the base editor is a Cas9 nickase (nCas9) fused to an adenosine deaminase. In some embodiments, the base editor is a nuclease-inactive Cas9 (dCas9) fused to an adenosine deaminase. In some embodiments, the base editor is fused to an inhibitor of base excision repair, for example, a UGI domain, or a dISN domain. In some embodiments, the fusion protein comprises a Cas9 nickase fused to a deaminase and an inhibitor of base excision repair, such as a UGI or dISN domain. "Prime editing" directly introduces new genetic information into a targeted DNA site. Typically editing is effected by a fusion protein, consisting of a catalytically impaired Cas9 endonuclease fused to an engineered reverse transcriptase enzyme, and a prime editing guide RNA (pegRNA), capable of identifying the target site and providing the new genetic information to replace the target DNA nucleotides. Using this technique targeted insertions, deletions, and base-to-base conversions without the need for double strand breaks (DSBs) or donor DNA templates can be introduced into the targeted nucleic acid molecule. The term "linker," as used herein, refers to a bond (e.g., covalent bond), chemical group, or a molecule linking two molecules or moieties, e.g., two domains of a fusion protein, such as, for example, a nuclease-inactive Cas9 domain and a nucleic acid-editing domain (e.g., an adenosine deaminase). In some embodiments, a linker joins a gRNA binding domain of an RNA- programmable nuclease, including a Cas9 nuclease domain, and the catalytic domain of a nucleic-acid editing protein. In some embodiments, a linker joins a dCas9 and a nucleic-acid editing protein. Typically, the linker is positioned between, or flanked by, two groups, molecules, or other moieties and connected to each one via a covalent bond, thus connecting the two. In some embodiments, the linker is an amino acid or a plurality of amino acids (e.g., a peptide or protein). In some embodiments, the linker is an organic molecule, group, polymer, or chemical moiety. In some embodiments, the linker is 5-200 amino acids in length, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 30- 35, 35-40, 40-45, 45-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-150, or 150-200 amino acids in length. Longer or shorter linkers are also contemplated. As used herein the term "wild-type" is a term of the art understood by skilled persons and means the typical form of an organism, strain, gene, or characteristic as it occurs in nature as distinguished from mutant or variant forms. As used herein the term "variant" should be taken to mean the exhibition of qualities that have a pattern that deviates from the wild-type or comprises non naturally occurring components. The term "mutation," as used herein, refers to a substitution of a residue within a sequence, e.g., a nucleic acid or amino acid sequence, with another residue, or a deletion or insertion of one or more residues within a sequence. Mutations are typically described herein by identifying the original residue followed by the position of the residue within the sequence and by the identity of the newly substituted residue. Various methods for making the amino acid substitutions (mutations) provided herein are well known in the art, and are provided by, for example, Green and Sambrook, Molecular Cloning: A Laboratory Manual (4.sup.th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)). The term "uracil glycosylase inhibitor" or "UGI," as used herein, refers to a protein that is capable of inhibiting a uracil-DNA glycosylase base-excision repair enzyme. In some embodiments, the UGI proteins provided herein include fragments of UGI and proteins homologous to a UGI or a UGI fragment. In some embodiments, a UGI fragment comprises an amino acid sequence that comprises at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% of the amino acid sequence encoding UGI. The term "nuclear localization sequence" or "NLS" refers to an amino acid sequence that promotes import of a protein into the cell nucleus, for example, by nuclear transport. Nuclear localization sequences are known in the art and would be apparent to the skilled artisan. For example, NLS sequences are described in Plank et al., international PCT application, PCT / EP2000 / 011690, filed Nov. 23, 2000, published as WO / 2001 / 038547 on May 31, 2001, the contents of which are incorporated herein by reference for their disclosure of exemplary nuclear localization sequences. The term "nucleic acid programmable DNA binding protein" or "napDNAbp" refers to a protein that associates with a nucleic acid (e.g., DNA or RNA), such as a guide nucleic acid, that guides the napDNAbp to a specific nucleic acid sequence. For example, a Cas9 protein can associate with a guide RNA that guides the Cas9 protein to a specific DNA sequence that has complementarity to the spacer sequence in the guide RNA. In some embodiments, the napDNAbp is a class 2 microbial CRISPR-Cas effector. In some embodiments, the napDNAbp is a Cas9 domain, for example a nuclease active Cas9, a Cas9 nickase (nCas9), or a nuclease inactive Cas9 (dCas9). Examples of nucleic acid programmable DNA binding proteins include, without limitation, Cas9 (e.g., dCas9 and nCas9), CasX, CasY, Cpf1, C2c1, C2c2, C2C3, and Argonaute. It should be appreciated, however, that nucleic acid programmable DNA binding proteins also include nucleic acid programmable proteins that bind RNA. For example, the napDNAbp may be associated with a nucleic acid that guides the napDNAbp to an RNA. Other nucleic acid programmable DNA binding proteins are also within the scope of this disclosure, though they may not be specifically listed in this disclosure. The term "Cas9" or "Cas9 domain" refers to an RNA-guided nuclease comprising a Cas9 protein, or a fragment thereof (e.g., a protein comprising an active, inactive, or partially active DNA cleavage domain of Cas9, and / or the gRNA binding domain of Cas9). CRISPR (clustered regularly interspaced short palindromic repeat) is an adaptive immune system that provides protection against mobile genetic elements (viruses, transposable elements, and conjugative plasmids). CRISPR clusters contain spacers, sequences complementary to antecedent mobile elements, and target invading nucleic acids. CRISPR clusters are transcribed and processed into CRISPR RNA (crRNA). In type II CRISPR systems correct processing of pre-crRNA requires a trans-encoded small RNA (tracrRNA), endogenous ribonuclease 3 (mc), and a Cas9 protein. The tracrRNA serves as a guide for ribonuclease 3-aided processing of pre-crRNA. Subsequently, Cas9 / crRNA / tracrRNA endonucleolytically cleaves linear or circular dsDNA target complementary to the spacer. The target strand not complementary to crRNA is first cut endonucleolytically, then trimmed 3'-5' exonucleolytically. In nature, DNA-binding and cleavage typically requires protein and both RNAs. However, single guide RNAs ("sgRNA", or simply "gRNA") can be engineered so as to incorporate aspects of both the crRNA and tracrRNA into a single RNA species. See, e.g., Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna J. A., Charpentier E. Science 337:816-821 (2012), the entire contents of which is hereby incorporated by reference. Cas9 recognizes a short motif present in the target DNA sequence (the PAM or protospacer-adjacent motif) but not in the CRISPR repeat sequences to help distinguish non-self versus self, since the presence of the PAM is required for the binding activity and catalytic activity of Cas9. Cas9 nuclease sequences and structures are well known to those of skill in the art (see, e.g., Ferretti J. J., McShan W. M., Ajdic D. J., Savic D. J., Savic G., Lyon K., Primeaux C., Sezate S., Suvorov A. N., Kenton S., Lai H. S., Lin S. P., Qian Y., Jia H. G., Najar F. Z., Ren Q., Zhu H., Song L., White J., Yuan X., Clifton S. W., Roe B. A., McLaughlin R. E. "Complete genome sequence of an M1 strain of Streptococcus pyogenes." Proc. Natl. Acad. Sci. U.S.A. 98:4658-4663 (2001); Deltcheva E., Chylinski K., Sharma C. M., Gonzales K., Chao Y., Pirzada Z. A., Eckert M. R., Vogel J., Charpentier E. "CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III." Nature 471:602-607( 2011); and Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna J. A., Charpentier E. "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity." Science 337:816-821 (2012); the entire contents of each of which are incorporated herein by reference). Cas9 orthologs have been described in various species, including, but not limited to, Streptococcus pyogenes (S. pyogenes Cas9 or SpCas9) and Staphylococcus aureus (S. aureus Cas9 or SaCas9). Additional suitable Cas9 nucleases and sequences will be apparent to those of skill in the art based on this disclosure, and such Cas9 nucleases and sequences include Cas9 sequences from the organisms and loci disclosed in Chylinski K., Rhun A. L., and Charpentier E., "The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems." RNA Biol. 10:726-737 (2013); the entire contents of which are incorporated herein by reference. In some embodiments, a Cas9 nuclease has an inactive (e.g., an inactivated) DNA cleavage domain. In some embodiments, Cas9 is adapted from Streptococcus pyogenes (S. pyogenes; GenBank Ref: AP014596.1). In certain embodiments the Cas9 requires a PAM comprising the sequence NGG in the target DNA sequence for it to have binding activity and catalytic activity. In some embodiments, Cas9 is further engineered to require a PAM differing from the sequence NGG. In some embodiments, Cas9 is further engineered to not require a specific PAM (see, e.g., Walton R. T., Christie K. A., Whittaker M. N., Kleinstiver B. P. "Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants." Science 368:290-296 (2020); the entire contents of which are incorporated herein by reference). In certain embodiments, the Cas9 is adapted from S. pyogenes and requires a PAM comprising the sequence NGG in the target DNA sequence, is further engineered to require a PAM differing from the sequence NGG, or is further engineered to not require a specific PAM. A nuclease-inactivated Cas9 protein may interchangeably be referred to as a "dCas9" protein (for nuclease-"dead" Cas9). Methods for generating a Cas9 protein (or a fragment thereof) having an inactive DNA cleavage domain are known (see, e.g., Jinek et al., Science. 337:816-821 (2012); Qi L. S., Larson M. H., Gilbert L. A., Doudna J. A., Weissman J. S., Arkin A. P., Lim W. A. "Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression." Cell 152:1173-1183 (2013); the entire contents of each of which are incorporated herein by reference). In some embodiments, Cas9 refers to Cas9 from: Corynebacterium ulcerans (NCBI Refs: NC_015683.1, NC_017317.1); Corynebacterium diphtheria (NCBI Refs: NC_016782.1, NC_016786.1); Spiroplasma syrphidicola (NCBI Ref: NC_021284.1); Prevotella intermedia (NCBI Ref: NC_017861.1); Spiroplasma taiwanense (NCBI Ref: NC_021846.1); Streptococcus iniae (NCBI Ref: NC_021314.1); Belliella baltica (NCBI Ref: NC_018010.1); Psychroflexus torquisI (NCBI Ref: NC_018721.1); Streptococcus thermophilus (NCBI Ref: YP_820832.1), Listeria innocua (NCBI Ref: NP_472073.1), Campylobacter jejuni (NCBI Ref: YP_002344900.1), or Neisseria meningitidis (NCBI Ref: YP_002342100.1) or to a Cas9 from any other organism. In some embodiments, dCas9 corresponds to, or comprises in part or in whole, a Cas9 amino acid sequence having one or more mutations that inactivate the Cas9 nuclease activity. Such Cas9 variants are able to generate a single-strand DNA break (nick) at a specific location based on the gRNA-defined target sequence, leading to repair of the non-edited strand, ultimately resulting in a T to C change on the non-edited strand. A schematic representation of this process is shown in FIG. 1A. Briefly, and without wishing to be bound by any particular theory, the A of a A-T base pair can be deaminated to an inosine (I) by an adenosine deaminase, e.g., an engineered adenosine deaminase that deaminates an adenosine in DNA. Nicking the non- edited strand, having the T, facilitates removal of the T via mismatch repair mechanisms. A catalytically inactive inosine-specific nuclease (dISN) may inhibit inosine-specific nucleases (e.g., sterically) thereby preventing removal of the inosine (I). In some embodiments, the nucleic acid programmable DNA binding protein (napDNAbp) of any of the fusion proteins provided herein may be a CasX or CasY protein. In some embodiments, the napDNAbp is a CasX protein. In some embodiments, the napDNAbp is a CasY protein. The term "effective amount," as used herein, refers to an amount of a biologically active agent that is sufficient to elicit a desired biological response. For example, in some embodiments, an effective amount of a nucleobase editor may refer to the amount of the nucleobase editor that is sufficient to induce mutation of a target site specifically bound and mutated by the nucleobase editor. In some embodiments, an effective amount of a fusion protein provided herein, e.g., of a fusion protein comprising a nucleic acid programmable DNA binding protein and a deaminase domain (e.g., an adenosine deaminase domain) may refer to the amount of the fusion protein that is sufficient to induce editing of a target site specifically bound and edited by the fusion protein. As will be appreciated by the skilled artisan, the effective amount of an agent, e.g., a fusion protein, a nucleobase editor, a deaminase, a hybrid protein, a protein dimer, a complex of a protein (or protein dimer) and a polynucleotide, or a polynucleotide, may vary depending on various factors as, for example, on the desired biological response, e.g., on the specific allele, genome, or target site to be edited, on the cell or tissue being targeted, and on the agent being used. The terms "nucleic acid" and "nucleic acid molecule," as used herein, refer to a compound comprising a nucleobase and an acidic moiety, e.g., a nucleoside, a nucleotide, or a polymer of nucleotides. Typically, polymeric nucleic acids, e.g., nucleic acid molecules comprising three or more nucleotides are linear molecules, in which adjacent nucleotides are linked to each other via a phosphodiester linkage. In some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, "nucleic acid" refers to an oligonucleotide chain comprising three or more individual nucleotide residues. As used herein, the terms "oligonucleotide" and "polynucleotide" can be used interchangeably to refer to a polymer of nucleotides (e.g., a string of at least three nucleotides). In some embodiments, "nucleic acid" encompasses RNA as well as single and / or double- stranded DNA. Nucleic acids may be naturally occurring, for example, in the context of a genome, a transcript, an mRNA, tRNA, rRNA, siRNA, snRNA, a plasmid, cosmid, chromosome, chromatid, or other naturally occurring nucleic acid molecule. On the other hand, a nucleic acid molecule may be a non-naturally occurring molecule, e.g., a recombinant DNA or RNA, an artificial chromosome, an engineered genome, or fragment thereof, or a synthetic DNA, RNA, DNA / RNA hybrid, or including non-naturally occurring nucleotides or nucleosides. Furthermore, the terms "nucleic acid," "DNA," "RNA," and / or similar terms include nucleic acid analogs, e.g., analogs having other than a phosphodiester backbone. Nucleic acids can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, and backbone modifications. A nucleic acid sequence is presented in the 5’ to 3’ direction unless otherwise indicated. In some embodiments, a nucleic acid is or comprises natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3- methyl adenosine, 5-methylcytidine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5- iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioates and 5'-N- phosphoramidite linkages). The terms "protein," "peptide," and "polypeptide" are used interchangeably herein, and refer to a polymer of amino acid residues linked together by peptide (amide) bonds. The terms refer to a protein, peptide, or polypeptide of any size, structure, or function. Typically, a protein, peptide, or polypeptide will be at least three amino acids long. A protein, peptide, or polypeptide may refer to an individual protein or a collection of proteins. One or more of the amino acids in a protein, peptide, or polypeptide may be modified, for example, by the addition of a chemical entity such as a carbohydrate group, a hydroxyl group, a phosphate group, a farnesyl group, an isofarnesyl group, a fatty acid group, a linker for conjugation, functionalization, or other modification, etc. A protein, peptide, or polypeptide may also be a single molecule or may be a multi-molecular complex. A protein, peptide, or polypeptide may be just a fragment of a naturally occurring protein or peptide. A protein, peptide, or polypeptide may be naturally occurring, recombinant, or synthetic, or any combination thereof. The term "fusion protein" as used herein refers to a hybrid polypeptide which comprises protein domains from at least two different proteins. One protein may be located at the amino-terminal (N-terminal) portion of the fusion protein or at the carboxy-terminal (C-terminal) protein thus forming an "amino-terminal fusion protein" or a "carboxy-terminal fusion protein," respectively. A protein may comprise different domains, for example, a nucleic acid binding domain (e.g., the gRNA binding domain of Cas9 that directs the binding of the protein to a target site) and a nucleic acid cleavage domain or a catalytic domain of a nucleic-acid editing protein. In some embodiments, a protein comprises a proteinaceous part, e.g., an amino acid sequence constituting a nucleic acid binding domain, and an organic compound, e.g., a compound that can act as a nucleic acid cleavage agent. In some embodiments, a protein is in a complex with, or is in association with, a nucleic acid, e.g., RNA. Any of the proteins provided herein may be produced by any method known in the art. For example, the proteins provided herein may be produced via recombinant protein expression and purification, which is especially suited for fusion proteins comprising a peptide linker. Methods for recombinant protein expression and purification are well known, and include those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4.sup.th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2012)), the entire contents of which are incorporated herein by reference. The term "RNA-programmable nuclease" and "RNA-guided nuclease" are used interchangeably herein and refer to a nuclease that forms a complex with (e.g., binds or associates with) one or more RNA(s) that is not a target for cleavage. In some embodiments, an RNA-programmable nuclease, when in a complex with an RNA, may be referred to as a nuclease:RNA complex. Typically, the bound RNA(s) is referred to as a guide RNA (gRNA). gRNAs can exist as a complex of two or more RNAs, or as a single RNA molecule. gRNAs that exist as a single RNA molecule may be referred to as single-guide RNAs (sgRNAs), though "gRNA" is used interchangeably to refer to guide RNAs that exist as either single molecules or as a complex of two or more molecules. Typically, gRNAs that exist as single RNA species comprise two domains: (1) a domain that shares homology to a target nucleic acid (e.g., and directs binding of a Cas9 complex to the target), which may be referred to as a spacer or a spacer sequence; and (2) a domain that binds a Cas9 protein. In some embodiments, domain (2) corresponds to a sequence known as a tracrRNA and comprises a stem-loop structure. For example, in some embodiments, domain (2) is identical or homologous to a tracrRNA as provided in Jinek et al., Science 337:816-821 (2012), the entire contents of which is incorporated herein by reference. Other examples of gRNAs (e.g., those including domain 2) can be found in U.S. Provisional Patent Application, U.S.S.N. 61 / 874,682, filed Sep. 6, 2013, entitled "Switchable Cas9 Nucleases And Uses Thereof," and U.S. Provisional Patent Application, U.S.S.N. 61 / 874,746, filed Sep. 6, 2013, entitled "Delivery System For Functional Nucleases," the entire contents of each are hereby incorporated by reference in their entirety. Exemplary gRNAs and target sites for effecting a change in a sequence associated with the PKU phenotype are identified in Table 1. Table 1 Sequence Sequence SEQ ID In some embodiments, a gRNA comprises two or more of domains and may be referred to as an "extended gRNA." For example, an extended gRNA will, e.g., bind two or more Cas9 proteins and bind a target nucleic acid at two or more distinct regions, as described herein. The gRNA comprises a nucleotide sequence that complements a target site, which mediates binding of the nuclease / RNA complex to said target site, providing the sequence specificity of the nuclease:RNA complex. In some embodiments, the RNA-programmable nuclease is the (CRISPR-associated system) Cas9 endonuclease, for example, Cas9 (Csn1) from S. pyogenes (see, e.g., Ferretti J. J., McShan W. M., Ajdic D. J., Savic D. J., Savic G., Lyon K., Primeaux C., Sezate S., Suvorov A. N., Kenton S., Lai H. S., Lin S. P., Qian Y., Jia H. G., Najar F. Z., Ren Q., Zhu H., Song L., White J., Yuan X., Clifton S. W., Roe B. A., McLaughlin R. E. "Complete genome sequence of an M1 strain of Streptococcus pyogenes." Proc. Natl. Acad. Sci. U.S.A. 98:4658-4663 (2001); Deltcheva E., Chylinski K., Sharma C. M., Gonzales K., Chao Y., Pirzada Z. A., Eckert M. R., Vogel J., Charpentier E. "CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III." Nature 471:602-607 (2011); and Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna J. A., Charpentier E. "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity." Science 337:816-821 (2012); the entire contents of each of which are incorporated herein by reference. Because RNA-programmable nucleases (e.g., Cas9) use RNA:DNA hybridization to target DNA cleavage sites, these proteins are able to be targeted, in principle, to any sequence specified by the guide RNA. Methods of using RNA-programmable nucleases, such as Cas9, for site-specific cleavage (e.g., to modify a genome) are known in the art (see e.g., Cong, L. et al., "Multiplex genome engineering using CRISPR / Cas systems." Science 339:819-823 (2013); Mali, P. et al. "RNA-guided human genome engineering via Cas9." Science 339:823-826 (2013); Hwang, W. Y. et al. "Efficient genome editing in zebrafish using a CRISPR-Cas system." Nature Biotechnology 31:227-229 (2013); Jinek, M. et al. "RNA-programmed genome editing in human cells." eLife 2:e00471 (2013); Dicarlo, J. E. et al. "Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems." Nucleic Acids Research 41:4336-4343 (2013); Jiang, W. et al. "RNA-guided editing of bacterial genomes using CRISPR-Cas systems." Nature Biotechnology 31:233-239 (2013); the entire contents of each of which are incorporated herein by reference). The term "subject," as used herein, refers to an individual organism, for example, an individual mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a non-human primate. In some embodiments, the subject is a rodent. In some embodiments, the subject is a sheep, a goat, a cattle, a cat, or a dog. In some embodiments, the subject is a vertebrate, an amphibian, a reptile, a fish, an insect, a fly, or a nematode. In some embodiments, the subject is a research animal. In some embodiments, the subject is genetically engineered, e.g., a genetically engineered non- human subject. The subject may be of either sex and at any stage of development. The term "target site" refers to a sequence within a nucleic acid molecule that is deaminated by a deaminase or a fusion protein comprising a deaminase, (e.g., a dCas9-adenosine deaminase fusion protein provided herein). The terms "treatment," "treat," and "treating" refer to a clinical intervention aimed to reverse, alleviate, delay the onset of, or inhibit the progress of a disease or disorder, or one or more symptoms thereof, as described herein. As used herein, the terms "treatment," "treat," and "treating" refer to a clinical intervention aimed to reverse, alleviate, delay the onset of, or inhibit the progress of a disease or disorder, or one or more symptoms thereof, as described herein. In some embodiments, treatment may be administered after one or more symptoms have developed and / or after a disease has been diagnosed. In other embodiments, treatment may be administered in the absence of symptoms, e.g., to prevent or delay onset of a symptom or inhibit onset or progression of a disease. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of symptoms and / or in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example, to prevent or delay their recurrence. The term "recombinant" as used herein in the context of proteins or nucleic acids refers to proteins or nucleic acids that do not occur in nature but are the product of human engineering. For example, in some embodiments, a recombinant protein or nucleic acid molecule comprises an amino acid or nucleotide sequence that comprises at least one, at least two, at least three, at least four, at least five, at least six, or at least seven mutations as compared to any naturally occurring sequence. In certain embodiments, the invention provides methods comprising delivering one or more polynucleotides, such as or one or more vectors as described herein, one or more transcripts thereof, and / or one or proteins transcribed therefrom, to a host cell. In some aspects, the invention further provides cells produced by such methods, and organisms (such as animals, plants, or fungi) comprising or produced from such cells. In some embodiments, a CRISPR enzyme in combination with (and optionally complexed with) a gRNA is delivered to a cell. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding components of a CRISPR system to cells in culture, or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell. For a review of gene therapy procedures, see Anderson, Science 256:808-813 (1992); Nabel & Feigner, TIBTECH 11:211- 217 (1993); Mitani & Caskey, TIBTECH 11:162-166 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6:1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36(1995); Kremer & Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada et al., in Current Topics in Microbiology and Immunology Doerfler and Bihm (eds) (1995); and Yu et al., Gene Therapy 1:13-26 (1994). Methods of non-viral delivery of nucleic acids include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid-nucleic acid conjugates, lipid nanoparticles, artificial virions, virus-like particles, naked DNA, and agent-enhanced uptake of DNA. Lipofection is described in e.g., U.S. Pat. Nos. 5,049,386, 4,946,787, and 4,897,355, and lipofection reagents are sold commercially (e.g., Transfectam™ and Lipofectin™). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those of Feigner, WO 91 / 17424; WO 91 / 16024. Delivery can be to cells (e.g., in vitro or ex vivo administration) or target tissues (e.g., in vivo administration). Methods to deliver gene editing agents in vivo as ribonucleoproteins is another approach and provides safety advantages over nucleic acid delivery approaches. Engineered DNA-free virus-like particles (eVLPs) have been developed that efficiently package and deliver base editor or Cas9 ribonucleoproteins. By engineering VLPs to overcome cargo packaging, release, and localization bottlenecks, fourth-generation eVLPs have been developed that mediate efficient base editing in several primary mouse and human cell types. Using different glycoproteins in eVLPs alters their cellular tropism. Single injections of eVLPs into mice support therapeutic levels of base editing in multiple tissues, reducing serum Pcsk9 levels 78% following 63% liver editing, and partially restoring visual function in a mouse model of genetic blindness. In vitro and in vivo off-target editing from eVLPs was virtually undetected, an improvement over AAV or plasmid delivery. Thus, eVLPs provide promising vehicles for therapeutic macromolecule delivery that combine key advantages of both viral and nonviral delivery. See Banskota et al. Cell 185:250-265 (2021). The preparation of lipid nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art (see, e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820 (1992); U.S.Pat. Nos.4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787). Other lipid nanoparticle formulations are disclosed in 11,066,355; 11,059,807; US patent publications 2021 / 0106538 and 2021 / 0113466. The use of RNA or DNA viral based systems for the delivery of nucleic acids take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus. Viral vectors can be administered directly to patients (in vivo) or they can be used to treat cells in vitro, and the modified cells may optionally be administered to patients (ex vivo). Conventional viral based systems could include retrovirus, lentivirus, adenovirus, adeno-associated virus, and herpes simplex virus vectors for gene transfer. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long-term expression of the inserted transgene. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues. The tropism of a retrovirus can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. Selection of a retroviral gene transfer system would therefore depend on the target tissue. Retroviral vectors comprise cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression. Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immuno deficiency virus (SIV), human immuno deficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992); Sommnerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT / US94 / 05700). In applications where transient expression is preferred, adenoviral based systems may be used. Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system. Adeno-associated virus ("AAV") vectors may also be used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g., West et al., Virology 160:38-47 (1987); U.S. Pat. No. 4,797,368; WO 93 / 24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994). Several different AAV serotypes have been used to advantage for transduction of mammalian cells; these include, for example AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9 that have different tropisms for cell types of interest. Construction of recombinant AAV vectors is described in a number of publications, including U.S. Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989). In certain preferred embodiments, the viral vector is a split AA8 vector or a split AAV9 vector. Packaging cells are typically used to form virus particles that are capable of infecting a host cell. Such cells include HEK 293 cells, which package adenovirus, and y2 cells or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are usually generated by producing a cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host, other viral sequences being replaced by an expression cassette for the polynucleotide(s) to be expressed. The missing viral functions are typically supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically only possess ITR sequences from the AAV genome which are required for packaging and integration into the host genome. Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences. The cell line may also be infected with adenovirus as a helper. The helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid. The helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV. In some embodiments, a host cell is transiently or non-transiently transfected with one or more vectors described herein. In some embodiments, a cell is transfected as it naturally occurs in a subject. In some embodiments, a cell that is transfected is taken from a subject. In some embodiments, the cell is derived from cells taken from a subject, such as a cell line. In one aspect, the invention provides for methods of modifying a target polynucleotide in a eukaryotic cell, which may be in vivo, ex vivo, or in vitro. In some embodiments, the method comprises sampling a cell or population of cells from a human or non-human animal and modifying the cell or cells. Culturing may occur at any stage ex vivo. The cell or cells may be re- introduced into the human or non-human animal. In one aspect, the invention provides for methods of modifying a target polynucleotide in a eukaryotic cell. In some embodiments, the method comprises allowing an adenine base editor (ABE) CRISPR complex to bind to the target polynucleotide to effect correction of a mutation in said target polynucleotide thereby modifying the target polynucleotide, wherein the CRISPR complex comprises the ABE CRISPR enzyme complexed with a gRNA hybridized to a target sequence within said target polynucleotide. In one aspect, the invention provides kits containing any one or more of the elements disclosed in the above methods and compositions. In some embodiments, the kit comprises a vector system or components for an alternative delivery system such as those described above and instructions for using the kit. In some embodiments, the vector or delivery system comprises an ABE CRISPR enzyme complexed with a gRNA for base editing of a target nucleic acid. The kit can contain a lipid nanoparticle formulation encapsulating the appropriate base editor and at least one gRNA. Elements may be provided individually or in combinations, and may be provided in any suitable container, such as a vial, a bottle, or a tube. In some embodiments, the kit includes instructions in one or more languages, for example in more than one language. In some embodiments, a kit comprises one or more reagents for use in a process utilizing one or more of the elements described herein. Reagents may be provided in any suitable container. For example, a kit may provide one or more reaction or storage buffers. Reagents may be provided in a form that is usable in a particular assay, or in a form that requires addition of one or more other components before use (e.g., in concentrate or lyophilized form). A buffer can be any buffer, including but not limited to a sodium carbonate buffer, a sodium bicarbonate buffer, a borate buffer, a Tris buffer, a MOPS buffer, a HEPES buffer, and combinations thereof. In some embodiments, the buffer is alkaline. In some embodiments, the buffer has a pH from about 7 to about 10. In some embodiments, the kit comprises one or more oligonucleotides corresponding to a gRNA sequence for insertion into a vector so as to operably link the gRNA sequence and a regulatory element. In some embodiments, the kit comprises a homologous recombination template polynucleotide. In one aspect, the invention provides methods for using one or more elements of a CRISPR system. The CRISPR complex of the invention provides an effective means for modifying a target polynucleotide. The CRISPR complex of the invention has a wide variety of utility including modifying (e.g., deleting, inserting, translocating, inactivating, activating) a target polynucleotide in a multiplicity of cell types in methods of gene therapy. As used herein, the term “metabolic gene” is defined as an inherited single gene anomaly, i.e., a single gene coding for an enzyme is defective, and that defect causes an enzyme deficiency. The enzyme deficiency produces an inherited metabolic disease or disorder, of which a subtype is an inborn error of metabolism. Most single gene anomalies are autosomal recessive, i.e., two defective copies of the gene must be present for the disease or trait to develop. Non- limiting examples of metabolic disorders include glucose metabolism disorders, lipid metabolism disorders, malabsorption syndromes, metabolic brain diseases, calcium metabolism disorders, DNA repair-deficiency disorders, hyperlactatemia, iron metabolism disorders, metabolic syndrome X, inborn errors of metabolism, phosphorus metabolism disorders, and acid-base imbalance. Inherited metabolic diseases previously were classified as disorders of carbohydrate metabolism, amino acid metabolism, organic acid metabolism, or lysosomal storage diseases; however, new inherited disorders of metabolism have been discovered, and the categories have multiplied. Certain major classes of congenital metabolic diseases include disorders of carbohydrate metabolism, e.g., glycogen storage disease, glucose-6-phosphate dehydrogenase (G6PD) deficiency (resulting from a mutation in the G6PD gene); disorders of amino acid metabolism, e.g., phenylketonuria, maple syrup urine disease, glutaric acidemia type 1; urea cycle disorder (urea cycle defects), e.g., carbamoyl phosphate synthetase I deficiency; disorders of organic acid metabolism (organic acidurias), e.g., alcaptonuria, 2-hydroxyglutaric acidurias; disorders of fatty acid oxidation and mitochondrial metabolism; e.g., medium-chain acyl- coenzyme A dehydrogenase deficiency (often called “MCADD”) (caused by mutations in the ACADM gene, which results in medium-chain fatty acids not being metabolized properly and leads to lethargy and hypoglycemia); disorders of porphyrin metabolism, e.g., acute intermittent porphyria; disorders of purine or pyrimidine metabolism, e.g., Lesch-Nyhan syndrome (caused by mutations in the hypoxanthine phosphoribosyltransferase 1 [HPRT1] gene and inherited in an X-linked recessive manner); disorders of steroid metabolism, e.g., lipoid congenital adrenal hyperplasia, congenital adrenal hyperplasia; disorders of mitochondrial function, e.g., Keams- Sayre syndrome; disorders of peroxisomal function, e.g., Zellweger syndrome (caused by mutations in genes encoding peroxins, e.g., PEX1 , PEX2 , PEX3 , PEX5 , PEX6 , PEX10 , PEX12 , PEX13, PEX14 , PEX16, PEX19, or PEX26 genes); and lysosomal storage disorders, e.g., Gaucher's disease (of which there are three subtypes, all of which are autosomal recessive) and Niemann-Pick disease (has an autosomal recessive inheritance pattern; Niemann-Pick types A and B are caused by a mutation in the Sphingomyelin phosphodiesterase 1 [SMPD1] gene; mutations in NPC1 gene or NPC2 gene cause Niemann-Pick disease, type C [NPC], which affects a protein used to transport lipids; Niemann-Pick type D shares a specific mutation in the NPC1 gene, patients having type D share a common Nova Scotian ancestry). In certain aspects, an adenine base editor (ABE) complex for programming conversion of adenine to guanine in a patient in need thereof is provided where the patient has a target DNA molecule harboring a mutation associated with phenylketonuria. An exemplary ABE complex includes a modified TadA enzyme, a catalytically impaired Cas9 protein and at least one single guide RNA (sgRNA) which directs said ABE complex to said mutated target DNA molecule, which upon contact converts adenosine in said mutation to inosine, thereby catalyzing an A-T to G-C transition following DNA repair or DNA replication. The activity window of each ABE typically ranges across several positions within the protospacer DNA sequence (e.g., the ABE8.8 window ranges from position 3 to position 9, with peak editing observed at position 6 of the protospacer), with different ABEs having different windows (Anzalone et al., 2020). ABEs have the potential to edit any adenine within the window, which could include a desired target adenine but also undesired additional adenines (bystander edits). Published ABEs with Streptococcus pyogenes Cas9 nickase include so-called eighth-generation ABEs (harboring optimized deaminase domains resulting from eight rounds of molecular evolution)—the most commonly used to date are ABE8.8, ABE8.20, and ABE8e— and circularly permuted or inlaid ABEs, in which the deaminase domain is embedded within a loop of the Cas9 nickase protein, rather than fused to the N-terminal end, which has the effect of shifting the editing window further towards the 3’ end of the protospacer sequence (Gaudelli et al., 2020; Richter et al., 2020; Chu et al., 2021). Similar ABEs with Cas9 nickase from other bacterial species (e.g., Staphylococcus aureus) have been reported (Gaudelli et al., 2020; Richter et al., 2020). Screening Methods Using the compositions and methods described herein, methods for identifying effective adenosine base editor (ABE) / guide polynucleotide editing complexes for correcting mutations in can be performed. In certain embodiments, the screening technique involves the use of host cells which have the target mutation. In certain embodiments, the methods comprise a) contacting a cell harboring a control mutation with a control ABE / guide polynucleotide editing complex that edits the control mutation; b) contacting a cell harboring a target mutation with a test ABE / guide polynucleotide editing complex that edits the target mutation; c) comparing the corrective activity of the control ABE / guide polynucleotide editing complex with the corrective activity of the at least one test ABE / guide polynucleotide editing complex; and e) identifying a test ABE / guide polynucleotide editing complex having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, or more of the corrective activity of the control ABE / guide polynucleotide editing complex. In certain embodiments, the methods further comprise comparing the level of bystander editing of the test ABE / guide polynucleotide editing complex and the bystander editing of the control ABE / guide polynucleotide editing complex. In certain embodiments, the methods further comprise comparing the level of bystander editing of the test ABE / guide polynucleotide editing complex and the bystander editing of the control ABE / guide polynucleotide editing complex. The “screening” of a candidate editing complex refers to conducting an assay that is capable of evaluating the efficacy and / or specificity of the candidate. In this context, “efficacy” refers to the ability of the candidate to effect the cell or organism it is administered to in a beneficial way: for example, the correction of a target mutation. The “target mutation” refers to a change in a DNA sequence that is associated with a particular disease or biological process. In certain embodiments, the target mutation is a disease- associated mutation. A “disease-associated mutation” refers to a change in the DNA sequence of a gene that causes a person to have or be at risk of developing a certain genetic disease or disorder. In certain embodiments, the disease associated mutation is a mutation associated with PKU. In certain embodiments, the target mutation is selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp)c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), and c.728G>A (p.Arg243Gln). In certain embodiments, the methods comprise identifying the effect of one or more test ABE / guide polynucleotide editing complex on a single target mutation. In certain embodiments, the methods comprise identifying the effect of one or more the test ABE / guide polynucleotide editing complex on multiple target mutations. The terms “agent” and “test adenosine base editor / guide polynucleotide editing complex” are used interchangeably herein and denote a combination of a base editor and a guide polynucleotide exhibits the capacity to correct a target mutation. Agents are evaluated for potential corrective activity by inclusion in screening assays described herein. In certain embodiments, the test adenosine base editor / guide polynucleotide editing complex comprises the guide polynucleotides described in table 1 and / or base editors described in table 2. The term “control mutation” refers to a known mutation that has a previously validated corrective activity when contacted with a specific ABE / guide polynucleotide editing complexes. In certain embodiments, the control mutation is treated with an ABE / gRNA editing complex that has previously been validated as having a therapeutically effective activity against the control mutation. In certain embodiments, the control mutation is c.842C>T (p.Pro281Leu) or c.1222C>T (p.Arg408Trp). In certain embodiments, the control mutation can be corrected with at least about 30%, 29%, 28%, 27%, 26% 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, or 10% corrective activity. The term “control ABE / guide polynucleotide editing complex” refers to a combination of a base editor and a guide polynucleotide exhibits a previously validated therapeutically effective corrective activity on a control mutation. In certain embodiments, control ABE / guide polynucleotide editing complex can correct the control mutation with at least about 30%, 29%, 28%, 27%, 26% 25%, 24%, 23%, 22%, 21%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, or 10% corrective activity. The term “corrective activity” refers to the editing efficiency of an ABE / guide polynucleotide editing complex. In certain embodiments, the corrective activity can be calculated using the following equation: (# of corrected cells / total # of cells contacted with the ABE / guide polynucleotide editing complex)*100. In certain embodiments, a test ABE / gRNA editing complex is identified as corrective of a target mutation if it has at least between 50%-100% of the corrective activity of the control ABE / gRNA editing complex. In certain embodiments, a test ABE / gRNA editing complex is identified as corrective of a target mutation if it has at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the corrective activity of the control ABE / gRNA editing complex. In certain embodiments, a test ABE / gRNA editing complex is identified as corrective of a target mutation if it has a greater corrective activity than the control ABE / gRNA editing complex. MATERIALS AND METHODS The following materials and methods are provided to facilitate the practice of the present invention. For prime editing, the pCMV-PEmax-P2A-hMLH1dn plasmid (Addgene #174828) was used to express the prime editor (PEmax), the pU6-tevopreq1-GG-acceptor plasmid (Addgene #174038) was used to express the prime editing guide RNA (pegRNA)—for insertion of the PAH c.1222C>T variant—following Gibson cloning of the oligonucleotide-synthesized pegRNA sequence, and the pGuide plasmid (Addgene #64711) was used to express the nicking guide RNA (ngRNA) following subcloning of the oligonucleotide-synthesized ngRNA sequence. For base editing, a variety of adenine base editor (ABE)-expressing plasmids were used including: SpG-ABE8e (Addgene #185911), SpG-ABE8.20 (Addgene #185916), SpRY-ABE8e (Addgene #185912), SpRY-ABE8.20 (Addgene #185917), and SpRY-ABE8.8 (made by combining elements of Addgene #185912 and Addgene #136294). The pGuide plasmid (Addgene #64711) was used to express each accompanying guide RNA (specific for the PAH c.1222C>T variant) following subcloning of the oligonucleotide-synthesized gRNA sequence. The lentiGuide-Puro plasmid (Addgene #52963) was used to produce lentiviral particles. Sequences encoding exemplary adenine base editors (ABEs) used in these Examples are provided in the table below: TABLE 2 SpRY-ABE88 A G E D V Q R E N I K S K Y G V S E A G G E D V Q R E N I K S K Y G V S E A G E D V Q R E N I K S K Y G V S E A G E D V Q R E N I K S K Y G V S E G A G G E D V Q R E N I K S K Y G V S E G A G E D V Q R E N I K S K Y G V S E G A G E D V Q R E N I K S K Y G S E A G G E D V Q R E N I K S K Y G S E A G E D V Q R E N I K S K Y G S E 100-mer PAH4 gRNA was chemically synthesized under solid phase synthesis conditions by a commercial supplier (Agilent) with end-modifications as well as heavy 2’-O- methylribosugar modification: PAH4, 5’-mG*mG*mC*CAAGGUAUUGUGGCAGCGUUUUAGAmGmCmUmAmGmAmA mAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAm AmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU- 3’; (SEQ ID NO: 77) where “m” and * respectively indicate 2’-O-methylation and phosphorothioate linkage. SpRY-ABE8.8 mRNA was produced via in vitro transcription (IVT) and purification. In brief, a plasmid DNA template containing a codon-optimized SpRY-ABE8.8 coding sequence to express the SpRY-ABE8.8 protein (SEQ ID NO: 78) and a 3’ polyadenylate sequence was linearized. An IVT reaction containing linearized DNA template, T7 RNA polymerase, NTPs, and cap analog was performed to produce mRNA containing N1-methylpseudouridine. After digestion of the DNA template with DNase I, the mRNA product underwent purification and buffer exchange, and the purity of the final mRNA product was assessed with spectrophotometry and capillary gel electrophoresis. Elimination of double-stranded RNA contaminants was assessed using dot blots and transfection into human dendritic cells. Endotoxin content was measured using a chromogenic Limulus amebocyte lysate (LAL) assay; all assays were negative. Lipid nanoparticles (LNPs) were formulated as previously described, with the lipid components (SM-102, 1,2-distearoyl-sn-glycero-3-phosphocholine, cholesterol, and a PEG-lipid) being rapidly mixed with an aqueous buffer solution containing ABE8.8 mRNA and PAH4 gRNA in a 1:1 ratio by weight in 25 mM sodium acetate (pH 4.0). The resulting LNP formulations were subsequently dialyzed against sucrose-containing buffer, concentrated using Amicon Ultra-15 mL Centrifugal Filter Units (Millipore Sigma), sterile-filtered using 0.2-µm filters, and frozen until use. HuH-7 human hepatoma cells were obtained from the Japanese Collection of Research Bioresources (JCRB) Cell Bank and maintained in culture with DMEM containing 1g / L glucose and supplemented with 10% FBS (Thermo Fisher). HuH-7 cells were maintained in Dulbecco’s modified Eagle’s medium (containing 4 mM L-glutamine and 1 g / L glucose) with 10% fetal bovine serum and 1% penicillin / streptomycin at 37°C with 5% CO2. To make homozygous R408W HuH-7 clones, HuH-7 cells were seeded on 6-well plates (Corning) at 3.5 × 105cells per well. At 16–24 hours after seeding, cells were transfected at approximately 80–90% confluency with 9 μL TransIT®-LT1 Transfection Reagent, 1.5 μg PEmax plasmid, 0.75 µg epegRNA- expressing plasmid, and 0.75 μg nicking gRNA plasmid. Cells were dissociated with trypsin 48 hours post-transfection and replated onto 10-cm plates (5,000 cells / plate) with conditioned medium to facilitate recovery, and genomic DNA was isolated from the remainder of the cells as a pool to perform PCR and Sanger sequencing of the PAH locus at the site of the c.1222C>T variant. Single cells were permitted to expand for 7-14 days to establish clonal populations. Colonies were manually picked and replated into individual wells of a 96-well plate. Genomic DNA was isolated from individual clones, and PCR and Sanger sequencing was performed to identify homozygous R408W HuH-7 clones. One representative clone was expanded for use in subsequent studies. To make HuH-7 cells with six PAH variants (c.1222C>T, c.842C>T, c.1066–11G>A, c.782G>A, c.728G>A, and c.1315+1G>A), a single DNA cassette comprising genomic segments flanking each of these variants was subcloned into the lentiGuide-Puro plasmid using standard techniques, and the plasmid was used to generate lentiviral particles using standard techniques. Wild-type HuH-7 cells were treated with the lentiviral particles and selected with puromycin in the media at a concentration of 2 µg / mL for 5 to 7 days. The cells were expanded for use in subsequent studies. For assessment of base editing of the PAH c.1222C>T variant, homozygous R408W HuH-7 cells were seeded on 6-well plates (Corning) at 3.5 × 105cells per well. At 16–24 hours after seeding, cells were transfected at approximately 80–90% confluency with 9 μL TransIT®- LT1 Transfection Reagent (MIR2300, Mirus), 2 μg base editor plasmid, and 1 μg gRNA plasmid per well according to the manufacturer’s instructions. Similar conditions were used for assessment of base editing of the PAH variants in the lentivirus-infected HuH-7 cells. In other experiments, LNPs were added at various doses (quantified by the total amount of RNA within the LNPs) directly to the media. Cells were cultured for 72 hours after transfection, and then media were removed, cells were washed with 1× DPBS (Corning), and genomic DNA was isolated using the DNeasy Blood and Tissue Kit (QIAGEN) according to the manufacturer’s instructions. PCR amplification of the target sequences (PAH locus at the site of the c.1222C>T variant, or the cassette introduced by lentivirus infection) in genomic DNA samples from transfected HuH-7 cells was performed using NEBnext High-Fidelity 2X PCR Master Mix (New England Biolabs) with locus-specific primers containing 5′ Nextera adaptor sequences (Illumina), followed by purification of the PCR amplicons with the NGS Normalization 96-Well Kit (Norgen Biotek). A second round of PCR with the Nextera XT Index Kit V2 Set A and / or Nextera XT Index Kit V2 Set D (Illumina), followed by purification with the NGS Normalization 96-Well Kit, generated barcoded libraries, which were pooled and quantified using a Qubit 3.0 Fluorometer. After denaturation, dilution to 10 pM, and supplementation with 15% PhiX, the pooled libraries underwent single-end or paired-end next-generation sequencing on an Illumina MiSeq System. The amplicon sequencing data were analyzed with CRISPResso2 v2 (available on the world wide web at: crispresso.pinellolab.partners.org / ) and custom scripts. For on-target editing, A-to-G editing was quantified at the site of the R408W variant (position 5 of the PAH4 protospacer sequence) and at the sites of potential bystander adenine editing (positions 6 and 10 of the PAH4 protospacer sequence). In some cases, PCR amplicons were subjected to confirmatory Sanger sequencing, performed by GENEWIZ, with editing frequencies estimated from the chromatograms. A PKU mouse model with one or more humanized PAH R408W alleles was generated using in vitro transcribed Cas9 mRNA, a synthetic gRNA (spacer sequence 5’- AGCGAACGGAGAAGGGCCGG-3’ (SEQ ID NO: 79)) (Integrated DNA Technologies), and a synthetic single-strand DNA oligonucleotide (Integrated DNA Technologies) with homology arms matching the target site and harboring the R408W variant and synonymous variants (bold with underline): 5’-AAAAGCCACTTGGAACTCCTCCAGGATAACCTGTCTTTAAATGGTGTCCTTCACTG GGGTCCTTGGTTTTGGTTTCAGGAACTTTGCTGCCACAATACCTTGGCCCTTCTCAGT TCGCTACGACCCCTACACTCAAAGGGTTGAGGTCCTGGACAATACTCAGCAGTTGAA GATTTTAGCTGACTCCATTAATAGTAAGT-3’ (SEQ ID NO: 80). The mixture of the 3 components was injected into cytoplasm of fertilized oocytes from C57BL / 6J mice at the Penn Vet Transgenic Mouse Core (available on the world wide web at: vet.upenn.edu / research / core- resources-facilities / transgenic-mouse-core). Genomic DNA samples from founders were screened for knock-in of the desired sequence in the Pah locus via homology-directed repair. Founders with the humanized R408W allele were bred through two generations to obtain homozygous mice. A different PKU mouse model with one or more humanized PAH R408W alleles was generated through the use of homologous recombination in mouse embryonic stem cells, followed by blastocyst injections, generation of chimeras, and subsequent breeding, as illustrated in Figure 7. Homozygous and compound heterozygous humanized PKU mice, as well as heterozygous humanized non-PKU mice, were generated as littermates / colony-mates via timed breeding, in some cases using wild-type C57BL / 6J mice (stock no. 000664) obtained from The Jackson Laboratory. Genotyping was performed using PCR amplification from genomic DNA samples (prepared from clipped tails / ears) followed by next-generation sequencing. LNPs were administered to the mice via retro-orbital injection under anesthesia with 1%-2% inhaled isoflurane. In short-term studies, mice were euthanized at 1 week after treatment, and 8 liver samples (2 from each lobe) and samples of other organs were obtained on necropsy and processed with the DNeasy Blood and Tissue Kit (QIAGEN) as per the manufacturer’s instructions to isolate genomic DNA. Next-generation sequencing results from the liver samples were averaged to provide quantification of whole-liver editing. Blood samples were collected via the tail tip at various time points (pre-treatment, day 1, day 2, day 3, and day 7), in the early afternoon to account for diurnal variation in blood phenylalanine levels. The blood phenylalanine levels were measured by an enzymatic method using the Phenylalanine Assay Kit (MAK005, Millipore Sigma) according to the manufacturers’ instructions. Briefly, plasma samples were deproteinized with a 10 kDa MWCO spin filter (CLS431478-25EA, Millipore Sigma) and pre-treated with 5 µL of tyrosinase for 10 minutes at room temperature prior to start of the assay. Reaction mixes were made according to the manufacturers’ instructions, and the fluorescence intensity of each sample was measured (λex = 535 / λem = 587 nm). Mice were euthanized by CO2inhalation at the time of tissue collection. For next- generation sequencing (NGS), PCR reactions were performed using NEBNext Polymerase (NEB) with locus-specific primers containing 5′ Nextera adaptor sequences (Illumina). The following program was used for all genomic DNA PCRs: 98°C for 20 seconds, 35× (98°C for 20 seconds, 57°C for 30 seconds, 72°C for 10 seconds), 72°C for 2 minutes. PCR products were visualized via capillary electrophoresis (QIAxcel, QIAGEN) and then purified and normalized via the NGS Normalization 96-Well Kit (Norgen Biotek Corporation). A secondary barcoding PCR was conducted to add Illumina barcodes (Nextera XT Index Kit V2 Set A and / or Nextera XT Index Kit V2 Set D) using ≈15 ng of first-round PCR product as template, followed by purification and normalization. Final pooled libraries were quantified using a Qubit 3.0 Fluorometer (Thermo Fisher Scientific) and then after denaturation, dilution to 10 pM, and supplementation with 15% PhiX, underwent single-end or paired-end sequencing on an Illumina MiSeq System. The amplicon sequencing data were analyzed with CRISPResso2 v2 and custom scripts to quantify editing. For on-target editing, A-to-G editing was quantified at the site of the R408W variant (position 5 of the PAH4 protospacer sequence) and at the sites of potential bystander adenine editing (positions 6 and 10 of the PAH4 protospacer sequence). The following examples are provided to illustrate certain embodiments of the invention. They are not intended to limit the invention in any way. Example 1 Meta analysis of PKU patients with PAH c.1222C>T variants and screening ABEs for corrective activity Gene-editing methods and compositions include CRISPR-Cas9 and -Cas12 nucleases (Jinek et al., 2012; Zetsche et al., 2015; Strecker et al., 2019), CRISPR cytosine base editors (Komor et al., 2016), CRISPR adenine base editors (Gaudelli et al., 2017), and CRISPR prime editors (Anzalone et al., 2019). CRISPR base editors are an attractive gene-editing modality because they function efficiently for introducing precise targeted alterations without the need for double-strand breaks, in contrast to CRISPR-Cas9 and other gene-editing nucleases (Figure 1A, Figure 1B). Adenine base editors (ABEs) can induce targeted A→G edits in DNA (T→C on the opposing strand). Each ABE uses its core Cas9 nickase protein with a guide RNA (gRNA) to engage a double- strand protospacer DNA sequence, which is flanked by a protospacer-adjacent motif (PAM) sequence on its 3′ end. Some ABEs use a core Cas9 nickase protein that has been engineered to accommodate a variety of PAM sequences, making it much more flexible with respect to target site selection. For example, standard S. pyogenes Cas9 has a PAM preference of NGG, but SpG- Cas9 has a relaxed PAM preference of NGN, and SpRY-Cas9 is “near-PAMless” and can accommodate almost any PAM, while still using a standard S. pyogenes gRNA (Walton et al., 2020). Other engineered core Cas9 nickase proteins have a highly specific PAM preference for a sequence other than NGG (e.g., NGA, NGCG, NGCA, NAA, or NAAG). Unlike Cas9 and Cas12, ABEs do not make double-strand breaks and have minimal risk of inducing large deletions, chromosomal abnormalities, and chromothripsis (shattering). Instead, each ABE uses an evolved deoxyadenosine deaminase domain—typically fused to the N-terminal end of the Cas9 nickase—to chemically modify an adenosine nucleoside on one DNA strand, which (in combination with nicking of the other strand) enables highly precise and efficient A→G transition mutations at the targeted site. Phenylketonuria (PKU) is an autosomal recessive disorder caused by mutations in the gene encoding phenylalanine hydroxylase (PAH), resulting in the accumulation of phenylalanine (Phe) to neurotoxic levels due to the inability to convert Phe into tyrosine. Untreated PKU can manifest high blood Phe levels of >1200 μmol / L. However, current treatment guidelines state that blood Phe levels should ideally be maintained in the range of 120-360 µmol / L (Vockley et al., 2014). The existing treatment options range from a strict low-Phe diet to an oral medication (sapropterin, a cofactor of PAH) to an injectable enzyme substitution therapy (pegvaliase). All are chronic, everyday interventions to which patients must adhere for the lifetime if they are to prevent cognitive impairment and a range of neuropsychiatric complications. The burden of intensive Phe control and monitoring faced by PKU patients and their families is profound, especially with treatments that can be unpalatable and cost-prohibitive. Lack of adherence to the guidelines on the part of many patients with PKU is not only a serious risk, but also common and therefore expected. Studies have shown that more than 70% of adults with PKU are noncompliant with therapy (Jurecki et al., 2017). As such, durable and, ideally, curative therapies would be needed to optimally address the medical needs of PKU patients. Out of the more than 1,000 PAH variants that have been cataloged in patients (Regier and Greene, 2017), the most common pathogenic variants linked to classic PKU are all transition mutations, specifically G→A or C→T variants on the sense or antisense strand (Hillert et al., 2020). As such, each of these variants is potentially amenable to correction by gene editing. For example, adenine base editing, which can engineer site-specific A→G changes on either DNA strand (Gaudelli et al., 2017), would be effective to correct each of these variants. The PAH c.1222C>T (p.Arg408Trp, R408W) variant is by far the most common pathogenic variant for PKU worldwide. The PAH c.1222C>T variant has its highest prevalence in European populations (e.g., present in 98.9% of PKU patients in Estonia, 89.2% in Poland, 75.7% in Russia, 43.6% in Sweden, and 35.7% in Germany), Australia (34.7%), and the United States (32.9%) (Hillert et al., 2020). Patients homozygous for the PAH c.1222C>T variant have the most severe form of PKU and typically do not respond to sapropterin (Leuders et al., 2014), limiting their treatment options. Patients with the R408W variant do respond to pegvaliase, a once-daily injected bacterial-derived enzyme that directly catabolizes Phe, albeit with a substantial risk of anaphylaxis. However, in clinical trials, PKU patients on pegvaliase had only a mean Phe reduction of 51% at one year after initiation (from 1233 μmol / L to 565 μmol / L), meaning that a large proportion of the patients did not achieve the guideline-directed Phe goal of <360 µmol / L (Burton et al., 2020). To define the degree of adherence to Phe treatment and monitoring goals by PKU patients with the PAH R408W variant, real-world data from a PKU cohort managed at a metabolic specialty clinic at an academic medical center were analyzed. Among 129 patients with PKU followed by the Children’s Hospital of Philadelphia (CHOP) Metabolic Clinic, 32 (24.8%) were found to be compound heterozygous for the PAH R408W allele, while 4 (3.1%) were homozygous for the variant. This may be an underestimate of true R408W prevalence, as genotype information was not available for some older patients with PKU. Consensus management guidelines from the American College of Medical Genetics recommend patients with PKU maintain Phe levels in the 120-360 µmol / L range (Vockley et al., 2014). Levels above 600 µmol / L can be neurotoxic and are associated with poor psychiatric and neurocognitive outcomes (Romani et al., 2019; Ashe et al., 2019; Thomas et al., 2023). In the study cohort, 33 of 36 (91.6%) treated patients had at least a single Phe level above 360 µmol / L, and 25 of 36 (69.4%) had at least a single level above 600 µmol / L (Figure 2). Furthermore, 10 of 36 (27.7%) had lifetime average Phe levels above 360 µmol / L. The four patients homozygous for the R408W allele demonstrated especially poor metabolic control. In addition to high Phe levels, patients with R408W variants demonstrated poor adherence to Phe monitoring schedules. While exact recommended intervals can vary by clinical scenario, general guidelines include weekly Phe monitoring prior to age 1 year, every-2-week monitoring for ages 1-12 years, and every-2-4 week monitoring in adolescents and adults (Figure 3, grey box) (Vockley et al., 2014). The interval since the last recorded value for every Phe measurement in the cohort was calculated (Figure 3, black dots). The interval between monitoring labs was longer than recommended for 1,556 of 2,535 (61.3%) of the Phe values measured. Collectively, these data demonstrate that most patients with R408W variants have poor metabolic control and are at risk for chronic neurologic damage, providing a strong rationale for a one-time, definitive gene editing treatment to correct the PAH R408W variant in the liver. Studies have been performed demonstrating the viability of adenine base editing as a therapeutic approach in vivo. Most notably, lipid nanoparticles (LNPs) have proven effective at delivering an adenine base editor, encoded in mRNA, into the livers of non-human primates (Musunuru et al., 2021; Rothgangl et al., 2021). An adenine base editor efficiently introduced a loss-of-function variant into the PCSK9 cholesterol-regulating gene, achieving saturation editing of the hepatocytes in the liver and reducing the PCSK9 protein by ≈90% without any adverse health consequences (Musunuru et al., 2021). In a recent clinical trial, LNP-mediated delivery of a nuclease editor (CRISPR-Cas9) into the liver to introduce loss-of-function mutations into a target gene (TTR) was safely tolerated and resulted in up to 96% reduction of the protein product (transthyretin) (Gillmore et al., 2021). Accordingly, a broad range of editing therapies can now be developed to ameliorate symptoms of a variety of diseases for which gene alterations in the liver would be curative. With PCSK9, the goal was to edit the wild-type gene, which is endogenous in primary human hepatocytes or cultured hepatocyte lines from any source. In contrast, with PAH, the goal is to correct a rare human mutation, c.1222C>T (Figure 4). However, there are no readily available primary human hepatocytes or cultured hepatocyte lines bearing that variant. Moreover, due to the limited ability of primary human hepatocytes to proliferate or to persist in culture more than a few days, there is no possibility of editing the variant into the hepatocytes to allow for subsequent testing of variant correction. Accordingly, prime editing was used to introduce the PAH R408W variant into HuH-7 human hepatoma cells, which have the advantage of being hepatocyte-like cells that proliferate indefinitely in culture, are highly transfectable, and can undergo single-cell cloning to generate genetically modified cell lines. The initial attempt at the use of a prime editor (PEmax) with an engineered pegRNA and a ngRNA achieved 34% insertion of the R408W variant into bulk HuH-7 cells when delivered via plasmid transfection. Single-cell cloning to expand edited HuH-7 cell lines yielded lines that were homozygous for the R408W variant (Figure 4). A representative homozygous R408W HuH-7 cell line was used for further experiments. Developed by directed evolution of a seventh-generation ABE, ABE7.10, at least forty- one modified eighth-generation ABEs have been reported that all can have higher editing efficiencies compared to ABE7.10 in mammalian cells (Gaudelli et al., 2020; Richter et al., 2020). In addition, 30 inlaid base editors (IBEs) have been reported, several of which have higher editing efficiencies compared to the standard N-terminal deaminase-fused ABE, while having 3’-shifted editing windows (Chu et al., 2021). Of note, the possibility of using a SaCas9- containing ABE was considered. However, there is no SaCas9 NNGRRT PAM or SaCas9 KKH variant NNNRRT PAM that is optimally positioned to place the target PAH c.1222C>T adenine within the editing window in such a way as to avoid or minimize counterproductive bystander editing, due to the much broader editing windows with SaCas9-containing ABEs compared to SpCas9-containing ABEs. As such, SpCas9-containing ABEs were utilized. Using the clonal HuH-7 cell line homozygous for the PAH c.1222C>T variant (homozygous R408W HuH-7 cells), generated with prime editing as described above, a variety of eighth-generation ABEs in combination with some or all of six gRNAs (SEQ ID NOS: 1, 3, 5, 7, 9, and 11) (Figure 4) were tested for their ability to correct the variant (Figure 5). To expand the set of potential target sites beyond those that can be targeted by standard SpCas9 with NGG PAMs, ABEs with core SpG-Cas9 (NGN PAMs), SpRY-Cas9 (near-PAMless), and iSpyMacCas9 (NAA PAM) nickases were tested. All of the ABE / gRNA sets corrected some proportion of the variant alleles to wild-type, but with highly varied levels of editing of the PAH c.1222C>T variant and highly varied levels of bystander editing. Of note, bystander editing of the adenine in the position adjacent to the position of the c.1222C>T (c.1221) would represent a synonymous edit not expected to be of any functional consequence. Among the ABE / gRNA sets tested, SpRY-ABE8.8 (SEQ ID NO: 78) in combination with the PAH4 gRNA (SEQ ID NO: 7) displayed the most favorable balance of efficient variant correction and minimized bystander editing at positions other than c.1221. Example 2 ABE activity in human hepatocytes via LNP delivery. For LNP delivery, the PAH4 gRNA with appropriately positioned 2’-O-methyl and phosphorothioate modifications was synthesized by Agilent. mRNA encoding SpRY-ABE8.8 was generated via in vitro transcription and purification by the University of Pennsylvania Engineered mRNA and Targeted Nanomedicine Core. The Core also formulated the mRNA with the gRNA into LNPs containing standard lipid components (ionizable cationic lipid, 1,2- distearoyl-sn-glycero-3-phosphocholine, cholesterol, and a PEG-lipid). We performed dose- response studies with the LNPs using the homozygous R408W HuH-7 cell line (Figure 6). These studies showed that there was ≈30% corrective editing at higher doses. Example 3 Generating two humanized mouse models with the human PAH c.1222C>T variant. In order to assess for editing activity of the prioritized ABE / gRNA set(s) in hepatocytes in vivo, an animal model that harbors not only the PAH c.1222C>T variant but also the protospacer DNA sequence and the surrounding sequence context that allows for a functional readout of variant correction must be generated. Accordingly, humanized mouse models in which a portion of the endogenous mouse PAH locus has been replaced with the orthologous portion of the human PAH locus containing the variant have been created. This degree of humanization facilitates assessment of the therapeutic effect of base editing of the PAH c.1222C>T variant via disease-relevant phenotypic readouts. A humanized mouse model can be generated using a number of approaches. In one approach, the mouse exon containing the site of the PAH c.1222C>T variant (exon 12) was replaced as well as ≈500 base pairs of the flanking introns (intron 11 and intron 12) (Figure 7). This was achieved via electroporation of a PAH targeting vector into mouse embryonic stem cells and generation of chimeras, followed by breeding, in the inbred C57BL / 6J background. Homozygous mice, when maintained on a normal chow diet, displayed signs of PKU including elevated blood Phe levels and hypopigmentation (agouti instead of black fur). The humanized PAH c.1222C>T variant can be maintained in the heterozygous state, with heterozygous mice being entirely healthy. In another approach, we used CRISPR-Cas9 targeting in mouse embryos to generate a minimally humanized PKU model, in the C57BL / 6J background, in which we replaced a small portion of the endogenous mouse Pah exon 12 with the orthologous human sequence spanning the protospacers of the tested gRNAs (SEQ IQ NOS: 2, 4, 6, 8, 10, and 12) and containing the c.1222C>T variant (Figure 8A). Homozygous mice had phenotypes consistent with PKU (Figure 8B, Figure 9A). Example 4 ABE activity in mice via LNP delivery. For LNP delivery, the PAH4 gRNA with appropriately positioned 2’-O-methyl and phosphorothioate modifications were synthesized by Agilent. mRNA encoding SpRY-ABE8.8 ABE was generated via in vitro transcription and purification by the University of Pennsylvania Engineered mRNA and Targeted Nanomedicine Core. The Core also formulated the mRNA with the gRNA into LNPs containing standard lipid components (ionizable cationic lipid, 1,2- distearoyl-sn-glycero-3-phosphocholine, cholesterol, and a PEG-lipid). In a short-term study, homozygous R408W (PKU) mice were treated with SpRY- ABE8.8 / PAH4 LNPs at a 5-mg / kg dose (n = 3 animals) or at a 2.5-mg / kg dose (n = 3 animals), with vehicle-treated homozygous PKU (n = 4 animals) and vehicle-treated heterozygous non- PKU control (n = 4 animals) age-matched (approximately 8 weeks of age) colony mates serving as controls (Figure 9A). At baseline, the PKU mice had blood phenylalanine (Phe) levels in the 1000-1500 μmol / L range (highly elevated levels consistent with PKU), whereas the non-PKU mice generally had blood Phe levels <125 μmol / L (similar to human profiles). All mice in both dose groups achieved blood Phe levels less than 125 mmol / L by 7 days after treatment. The treated mice were necropsied 1 week after treatment to assess editing in the liver. The desired corrective editing in the whole liver with SpRY-ABE8.8 / PAH4 LNPs was a mean 29% in the higher dose group and a mean 26% in the lower dose group (Figure 9B). Example 5 Screening ABEs for corrective activity for additional PKU variants. The prime editing described above was effective at introducing the PAH R408W variant into HuH-7 human hepatoma cells. However, a different methodology was used to introduce the PAH c.1066–11G>A, c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), and c.1315+1G>A variants into HuH-7 cells. A single DNA cassette comprising genomic segments flanking each of these four variants, along with genomic segments flanking the PAH c.842C>T (p.Pro281Leu, also known as P281L) and R408W variants, was subcloned into a lentiviral vector, which was used to generate lentiviral particles that were in turn used to infect HuH-7 cells. This introduced all 6 variants simultaneously into the genomes of the HuH-7 cells, allowing for side-by-side comparison of editing efficiencies of the validated SpRY-ABE8.8 / PAH4 set to correct the PAH R408W variant, of a previously validated ABE8.8 / gRNA set to correct the PAH P281L variant (using a gRNA termed PAH0, SEQ ID NO: 69), and a variety of candidate ABE / gRNA sets to correct each of the other 4 variants, using plasmid transfections. For each of the 4 new variants, an experiment was performed with ABEs using core Cas9 (NGG PAM), SpG-Cas9 (NGN PAMs), and SpRY-Cas9 (near-PAMless) nickases with any of 7 candidate gRNAs as appropriate, screening for corrective editing of the new variants. Each experiment also included the validated ABE8.8 / PAH4 set for correction of the PAH R408W variant and the validated ABE8.8 / PAH0 set for correction of the PAH P281L variant. Because the ABE / gRNA sets for R408W and P281L had previously been validated as having therapeutically effective activity in humanized PKU mouse models in vivo (i.e., normalization of blood Phe levels in LNP-treated mice), these validated ABE / gRNA sets serve as “standards” against any candidate ABE / gRNA sets. Sets that showed comparable corrective editing of the new variant in these HuH-7 cells in vitro demonstrated therapeutically effective activity. For the PAH c.1066–11G>A variant (Figure 10A), many of the tested candidate ABE / gRNA sets (using gRNAs termed PAH7 through PAH13, SEQ ID NOS: 13, 15, 17, 19, 21, 23, and 25) demonstrated corrective editing levels comparable to the R408W and P281L standards. Additionally, several candidate ABE / gRNA sets demonstrated corrective editing levels surpassing the P281L standard. Of note, bystander editing of adenine bases near the c.1066–11G>A variant are likely neutral with respect to PAH enzyme activity, because the adenine bases are located in intronic sequence. For the PAH c.782G>A (p.Arg261Gln) variant (Figure 10B), many of the tested candidate ABE / gRNA sets (using gRNAs termed PAH14 through PAH20, SEQ ID NOS: 27, 29, 31, 33, 35, 37, and 39) demonstrated corrective editing levels comparable to the R408W and P281L standards. Additionally, one candidate ABE / gRNA set demonstrated a corrective editing level surpassing the P281L standard. Of note, bystander editing of adenine bases near the c.782G>A would result in either synonymous protein changes, not expected to be of any functional consequence, or nonsynonymous protein changes, which might adversely affect PAH enzyme activity. Accordingly, editing outcomes that included nonsynonymous protein changes were excluded from the calculation of the observed corrective editing. For the PAH c.728G>A (p.Arg243Gln) variant (Figure 10C), one of the tested candidate ABE / gRNA sets (using gRNAs termed PAH21 through PAH27, SEQ ID NOS: 41, 43, 45, 47, 49, 51, and 53) demonstrated a corrective editing level surpassing the R408W and P281L standards. Of note, there were no adenine bases near the c.728G>A variant where nonsynonymous bystander editing occurred. For the PAH c.1315+1G>A variant (Figure 10D), none of the candidate ABE / gRNA sets (using gRNAs termed PAH28 through PAH34, SEQ ID NOS: 55, 57, 59, 61, 63, 65, and 67) demonstrated corrective editing levels comparable to or surpassing the R408W and P281L standards; moreover, nonsynonymous bystander editing dominated the editing outcomes. These findings demonstrate the need for experimentation to identify therapeutically effective ABE / gRNA sets to correct any given PAH variant. These findings also show that it cannot be assumed that any given PAH variant that, in principle, is amenable to adenine base editing (G>A or C>T variant) will yield a viable corrective editing solution. REFERENCES Anzalone AV, Koblan LW, Liu DR. Genome editing with CRISPR-Cas nucleases, base editors, transposases and prime editors. Nat Biotechnol. 2020 Jul;38(7):824-844. Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM, Chen PJ, Wilson C, Newby GA, Raguram A, Liu DR. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature. 2019 Dec;576(7785):149-157. Ashe K, Kelso W, Farrand S, Panetta J, Fazio T, De Jong G, Walterfang M. Psychiatric and Cognitive Aspects of Phenylketonuria: The Limitations of Diet and Promise of New Treatments. Front Psychiatry. 2019 Sep 10;10:561. Banskota S, Raguram A, Suh S, Du SW, Davis JR, Choi EH, Wang X, Nielsen SC, Newby GA, Randolph PB, Osborn MJ, Musunuru K, Palczewski K, Liu DR. Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins. Cell. 2022 Jan 20;185(2):250-265.e16. Blau N, van Spronsen FJ, Levy HL. Phenylketonuria. Lancet. 2010 Oct 23;376(9750):1417-27. Burton BK, Longo N, Vockley J, Grange DK, Harding CO, Decker C, Li M, Lau K, Rosen O, Larimore K, Thomas J; PAL-002 and PAL-004 Investigators. Pegvaliase for the treatment of phenylketonuria: Results of the phase 2 dose-finding studies with long-term follow-up. Mol Genet Metab. 2020 Aug;130(4):239-246. Cancellieri S, Zeng J, Lin LY, Tognon M, Nguyen MA, Lin J, Bombieri N, Maitland SA, Ciuculescu MF, Katta V, Tsai SQ, Armant M, Wolfe SA, Giugno R, Bauer DE, Pinello L. Human genetic diversity alters off-target outcomes of therapeutic gene editing. Nat Genet. 2023 Jan;55(1):34-43. Chadwick AC, Evitt NH, Lv W, Musunuru K. Reduced Blood Lipid Levels With In Vivo CRISPR-Cas9 Base Editing of ANGPTL3. Circulation. 2018 Feb 27;137(9):975-977. Chadwick AC, Wang X, Musunuru K. In Vivo Base Editing of PCSK9 (Proprotein Convertase Subtilisin / Kexin Type 9) as a Therapeutic Alternative to Genome Editing. Arterioscler Thromb Vasc Biol. 2017 Sep;37(9):1741- 1747. doi: 10.1161 / ATVBAHA.117.309881. Epub 2017 Jul 27. Chu SH, Packer M, Rees H, Lam D, Yu Y, Marshall J, Cheng LI, Lam D, Olins J, Ran FA, Liquori A, Gantzer B, Decker J, Born D, Barrera L, Hartigan A, Gaudelli N, Ciaramella G, Slaymaker IM. Rationally Designed Base Editors for Precise Editing of the Sickle Cell Disease Mutation. CRISPR J. 2021 Apr;4(2):169-177. Davis JR, Wang X, Witte IP, Huang TP, Levy JM, Raguram A, Banskota S, Seidah NG, Musunuru K, Liu DR. Efficient in vivo base editing via single adeno-associated viruses with size-optimized genomes encoding compact adenine base editors. Nat Biomed Eng. 2022 Nov;6(11):1272-1283. Donohoue PD, Pacesa M, Lau E, Vidal B, Irby MJ, Nyer DB, Rotstein T, Banh L, Toh MS, Gibson J, Kohrs B, Baek K, Owen ALG, Slorach EM, van Overbeek M, Fuller CK, May AP, Jinek M, Cameron P. Conformational control of Cas9 by CRISPR hybrid RNA-DNA guides mitigates off-target activity in T cells. Mol Cell. 2021 Sep 2;81(17):3637-3649.e5. Essalmani R, Weider E, Marcinkiewicz J, Chamberland A, Susan-Resiga D, Roubtsova A, Seidah NG, Prat A. A single domain antibody against the Cys- and His-rich domain of PCSK9 and evolocumab exhibit different inhibition mechanisms in humanized PCSK9 mice. Biol Chem. 2018 Nov 27;399(12):1363-1374. Gaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI, Liu DR. Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage. Nature. 2017 Nov 23;551(7681):464-471. Gaudelli NM, Lam DK, Rees HA, Solá-Esteves NM, Barrera LA, Born DA, Edwards A, Gehrke JM, Lee SJ, Liquori AJ, Murray R, Packer MS, Rinaldi C, Slaymaker IM, Yen J, Young LE, Ciaramella G. Directed evolution of adenine base editors with increased activity and therapeutic application. Nat Biotechnol. 2020 Jul;38(7):892- 900. Gillmore JD, Gane E, Taubel J, Kao J, Fontana M, Maitland ML, Seitzer J, O'Connell D, Walsh KR, Wood K, Phillips J, Xu Y, Amaral A, Boyd AP, Cehelsky JE, McKee MD, Schiermeier A, Harari O, Murphy A, Kyratsous CA, Zambrowicz B, Soltys R, Gutstein DE, Leonard J, Sepp- Lorenzino L, Lebwohl D. CRISPR-Cas9 In Vivo Gene Editing for Transthyretin Amyloidosis. N Engl J Med. 2021 Aug 5;385(6):493-502. Grisch-Chan HM, Schwank G, Harding CO, Thöny B. State-of-the-Art 2019 on Gene Therapy for Phenylketonuria. Hum Gene Ther. 2019 Oct;30(10):1274-1283. Hillert A, Anikster Y, Belanger-Quintana A, Burlina A, Burton BK, Carducci C, Chiesa AE, Christodoulou J, Đorđević M, Desviat LR, Eliyahu A, Evers RAF, Fajkusova L, Feillet F, Bonfim-Freitas PE, Giżewska M, Gundorova P, Karall D, Kneller K, Kutsev SI, Leuzzi V, Levy HL, Lichter-Konecki U, Muntau AC, Namour F, Oltarzewski M, Paras A, Perez B, Polak E, Polyakov AV, Porta F, Rohrbach M, Scholl-Bürgi S, Spécola N, Stojiljković M, Shen N, Santana-da Silva LC, Skouma A, van Spronsen F, Stoppioni V, Thöny B, Trefz FK, Vockley J, Yu Y, Zschocke J, Hoffmann GF, Garbade SF, Blau N. The Genetic Landscape and Epidemiology of Phenylketonuria. Am J Hum Genet. 2020 Aug 6;107(2):234-250. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable dual- RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012 Aug 17;337(6096):816-21. Jurecki ER, Cederbaum S, Kopesky J, Perry K, Rohr F, Sanchez-Valle A, Viau KS, Sheinin MY, Cohen-Pfeffer JL. Adherence to clinic recommendations among patients with phenylketonuria in the United States. Mol Genet Metab. 2017 Mar;120(3):190-197. Kasiewicz LN, Biswas S, Beach A, Ren H, Dutta C, Mazzola AM, Rohde E, Chadwick A, Cheng C, Garcia SP, Iyer S, Matsumoto Y, Khera AV, Musunuru K, Kathiresan S, Malyala P, Rajeev KG, Bellinger AM. GalNAc-Lipid nanoparticles enable non-LDLR dependent hepatic delivery of a CRISPR base editing therapy. Nat Commun. 2023 May 15;14(1):2776. Kim D, Kim DE, Lee G, Cho SI, Kim JS. Genome-wide target specificity of CRISPR RNA- guided adenine base editors. Nat Biotechnol. 2019 Apr;37(4):430-435. Kingwell K. Base editors hit the clinic. Nat. Rev. Drug Discov. 21, 545-547 (2022). Komor AC, Kim YB, Packer MS, Zuris JA, Liu DR. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature. 2016 May 19;533(7603):420-4. Leuders S, Wolfgart E, Ott T, du Moulin M, van Teeffelen-Heithoff A, Vogelpohl L, Och U, Marquardt T, Weglage J, Feldmann R, Rutsch F. Influence of PAH Genotype on Sapropterin Response in PKU: Results of a Single-Center Cohort Study. JIMD Rep. 2014;13:101-9. Levy HL, Sarkissian CN, Scriver CR. Phenylalanine ammonia lyase (PAL): From discovery to enzyme substitution therapy for phenylketonuria. Mol Genet Metab. 2018 Aug;124(4):223-229. Levy JM, Yeh WH, Pendse N, Davis JR, Hennessey E, Butcher R, Koblan LW, Comander J, Liu Q, Liu DR. Cytosine and adenine base editing of the brain, liver, retina, heart and skeletal muscle of mice via adeno-associated viruses. Nat Biomed Eng. 2020 Jan;4(1):97-110. Liang P, Xie X, Zhi S, Sun H, Zhang X, Chen Y, Chen Y, Xiong Y, Ma W, Liu D, Huang J, Songyang Z. Genome-wide profiling of adenine base editor specificity by EndoV-seq. Nat Commun. 2019 Jan 8;10(1):67. Musunuru K, Chadwick AC, Mizoguchi T, Garcia SP, DeNizio JE, Reiss CW, Wang K, Iyer S, Dutta C, Clendaniel V, Amaonye M, Beach A, Berth K, Biswas S, Braun MC, Chen HM, Colace TV, Ganey JD, Gangopadhyay SA, Garrity R, Kasiewicz LN, Lavoie J, Madsen JA, Matsumoto Y, Mazzola AM, Nasrullah YS, Nneji J, Ren H, Sanjeev A, Shay M, Stahley MR, Fan SHY, Tam YK, Gaudelli NM, Ciaramella G, Stolz LE, Malyala P, Cheng CJ, Rajeev KG, Rohde E, Bellinger AM, Kathiresan S. In vivo CRISPR base editing of PCSK9 durably lowers cholesterol in primates. Nature. 2021 May;593(7859):429-434. Petri K, Kim DY, Sasaki KE, Canver MC, Wang X, Shah H, Lee H, Horng JE, Clement K, Iyer S, Garcia SP, Guo JA, Newby GA, Pinello L, Liu DR, Aryee MJ, Musunuru K, Joung JK, Pattanayak V. Global-scale CRISPR gene editor specificity profiling by ONE-seq identifies population-specific, variant off-target effects. bioRxiv. 2021 Apr 5. Regier DS, Greene CL. Phenylalanine Hydroxylase Deficiency. 2017 Jan 5. In: Adam MP, Ardinger HH, Pagon RA, Wallace SE, Bean LJH, Gripp KW, Mirzaa GM, Amemiya A, editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993–2022. Richter MF, Zhao KT, Eton E, Lapinaite A, Newby GA, Thuronyi BW, Wilson C, Koblan LW, Zeng J, Bauer DE, Doudna JA, Liu DR. Phage-assisted evolution of an adenine base editor with improved Cas domain compatibility and activity. Nat Biotechnol. 2020 Jul;38(7):883-891. Romani C, Manti F, Nardecchia F, Valentini F, Fallarino N, Carducci C, De Leo S, MacDonald A, Palermo L, Leuzzi V. Adult cognitive outcomes in phenylketonuria: explaining causes of variability beyond average Phe levels. Orphanet J Rare Dis. 2019 Nov 28;14(1):273. Rossidis AC, Stratigis JD, Chadwick AC, Hartman HA, Ahn NJ, Li H, Singh K, Coons BE, Li L, Lv W, Zoltick PW, Alapati D, Zacharias W, Jain R, Morrisey EE, Musunuru K, Peranteau WH. In utero CRISPR-mediated therapeutic editing of metabolic genes. Nat Med. 2018 Oct;24(10):1513-1518. Rothgangl T, Dennis MK, Lin PJC, Oka R, Witzigmann D, Villiger L, Qi W, Hruzova M, Kissling L, Lenggenhager D, Borrelli C, Egli S, Frey N, Bakker N, Walker JA 2nd, Kadina AP, Victorov DV, Pacesa M, Kreutzer S, Kontarakis Z, Moor A, Jinek M, Weissman D, Stoffel M, van Boxtel R, Holden K, Pardi N, Thöny B, Häberle J, Tam YK, Semple SC, Schwank G. In vivo adenine base editing of PCSK9 in macaques reduces LDL cholesterol levels. Nat Biotechnol. 2021 Aug;39(8):949-957. Strecker J, Jones S, Koopal B, Schmid-Burgk J, Zetsche B, Gao L, Makarova KS, Koonin EV, Zhang F. Engineering of CRISPR-Cas12b for human genome editing. Nat Commun. 2019 Jan 22;10(1):212. doi: 10.1038 / s41467-018-08224-4. Thomas L, Olson A, Romani C. The impact of metabolic control on cognition, neurophysiology, and well-being in PKU: A systematic review and meta-analysis of the within-participant literature. Mol Genet Metab. 2023 Jan;138(1):106969. van Spronsen FJ, Blau N, Harding C, Burlina A, Longo N, Bosch AM. Phenylketonuria. Nat Rev Dis Primers. 2021 May 20;7(1):36. Villiger L, Grisch-Chan HM, Lindsay H, Ringnalda F, Pogliano CB, Allegri G, Fingerhut R, Häberle J, Matos J, Robinson MD, Thöny B, Schwank G. Treatment of a metabolic liver disease by in vivo genome base editing in adult mice. Nat Med. 2018 Oct;24(10):1519-1525. Vockley J, Andersson HC, Antshel KM, Braverman NE, Burton BK, Frazier DM, Mitchell J, Smith WE, Thompson BH, Berry SA; American College of Medical Genetics and Genomics Therapeutics Committee. Phenylalanine hydroxylase deficiency: diagnosis and management guideline. Genet Med. 2014 Feb;16(2):188-200. Walton RT, Christie KA, Whittaker MN, Kleinstiver BP. Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants. Science. 2020 Apr 17;368(6488):290-296. Wang L, Breton C, Warzecha CC, Bell P, Yan H, He Z, White J, Zhu Y, Li M, Buza EL, Jantz D, Wilson JM. Long-term stable reduction of low-density lipoprotein in nonhuman primates following in vivo genome editing of PCSK9. Mol Ther. 2021 Jun 2;29(6):2019-2029. Zetsche B, Gootenberg JS, Abudayyeh OO, Slaymaker IM, Makarova KS, Essletzbichler P, Volz SE, Joung J, van der Oost J, Regev A, Koonin EV, Zhang F. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell. 2015 Oct 22;163(3):759-71. Zheng Z, Liebers M, Zhelyazkova B, Cao Y, Panditi D, Lynch KD, Chen J, Robinson HE, Shim HS, Chmielecki J, Pao W, Engelman JA, Iafrate AJ, Le LP. Anchored multiplex PCR for targeted next-generation sequencing. Nat Med. 2014 Dec;20(12):1479-84. While certain features of the invention have been described herein, many modifications, substitutions, changes, and equivalents will now occur to those of ordinary skill in the art. It is, therefore, to be understood that the appended claims are intended to cover all such modifications and changes as fall within the true spirit of the invention.

Claims

WHAT IS CLAIMED IS:

1. A method for editing a phenylalanine hydroxylase (PAH) encoding polynucleotide comprising a c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), or c.728G>A (p.Arg243Gln) mutation, the method comprising contacting the PAH polynucleotide with a base editor and one or more guide polynucleotides, thereby forming a base editor complex, said base editor complex comprising a polynucleotide programmable DNA binding domain and an adenosine deaminase domain, wherein said one or more guide polynucleotides target said base editor complex to said mutation and effect an A•T to G•C base change thereby correcting said mutation.

2. The method of claim 1 for treatment of a patient wherein said mutation is c.1222C>T (p.Arg408Trp) and said guide polynucleotide has a sequence with at least 90% identity to SEQ ID NO: 7, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 1, SEQ ID NO: 9, or SEQ ID NO: 11, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer sequence.

3. The method of claim 1 for treatment of a patient wherein said mutation is c.1222C>T (p.Arg408Trp) and said guide polynucleotide comprises a nucleic acid sequence complementary to a PAH encoding nucleic acid sequence with at least 90% identity to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO:

12.

4. The method of any one of claims 2-3, wherein the patient has a second mutation in a different allele in a second PAH encoding polynucleotide selected from c.842C>T (p.Pro281Leu), c.1066–11G>A, c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln).

5. The method of claim 1 for treatment of a patient, wherein said mutation is c.1066–11G>A and said guide polynucleotide has a sequence with at least 90% identity to SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, or SEQ ID NO: 25, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer sequence.

6. The method of claim 1 for treatment of a patient, wherein said mutation is c.1066–11G>A and said guide polynucleotide comprises a nucleic acid sequence complementary to a PAH encoding nucleic acid sequence with at least 90% identity to SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, or SEQ ID NO:

26.

7. The method of any one of claims 5-6, wherein the patient has a second mutation in a different allele in a second PAH encoding polynucleotide selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln).

8. The method of claim 1 wherein said mutation is c.782G>A (p.Arg261Gln) and said guide polynucleotide has a sequence with at least 90% identity to SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer sequence.

9. The method of claim 1 wherein said mutation is c.782G>A (p.Arg261Gln) and said guide polynucleotide comprises a nucleic acid sequence complementary to a PAH encoding nucleic acid sequence with at least 90% identity to SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, or SEQ ID NO:

40.

10. The method of any one of claims 8-9 for treatment of a patient, wherein the patient has a second mutation in a different allele in a second PAH encoding polynucleotide selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln).

11. The method of claim 1 wherein said mutation is c.728G>A (p.Arg243Gln) and said guide polynucleotide has a sequence with at least 90% identity to SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, or SEQ ID NO: 53, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer sequence.

12. The method of claim 1 wherein said mutation is c.728G>A (p.Arg243Gln) and said guide polynucleotide comprises a nucleic acid sequence complementary to a PAH encoding nucleicacid sequence with at least 90% identity to SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, or SEQ ID NO:

54.

13. The method of any one of claims 11-12, wherein the patient has a second mutation in a different allele in a second PAH encoding polynucleotide selected from c.842C>T (p.Pro281Leu), c 122C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln).

14. The method of any one of claims 1-13, wherein the contacting is in a cell, a eukaryotic cell, a mammalian cell, or human cell.

15. The method of any one of claims 1-14, wherein the cell is in vivo.

16. The method of any one of claims 1-14, wherein the cell is ex vivo.

17. The method of any one of claims 1-16, wherein the polynucleotide programmable DNA binding domain is a Streptococcus pyogenes Cas9 (SpCas9) or Staphylococcus aureus Cas9 (SaCas9) or a variant thereof.

18. The method of any one of claims 1-17, wherein the polynucleotide programmable DNA binding domain comprises a modified SpCas9 having an altered protospacer-adjacent motif (PAM) specificity.

19. The method of any one of claims 1-18, wherein the polynucleotide programmable DNA binding domain is a nuclease inactive or nickase variant.

20. The method of any one of claims 1-19, wherein the adenosine deaminase domain is capable of deaminating adenosine in deoxyribonucleic acid (DNA).

21. The method of claim 20, wherein the adenosine deaminase is a TadA deaminase or a variant thereof.

22. The method of any one of claims 1-21, wherein the base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to a nucleic acid sequence comprising the mutation associated with phenylketonuria (PKU).

23. A cell produced by introducing into the cell, or a progenitor cell thereof: a) a base editor, or a polynucleotide encoding said base editor, wherein said base editor comprises a polynucleotide programmable DNA binding domain and an adenosine deaminase domain; and b) one or more guide polynucleotides that target the base editor to a mutation site and effect an A•T to G•C alteration of a c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), or c.728G>A (p.Arg243Gln) mutation, thereby treating PKU.

24. The cell of claim 23, wherein the cell is a hepatocyte.

25. The cell of claim 23 or 24, wherein the hepatocyte expresses a PAH polypeptide.

26. The cell of any one of claims 23-25, wherein the cell is from a subject having PKU.

27. The cell of any one of claims 23-26, wherein the polynucleotide programmable DNA binding domain is a Streptococcus pyogenes Cas9 (SpCas9) or variant thereof.

28. The cell of any one of claims 23-27, wherein the polynucleotide programmable DNA binding domain comprises a modified SpCas9 having an altered protospacer-adjacent motif (PAM) specificity.

29. The cell of claim 28, wherein the modified SpCas9 has specificity for the nucleic acid sequence 5’-NGC-3’.

30. The cell of claim 28, wherein the modified SpCas9 has specificity for the nucleic acid sequence 5’-NCA-3’.

31. The cell of claim 28, wherein the modified SpCas9 has specificity for the nucleic acid sequence 5’-NAA-3’.

32. The cell of claim 28, wherein the modified SpCas9 has specificity for the nucleic acid sequence 5’-NAG-3’.

33. The cell of claim 28, wherein the modified SpCas9 has specificity for the nucleic acid sequence 5’-NGT-3’.

34. The cell of claim 28, wherein the modified SpCas9 has specificity for the nucleic acid sequence 5’-NGN-3’.

35. The cell of claim 28, wherein the modified SpCas9 has no specificity for a nucleic acid sequence.

36. The cell of any one of claims 23-35, wherein the polynucleotide programmable DNA binding domain is a nuclease inactive or nickase variant.

37. The cell of any one of claims 23-36, wherein the adenosine deaminase domain is capable of deaminating adenosine in deoxyribonucleic acid (DNA).

38. The cell of any one of claims 23-37, wherein the base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to a PAH encoding nucleic acid sequence comprising the mutation associated with PKU.

39. A plurality of adenosine base editor / guide polynucleotides for correction of a mutation causing PKU comprising: (i) a modified SpCas9 or SaCas9; (ii) an adenosine deaminase or functional fragment thereof; and iii) a guide polynucleotide that targets the base editor to effect an A•T to G•C alteration of a c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), or c.728G>A (p.Arg243Gln)) mutation associated with PKU.

40. The cell of any one of claims 23-38, or the base editor / guide plurality of polynucleotides of claim 39, wherein said mutation is c.1222C>T (p.Arg408Trp) and said guide polynucleotide has a sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, or SEQ ID NO: 11, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer sequence.

41. The cell of any one of claims 23-38, or the base editor / guide plurality of polynucleotides of claim 39, wherein said mutation is c.1222C>T (p.Arg408Trp) and said guide polynucleotidecomprises a nucleic acid sequence complementary to a PAH encoding nucleic acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO:

12.

42. The cell of any one of claims 23-38, or the base editor / guide polynucleotide base editing complex of claim 39, wherein said mutation is c.1066–11G>A and said guide polynucleotide has a sequence with at least 90% identity to SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, or SEQ ID NO: 25, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer sequence.

43. The cell of any one of claims 23-38, or the base editor / guide polynucleotide editing complex of claim 39 wherein said mutation is c.1066–11G>A and said guide polynucleotide comprises a nucleic acid sequence complementary to a PAH encoding nucleic acid sequence with at least 90% identity to SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, or SEQ ID NO:

26.

44. The cell of any one of claims 23-38, or the base editor / guide polynucleotide editing complex of claim 39 wherein said mutation is c.782G>A (p.Arg261Gln) and said guide polynucleotide has a sequence with at least 90% identity to SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, or SEQ ID NO: 39, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer.

45. The cell of any one of claims 23-38, or the base editor / guide polynucleotide editing complex of claim 39 wherein said mutation is c.782G>A (p.Arg261Gln) and said guide polynucleotide comprises a nucleic acid sequence complementary to a PAH encoding nucleic acid sequence with at least 90% identity to SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, or SEQ ID NO:

40.

46. The cell of any one of claims 23-38, or the base editor / guide polynucleotide editing complex of claim 39 wherein said mutation is c.728G>A (p.Arg243Gln) and said guide polynucleotide has a sequence with at least 90% identity to SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, or SEQ ID NO: 53, or is a hybrid gRNAhaving one of these sequences with at least one DNA nucleotide substitution in a spacer sequence.

47. The cell of any one of claims 23-38, or the base editor / guide polynucleotide editing complex of claim 39 wherein said mutation is c.728G>A (p.Arg243Gln) and said guide polynucleotide comprises a nucleic acid sequence complementary to a PAH encoding nucleic acid sequence with at least 90% identity to SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, or SEQ ID NO:

54.

48. The method of any one of claims 1-22, the cell of any one of claims 23-38, or the base editor / guide plurality of polynucleotides of claim 39, wherein said mutation is c.1222C>T (p.Arg408Trp) and said guide polynucleotide has a sequence of SEQ ID NO: 7, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer sequence.

49. The method of any one of claims 1-22, the cell of any one of claims 23-38, or the base editor / guide editing complex of claim 39, wherein said mutation is c.1222C>T (p.Arg408Trp) and wherein said base editor has a sequence of SEQ ID NO:

78.

50. The method of any one of claims 1-22, the cell of any one of claims 23-38, or the base editor / guide plurality of polynucleotides of claim 39, wherein said mutation is c.1222C>T (p.Arg408Trp), i) said guide polynucleotide has a sequence of SEQ ID NO: 7, or is a hybrid gRNA having one of these sequences with at least one DNA nucleotide substitution in a spacer sequence; and ii) said base editor has a sequence of SEQ ID NO:

78.

51. A method of treating PKU in a subject comprising administering to said subject an effective amount the adenosine base editor / guide polynucleotide editing complex of any one of claims 39 to 50.

52. The method of claim 51, wherein the subject is a mammal or a human.

53. The method of claim 51 or 52, comprising delivering the base editor, or polynucleotide encoding said base editor, and said one or more guide polynucleotides to a cell of the subject.

54. The method of any one of claims 51-53, wherein the cell is a liver cell.

55. The method of any one of claims 51-54, wherein said base editor / guide polynucleotide set are encapsulated in a lipid nanoparticle formulation and delivered to a liver cell of said subject.

56. The method of claim 55 wherein said formulation comprises ionizable cationic lipid, 1,2- distearoyl-sn-glycero-3-phosphocholine, cholesterol, and a PEG-lipid.

57. The method of any one of claims 51-55, wherein said base editor and guide polynucleotide are delivered to hepatocytes in a single or dual AAV vector system.

58. The method of any one of claims 51-54, wherein said base editor and guide polynucleotide are delivered to hepatocytes in virus-like particles.

59. A transgenic mouse comprising a humanized Pah gene comprising a first mutation selected from c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), or c.728G>A (p.Arg243Gln).

60. The transgenic mouse of claim 59, wherein mouse further comprises at least one additional mutation selected from c.842C>T (p.Pro281Leu), c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), c.728G>A (p.Arg243Gln), c.1315+1G>A, and c.473G>A (p.Arg158Gln), wherein the first mutation and the at least one additional mutation are not the same.

61. A method of identifying an effective adenosine base editor (ABE) / guide polynucleotide editing complex for correction of a target mutation, the method comprising: a) contacting a cell harboring a control mutation with a control ABE / guide polynucleotide editing complex that edits the control mutation; b) contacting a cell harboring a target mutation with a test ABE / guide polynucleotide editing complex that edits the target mutation;c) comparing the corrective activity of the control ABE / guide polynucleotide editing complex with the corrective activity of the at least one test ABE / guide polynucleotide editing complex; and e) identifying a test ABE / guide polynucleotide editing complex having at least 50% of the corrective activity of the control ABE / guide polynucleotide editing complex.

62. The method of claim 61, wherein the control mutation is c.842C>T (p.Pro281Leu) or c.1222C>T (p.Arg408Trp).

63. The method of claim 61 or 62, wherein the control ABE / Guide polynucleotide editing complex has a guide polynucleotide of SEQ ID NO: 7 and a base editor has a sequence of SEQ ID NO:

78.

64. The method of any one of claims 61-63, wherein the target mutation and / or control mutation are mutations associated with PKU.

65. The method of any one of claims 61-64, wherein the target mutation is selected from c.1222C>T (p.Arg408Trp), c.1066–11G>A, c.782G>A (p.Arg261Gln), and c.728G>A (p.Arg243Gln).

66. The method of any one of claims 61-65, wherein the test ABE / guide polynucleotide editing complex comprises at least one guide polynucleotide selected from Table 1.

67. The method of any one of claims 61-66, wherein the test ABE / guide polynucleotide editing complex comprises at least one base editor selected from Table 2.

68. The method of any one of claims 61-67, wherein the test ABE / guide polynucleotide editing complex has at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% of the corrective activity of the control ABE / guide polynucleotide editing complex.

69. The method of any one of claims 61-68, wherein the test ABE / guide polynucleotide editing complex has greater corrective activity than the control ABE / guide polynucleotide editing complex.

70. The method of any one of claims 61-69, further comprising comparing the level of bystander editing of the test ABE / guide polynucleotide editing complex and the bystander editing of the control ABE / guide polynucleotide editing complex.

71. The method of claim 70, wherein the test ABE / guide polynucleotide editing complex has about the same or less bystander editing than the control ABE / guide polynucleotide editing complex.

72. The method of claim 70 or 71, further comprising selecting the test ABE / guide polynucleotide editing complex without untolerated bystander editing and without nonsynonymous bystander editing.

Images