Composition for improving skin condition comprising peptide as active ingredient

Abstract

The present invention relates to a peptide having a skin condition-improving activity. The peptide of the present invention increases expression levels of extracellular matrix components and skin barrier enhancement factors, reduces expression of skin cell damage factors that are increased due to ultraviolet radiation, and restores expression levels of extracellular matrix components and skin barrier enhancement factors that were reduced by ultraviolet radiation.

Description

Composition for improving skin condition containing peptide as an active ingredient

[0001] [Cross-citation with related applications]

[0002] This application claims the benefit of priority from Korean Patent Application No. 10-2023-0137615, filed October 16, 2023, the entire contents of which are incorporated herein by reference.

[0003] [Technical Field]

[0004] The present invention relates to the use of a peptide having skin condition improvement activity for improving skin condition.

[0005] The skin, an organ that covers all of the body's organs, protects the body from external invasion and plays a crucial role in maintaining homeostasis by conserving moisture and temperature. Histologically, the skin is composed of three layers: the epidermis, dermis, and subcutis. Skin aging can be divided into intrinsic and extrinsic factors. Intrinsic aging occurs naturally with age and is thought to be caused by a decline in skin cell activity due to genetic factors, such as telomere shortening. Extrinsic aging is caused by environmental factors such as sunlight, cold, wind, and fine dust, of which ultraviolet and infrared rays from sunlight are known to be the most important.

[0006] As skin ages, collagen and elastic fibers, which are fibrous tissues that support the skin's structure, harden. Meanwhile, the ground substance, which fills the spaces between cells and between fibrous substances such as collagen and elastic fibers, has a very strong ability to retain moisture. As these ground substances decrease, skin elasticity decreases and wrinkles develop. Representative substances among these ground substances are hyaluronic acid and mucopolysaccharides. As skin ages, hyaluronidase increases, gradually reducing the amount of hyaluronic acid in the dermis. Furthermore, free radicals induced by ultraviolet rays or generated by intracellular respiration react with unsaturated fatty acids in cell membranes to form new radicals, peroxyradicals. These substances initiate a chain reaction in the presence of oxygen, further inducing lipid peroxidation. Lipid peroxidation can further amplify lipid peroxidation reactions and react with proteins, damaging the function of enzymes and receptor systems. Thus, reactive oxygen species are a major cause of damage to skin cells and tissues. Furthermore, reactive oxygen species disrupt the skin's antioxidant defense network, which consists of antioxidant enzymes and non-enzymatic antioxidants, thereby shifting the balance between oxidants and antioxidants toward oxidation. Continued oxidative stress damages biological components through processes such as lipid peroxidation, protein oxidation, activation of proteolytic enzymes that destroy interstitial components, chain scission and abnormal cross-linking of collagen and elastin, cleavage of hyaluronic acid chains, promotion of melanin production, and DNA oxidation.

[0007] Patent documents on peptide active substances with skin aging or wrinkle improvement activity are as follows: Korean Patent No. 10-2486996, Korean Patent No. 10-2507392, and International Patent Application PCT-KR2021-011278.

[0008] [Prior Art Literature]

[0009] [Patent Document]

[0010] Patent Document 1. Republic of Korea Patent No. 10-2486996

[0011] Patent Document 2. Republic of Korea Patent No. 10-2507392

[0012] Patent Document 3. International Patent Application No. PCT-KR2021-011278

[0013] The inventors of the present invention have dedicated their research efforts to developing an effective active substance that can be used to improve skin conditions, including inhibiting skin aging and improving wrinkles. As a result, the inventors experimentally confirmed that the peptide they synthesized exhibits excellent skin condition-improving activity, preventing skin aging and wrinkles caused by both endogenous and exogenous factors, thereby completing the present invention.

[0014] Accordingly, the purpose of the present invention is to provide a composition for improving skin condition, which comprises a peptide having skin condition improving activity as an active ingredient.

[0015] In order to achieve the purpose of the present invention described above,

[0016] One aspect of the present invention provides a composition for improving skin condition, comprising a peptide comprising an amino acid sequence disclosed in SEQ ID NO: 1 as an active ingredient.

[0017] The present invention is described in detail below.

[0018] Peptides and their activities

[0019] The present invention relates to the use of a peptide comprising an amino acid sequence disclosed in SEQ ID NO: 1 for improving skin condition.

[0020] [Amino acid sequence of sequence number 1]

[0021] RLLN

[0022] The term "peptide" as used herein means a linear molecule formed by amino acid residues being linked to each other by peptide bonds.

[0023] The peptide comprising the amino acid sequence of SEQ ID NO: 1 of the present invention may be used without modification, but a variant or fragment of an amino acid having a different sequence by deletion, insertion, substitution, or a combination thereof of amino acid residues may be used within a range that does not affect the original activity of the peptide, for example, the activity of improving skin condition.

[0024] The peptide of the present invention can be modified by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, etc., within a range that does not change its activity.

[0025] The peptide of the present invention includes a peptide comprising an amino acid sequence substantially identical to a peptide comprising an amino acid sequence of SEQ ID NO: 1, and a variant or active fragment thereof. The substantially identical amino acid sequence refers to an amino acid sequence having a sequence identity of 75% or more, for example, 80% or more, 85% or more, 90% or more, 95% or more, 97% or more, or 98% or more, with the amino acid sequence of SEQ ID NO: 1. In addition, the peptide may additionally include a targeting sequence, a tag, a labeled residue, an amino acid sequence manufactured for a specific purpose to increase half-life or peptide stability.

[0026] The peptide of the present invention may be modified at the N-terminus and / or C-terminus to select a portion of the amino acid sequence and increase its activity. Such N-terminus and / or C-terminus modifications can significantly improve the stability of the peptide of the present invention, for example, increasing the half-life of the peptide when administered in vivo. The term "stability" encompasses not only in vivo stability, which protects the peptide of the present invention from attack by in vivo protein-cleaving enzymes, but also storage stability (e.g., room temperature storage stability).

[0027] The above N-terminal modification may be a modification in which a protecting group selected from the group consisting of an acetyl group, a fluoreonylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG) is bonded to the N-terminus of the peptide. The above C-terminal modification may be a modification in which a hydroxyl group (-OH), an amino group (-NH2), an azide (-NHNH2), or the like is bonded to the C-terminus of the peptide, but is not limited thereto.

[0028] The peptide of the present invention can be prepared by various methods widely known in the art to which the present invention pertains. For example, the peptide of the present invention can be prepared by chemical synthesis methods known in the art, particularly solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85:2149-54 (1963); Stewart, et al., Solid Phase Peptide Synthesis, 2nd ed., Pierce Chem. Co.: Rockford, 111 (1984)) or liquid-phase synthesis techniques (US Patent No. 5,516,891).

[0029] The peptide of the present invention has the activity of improving skin condition.

[0030] In one embodiment, the peptide of the present invention has the following activities with respect to improving skin condition:

[0031] (i) Increases the expression levels of extracellular matrix components collagen Iα1, fibronectin, and elastin genes.

[0032] (ii) Increases the expression levels of SIRT1 (Sirtuin 1) and AQP3 (Aquaporin 3) genes, which are skin barrier strengthening factors.

[0033] (iii) Reduces the level of reactive oxygen species (ROS) increased by ultraviolet (UV) irradiation.

[0034] (iv) Increases the expression levels of collagen Iα1, fibronectin and elastin genes, which are extracellular matrix components reduced by ultraviolet irradiation.

[0035] (v) Increases the expression levels of SIRT1 and AQP3 genes, which are skin barrier strengthening factors reduced by ultraviolet irradiation.

[0036] (vi) Reduces the expression level of MMP-1 increased by ultraviolet irradiation.

[0037] Composition for improving skin condition

[0038] According to one aspect of the present invention, a composition for improving skin condition is provided, which comprises a peptide having an amino acid sequence disclosed in SEQ ID NO: 1 as an active ingredient.

[0039] The peptide of the present invention having the above-described activity exhibits excellent efficacy in improving skin condition and can be used for improving skin condition.

[0040] In one embodiment, the improvement of skin condition in the composition for improving skin condition may be improvement of skin aging, promotion of skin regeneration, improvement of skin elasticity, improvement of skin wrinkles, or improvement of skin barrier.

[0041] In one embodiment, the composition for improving skin condition of the present invention has one or more of the following activities:

[0042] (i) Increases the expression levels of extracellular matrix components collagen Iα1, fibronectin, and elastin genes.

[0043] (ii) Increases the expression levels of SIRT1 (Sirtuin 1) and AQP3 (Aquaporin 3) genes, which are skin barrier strengthening factors.

[0044] (iii) Reduces the level of reactive oxygen species (ROS) increased by ultraviolet (UV) irradiation.

[0045] (iv) Increases the expression levels of collagen Iα1, fibronectin and elastin genes, which are extracellular matrix components reduced by ultraviolet irradiation.

[0046] (v) Increases the expression levels of SIRT1 and AQP3 genes, which are skin barrier strengthening factors reduced by ultraviolet irradiation.

[0047] (vi) Reduces the expression level of MMP-1 increased by ultraviolet irradiation.

[0048] The composition for improving skin condition of the present invention may contain the peptide of the present invention at a concentration of 0.01 μM to 1000 μM, specifically, the peptide of the present invention may contain the peptide of the present invention at a concentration of 0.01 μM to 1000 μM; 0.05 μM to 800 μM, 0.05 μM to 700 μM, 0.05 μM to 600 μM, 0.05 μM to 500 μM, 0.05 μM to 300 μM, 0.05 μM to 200 μM; 0.1 μM to 800 μM, 0.1 μM to 700 μM, 0.1 μM to 600 μM, 0.1 μM to 500 μM, 0.1 μM to 300 μM, 0.1 μM to 200 μM; It may be included at a concentration of, but is not limited to, 1 μM to 800 μM, 1 μM to 700 μM, 1 μM to 600 μM, 1 μM to 500 μM, 1 μM to 300 μM, 1 μM to 200 μM; 5 μM to 800 μM, 5 μM to 700 μM, 5 μM to 600 μM, 5 μM to 500 μM, 5 μM to 300 μM, or 5 μM to 200 μM.

[0049] In one embodiment, the composition for improving skin condition described above may be a cosmetic composition.

[0050] The above cosmetic composition may be prepared in any formulation commonly manufactured in the technical field to which the present invention pertains, and may be a topical skin preparation. For example, it may be formulated as a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleanser, oil, powder foundation, emulsion foundation, wax foundation, and spray, but is not limited thereto.

[0051] The above cosmetic composition can be manufactured in various forms such as a solution, sol-gel, emulsion, oil, wax, aerosol, etc., such as a flexible toner, a nourishing toner, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, a powder, a hair tonic, a hair cream, a hair lotion, a hair shampoo, a hair rinse, a hair conditioner, a hair spray, a hair aerosol, a pomade, a gel, etc., but is not limited thereto.

[0052] The cosmetic composition of the present invention may include other additives such as excipients and carriers, and it is possible to apply and mix as much as necessary the usual ingredients mixed in general skin cosmetics.

[0053] When the formulation of the above cosmetic composition is in the form of a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component.

[0054] When the formulation of the above cosmetic composition is in the form of a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, a propellant such as chlorofluorohydrocarbon, propane / butane or dimethyl ether may be additionally included, but is not limited thereto.

[0055] When the formulation of the above cosmetic composition is in the form of a solution or emulsion, a solvent, a solubilizer or an emulsifier may be used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or fatty acid ester of sorbitan.

[0056] When the formulation of the above cosmetic composition is in the form of a suspension, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethyl sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth, etc. can be used as a carrier component.

[0057] When the formulation of the above cosmetic composition is a surfactant-containing cleansing, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, fatty alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester may be used as a carrier component.

[0058] When the formulation of the above cosmetic composition is a hair shampoo, base ingredients for forming a shampoo, such as a thickener, a surfactant, a viscosity modifier, a moisturizer, a pH adjuster, a preservative, and essential oils, may be mixed. CDE may be used as the thickener, LES, which is an anionic surfactant, and coco betaine, which is an amphoteric surfactant, polyquat may be used as the viscosity modifier, glycerin may be used as the moisturizer, and citric acid or sodium hydroxide may be used as the pH adjuster. Grapefruit extract or the like may be used as the preservative, and in addition, essential oils such as cedarwood, peppermint, and rosemary, as well as silk amino acids, pentaol, or vitamin E may be added.

[0059] The ingredients included in the above cosmetic composition may further include, in addition to the peptide of the present invention and the carrier component as active ingredients, ingredients commonly used in cosmetic compositions, such as conventional auxiliary agents such as antioxidants, stabilizers, solubilizers, vitamins, pigments, and fragrances, but are not limited thereto.

[0060] According to another aspect of the present invention, a functional food composition for improving skin condition is provided, which comprises a peptide having an amino acid sequence disclosed in SEQ ID NO: 1 as an active ingredient.

[0061] The above skin condition improvement may be improvement of skin aging, promotion of skin regeneration, improvement of skin elasticity, improvement of skin wrinkles, or improvement of the skin barrier.

[0062] The activity related to improving skin condition in the functional food composition of the present invention is the same as that described in the composition for improving skin condition described above, and therefore, this is cited and will not be described again.

[0063] In the functional food composition of the present invention, the active ingredient, peptide, may be included in an appropriate amount selected within a range of 10 wt% or less, specifically 0.000001 wt% to 10 wt%, based on the total composition weight.

[0064] The functional food composition of the present invention may include a food-related effective amount of a peptide and a food-related acceptable carrier.

[0065] The functional food composition of the present invention comprises not only the peptide as the effective ingredient, but also components commonly added during food manufacturing, such as proteins, carbohydrates, fats, nutrients, seasonings, and flavoring agents. Examples of the carbohydrates mentioned above include monosaccharides such as glucose, fructose, etc.; disaccharides such as maltose, sucrose, oligosaccharides, etc.; and polysaccharides such as dextrin, cyclodextrin, etc., and sugar alcohols such as xylitol, sorbitol, and erythritol. Natural flavoring agents, thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agents (saccharin, aspartame, etc.) can be used.

[0066] In addition to the above-described ingredients, the functional food composition of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickeners (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, it may contain fruit pulp for the production of natural fruit juices and fruit juice drinks and vegetable drinks. For example, when the functional food composition of the present invention is produced as a drink, in addition to the peptide, which is an effective ingredient of the present invention, citric acid, high fructose corn syrup, sugar, glucose, acetic acid, malic acid, fruit juice, Eucommia ulmoides extract, jujube extract, licorice extract, etc. may be additionally contained.

[0067] There are no specific restrictions on the types of the above functional foods. Examples of the above functional foods or foods include meat, sausages, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea drinks, alcoholic beverages, vitamin complexes, dairy products, fermented milk, etc., and all functional foods or foods in the conventional sense can be included.

[0068] Uses of Peptides

[0069] According to another aspect of the present invention, there is provided a use of a peptide comprising an amino acid sequence disclosed in SEQ ID NO: 1 for improving skin condition.

[0070] According to another aspect of the present invention, there is provided a use of a peptide comprising an amino acid sequence disclosed in SEQ ID NO: 1 for the manufacture of cosmetics or functional foods for improving skin conditions.

[0071] According to another aspect of the present invention, a method for improving a skin condition is provided, comprising administering to a patient or subject in need of improvement of a skin condition a peptide comprising an amino acid sequence disclosed in SEQ ID NO: 1 or a composition comprising the peptide as an active ingredient.

[0072] The term “patient” or “subject” as used herein refers to a human or non-human animal, such as humans, primates, mammals, and vertebrates.

[0073] All of the contents described above regarding the peptide of the present invention, its activity and composition can be equally applied to the above-described uses and methods for improving skin conditions, and are not described repeatedly to avoid excessive complexity of the specification.

[0074] The peptide of the present invention has skin condition-improving activity. Specifically, the peptide of the present invention increases the expression levels of extracellular matrix components and skin barrier strengthening factors, reduces the expression of skin cell damage factors increased by UV irradiation, and restores the expression levels of extracellular matrix components and skin barrier strengthening factors decreased by UV irradiation.

[0075] However, the effects of the present invention are not limited to the effects mentioned above, and other effects not mentioned will be clearly understood by those skilled in the art from the description below.

[0076] Figure 1 shows that the peptide of the present invention increases the mRNA expression levels of collagen Iα1 (Collagen Iα1, COLA1), fibronectin (FN1), and elastin (ELN) genes in NIH3T3 cells. The numbers in the figure represent the relative expression levels calculated by comparing the band density values ​​of each gene with the band density value of GAPDH, which is a loading control, and setting the control group to 1.

[0077] Figure 2 shows that the peptide of the present invention increases the mRNA expression levels of SIRT1 (Sirtuin 1) and AQP3 (Aquaporin 3) genes in HaCaT cells. The numbers in the figure represent the relative expression levels calculated by comparing the band density values ​​of each gene with the band density values ​​of GAPDH, which is a loading control, and setting the control group to 1.

[0078] Figures 3a and 3b show that the peptide of the present invention reduces intracellular ROS (reactive oxygen species) levels increased by UV irradiation in NIH3T3 cells and HaCaT cells.

[0079] Figure 4 shows that the peptide of the present invention re-increases the mRNA expression levels of collagen Iα1 (COLA1), fibronectin (FN1), and elastin (ELN) genes, which were reduced by UV irradiation in NIH3T3 cells. The numbers in the figure represent the relative expression levels calculated by comparing the band density values ​​of each gene to the band density values ​​of GAPDH, which is a loading control, and setting the control group to 1.

[0080] Figure 5 shows that the peptide of the present invention re-increases mRNA levels of the SIRT1 and AQP3 genes, which were reduced by UV irradiation in HaCaT cells. The figures in the figure represent the relative expression levels calculated by comparing the band density of each gene to the band density of the GAPDH loading control, with the control group set to 1.

[0081] Figures 6a and 6b demonstrate that the peptides of the present invention re-decrease the expression of MMP-1, which is increased by UV irradiation, in NIH3T3 cells and HaCaT cells. The numbers in the figures represent the relative expression levels calculated by comparing the MMP-1 band density value to the α-tubulin band density value, which is the loading control, and setting the control group to 1.

[0082] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples specifically illustrate the present invention, and the content of the present invention is not limited by the following examples.

[0083] Manufacturing Example 1: Manufacturing of peptides

[0084] A peptide having the amino acid sequence of SEQ ID NO: 1 shown in Table 1 below was synthesized using an automatic peptide synthesizer (Milligen 9050, Millipore, USA), and the synthesized peptide was purified using C18 reverse-phase high-performance liquid chromatography (HPLC) (Waters Associates, USA). The column used was ACQUITY UPLC BEH300 C18 (2.1 mm Х 100 mm, 1.7 μm, Waters Co, USA).

[0085] Sequence number Amino acid sequence (N-terminal → C-terminal) 1RLLN

[0086] The efficacy of the peptide of sequence number 1 manufactured above was evaluated through the following experiment.

[0087] Experimental Example 1: Expression Analysis of Extracellular Matrix Component Genes

[0088] The effect of the peptide manufactured in Manufacturing Example 1 on the expression of extracellular matrix (ECM) components was evaluated by measuring the mRNA expression level of the genes of each component.

[0089] NIH3T3 cells (mouse fibroblast cell line) 3 x 10 5Cells were seeded in 6-well plates at a density of 10 cells / well and cultured for 24 hours. The cultured cells were washed once with serum-free DMEM medium. The peptides prepared in Preparation Example 1 were mixed with serum-free DMEM medium at various concentrations to prepare peptide medium solutions of 10 μM, 50 μM, and 100 μM, which were then added to the cells. The cells were cultured in a CO2 incubator at 37°C for 24 hours, washed twice with PBS, and RNA was isolated using easy blue (iNtRON, Cat. No.: 17061, Korea). The amount of RNA was quantified, 1000 ng of RNA was added per tube, and cDNA synthesis was performed using an RT kit (enzynomics, Cat. No.: RT200, Korea). Then, PCR targeting collagen Iα1, fibronectin, or elastin genes was performed using a PCR kit (enzynomics, Cat. No.: P581T, Korea). The primers used for PCR are shown in Table 2 below.

[0090] As a result of the experiment, it was confirmed that the mRNA expression level of the genes for collagen Iα1 (Collagen, type I, alpha 1), fibronectin, and elastin, which are components of the extracellular matrix (ECM), increased by the peptide of sequence number 1 in NIH3T3 cells (Fig. 1).

[0091] Experimental Example 2: Expression Analysis of Skin Barrier-Related Genes

[0092] The effect of the peptide manufactured in Manufacturing Example 1 on the expression of genes related to the skin barrier was evaluated.

[0093] HaCaT cells (human keratinocyte cell line) were seeded at 3 x 10 5Cells were seeded in 6-well plates at a density of 10 cells / well and cultured for 24 hours. The cultured cells were washed once with serum-free DMEM medium. The peptides prepared in Preparation Example 1 were mixed with serum-free DMEM medium at various concentrations to prepare peptide medium solutions of 10 μM, 50 μM, and 100 μM, which were then added to the cells. The cells were cultured in a CO2 incubator at 37°C for 24 hours, washed twice with PBS, and RNA was isolated using easy blue (iNtRON, Cat. No.: 17061, Korea). The amount of RNA was quantified, 1000 ng of RNA was added per tube, and cDNA was synthesized using an RT kit (enzynomics, Cat. No.: RT200, Korea). Then, PCR targeting the SIRT1 (Sirtuin 1) or AQP3 (Aquaporin 3) gene was performed using a PCR kit (enzynomics, Cat. No.: P581T, Korea). The primers used for PCR are shown in Table 2.

[0094] Sirtuin 1 (SIRT1) and Aquaporin 3 (AQP3) are known to influence the maintenance of the skin barrier by regulating the aging and hydration of cells constituting the epidermis. Experimental results confirmed that the peptide with sequence number 1 increased the mRNA expression levels of the Sirtuin 1 (SIRT1) and Aquaporin 3 (AQP3) genes, which are skin barrier strengthening factors, in HaCaT cells (Fig. 2).

[0095] Experimental Example 3: Inhibition of UV-induced reactive oxygen species (ROS) production

[0096] It was evaluated whether the peptide manufactured in Manufacturing Example 1 inhibits the production of reactive oxygen species (ROS) induced by UV.

[0097] NIH3T3 cells (mouse fibroblast cell line) and HaCaT cells (human keratinocyte cell line) were cultured at 5 x 10 5 The cells were seeded in 6-well plates at a density of 10 cells / well and cultured for 24 hours. The cultured cells were washed once with serum-free DMEM medium. The peptides prepared in Preparation Example 1 were mixed in serum-free DMEM medium at various concentrations to prepare peptide medium solutions of 10 μM, 50 μM, and 100 μM, which were then added to the cells. The cells with the peptides added were cultured in a CO2 incubator at 37°C for 1 hour. After culture, the medium was removed from the cells, and PBS was added. Using a UV irradiator (VILBER LOURMAT, Cat No.: 3102-BSU, France), NIH3T3 cells were irradiated with UVA at 6 J / cm 2 , and for HaCaT cells, UVB was applied at 15 mJ / cm 2 was investigated. After removing PBS, the peptide medium solution at each concentration mentioned above was added to the cells again. The cells with added peptides were cultured in a CO2 incubator at 37°C for 24 hours. After treating with 10 μM DCFH-DA (2', 7'-dichlorofluorescein diacetate), the cells were wrapped in foil and cultured in a CO2 incubator at 37°C for 30 minutes. After washing twice with PBS, the cells were harvested and the fluorescence values ​​were measured using FACS.

[0098] Experimental results confirmed that the peptide with sequence number 1 reduced the intracellular ROS level increased by UV irradiation in NIH3T3 cells (Fig. 3a). In addition, it was confirmed that the peptide with sequence number 1 again reduced the intracellular ROS level increased by UV irradiation in HaCaT cells (Fig. 3b).

[0099] Experimental Example 4: Restoration of extracellular matrix gene expression reduced by UV irradiation

[0100] It was evaluated whether the peptide of sequence number 1 manufactured in Manufacturing Example 1 restores the expression level of extracellular matrix genes reduced by UV irradiation.

[0101] NIH3T3 cells (mouse fibroblast cell line) 5 x 10 5 The cells were seeded in a 6-well plate at a density of 10 cells / well and cultured for 24 hours. The cultured cells were washed once with serum-free DMEM medium. The peptides prepared in Preparation Example 1 were mixed in serum-free DMEM medium at various concentrations to prepare peptide medium solutions of 10 μM, 50 μM, and 100 μM, which were then added to the cells. The cells with the peptides added were cultured in a CO2 incubator at 37°C for 1 hour. After culturing the cells, the medium was removed from the cells, and PBS was added. A UV irradiator (VILBER LOURMAT, Cat No.: 3102-BSU, France) was used to irradiate UVA at 6 J / cm 2 was investigated. After removing PBS, the peptide medium solution at each concentration mentioned above was added to the cells again. The cells with added peptides were cultured in a CO2 incubator at 37℃ for 6 hours. After washing twice with PBS, RNA was isolated using easy blue (iNtRON, Cat. No.: 17061, Korea). The amount of RNA was quantified, and 1000 ng of RNA was added per tube, and cDNA synthesis was performed using an RT kit (enzynomics, Cat. No.: RT200, Korea). Subsequently, PCR targeting collagen Iα1, fibronectin, or elastin genes was performed using a PCR kit (enzynomics, Cat. No.: P581T, Korea). The primers used for PCR are shown in Table 2.

[0102] Experimental results showed that UV irradiation in NIH3T3 cells reduced the mRNA expression levels of collagen Iα1, fibronectin, and elastin genes. However, treatment with the peptide of sequence number 1 resulted in a re-increase in the expression levels of these genes (Fig. 4).

[0103] Experimental Example 5: Restoration of skin barrier-related gene expression reduced by UV irradiation.

[0104] It was evaluated whether the peptide of sequence number 1 manufactured in Manufacturing Example 1 restores the expression level of skin barrier-related genes reduced by UV irradiation.

[0105] HaCaT cells (human keratinocyte cell line) were seeded at 5 x 10 5 The cells were seeded in 6-well plates at a density of 10 cells / well and cultured for 24 hours. The cultured cells were washed once with serum-free DMEM medium. The peptides prepared in Preparation Example 1 were mixed in serum-free DMEM medium at various concentrations to prepare peptide medium solutions of 10 μM, 50 μM, and 100 μM, which were then added to the cells. The cells with the peptides were cultured in a CO2 incubator at 37°C for 1 hour. After culturing the cells, the medium was removed from the cells and PBS was added. A UV irradiator (VILBER LOURMAT, Cat No.: 3102-BSU, France) was used to irradiate UVB at 20 mJ / cm. 2was investigated. After removing PBS, the peptide medium solution at each concentration mentioned above was added to the cells again. The cells with added peptides were cultured in a CO2 incubator at 37℃ for 4 hours. After washing twice with PBS, RNA was isolated using easy blue (iNtRON, Cat. No.: 17061, Korea). The amount of RNA was quantified, and 1000 ng of RNA was added per tube, and cDNA synthesis was performed using an RT kit (enzynomics, Cat. No.: RT200, Korea). Subsequently, PCR targeting SIRT1 and AQP3 genes was performed using a PCR kit (enzynomics, Cat. No.: P581T, Korea). The primers used for PCR are shown in Table 2.

[0106] As a result of the experiment, the mRNA levels of SIRT1 and AQP3 genes were reduced by UV irradiation in HaCaT cells, and the reduced mRNA expression levels of these genes were restored by treatment with the peptide of sequence number 1 (Fig. 5).

[0107] Experimental Example 6: Inhibition of UV-induced MMP-1 expression

[0108] The effect of the peptide of sequence number 1 manufactured in Manufacturing Example 1 on MMP-1 expression induced by UV was evaluated.

[0109] NIH3T3 cells (mouse fibroblast cell line) and HaCaT cells (human keratinocyte cell line) were cultured at 5 x 10 5The cells were seeded in 6-well plates at a density of 10 cells / well and cultured for 24 hours. The cultured cells were washed once with serum-free DMEM medium. The peptides prepared in Preparation Example 1 were mixed in serum-free DMEM medium at various concentrations to prepare peptide medium solutions of 10 μM, 50 μM, and 100 μM, which were then added to the cells. The cells with the peptides added were cultured in a CO2 incubator at 37°C for 1 hour. After culturing the cells, the medium was removed from the cells, and PBS was added. Using a UV irradiator (VILBER LOURMAT, Cat No.: 3102-BSU, France), NIH3T3 cells were irradiated with UVA at 6 J / cm. 2 , and HaCaT cells were exposed to UVB at 15 mJ / cm 2was investigated. After removing PBS, the peptide medium solution for each concentration mentioned above was added to the cells again. The cells with added peptides were cultured in a CO2 incubator at 37℃ for 24 hours. After washing twice with PBS, the cells were lysed by adding cell lysis buffer. After processing with 5X sample buffer, SDS-PAGE was performed using 10% SDS-PAGE gel. The proteins separated by SDS-PAGE were transferred to PVDF membrane. Blocking was performed with 5% skim milk for 1 hour at room temperature. Anti-MMP-1 primary antibody (Abcam, Cat No.: ab137332, UK) was diluted 1:1000 in 5% skim milk and reacted with the membrane for 2 hours. The loading control was reacted in the same manner using anti-α-tubulin primary antibody (Santa Cruz Biotechnology, Cat No.: sc69969, USA). The membrane was washed three times for 10 minutes each with 0.1% PBS-T (0.1% Tween-20 in PBS). As a secondary antibody for the MMP-1 primary antibody, Goat Anti-Rabbit IgG (H+L) (Jackson ImmunoResearch, Cat No.: 111-035-003, USA) was diluted 1:3000 in 5% skim milk and reacted with the membrane for 1 hour. As a secondary antibody for the loading control α-tubulin primary antibody, Goat Anti-Mouse IgG (H+L) (Jackson ImmunoResearch, Cat No.: 115-035-003, USA) was reacted in the same manner. After treatment with ECL solution (GE Healthcare, Cat. No.: RPN2232, USA), the expression level was analyzed using ImageQuant 800 (Cytiva, Cat. No: 29-3994-81, USA) equipment.

[0110] Experimental results showed that UV irradiation increased the expression of MMP-1 in NIH3T3 cells, and the peptide of sequence number 1 inhibited the UV irradiation-induced increase in MMP-1 expression (Fig. 6a). Furthermore, UV irradiation increased the expression of MMP-1 in HaCaT cells, and the peptide of sequence number 1 inhibited the UV irradiation-induced increase in MMP-1 expression (Fig. 6b).

[0111] Primer sequence (5'-> 3') SEQ ID NO Col1a1 Forward(5') CAC CCT CAA GAG CCT GAG TC (3')2Col1a1 Reverse(5') AGA CGG CTG AGT AGG GAA CA (3')3Fibronectin Forward(5') CCA GGA ACC GAG TAC ACC AT (3')4Fibronectin Reverse(5') ATA CCC AGG TTG GGT GAT GA (3')5Elastin Forward(5') GCAAGACCTGGCTTTGGACT (3')6Elastin Reverse(5') GGGAGTTTCTGGTTAGGGCTG (3')7AQP3 Forward(5') CCT TCT TGG GTG CTG GAA TA (3')8AQP3 Reverse(5') ACA CGA TAA GGG AGG CTG TG (3')9SIRT1 Forward(5') TCA GTG GCT GGA ACA GTG AG (3')10SIRT1 Reverse(5') TCT GGC ATG TCC CAC TAT CA (3')11GAPDH Forward(5') GGA GCC AAA AGG GTC ATC AT (3')12GAPDH Reverse(5') GTG ATG GCA TGG ACT GTG GT (3')13

[0112] Although representative embodiments of the present application have been described above as examples, the scope of the present application is not limited to the specific embodiments described above, and a person with ordinary knowledge in the relevant field will be able to make appropriate changes within the scope described in the claims of the present application.

Claims

1. A composition for improving skin condition, comprising a peptide having an amino acid sequence of sequence number 1 as an active ingredient.

2. In claim 1, A composition for improving skin condition, wherein the improvement of the above skin condition is improvement of skin aging, promotion of skin regeneration, improvement of skin elasticity, improvement of skin wrinkles, or improvement of the skin barrier.

3. In claim 1, The composition has a skin condition improvement activity through one or more of the following activities: (i) Activity that increases the expression levels of extracellular matrix components collagen Iα1, fibronectin and elastin genes; (ii) Activity that increases the expression levels of SIRT1 (Sirtuin 1) and AQP3 (Aquaporin 3) genes, which are skin barrier strengthening factors; (iii) Activity in reducing the level of reactive oxygen species (ROS) increased by ultraviolet (UV) irradiation; (iv) Activity that increases the expression levels of collagen Iα1, fibronectin and elastin genes, which are extracellular matrix components reduced by ultraviolet irradiation; (v) activity that increases the expression levels of SIRT1 and AQP3 genes, which are skin barrier strengthening factors reduced by ultraviolet irradiation; and (vi) Activity in reducing the expression level of MMP-1 increased by ultraviolet irradiation.

4. In claim 1, The above composition is a cosmetic composition, a composition for improving skin condition.

5. In claim 4, A composition for improving skin condition, wherein the cosmetic composition is in any one formulation selected from the group consisting of a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, a surfactant-containing cleansing, an oil, a powder foundation, an emulsion foundation, a wax foundation, and a spray.

6. A functional food composition for improving skin condition, comprising a peptide having an amino acid sequence of sequence number 1 as an active ingredient.

7. In claim 6, A functional food composition for improving skin condition, wherein the improvement of the above skin condition is improvement of skin aging, promotion of skin regeneration, improvement of skin elasticity, improvement of skin wrinkles, or improvement of the skin barrier.

8. A method for improving a skin condition, comprising administering a peptide comprising an amino acid sequence of sequence number 1 or a composition comprising the peptide as an active ingredient to a patient or subject in need of improvement of a skin condition.

Images