Enhanced isomaltulose production through recombinant host cells and nucleic acid constructs encoding fusion proteins and process thereof

Abstract

The present subject matter relates generally to a recombinant host cell comprising a polynucleotide fragment encoding for a polypeptide fragment of a fusion protein. The present subject matter also relates to a polynucleotide fragment, a polypeptide fragment, an expression vector and an expression vector replicating cell used for the production and development of the recombinant host cell. Further, the present subject matter relates to a process for production of isomaltulose from sucrose using the recombinant host cell. The present subject matter also pertains to an isomaltulose obtained from the process. The recombinant host cell expresses a cell-wall anchored sucrose isomerase enzyme, resulting in an improved conversion of sucrose to isomaltulose.

Description

Enhanced Isomaltulose Production through Recombinant Host Cells and Nucleic Acid Constructs encoding Fusion Proteins and Process thereof

[0001] The biological materials, used in the present invention, are not sourced from India. The host strainKomagataellaphaffii(Pichia pastoris) was obtained from VIB Protein Core facility (Ghent, Belgium). The DNA sequence ofKlebsiella singaporensisLX3 strain was obtained from National Center for Biotechnology Information (NCBI) database using the GenBank number: AY040843. The DNA sequence of Sed1p was PCR amplified using primer sequences designed based on the coding DNA sequence retrieved fromSaccharomycesGenome Database (SGD: S000002484).Field of Invention

[0002] The invention generally relates to a novel biocatalyst for production of isomaltulose from sucrose and the process for development thereof. The present subject matter pertains particularly to a strain of a host cell or host micro-organism that expresses a cell-wall anchored sucrose isomerase enzyme, resulting in improved conversion of sucrose to isomaltulose.Background

[0003] Sweeteners are widely used in the food industry across the globe. One of the main ingredients used in sweeteners has historically been sucrose. However, recent studies have shown sucrose being associated with serious health disorders due to high glycemic index that causes disruptive blood sugar spike in consumers. There are alternatives to sucrose and a healthier alternative that has been found is Isomaltulose. Isomaltulose being a promising substitute of sucrose, can meet a strong demand for an alternative sweetener in food industry. Hydrolysis of isomaltulose is slow, causing a smaller spike in blood glucose and insulin, making it a low glycemic food that lowers the risk of cardiovascular diseases and diabetes. Further, in comparison with other carbohydrates, isomaltulose is not a significant substrate for oral bacteria and even shows a beneficial gut prebiotic activity. Therefore, the beneficial properties of isomaltulose make it suitable for diabetic patients, athletes and the general population with healthier choices.

[0004] However, production of isomaltulose is a complex chemical process. Enzymatic bioconversion is a preferred method for the production of isomaltulose because of the complexity in its chemical synthesis. Conventionally, enzymes like glucosyltransferase and isomaltulose synthase are used in the production of isomaltulose. These enzymes require enzymatic co-factors for bioconversion processes necessitating an intracellular expression or the addition of co-factors to the process, which is expensive at an industrial scale. Moreover, expression of enzymes like glucosyltransferase on the cell wall is unfeasible due to its requirement of expensive substrates and cofactors, its structural complexity leading to possible disruption of wall integrity, incompatibility with secretion mechanisms, enzyme stability issues, and limited spatial arrangement for reactions. Therefore, an active expression of this enzyme on the cell wall of the host cell will most likely not be possible. However, display of an enzyme on the surface of a host cell bears several advantages. Firstly, neither the substrate nor the product of the enzymatic reaction is required to cross a membrane barrier. Secondly, the enzyme linked to the cell surface and the product can be separated from the reaction mixture by simple centrifugation. This enables multiple cycles of enzymatic conversion by transferring the enzyme-linked cells to freshly prepared substrate. Finally, the anchoring of the enzyme to cell envelope, stabilizes the enzyme in a matrix and makes it less susceptible to proteolytic degradation, inhibitory molecules, stress factors and material adsorption resulting in continuous higher activities. The proteins / peptides displayed on cell surface can be directly analyzed using intact cells without concentration and purification resulting in high-throughput screening. These advantages cannot be availed in case of intracellular expression or extra-cellular secretion of enzymes. Further, in processes employing such pure enzymes, the byproducts like trehalulose, glucose and fructose are also produced which considerably decrease the yield of isomaltulose.

[0005] The use of sucrose isomerase enzyme for production of isomaltulose successfully eliminates the above challenges to a great extent by efficiently converting the sucrose into its structural isomers, mainly isomaltulose and to a lesser extent trehalulose, glucose and fructose without the need of co-factors. It rearranges the glycosidic bond between glucose and fructose in sucrose to form isomaltulose and trehalulose. The small amounts of glucose and fructose formed are consumed by the host cells, preventing their presence as impurities in the isomaltulose produced.

[0006] Sucrose isomerases isolated from different microorganisms are widely used for the industrial conversion of sucrose into isomaltulose. However, sucrose isomerase derived from different microorganisms vary in their conversion efficiency, product yield and ratio despite belonging to the same structural TIM-barrel family 13 of glycoside hydrolases. The requirement of a highly active combination of sucrose isomerase and cell-wall anchor protein remains unaddressed in the food industry.

[0007] Also, the host cells used for the production of such enzymes tend to hydrolyze sucrose for their own metabolism, instead of converting it to isomaltulose. Thus, the yield of isomaltulose is greatly suffered if genes involved in sucrose hydrolysis are present in the host cell.

[0008] Therefore, there is a need of a novel host cell which provides for an expression of sucrose isomerase on its surface and addresses the above cited problems of the prior arts.OBJECT OF THE INVENTION

[0009] It is an object of present invention to provide for a recombinant host cell, comprising a poly-nucleotide fragment encoding and capable of expressing a cell-wall anchored sucrose isomerase (SI) enzyme.

[0010] It is another object of present invention to provide for a recombinant host cell, comprising a poly-nucleotide fragment encoding and capable of expressing a cell-wall anchored sucrose isomerase (SI) enzyme with a higher sucrose conversion capacity into isomaltulose.

[0011] It is yet another object of present invention to provide for a recombinant host cell lacking genes involved in sucrose hydrolysis, and comprising a poly-nucleotide fragment encoding and capable of expressing a cell-wall anchored sucrose isomerase (SI) enzyme with a higher sucrose conversion capacity into isomaltulose.

[0012] It is yet another object of the present invention to provide a commercially viable solution and process for production of isomaltulose, by way of a recombinant host cell lacking genes involved in sucrose hydrolysis, and comprising a poly-nucleotide fragment encoding and capable of expressing a cell-wall anchored sucrose isomerase (SI) enzyme with a higher sucrose conversion capacity into isomaltulose.SUMMARY OF THE INVENTION

[0013] In light of the disadvantages mentioned in the previous section, the following summary is provided to facilitate an understanding of some of the innovative features unique to the present invention and is not intended to be a full description. A full appreciation of the various aspects of the invention can be gained by taking the entire specification and drawings, if any, as a whole.

[0014] Embodiments of the present invention disclose a polynucleotide fragment, a recombinant host cell, a polypeptide fragment of a fusion protein, an expression vector, an expression vector replicating cell, a process for production of isomaltulose from sucrose and an isomaltulose obtained from the process. The recombinant host cell comprises a polynucleotide fragment which is capable of expressing a fusion protein. The fusion protein is made up of a polypeptide fragment. The fusion protein is a sucrose isomerase obtained fromKlebsiella singaporensisfused to a Sed1 anchor protein sourced fromSaccharomyces cerevisiae, for a cell-wall display of the sucrose isomerase. The host cell is incapable of hydrolysing or metabolizing the sucrose.

[0015] Embodiments of the present invention also disclose the process of developing the recombinant host cell. Initially, the sucrose isomerase (SI) genes sourced fromKlebsiella singaporensis(LX3) are subjected to codon optimization for optimal expression in aKomagataella phaffii(Pichia pastoris) host cell. The selected host cell is incapable of hydrolysing or metabolizing the sucrose. Subsequently, specialized expression cassettes / constructs are meticulously constructed by fusing the SI gene with the gene encoding the anchor protein Sed1 derived fromSaccharomyces cerevisiae. These constructs are then strategically integrated into the host cell genome using CRISPR / Cas9 technology. Using the designed genome integration strategy, host cells are subjected to transformation with the designed vectors, leading to the successful integration of the Sed1-KsSI fusion construct into the host cells. This integration empowers the host cells to effectively produce and anchor the SI enzyme to their cell walls through the Sed1 anchor protein. This orchestrated process culminates in the development of recombinant host cell strains, exemplifying remarkable efficiency in both the production and display of the Sucrose Isomerase enzyme.

[0016] Embodiments of the present invention further disclose the process of production of the isomaltulose from sucrose using the recombinant host cells. The recombinant host cell comprises a poly-nucleotide fragment which is capable of expressing a fusion protein. The fusion protein is a sucrose isomerase obtained fromKlebsiella singaporensisfused to an anchor protein sourced fromSaccharomyces cerevisiaeSed1, for a cell-wall display of the sucrose isomerase. The selected host cell being incapable of hydrolysing or metabolizing the sucrose.

[0017] This summary is provided merely for purposes of summarizing some example embodiments, so as to provide a basic understanding of some aspects of the subject matter described herein. Accordingly, it will be appreciated that the above-described features are merely examples and should not be construed to narrow the scope or spirit of the subject matter or the number of possible embodiments herein in any way.DETAILED DESCRIPTION

[0018] Before the polynucleotide fragment, the recombinant host cell, the polypeptide fragment of a fusion protein, the expression vector, the expression vector replicating cell, the isomaltulose and the process for production of isomaltulose from sucrose are described in greater detail, it is to be understood that the invention is not limited to any particular embodiment and may vary accordingly. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the methods and compositions will be limited only by the appended claims.

[0019] The embodiments of the present invention will now be described in detail with reference to an embodiments of the polynucleotide fragment, the recombinant host cell, the polypeptide fragment of a fusion protein, the expression vector, the expression vector replicating cell, the isomaltulose and the process for production of isomaltulose from sucrose along with the methods, materials and processes used in analysis, evaluation and development of the recombinant host cell. However, the disclosed invention is not limited to the present embodiments.

[0020] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. The processes, methods, and examples provided herein are only illustrative and not intended to be limiting.

[0021] In one of the embodiments, a polynucleotide fragment is provided. The polynucleotide fragment encodes for a fusion protein. The fusion protein is made up of a polypeptide fragment. The polypeptide fragment is at least 90% identical to a polypeptide fragment set forth as Sequence ID No. 1.

[0022] In another embodiment of the polynucleotide fragment, the fusion protein is a Sucrose Isomerase fused to an anchor protein for a cell-wall display of the Sucrose Isomerase.

[0023] In another embodiment of the polynucleotide fragment, the Sucrose Isomerase isKlebsiella singaporensisSucrose Isomerase.

[0024] In another embodiment of the polynucleotide fragment, the anchor protein isSaccharomyces cerevisiaeSed1 anchor protein.

[0025] In another embodiment of the polynucleotide fragment, the polypeptide fragment is at least 95% identical to the polypeptide fragment set forth as Sequence ID No. 1.

[0026] In another embodiment of the polynucleotide fragment, the polypeptide fragment is 100% identical to the polypeptide fragment set forth as Sequence ID No. 1.

[0027] The Sequence ID No. 1 (Seq_1) represents the fusion protein expressed by recombinantKomagataella phaffii(P. pastoris).The fusion protein comprises sucrose isomerase fused to an anchor protein for a cell-wall display of the sucrose isomerase. The sucrose isomerase is derived fromKlebsiella singaporensis.The anchor protein is a Sed1 anchor protein derived fromSaccharomyces cerevisiae. The Sequence ID No. 1 (Seq_1) and the Sequence ID No. 2 (Seq_2) are disclosed in the Sequence Listing filed along with the Provisional Specification.

[0028] In another embodiment of the polynucleotide fragment, the polynucleotide fragment is at least 90% identical to a polynucleotide fragment set forth as Sequence ID No. 2.

[0029] The Sequence ID No. 2 (Seq_2) represents the Sed1-KsSI expression construct, used for obtaining recombinantKomagataella phaffii(P. pastoris).The Sed1-KsSI expression construct comprises GAP promoter, Sed1 gene, glycine-serine linker sequence, 6xhis tag,K. singaporensisLX3 sucrose isomerase gene and PRM9 terminator. The Sequence ID No. 2 (Seq_2) are disclosed in the Sequence Listing filed along with the Provisional Specification.

[0030] In another embodiment of the polynucleotide fragment, the polynucleotide fragment comprises of GAP promoter, Sed1 gene, glycine-serine linker sequence, 6xhis tag,K. singaporensisLX3 sucrose isomerase gene and PRM9 terminator.

[0031] In one of the embodiments, a recombinant host cell is provided. The recombinant host cell comprises a polynucleotide fragment. The polynucleotide fragment is provided for an expression of a fusion protein. The fusion protein is made up of a polypeptide fragment. The polypeptide fragment is at least 90% identical to a polypeptide fragment set forth as Sequence ID No. 1.

[0032] In one of the embodiments, a recombinant host cell is provided. The recombinant host cell comprises a polynucleotide fragment. The polynucleotide fragment is provided for an expression of a fusion protein. The fusion protein is made up of a polypeptide fragment. The polypeptide fragment is at least 95% identical to a polypeptide fragment set forth as Sequence ID No. 1.

[0033] In another embodiment of the recombinant host cell, the fusion protein is sucrose isomerase fused to an anchor protein for a cell-wall display of the sucrose isomerase.

[0034] In another embodiment of the recombinant host cell, the sucrose isomerase isKlebsiella singaporensissucrose isomerase.

[0035] In another embodiment of the recombinant host cell, the recombinant host cell isrestricted from a metabolization and a hydrolysis of sucrose.

[0036] In another embodiment of the recombinant host cell, the recombinant host cell is naturallyrestricted from a metabolization and a hydrolysis of sucrose. The host cell isKomagataella phaffii.

[0037] In another embodiment of the recombinant host cell, the polynucleotide fragment is integrated with one or more genomic sites in the recombinant host cell. The one or more genomic sites is selected from a group of Integration Sites. The group of Integration Sites comprising IS 1.1 of a first chromosome, IS1.3 of a first chromosome, IS2.3 of a second chromosome, IS3.2 of a third chromosome, IS3.3 of a third chromosome, IS4.1 of a fourth chromosome, IS4.2 of a fourth chromosome, IS4.4 of a fourth chromosome, an extension with additional Integration Sites in the same or different chromosomes and a combination thereof.

[0038] In another embodiment of the recombinant host cell, the anchor protein isSaccharomyces cerevisiaeSed1 anchor protein.

[0039] In another embodiment of the recombinant host cell, the polypeptide fragment is 100% identical to the polypeptide fragment set forth as Sequence ID No. 1.

[0040] In another embodiment of the recombinant host cell, a vector-based strategy is employed within the host cellachieved through the seamless assembly of the polynucleotide fragment using NEBuilder® HiFi DNA Assembly Master Mix. This approach utilizes a yeast shuttle vector that encompasses key components, including a bacterial replication origin, elements from the yeast 2-micron plasmid for replication, a bleomycin resistance gene controlled by TEF1 and EM7 promoters, CYC1 terminator for selection, and a multiple cloning site. The seamless integration of the polynucleotide fragment into this expression vector ensures their controlled expression under the regulation of a GAP promoter and PRM9 terminator.

[0041] In another embodiment of the recombinant host cell, a precise CRISPR Cas9-targeted integration approach is employed for the incorporation of the polynucleotide fragment into the genome. This involves constructing a guide RNA plasmid with specific sequences targeting the cutting site, utilizing the GAP promoter and self-splicing ribozymes. The Cas9 plasmid and guide RNA plasmid are co-delivered with linear donor DNA intoKomagataella phaffiistrain. The linear donor carrying the sucrose isomerase gene integrates into the genome via homologous recombination. Transformants are selected using antibiotics and confirmed by PCR. Transformants are then grown without antibiotics to lose the Cas9 and guide RNA plasmids. Single colonies lacking both plasmids are stored for further evaluation of sucrose conversion.

[0042] In another embodiment of the recombinant host cell, a dual transformation process is utilized for efficient integration of the polynucleotide fragment into the host cell. This process involves simultaneous transformation of the host cells with both the expression vector and, if applicable, the linear donor DNA for Crispr Cas9 targeted modification. This enables the introduction of the polynucleotide fragment into the host cells, facilitating subsequent integration and expression. In this process, competent host cells (100 μl) are mixed with expression vector or linear donor DNA (up to 1 μg), placed in a cold electroporation cuvette, and subjected to electroporation. After pulsing, the mixture is combined with sorbitol medium and transferred to YPD medium for incubation. Subsequently, the mixture is plated on zeocin-supplemented YPD plates, and selected colonies undergo PCR checks.

[0043] In another embodiment of the recombinant host cell, the host cells are prepared to be electro-competent by growing an overnight culture in YPD medium at 30°C with 200 rpm shaking. The host cells are then transferred to fresh YPD medium and grown until reaching an OD600nm of 1.3-1.5. After centrifugation and resuspension steps, the electro-competent cells are obtained by resuspending in ice-cold sorbitol medium.

[0044] A stable strain of recombinant host cell, containing the polynucleotide fragment encoding for the fusion protein, was selected and deposited in an International Depository, namely Belgian Coordinated Collections of Micro-organisms (BCCM) bearing accession number MUCL 58379, dated 13 / 07 / 2023 (date of the original deposition).

[0045] In one of the embodiments, a polypeptide fragment of a fusion protein is provided. The fusion protein is made up of a polypeptide fragment. The polypeptide fragment is at least 90% identical to a polypeptide fragment set forth as Sequence ID No. 1.

[0046] In one of the embodiments, a polypeptide fragment of a fusion protein is provided. The fusion protein is made up of a polypeptide fragment. The polypeptide fragment is at least 95% identical to a polypeptide fragment set forth as Sequence ID No. 1.

[0047] In another embodiment of the polypeptide fragment, the fusion protein is a Sucrose Isomerase fused to an anchor protein for a cell-wall display of the Sucrose Isomerase

[0048] In another embodiment of the polypeptide fragment, the Sucrose Isomerase isKlebsiella singaporensisSucrose Isomerase.

[0049] In another embodiment of the polypeptide fragment, the anchor protein isSaccharomyces cerevisiaeSed1 anchor protein.

[0050] In another embodiment of the polypeptide fragment, the polypeptide fragment is 100% identical to the polypeptide fragment set forth as Sequence ID No. 1.

[0051] In one of the embodiments, an expression vector is provided. The expression vector comprises a polynucleotide fragment. The polynucleotide fragment encodes for a fusion protein. The fusion protein is made up of a polypeptide fragment. The polypeptide fragment is at least 90% identical to a polypeptide fragment set forth as Sequence ID No. 1.

[0052] In one of the embodiments, an expression vector is provided. The expression vector comprises a polynucleotide fragment. The polynucleotide fragment encodes for a fusion protein. The fusion protein is made up of a polypeptide fragment. The polypeptide fragment is at least 95% identical to a polypeptide fragment set forth as Sequence ID No. 1.

[0053] In another embodiment of the expression vector, the fusion protein is a Sucrose Isomerase fused to an anchor protein for a cell-wall display of the Sucrose Isomerase.

[0054] In another embodiment of the expression vector, the Sucrose Isomerase isKlebsiella singaporensisSucrose Isomerase.

[0055] In another embodiment of the expression vector, the anchor protein isSaccharomyces cerevisiaeSed1 anchor protein.

[0056] In another embodiment of the expression vector, the polypeptide fragment is 100% identical to the polypeptide fragment set forth as Sequence ID No. 1.

[0057] In another embodiment of the expression vector, the expression vector is a plasmid vector.

[0058] In another embodiment of the expression vector, the expression vector can be a cosmid vector, viral vector or an artificial chromosome.

[0059] In one of the embodiments, an expression vector replicating cell is provided. The expression vector replicating cell comprises an expression vector. The expression vector comprises a polynucleotide fragment. The polynucleotide fragment encodes for a fusion protein. The fusion protein is made up of a polypeptide fragment. The polypeptide fragment is at least 90% identical to a polypeptide fragment set forth as Sequence ID No. 1. In a preferred embodiment, yeast cells ofKomagataella phaffii(Pichia pastoris), such as the GS115 strain or other strain of that species, or from other yeast species, such asSaccharomyces cerevisiae,Kluyveromyces marxianus,Yarrowia lipolytica, or others are used as the expression vector replicating cells.

[0060] In another embodiment of the expression vector replicating cell, the fusion protein is a Sucrose Isomerase fused to an anchor protein for a cell-wall display of the Sucrose Isomerase.

[0061] In another embodiment of the expression vector replicating cell, the Sucrose Isomerase isKlebsiella singaporensisSucrose Isomerase.

[0062] In another embodiment of the expression vector replicating cell, the anchor protein isSaccharomyces cerevisiaeSed1 anchor protein.

[0063] In another embodiment of the expression vector replicating cell, the polypeptide fragment is at least 100% identical to a polypeptide fragment set forth as Sequence ID No. 1.

[0064] In one of the embodiments, a process for production of isomaltulose from sucrose is provided. The process comprises a plurality of steps of growing a culture of a recombinant host cell in a predefined media, contacting the recombinant host cell with a sucrose solution to obtain an isomaltulose solution and harvesting the isomaltulose from the isomaltulose solution. The recombinant host cells comprise a polynucleotide fragment. The polynucleotide fragment is provided for an expression of a fusion protein. The fusion protein is made up of a polypeptide fragment. The polypeptide fragment is at least 90% identical to a polypeptide fragment set forth as Sequence ID No. 1.

[0065] In one of the embodiments, a process for production of isomaltulose from sucrose is provided. The process comprises a plurality of steps of growing a culture of a recombinant host cell in a predefined media, contacting the recombinant host cell with a sucrose solution to obtain an isomaltulose solution and harvesting the isomaltulose from the isomaltulose solution. The recombinant host cells comprise a polynucleotide fragment. The polynucleotide fragment is provided for an expression of a fusion protein. The fusion protein is made up of a polypeptide fragment. The polypeptide fragment is at least 95% identical to a polypeptide fragment set forth as Sequence ID No. 1.

[0066] In another embodiment of the process for production of isomaltulose from sucrose, the fusion protein is a Sucrose Isomerase fused to an anchor protein for a cell-wall display of the Sucrose Isomerase.

[0067] In another embodiment of the process for production of isomaltulose from sucrose, the Sucrose Isomerase isKlebsiella singaporensisSucrose Isomerase.

[0068] In another embodiment of the process for production of isomaltulose from sucrose, the anchor protein isSaccharomyces cerevisiaeSed1 anchor protein.

[0069] In another embodiment of the process for production of isomaltulose from sucrose, the polypeptide fragment is 100% identical to the polypeptide fragment set forth as Sequence ID No. 1.

[0070] In one of the embodiments, an isomaltulose is provided. The isomaltulose is obtained from sucrose by using a process. The process comprises a plurality of steps of the process comprising a plurality of steps of growing a culture of a recombinant host cell in a predefined media, contacting the recombinant host cell with a sucrose solution to obtain an isomaltulose solution, and harvesting isomaltulose from the isomaltulose solution. The recombinant host cells comprise a polynucleotide fragment. The polynucleotide fragment is provided for an expression of a fusion protein. The fusion protein is made up of a polypeptide fragment. The polypeptide fragment is at least 90% identical to a polypeptide fragment set forth as Sequence ID No. 1.

[0071] In one of the embodiments, an isomaltulose is provided. The isomaltulose is obtained from sucrose by using a process. The process comprises a plurality of steps of the process comprising a plurality of steps of growing a culture of a recombinant host cell in a predefined media, contacting the recombinant host cell with a sucrose solution to obtain an isomaltulose solution, and harvesting isomaltulose from the isomaltulose solution. The recombinant host cells comprise a polynucleotide fragment. The polynucleotide fragment is provided for an expression of a fusion protein. The fusion protein is made up of a polypeptide fragment. The polypeptide fragment is at least 95% identical to a polypeptide fragment set forth as Sequence ID No. 1.

[0072] In another embodiment of the isomaltulose, the fusion protein is a Sucrose Isomerase fused to an anchor protein for a cell-wall display of the Sucrose Isomerase.

[0073] In another embodiment of the isomaltulose, the Sucrose Isomerase isKlebsiella singaporensisSucrose Isomerase.

[0074] In another embodiment of the isomaltulose, the anchor protein isSaccharomyces cerevisiaeSed1 anchor protein.

[0075] In another embodiment of the isomaltulose, the polypeptide fragment is 100% identical to the polypeptide fragment set forth as Sequence ID No. 1.

[0076] Therefore, the embodiments of the present invention disclose a novel biocatalysts in the form of the recombinant host cell for the production of isomaltulose from sucrose and the process for development thereof. The recombinant host cells encode a polynucleotide which expresses a fusion protein. The fusion protein is made up of a polypeptide fragment. This fusion protein is made by fusion of sucrose isomerase gene sourced fromKlebsiella singaporensiswith a gene encoding the Sed1 anchor protein from the yeastSaccharomyces cerevisiae. The fused sucrose isomerase exhibits its enzymatic prowess directly on the cell's exterior. Further, in the recombinant cell the genes involved in sucrose hydrolysis or sucrose metabolization are absent or suppressed.

[0077] Embodiments of the present invention also disclose the process of developing the recombinant host cell. In this embodiment,Komagataella phaffii(Pichia pastoris)GS115 strain is chosen as the host strain due to its lack of the invertase gene, rendering it incapable of metabolizing sucrose. The primary sequences of sucrose isomerase (SI) genes fromKlebsiella singaporensis(LX3) are optimized for optimal expression inKomagataella phaffii(P. pastoris)GS115 using Integrated DNA technologies (IDT)'s codon optimization tool. Expression cassettes / constructs are created to enable cell surface display. This is achieved by fusing the SI gene with the gene encoding the cell wall anchoring protein Sed1 derived fromSaccharomyces cerevisiae.The Sed1-KsSI fusion construct is inserted into aKomagataella phaffii(P. pastoris)expression vector. The construct contained a strong constitutive GAP promoter, a zeocin selection marker, and the fusion gene. The constructed expression vector is cloned using appropriate techniques to ensure accurate incorporation of the Sed1-KsSI fusion construct. The constructed vector is used to transform the host strain cells. This transformation process introduced the Sed1-KsSI fusion construct into the host cell genome. CRISPR / Cas9 technology is utilized to precisely integrate the Sed1-KsSI fusion construct into specific genomic sites for increased expression and efficiency. One copy is integrated into the IS4.4 genomic site, followed by integration of two copies into the IS1.3 site. An additional copy is integrated into the IS3.3 site, resulting in the creation of theKomagataella phaffii(P. pastoris)AS3 strain. After successful transformation, the Sed1-KsSI fusion construct is integrated into the genome of the host cell i.e.Komagataella phaffii(P. pastoris). This allowed the SI enzyme to be expressed and anchored to the cell wall via the Sed1 anchor protein. Gradually, additional variants AS4, AS5, AS6, AS7 and AS8 strains of theKomagataella phaffiihost have been developed, each containing an increased number of copies of the Sed1-KsSI expression constructs integrated into their genomes. These additional copies further enhance the strains' ability to convert sucrose into isomaltulose and provide advantage in terms of productivity of the conversion process.

[0078] EXAMPLE 1:Selectionof several sucrose isomerase genes

[0079] In order to identify a highly active combination of sucrose isomerase and cell-wall anchor protein, a variety of sucrose isomerases isolated from different microorganisms are evaluated in combination with different cell-wall anchor proteins. Initially, sucrose isomerase genes derived fromProtaminobacter rubrum(CB574.77),Erwinia rhapontici(DSM4484),Serratia plymuthica(ATCC15928) andKlebsiella singaporensis(LX3) are selected for testing their activity upon an expression inKomagataella phaffii(Pichia pastoris). Table 1 provides literature overview of selected sucrose isomerase genes.Table 1. Literature overview of candidate sucrose isomerase genesMicroorganism strainGenBank no.Isomaltulose yield (%)ReferencesProtaminobacter rubrumCB574.77A4584686Hyeon et al., 2008Erwinia rhaponticiDSM4484AF27928185Börnke et al., 2001Serratia plymuthicaATCC15928CQ76597372Kawaguti & Sato, 2010Klebsiella singaporensisLX3AY04084382,6Zhang et al., 2002

[0080] In one embodiment, the host cell isKomagataella phaffii,also known asPichia pastoris.InKomagataella phaffii(Pichia pastoris),the capacity of sucrose metabolization or sucrose hydrolysis is naturally absent.Komagataella phaffii(Pichia pastoris)GS115 is selected as a host strain for the expression of the sucrose isomerase genes as it lacks the invertase gene or any other sucrose hydrolyzing gene. Therefore,Komagataella phaffii(Pichia pastoris)is unable to metabolize sucrose. Moreover, the GS115 strain ofKomagataella phaffii(Pichia pastoris)is widely used as an expression system for the industrial production of recombinant proteins as it is generally recognised as a safe microorganism (GRAS) by the Food and Drug Administration agency (FDA). The primary sequences of selected sucrose isomerase genes are optimized by the codon optimization tool from Integrated DNA technologies (IDT) for an optimal expression inKomagataella phaffii(P. pastoris).

[0081] In another embodiment, host cells likeS. cerevisiaeandY. lipolytica,in which genes involved in sucrose hydrolysis and sucrose metabolization are artificially suppressed, can also be used. Therefore, making them suitable for an expression of cell wall display of sucrose isomerase.

[0082] EXAMPLE2:ProtaminobacterrubrumCB574.77 sucrose isomerase expression inKomagataella phaffii(P. pastoris)

[0083] P. rubrumsucrose isomerase is the first to be evaluated for activity inKomagataella phaffii(P. pastoris)through three constructs: a) C-terminally fused to theS. cerevisiaeFlo1-1099 part of the cell wall protein, b) C-terminally fused to theKomagataella phaffii(Pichia pastoris)Pir1 cell wall protein, and c) C-terminally fused to α-mating factor (MFα) for secretion into the medium.

[0084] All the Sed1-KsSI expression constructs are cloned into an expression vector, under the control of a strong constitutive GAP promoter containing a zeocin selection marker. In the preferred embodiment of the invention, the Sed1-KsSI expression construct, comprises of GAP promoter, Sed1 gene, glycine-serine linker sequence, 6xhis tag,K. singaporensisLX3 sucrose isomerase gene and PRM9 terminator.

[0085] Following this, theKomagataella phaffii(P. pastoris)cells are transformed and transformants carrying the vector are selected based on specific polymerase chain reaction (PCR) confirmation. Sucrose conversion activity of several recombinant transformants is evaluated in yeast peptone medium with 5% sucrose with 100 μg / ml zeocin, at 30°C temperature and shaking at 200 rpm. Table 2 provides for Isomaltulose yield inKomagataella phaffii(P. pastoris)through various expression constructs which are subjected to evaluation.Table 2. Sucrose isomerase conversion evaluationMicroorganismExpressionFusion proteinIsomaltulose yieldP. rubrum CB574.77Vector-basedFlo1-1099 cell wall anchorNot DetectedP. rubrum CB574.77Vector-basedPir1 cell wall anchorNot DetectedP. rubrum CB574.77Vector-basedMFα secretion signalNot Detected

[0086] High-performance liquid chromatography (HPLC) samples are collected and analyzed for evaluation of an Isomaltulose yield inKomagataella phaffii(P. pastoris)through various expression constructs. The results did not show any sucrose conversion nor isomaltulose production indicating that there is no activity of the codon optimizedP. rubrumsucrose isomerase enzyme expressed inKomagataella phaffii(P. pastoris)(see table 2).

[0087] EXAMPLE3:Evaluation ofErwinia rhaponticiDSM4484, Serratia plymuthicaATCC15928andKlebsiella singaporensisLX3sucrose isomerase expression inKomagataella phaffii(P. pastoris)

[0088] Three additional sucrose isomerases are evaluated through expression cassettes / constructs of codon optimized sucrose isomerase genes ofE. rhapontici,S. plymythicaandK. singaporensisLX3 fused with anchor proteins in following manner: a) Sucrose isomerase C-terminally fused to theS. cerevisiaeSed1 cell wall protein, b) Sucrose isomerase C-terminally fused to theKomagataella phaffii(P. pastoris)Pir1 cell wall protein, and c) Sucrose isomerase C-terminally fused to a α-mating factor (MFα) secretion signal.

[0089] All the expression constructs are cloned into an expression vector, under the control of a strong constitutive GAP promoter containing a zeocin selection marker. Following this, theKomagataella phaffii(P. pastoris)cells are transformed and transformants carrying the vector are selected based on specific PCR confirmation. Sucrose conversion activity of several recombinant transformants is evaluated in yeast peptone medium with 5% sucrose with 100 μg / ml zeocin, at 30°C temperature and shaking at 200 rpm. Samples are collected at several timepoints and analyzed by High-performance liquid chromatography for sucrose and isomaltulose concentration. Table 3 summarizes the analysis ofErwinia rhaponticiDSM4484,Serratia plymuthicaATCC15928 andKlebsiella singaporensisLX3 sucrose isomerase expression inKomagataella phaffii(P. pastoris).Table 3. Sucrose isomerase conversion evaluationMicroorganismExpressionFusion proteinIsomaltulose yieldErwinia rhaponticiDSM4484Vector-basedMFα secretion signal23% at 47hErwinia rhaponticiDSM4484Vector-basedPir1 cell wall anchorNot DetectedErwinia rhaponticiDSM4484Vector-basedSed1 cell wall anchorNot DetectedKlebsiella singaporensisLX3Vector-basedMFα secretion signal54.5% at 47hKlebsiella singaporensisLX3Vector-basedPir1 cell wall anchor27.2% at 67hKlebsiella singaporensisLX3Vector-basedSed1 cell wall anchor59.1% at 67hSerratia plymuthicaATCC15928Vector-basedMFα secretion signalNot DetectedSerratia plymuthicaATCC15928Vector-basedPir1 cell wall anchorNot DetectedSerratia plymuthicaATCC15928Vector-basedSed1 cell wall anchorNot Detected

[0090] The results, as summarized in table 3, unexpectedly showed that only the codon-optimizedK. singaporensisLX3 sucrose isomerase in all three expression constructs displayed sucrose conversion activity. The highest yield of isomaltulose is measured inKomagataella phaffii(P. pastoris)with gene coding forK. singaporensisLX3 sucrose isomerase and Sed1 cell-wall anchor fusion protein (Sed1-KsSI expression constructs), reaching 59.1% at 67h. Conversely,S. plymuthicasucrose isomerase does not show any activity for sucrose conversion into isomaltulose in all three tested constructs, whileE. rhaponticisucrose isomerase only showed low activity when secreted with the MFα secretion signal with an isomaltulose yield of 23% at 47h.

[0091] EXAMPLE4:Integration ofK. singaporensisLX3expressioncassette / constructsinto theKomagataella phaffii(P. pastoris)genome

[0092] As inferred from results shown in Table 2 and 3, only the Sed1-KsSI construct showed high activity, supporting efficient cell wall display and high productivity. To further assess the activity of Sed1-KsSI expression constructs, two recombinant strains ofKomagataella phaffii(P. pastoris),AS1 and AS2 are evaluated for sucrose conversion activity. The poly-nucleotide sequence encoding for Sed1-KsSI expression constructs is integrated in at least one genomic site in theKomagataella phaffii(P. pastoris)host cell. AS1 strain ofKomagataella phaffii(P.pastoris)contained only one copy of Sed1-KsSI expression constructs at any one of the chromosomal integration sites provided in Table 4. AS2 strain ofKomagataella phaffii(P. pastoris)contained two copies of Sed1-KsSI expression constructs at any two of the chromosomal integration sites provided in Table 4. CRISPR / Cas9-mediated targeted integration of one copy and subsequently two copies of Sed1-KsSI expression construct are performed into the IS4.4 and IS1.3 chromosomal sites in AS1 and AS2, respectively.Table 4. Genomic sites used for integration of Sed1-KsSI expression cassette / construct inKomagataella phaffii(P. pastoris)Integration sitesChromosomeChromosomal locationIS4.4IV1.167.814^1.167.815IS1.3I1.597.824^1.597.825IS3.3III1.620.100^1.620.101IS3.2III1.064.627^1.064.628IS2.3II1.421.055^1.421.056IS1.1I806.040^806.041IS4.1IV623.682^623.683IS4.2IV1.017.764^1.017.765

[0093] The AS1 and AS2 strains are grown in a pre-culture in Yeast extract peptone dextrose medium (YPD medium) with 100 μg / ml ampicillin. The following day cells of respective strains are collected by centrifugation, washed twice in citrate-phosphate buffer (pH 6) and transferred into citrate-phosphate buffer with 40% sucrose (pH 6) and immediately incubated at 35°C with agitation at 200rpm. Samples for HPLC analysis are taken at multiple timepoints, and the results are shown in Table 5.Table 5. Overview of productivity and isomaltulose yield ofKomagataella phaffii(P. pastoris)AS1 and AS2 strainsStrainProductivity in 3hIsomaltulose yield at 8hAS164.1 g / l / h59.2 %AS281.3 g / l / h73.8 %

[0094] Remarkably, chromosomal integration of the of the Sed1-KsSI expression cassette / construct led to much higher sucrose conversion capacity and isomaltulose production. Moreover, integration of the second copy of the Sed1-KsSI expression construct improved the productivity and isomaltulose yield even further. At 8h the AS2 strain reached 73.8% isomaltulose yield compared to 59.2% for the AS1 strain (Table 5).

[0095] To further improve the sucrose conversion capacity of the recombinantKomagataella phaffii(P. pastoris)strain, an additional third copy of the Sed1-KsSI expression construct is integrated into the AS2 strain at integration site IS3.3 (Table 4), which results in the AS3 strain ofKomagataella phaffii(P. pastoris). Evaluation of sucrose conversion in the strains AS2 and AS3 showed considerably higher productivity in the AS3 compared to the AS2 strain, as summarized in Table 6.Table 6. Overview of productivity and isomaltulose yield ofKomagataella phaffii(P. pastoris)AS1 and AS2 strainsStrainProductivity in 2hIsomaltulose yield at 5hAS2121.6 g / l / h70.2%AS3147.3 g / l / h70.2%

[0096] Though the isomaltulose yield of the two strains is the same after 5 hours, the higher productivity of the AS3 strain offers many advantages. Firstly, it lowers the capital expenditure and operating expenditure of the plant. Secondly, it reduces the amount of yeast to be proliferated for the inoculation. Lastly, it also reduces the risk of bacterial contamination and increases the potential for long-term recycling of the yeast in the production process. The AS3 strain is kept under the IDA status (Budapest Treaty Deposit) with the taxonomic nameKomagataella phaffii. A stable recombinant AS3 strain ofKomagataella phaffiihost cell, containing the recombinant nucleic acid constructs encoding the Sed1-KsSI fusion protein, was selected and deposited in an International Depository, namely Belgian Coordinated Collections of Micro-organisms (BCCM) bearing accession number MUCL 58379, dated 13 / 07 / 2023 (date of the original deposition).

[0097] Over time, additional variants AS4, AS5, AS6, AS7 and AS8 strains of theKomagataella phaffii(P. pastoris)host strain have been developed, each containing an increased number of copies of the Sed1-KsSI expression construct integrated into their genomes. The transformation and selection procedures for AS4, AS5, AS6, AS7 and AS8 strains are same as for the AS1, AS2 and AS3 strains.

[0098] The AS4 strain has one additional copy of the Sed1-KsSI expression construct compared to the AS3 strain. The additional copy of the Sed1-KsSI expression construct is integrated into the AS3 strain at integration site IS3.2 (Table 4), which results in the AS4 strain ofKomagataella phaffii(P. pastoris). The AS5 has two additional copies of the Sed1-KsSI expression construct compared to the AS3. The additional copy of the Sed1-KsSI expression construct is integrated into the AS4 strain at integration site IS2.3 (Table 4), which results in the AS5 strain ofKomagataella phaffii(P. pastoris). The AS6 strain has three additional copies of the Sed1-KsSI expression construct compared to the AS3. The additional copy of the Sed1-KsSI expression construct is integrated into the AS5 strain at integration site IS1.1 (Table 4), which results in the AS6 strain ofKomagataella phaffii(P. pastoris). The AS7 strain has four additional copies of the Sed1-KsSI expression construct compared to the AS3. The additional copy of the Sed1-KsSI expression construct is integrated into the AS6 strain at integration site IS4.1 (Table 4), which results in the AS7 strain ofKomagataella phaffii(P. pastoris). The AS8 strain has five additional copies of the Sed1-KsSI expression construct compared to the AS3. The additional copy of the Sed1-KsSI expression construct is integrated into the AS7 strain at integration site IS4.2 (Table 4), which results in the AS8 strain ofKomagataella phaffii(P. pastoris). The integration of these additional copies significantly enhances the strains' ability to convert sucrose into isomaltulose, potentially resulting in improved productivity at commercial scale as can be inferred from the Table 7 given below.Table 7. Overview of productivity and isomaltulose yield ofKomagataella phaffii(P. pastoris)AS4-AS8 strainsStrainOverall productivity in 4.5hMaximum productivity in 1hMaximum yield at 4.5h*Experiment datedAS466.7194.6480.602.11.2023AS566.7215.1480.602.11.2023AS666227.4279.902.11.2023AS665.521581.223.11.2023AS764.9260.280.523.11.2023AS763.9203,177.119.01.2024AS863.6212,376.719.01.2024* Yield was calculated using the initial sucrose amount to be 4% lower due to the cell pellet volume.Brief Description of the Sequence Listing

[0099] The fusion protein expressed by recombinantKomagataella phaffii(P. pastoris)is disclosed as the Sequence ID No. 1 (Seq_1).The fusion protein is made up of a polypeptide fragment. The fusion protein comprises sucrose isomerase fused to an anchor protein for a cell-wall display of the sucrose isomerase. The sucrose isomerase is derived fromKlebsiella singaporensis.The anchor protein is a Sed1 anchor protein derived fromSaccharomyces cerevisiae.

[0100] The Sed1-KsSI expression construct, used for obtaining recombinantKomagataella phaffii(P. pastoris),is disclosed as Sequence ID No. 2 (Seq_2). The Sed1-KsSI expression construct comprises GAP promoter, Sed1 gene, glycine-serine linker sequence, 6xhis tag,K. singaporensisLX3 sucrose isomerase gene and PRM9 terminator.Materials and methods

[0101] After screening several known sucrose isomerases derived from different bacterial species, a unique and highly active combination of a Sed1 anchor protein, C-terminally fused to the sucrose isomerase enzyme derived from theKlebsiella singaporensisLX3 strain is identified. Integration of the Sed1-KsSI expression construct into a GRAS host strain,Komagataella phaffii(P. pastoris)GS115 resulted in a strain with high sucrose conversion capacity and rapid isomaltulose production. Furthermore, additional integration of up to 3 copies of the Sed1-KsSI expression construct gradually improved the productivity of the sucrose conversion into isomaltulose further. The techniques, methods and materials employed for carrying out transformation, screening and selection of variousKomagataella phaffii(P. pastoris)GS115 recombinant strains and production of isomaltulose from sucrose using various recombinant strains will be described in further detail.

[0102] Genes encoding all sucrose isomerase expression constructs have been cloned using NEBuilder HiFi DNA Assembly Master Mix which enables seamless assembly of multiple DNA fragments. As a vector backbone, a yeast shuttle vector has been used. The vector includes a bacterial origin of replication, part of the endogenous yeast 2-micron plasmid for replication in yeast, the bleomycin resistance gene under the control of a TEF1 promoter (and EM7 bacterial promoter), CYC1 terminator for selection, and a multiple cloning site. Genes encoding all the sucrose isomerase constructs have been cloned in and expressed under the control of a GAP promoter and PRM9 terminator. The cells used for replicating the expression vector include but not limited to the yeast cells ofKomagataella phaffii(Pichia pastoris), such as the GS115 strain or other strain of that species, or from other yeast species, such asSaccharomyces cerevisiae,Kluyveromyces marxianus,Yarrowia lipolytica, or others.

[0103] For Crispr / Cas9 targeted integration of the Sed1-KsSI expression constructs into the genome of the host cell, a guide RNA plasmid expressing the specific guide RNA sequences that target the cutting site using the GAP promoter in combination with self-splicing ribozymes (50 hammerhead (HH) and 30 hepatitis delta virus (HDV)) has been constructed. The guide RNA plasmid contains a nourseothricin antibiotic marker, while the Cas9 expression plasmid contains a hygromycin antibiotic marker for selection of the cells. The donor DNA plasmids are constructed with the Sed1-KsSI expression construct flanked by regions homologous to about 1kb upstream and downstream of the guide RNA cutting site, enabling efficient homologous recombination and integration of the Sed1-KsSI expression construct.

[0104] Komagataella phaffii(P. pastoris)GS115 strain is simultaneously transformed with the Cas9 plasmid. The Cas9 plasmid contains the Cas9 expression construct, the guide RNA plasmid and the linear donor DNA. The linear donor construct is amplified and purified from the donor DNA plasmids previously constructed. The guide RNA plasmid contains specific guide RNA sequences which target the specific integration site as provided in Table 8.Table 8. Guide RNA sequences for integration of gene encoding for sucrose isomerase constructs inKomagataella phaffii(P. pastoris)Integration sitesChromosomeGuide RNA sequence (5’-3’)IS4.4IVGCACCATCTGGATAGCATTGIS1.3IATGATGTGTGCCTAATGACCIS3.3IIIAGCACACCCGAGCAGTGAAGIS3.2IIIGCACGTTCTGTGTTTCCAAGIS2.3IIATAAACACACGTATGGAGCGIS1.1IATTTGGCCGCCATCTTGCTCIS4.1IVCAGCAATGCATGCTAAGGTTIS4.2IVATCCAAACAGCATCCGCCAT

[0105] For the production of electro-competentKomagataella phaffii(P. pastoris)cells, the overnight culture ofKomagataella phaffii(P. pastoris)GS115 is grown in YPD medium at 30°C, with agitation at 200 rpm. The following day, cells are transferred into fresh 50ml of the YPD medium and grown for 4-5 hours to allow the Optical Density to reach at 1.3-1.5 at 600nm. The cells in the culture are spun down by centrifugation for 7 min with the agitation at 2800rpm to pellet the cells. The supernatant is removed, and the pellet is resuspended in 5 ml of YPD medium. To each tube, 0.5ml of 1M HEPES (pH 8.0) and 62.5 μL of 1M DTT is added and incubated for 15min at 30°C, with agitation at 200 rpm. After that, the cells are spun down by centrifugation and resuspended in 3ml ice-cold sterile water and centrifuged again at 500g for 5min at 4°C. The supernatant is removed, and the pellet is again resuspended in ice-cold sterile water and centrifuged as before. This washing step is repeated twice. Afterwards, the cells are re-suspended in 2 ml of ice-cold 1M sorbitol and centrifuged as before. Finally, the supernatant is removed, and the electro-competent cells are resuspended by pipetting in 100-200 μl of ice-cold sorbitol medium.

[0106] For the transformation ofKomagataella phaffii(P. pastoris)by electroporation, 100μl of electro-competentKomagataella phaffii(P. pastoris)GS115 cells are mixed with 1μg of vector in a 1.5ml tube on ice. In case of Crispr / Cas9 targeted modification, up to 1μg of linear donor DNA is additionally used. The mixture is then transferred to the bottom of a cold electroporation cuvette. The cuvette is placed in the electroporation system and a pulse of 1500 V, 200 ohms and 25 μF is given. Directly after the pulse, 1 ml of cold 1M sorbitol medium is added to the cuvette, pipetted up and down and transferred to a 15 ml tube with 2 ml of YPD medium. The 15 ml tube is incubated for 1-2 hours at 30°C in a static incubator. After the recovery period, 80-100μl of the mixture is plated on a YPD plate with antibiotic (100 μg / ml zeocin) for selection. The plates are incubated at 30°C for 3-4 days before picking and transferring single colonies on a new plate and performing colony PCR check.

[0107] As a result of the transformation, the linear donor DNA expressing the Sed1-KsSI construct, is integrated into the specific chromosomal integration site by homologous recombination. Transformants are selected on YPD medium containing 200 μg / ml of hygromycin and 200 μg / ml of nourseothricin. Correct transformants are confirmed using specific sets of PCR primers. The at least two PCR checked independent transformants are grown for 48h in YPD medium without antibiotic selection for the cells to lose the Cas9 and guide RNA plasmids. The cultures are plated for single colony forming units. Re-testing for sensitivity and for absence of plasmids is performed. Single colonies that lost both plasmids are stored in a -80°C glycerol stock and evaluated for sucrose conversion.

[0108] The processforgrowing the recombinanthost cell,convertingthesucroseintotheisomaltuloseandharvesting the isomaltulose.

[0109] For sucrose conversion experiments in the recombinantKomagataella phaffii(P. pastoris)strain with vector-based expression of a sucrose isomerase, the recombinantKomagataella phaffii(P. pastoris)strain cells are grown in a YPD pre-culture medium with 100 μg / ml of ampicillin to prevent bacterial contamination. The following day cells are transferred to fresh YPD medium supplemented with 5% sucrose and 100 μg / ml of ampicillin. 0.5ml of samples are taken at regular timepoints for HPLC analysis.

[0110] For sucrose conversion experiments in the recombinantKomagataella phaffii(P. pastoris)strains with a genome integrated sucrose isomerase, the recombinantKomagataella phaffii(P. pastoris)strain cells are grown in a YPD pre-culture medium with 100 μg / ml of ampicillin. The following day cells are collected by centrifugation and washed twice in citrate-phosphate buffer (pH 6) and transferred to citrate-phosphate buffer with 40% sucrose (pH 6). Then, the cells are immediately incubated at 35°C with agitation at 200rpm. The cell density is determined by optical density at 600nm, which was OD5 (approximately equal to 1g of dry weight of cells per litre). All preparatory works are performed at room temperature. Samples for HPLC analysis are collected at regular time points and supernatants are analysed on an Agilent Hi-Plex Ca column with water as an eluent.

[0111] The sucrose solution can be obtained from sugarcane or sugar beet juice / thin or thick juice / or clarified and concentrated juice or from molasses produced by the sugar mill during sugar production process. The sucrose concentration of the sucrose solution can be between 35-44–50-66 Brix. In one embodiment, a sucrose solution with a sucrose concentration between 40 and 44 brix, which has a dry substance of 40-50% solids with the dry substance being more than 90% sucrose in entirety is used.

[0112] The conversion process employs the treatment of the sucrose solution with the 20-25g cell dry Wt. / L of therecombinant host cell. A single step conversion of the sucrose to isomaltulose and trehalulose is achieved within 3 to 4 hours, at 30 degree Celsius and under optimal mixing conditions. The recombinant host cells are then separated by centrifugation with the objective of recycling them for another cycle of sucrose conversion process. A tubular / disc type centrifugal separator is used to remove the recombinant host cell from the isomaltulose and trehalulose solution obtained after the conversion of sucrose. The recombinant host cells can be further recycled for 8-10 cycles to develop a low-cost system for isomaltulose and trehalulose production compared to the conventional purified enzyme and immobilized bed biocatalysis.

[0113] The converted isomaltulose and trehalulose solution is further clarified using an ultra-filtration system equipped with a 50KDa membrane to remove cellular debris and proteins. The clarified isomaltulose and trehalulose solution is then passed through the Cation exchange (Dowex -88 4 A) and the Anion exchange columns (Dowex MSA1-4 A or Amberlite IRA-68) at the room temperature to obtain a deionized isomaltulose and trehalulose solution. Subsequently, the deionized isomaltulose and trehalulose solution is treated with the activated charcoal (LF310) at a concentration of 0.1% (w / v) at 50 degree Celsius for 30 minutes and then vacuum pre-filtered by using the Celite 508 column (0.45μm). The concentration of this isomaltulose and trehalulose solution is then reduced to 70 brix by heating it under vacuum, at 60-degree Celsius. The isomaltulose and trehalulose rich mother solution for the crystallization process is thus obtained, which is free of any product of cellular metabolism.

[0114] For the crystallization of the isomaltulose, it is preferred to heat the mother solution to decrease its concentration to 65-75% (w / v) or more preferentially to 70% solids. Then, the concentrated mother solution is agitated at 200 rpm to reduce its temperature to about 20 degrees Celsius within 5-6 hrs. Seeding of pure isomaltulose is done at the start of the crystallization process in a crystallizer. This facilitates the faster formation of small crystals upon the reduction of the temperature. Larger crystals can also be produced depending on the final use. When the isomaltulose concentration in the crystallizing mother solution decreases, the crystallizing mother solution with the crystals of isomaltulose is pumped into a filter press. This separates the crystals of isomaltulose from the mother solution. This separation can also be achieved through continuous centrifugation by using a centrifuge with a nylon basket. The crystals of isomaltulose are then recovered from the mother solution. The trehalulose is recovered as a non-crystallizable solution. The trehalulose solution is evaporated under the vacuum in the shallow vacuum pans to obtain the trehalulose. The isomaltulose crystals are washed twice with 85% (v / v) ethanol and then oven dried for 6 hours at 62-degree Celsius under vacuum. Up to 95% or more of the isomaltulose produced in the initial mother solution can be readily recovered as crystals. By employing successive crystallizations, the purity of the isomaltulose can be refined to more than 99% for applications in different food formulations.

[0115] The embodiments of the present disclosed invention successfully achieve an enhanced sucrose conversion efficiency and an increased isomaltulose yield by using a highly active combination of sucrose isomerase and cell-wall anchor protein. The tendency of the recombinant host cells to hydrolyze sucrose for their own metabolism, instead of converting it to isomaltulose is also addressed advantageously. The need to add expensive substrates and enzymatic co-factors for bioconversion processes is also eliminated thereby reducing the overall cost of the isomaltulose production. The cell wall display of the sucrose isomerase is achieved without any disruption of cell-wall integrity, incompatibility in secretion mechanisms, enzyme stability issues, and restriction in spatial arrangement for enzymatic reactions in the cell-wall of the recombinant host cells. The cell wall display of the sucrose isomerase does not require the substrate or the product of the enzymatic reaction to cross the membrane barrier of the recombinant host cells. It also enables the separation of the recombinant host cells from the converted isomaltulose and trehalulose solution by simple centrifugation. Further, it allows the recycling of the recombinant host cells for up to 8-10 cycles of enzymatic conversion of sucrose thereby making the isomaltulose production more economical. Also, the cell wall display of the sucrose isomerase makes it less susceptible to proteolytic degradation, inhibitory molecules, stress factors and material adsorption resulting in continuous higher activity. Also, the samples can be directly analyzed without requiring concentration and purification resulting in high-throughput screening. The yield of different by-products is also minimized which results in considerable increase the yield of isomaltulose. These advantages help in reducing the cost and complexity associated with the isomaltulose production. Therefore, making the isomaltulose, as an alternative to sugar, more affordable for the diabetic patients, athletes and the general population with healthier choices.

[0116] The present disclosed invention relates to a recombinant host cell, a polynucleotide fragment, a polypeptide fragment, an expression vector and an expression vector replicating cell, a process for production of isomaltulose from sucrose and the an isomaltulose obtained from the process. However, the disclosed invention is not limited to the aforementioned embodiments. The present disclosed invention can be worked upon with other possible embodiments involving a polypeptide fragment having at least 90% identity to Sequence ID No. 1. For example, as used in this specification and the appended claims, the singular forms “a,” “an” and “they” can include plural referents unless the content clearly indicates otherwise. Further, when introducing element(s) / component(s) / etc., the articles “a”, “an”, “the”, and “said” are intended to mean that there is one or more of the element(s) / component(s) / etc. The terms “comprising”, “including”, and “having” are intended to be inclusive and mean that there may be additional element(s) / component(s) / etc. other than the listed element(s) / component(s) / etc.

[0117] This written description uses examples to provide details on the disclosure, including the best mode, and also to enable any person skilled in the art to practice the disclosure, including making and using any product or performing any of the incorporated processes. The scope of the disclosure is defined by the claims, and may include other examples that occur to those skilled in the art. Such other examples are intended to be within the scope of the claims if they have structural elements that do not differ from the literal language of the claims, or if they include equivalent structural elements with insubstantial differences from the literal language of the claims.

[0118] It is to be understood that the aspects of the embodiments are not necessarily limited to the features described herein. Many modifications and variations of the present subject matter are possible in the light of above disclosure.

Claims

A polynucleotide fragment, the polynucleotide fragment encoding for a fusion protein, wherein the fusion protein is made up of a polypeptide fragment, the polypeptide fragment being at least 90% identical to a polypeptide fragment set forth as Sequence ID No. 1.The polynucleotide fragment as claimed in claim 1, wherein the fusion protein being a Sucrose Isomerase fused to an anchor protein for a cell-wall display of the Sucrose Isomerase.The polynucleotide fragment as claimed in claim 2, wherein the Sucrose Isomerase isKlebsiella singaporensisSucrose Isomerase.The polynucleotide fragment as claimed in claim 2, wherein the anchor protein isSaccharomyces cerevisiaeSed1 anchor protein.The polynucleotide fragment as claimed in claim 1, wherein the polypeptide fragment being at least 95% identical to the polypeptide fragment set forth as Sequence ID No. 1.The polynucleotide fragment as claimed in claim 1, wherein the polypeptide fragment being 100% identical to the polypeptide fragment set forth as Sequence ID No. 1.The polynucleotide fragment as claimed in claim 1, wherein the polynucleotide fragment is at least 90% identical to a polynucleotide fragment set forth as Sequence ID No. 2.A recombinant host cell, the recombinant host cell comprising a polynucleotide fragment, the polynucleotide fragment being provided for an expression of a fusion protein, wherein the fusion protein is made up of a polypeptide fragment, the polypeptide fragment being at least 90% identical to a polypeptide fragment set forth as Sequence ID No. 1.A recombinant host cell, the recombinant host cell comprising a polynucleotide fragment, the polynucleotide fragment being provided for an expression of a fusion protein, wherein the fusion protein being made up of a polypeptide fragment, the polypeptide fragment being at least 95% identical to a polypeptide fragment set forth as Sequence ID No. 1.The recombinant host cell as claimed in claim 8 or 9, wherein the fusion protein being a sucrose isomerase fused to an anchor protein for a cell-wall display of the sucrose isomerase.The recombinant host cell as claimed in claim 10, wherein the sucrose isomerase isKlebsiella singaporensissucrose isomerase.The recombinant host cell as claimed in claim 10, wherein the recombinant host cell beingrestricted from a metabolization and a hydrolysis of sucrose.The recombinant host cell as claimed in claim 12, wherein the recombinant host cell being naturallyrestricted from a metabolization and a hydrolysis of sucrose, the host cell beingKomagataella phaffii.The recombinant host cell as claimed in claim 13, wherein the polynucleotide fragment being integrated with one or more genomic sites in the recombinant host cell, the one or more genomic sites being selected from a group of Integration Sites, the group of Integration Sites comprising IS1.1 of a first chromosome, IS1.3 of a first chromosome, IS2.3 of a second chromosome, IS3.2 of a third chromosome, IS3.3 of a third chromosome, IS4.1 of a fourth chromosome, IS4.2 of a fourth chromosome, IS4.4 of a fourth chromosome, an extension with additional Integration Sites in the same or different chromosomes and a combination thereof.The recombinant host cell as claimed in claim 10, wherein the anchor protein isSaccharomyces cerevisiaeSed1 anchor protein.The recombinant host cell as claimed in claim 8 or 9, wherein the polypeptide fragment being 100% identical to the polypeptide fragment set forth as Sequence ID No. 1.A polypeptide fragment of a fusion protein, wherein the fusion protein is made up of a polypeptide fragment, the polypeptide fragment being at least 90% identical to a polypeptide fragment set forth as Sequence ID No. 1.A polypeptide fragment of a fusion protein, wherein the fusion protein is made up of a polypeptide fragment, the polypeptide fragment being at least 95% identical to a polypeptide fragment set forth as Sequence ID No. 1.The polypeptide fragment of the fusion protein as claimed in claim 17 or 18, wherein the fusion protein being a Sucrose Isomerase fused to an anchor protein for a cell-wall display of the Sucrose Isomerase.The polypeptide fragment of the fusion protein as claimed in claim 19, wherein the Sucrose Isomerase isKlebsiella singaporensisSucrose Isomerase.The polypeptide fragment of the fusion protein as claimed in claim 19, wherein the anchor protein isSaccharomyces cerevisiaeSed1 anchor protein.The polypeptide fragment of the fusion protein as claimed in claim 17 or 18, wherein the polypeptide fragment is 100% identical to the polypeptide fragment set forth as Sequence ID No. 1.An expression vector, the expression vector comprising a polynucleotide fragment, the polynucleotide fragment encoding for a fusion protein, wherein the fusion protein being made up of a polypeptide fragment, the polypeptide fragment being at least 90% identical to a polypeptide fragment set forth as Sequence ID No. 1.An expression vector, the expression vector comprising a polynucleotide fragment, the polynucleotide fragment encoding for a fusion protein, wherein the fusion protein being made up of a polypeptide fragment, the polypeptide fragment being at least 95% identical to a polypeptide fragment set forth as Sequence ID No. 1.The expression vector as claimed in claim 23 or 24, wherein the fusion protein is a Sucrose Isomerase fused to an anchor protein for a cell-wall display of the Sucrose Isomerase.The expression vector as claimed in claim 25, wherein the Sucrose Isomerase isKlebsiella singaporensisSucrose Isomerase.The expression vector as claimed in claim 25, wherein the anchor protein isSaccharomyces cerevisiaeSed1 anchor protein.The expression vector as claimed in claim 23 or 24, wherein the polypeptide fragment being 100% identical to the polypeptide fragment set forth as Sequence ID No. 1.The expression vector as claimed in claim 23 or 24, wherein the expression vector is a plasmid vector.An expression vector replicating cell, the expression vector replicating cell comprising an expression vector, the expression vector comprising a polynucleotide fragment, the polynucleotide fragment encoding for a fusion protein, wherein the fusion protein is made up of a polypeptide fragment, the polypeptide fragment being at least 90% identical to a polypeptide fragment set forth as Sequence ID No. 1.The expression vector replicating cell as claimed in claim 30, wherein the fusion protein is a Sucrose Isomerase fused to an anchor protein for a cell-wall display of the Sucrose Isomerase.The expression vector replicating cell as claimed in claim 31, wherein the Sucrose Isomerase isKlebsiella singaporensisSucrose Isomerase.The expression vector replicating cell as claimed in claim 31, wherein the anchor protein isSaccharomyces cerevisiaeSed1 anchor protein.The expression vector replicating cell as claimed in claim 30, wherein the polypeptide fragment being at least 100% identical to a polypeptide fragment set forth as Sequence ID No. 1.A process for production of isomaltulose from sucrose, the process comprising a plurality of steps of:growing a culture of a recombinant host cell in a predefined media, the recombinant host cells comprising a polynucleotide fragment, the polynucleotide fragment being provided for an expression of a fusion protein, wherein the fusion protein is made up of a polypeptide fragment, the polypeptide fragment being at least 90% identical to a polypeptide fragment set forth as Sequence ID No. 1;contacting the recombinant host cell with a sucrose solution to obtain an isomaltulose solution; andharvesting isomaltulose from the isomaltulose solution.A process for production of isomaltulose from sucrose, the process comprising a plurality of steps of:growing a culture of a recombinant host cell in a predefined media, the recombinant host cells comprising a polynucleotide fragment, the polynucleotide fragment being provided for an expression of a fusion protein, wherein the fusion protein is made up of a polypeptide fragment, the polypeptide fragment being at least 95% identical to a polypeptide fragment set forth as Sequence ID No. 1;contacting the recombinant host cell with a sucrose solution to obtain an isomaltulose solution; andharvesting isomaltulose from the isomaltulose solution.The process for production of the isomaltulose from sucrose as claimed in claim 35 or 36, wherein the fusion protein is a Sucrose Isomerase fused to an anchor protein for a cell-wall display of the Sucrose Isomerase.The process for production of the isomaltulose from sucrose as claimed in claim 37, wherein the Sucrose Isomerase isKlebsiella singaporensisSucrose Isomerase.The process for production of the isomaltulose from sucrose as claimed in claim 37, wherein the anchor protein isSaccharomyces cerevisiaeSed1 anchor protein.The process for production of the isomaltulose from sucrose as claimed in claim 35 or 36, wherein the polypeptide fragment being 100% identical to the polypeptide fragment set forth as Sequence ID No. 1.An isomaltulose, the isomaltulose being obtained from sucrose by using a process, the process comprising a plurality of steps of:growing a culture of a recombinant host cell in a predefined media, the recombinant host cells comprising a polynucleotide fragment, the polynucleotide fragment being provided for an expression of a fusion protein, wherein the fusion protein is made up of a polypeptide fragment, the polypeptide fragment being at least 90% identical to a polypeptide fragment set forth as Sequence ID No. 1;contacting the recombinant host cell with a sucrose solution to obtain an isomaltulose solution; andharvesting isomaltulose from the isomaltulose solution.An isomaltulose, the isomaltulose being obtained from sucrose by using a process, the process comprising a plurality of steps of:growing a culture of a recombinant host cell in a predefined media, the recombinant host cells comprising a polynucleotide fragment, the polynucleotide fragment being provided for an expression of a fusion protein, wherein the fusion protein is made up of a polypeptide fragment, the polypeptide fragment being at least 95% identical to a polypeptide fragment set forth as Sequence ID No. 1;contacting the recombinant host cell with a sucrose solution to obtain an isomaltulose solution; andharvesting isomaltulose from the isomaltulose solution.The isomaltulose as claimed in claim 41 or 42, wherein the fusion protein is a Sucrose Isomerase fused to an anchor protein for a cell-wall display of the Sucrose Isomerase.The isomaltulose as claimed in claim 43, wherein the Sucrose Isomerase isKlebsiella singaporensisSucrose Isomerase.The isomaltulose as claimed in claim 43, wherein the anchor protein isSaccharomyces cerevisiaeSed1 anchor protein.The isomaltulose as claimed in claim 41 or 42, wherein the polypeptide fragment being 100% identical to the polypeptide fragment set forth as Sequence ID No. 1.Dated this 17thday of April, 2024(Digitally Signed)Sudarshan Singh ShekhawatIN / PA-1611Agent for the Applicant