Multiplex panel for detecting gastrointestinal bacterial nucleic acids

A multiplex qPCR assay with specific primers and probes addresses the challenge of detecting multiple gastrointestinal pathogens by generating distinct fluorescent signals, ensuring rapid and accurate diagnosis.

WO2025160436A1PCT designated stage Publication Date: 2025-07-31LIFE TECHNOLOGIES CORP +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/013003
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-25
Filing Date
2025-01-24
Publication Date
2025-07-31

AI Technical Summary

Technical Problem

Current methods lack a sensitive and specific assay for detecting multiple gastrointestinal bacterial pathogens such as Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Plesiomonas shigelloides, Yersinia enterocolitica, and Aeromonas hydrophila in a single assay, leading to challenges in accurate diagnosis and management of associated illnesses.

Method used

A multiplex qPCR assay using specific primer pairs and probes for each pathogen, allowing simultaneous detection by generating distinct fluorescent signals for each amplicon, with an internal control for validation.

Benefits of technology

The method provides rapid, accurate, and sensitive detection of multiple gastrointestinal pathogens in a single reaction, reducing cross-reactivity and enhancing diagnostic efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025013003_31072025_PF_FP_ABST
    Figure US2025013003_31072025_PF_FP_ABST
Patent Text Reader

Abstract

Described herein are compositions, methods, and kits for detecting diarrhea causing pathogens from patient, food, or environmental samples. One embodiment described herein is primer pairs and probes for multiplex polymerase chain reaction (PCR) based assays for the detection of diarrhea causing pathogens, such as Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Plesiomonas shigelloides, Yersinia enterocolitica, or Aeromonas hydrophila. Other embodiments include methods and kits for detecting diarrhea causing pathogens.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]MULTIPLEX PANEL FOR DETECTING GASTROINTESTINAL BACTERIAL NUCLEIC ACIDS CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to United States Provisional Patent Application No.63 / 624,803, titled “MULTIPLEX PANEL FOR DETECTING GASTROINTESTINAL BACTERIAL NUCLEIC ACIDS,” filed January 25, 2024, the entirety of which is incorporated herein by reference. INCORPORATION BY REFERENCE All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. REFERENCE TO SEQUENCE LISTING This application was filed with a Sequence Listing XML in ST.26 XML format accordance with 37 C.F.R. § 1.831. The Sequence Listing XML file submitted in the USPTO Patent Center, “TP387445WO1.xml,” was created on January 23, 2025, contains 273 sequences, has a file size of 343,814 bytes, and is incorporated by reference in its entirety into the specification. FIELD OF THE INVENTION The invention relates to nucleic acid-based kits and in vitro methods for determining the presence or absence of bacterial gastrointestinal pathogens in a sample, the bacterial gastrointestinal pathogens including the following: Vibrio, Plesiomonas, Yersinia, and Aeromonas. BACKGROUND OF THE INVENTION Bacterial gastrointestinal (GI) pathogens such as Vibrio, Plesiomonas, Yersinia, and Aeromonas are the leading causes of illnesses such as diarrhea, acute gastroenteritis, and fatal cholera. The presence of GI pathogens is correlated to a plethora of highly impactful diseases and an increase in antibiotic resistance. Accordingly, detection of the etiological agents of acute bacterial diarrhea and gastroenteritis is important for patient management and public health interventions as key clinical decisions are driven by bacterial gastrointestinal identification. Vibrio infection can cause a variety of clinical diseases, including a mild, subclinical infection, or severe systemic infections, such as cholera, cellulitis, or sepsis, depending on the species. Vibrio cholerae, Vibrio parahaemolyticus, and Vibrio vulnificus are Gram-negative bacteria that naturally live in saltwater or brackish marine environments. These Vibrio species invade the host through ingestion of undercooked or raw seafood or through open skin (e.g., a wound). Plesiomonas shigelloides is another Gram-negative bacterium that can enter the body through water or seafood contaminated with fecal matter. P. shigelloides causes watery diarrhea or gastroenteritis in humans; however, certain animals have been found to be healthy carriers of the bacteria. Yersinia enterocolitica is a Gram-negative bacterium that is often contracted by the consumption of contaminated animal products, such as undercooked meat or unpasteurized milk, or contaminated water. Illnesses caused by Y. enterocolitica include diarrhea, fever, gastroenteritis, and abdominal pain mimicking appendicitis. Aeromonas hydrophila is a Gram- negative bacterium present in marine environments, including both fresh and brackish water. Similar to those bacteria already described, A. hydrophila enters the body through ingestion of contaminated water or food, or through open wounds. The resulting illnesses associated with A. hydrophila can include gastroenteritis (with symptoms similar to cholera or dysentery) and cellulitis. In rare cases, A. hydrophila can cause necrotizing fasciitis, which is life-threatening. In summary, these Gram-negative bacteria have many of the same methods of transmission and clinical presentations in those infected. Accordingly, there is a need to detect Gram-negative bacteria in a single assay that would be sensitive and specific for the targets but not cross-reactive. The need is solved by the presently disclosed method that is directed the detection of the presence or absence of V. cholerae, V. parahaemolyticus, and V. vulnificus, P. shigelloides, Y. enterocolitica, and A. hydrophila in single assays (per target) or in a multiplex qPCR assay. SUMMARY OF THE INVENTION Disclosed herein is an in vitro method for determining the presence or absence of at least one of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, or A. hydrophila in a sample. The method comprises the steps of: (a) creating a reaction mixture containing the sample and at least one Primer Pair Sets; wherein the Primer Pair Set comprises: at least one primer pair selected from Primer Pair Set A that specifically amplifies a portion of Vibrio cholerae genome; at least one primer pair selected from Primer Pair Set B that specifically amplifies a portion of Vibrio parahaemolyticus genome; at least one primer pair selected from Primer Pair Set C that specifically amplifies a portion of Vibrio vulnificus genome; at least one primer pair selected from Primer Pair Set D that specifically amplifies a portion of Plesiomonas shigelloides genome; at least one primer pair selected from Primer Pair Set E that specifically amplifies a portion of Yersinia enterocolitica; or at least one primer pair selected from Primer Pair Set F that specifically amplifies a portion of Aeromonas hydrophila genome; and (b) subjecting the reaction mixture to reaction conditions suitable to amplify targeted nucleic acids, thereby generating one or more amplicons; wherein the presence or absence of at least one amplicon in the sample indicates the presence or absence of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, or A. hydrophila in the sample. An exemplary embodiment described herein is a method for simultaneously determining the presence or absence of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, and A. hydrophila in a sample is provided, the method comprising the steps of: (a) creating a reaction mixture containing the sample and at least six Primer Pair Sets; wherein the Primer Pair Set comprises: at least one primer pair selected from Primer Pair Set A that specifically amplifies a portion of Vibrio cholerae genome; at least one primer pair selected from Primer Pair Set B that specifically amplifies a portion of Vibrio parahaemolyticus genome; at least one primer pair selected from Primer Pair Set C that specifically amplifies a portion of Vibrio vulnificus genome; at least one primer pair selected from Primer Pair Set D that specifically amplifies a portion of Plesiomonas shigelloides genome; at least one primer pair selected from Primer Pair Set E that specifically amplifies a portion of Yersinia enterocolitica; and at least one primer pair selected from Primer Pair Set F that specifically amplifies a portion of Aeromonas hydrophila genome; and (b) subjecting the reaction mixture to reaction conditions suitable to amplify targeted nucleic acids, thereby generating one or more amplicons; wherein the presence or absence of at least one amplicon in the sample indicates the presence or absence of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, and A. hydrophila in the sample. In some embodiments, the Primer Pair Set comprises at least one Primer Pair Set A, at least one Primer Pair Set B, at least one Primer Pair Set C, at least one Primer Pair Set D, at least one Primer Pair Set E, or at least one Primer Pair Set F from Tables 1a-1f. In some embodiments, the Primer Pair Set further comprises at least one Primer Pair Set G from Table 1g. In some embodiments, the primer pairs are used with corresponding probes as set out in Tables 1a-1g. In some embodiments, the Primer Pair Set comprises at least one Primer Pair Set A, at least one Primer Pair Set B, at least one Primer Pair Set C, at least one Primer Pair Set D, at least one Primer Pair Set E, and at least one Primer Pair Set F from Tables 1a-1f. In some embodiments, the Primer Pair Set further comprises at least one Primer Pair Set G from Table 1g. In some embodiments, the primer pairs are used with corresponding probes as set out in Tables 1a-1g. Another embodiment described herein is a method for individually determining the presence or absence of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, and A. hydrophila in a sample. The method comprises the steps of: (a) creating a reaction mixture containing the sample and at least one primer pair set; wherein the primer pair set comprises: at least one primer pair selected from SEQ ID NO: 1–2, 4–5, 7–8, 10–11, 13–14, 16–17, 19–20, 22–23, 25–26, 28–29, 31–32, 34–35, or 37–38 that specifically amplifies a portion of Vibrio cholerae genome; at least one primer pair selected from SEQ ID NO: 40–41, 43–44, 46– 47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, 73–74, or 76–77 that specifically amplifies a portion of Vibrio parahaemolyticus genome; at least one primer pair selected from SEQ ID NO: 79–80, 82–83, 85–86, 88–89, 91–92, 94–95, 97–98, 100–101, 103–104, 106–107, 109–110, 112–113, or 115–116 that specifically amplifies a portion of Vibrio vulnificus genome; at least one primer pair selected from SEQ ID NO: 118–119, 121–122, 124–125, 127–128, 130– 131, 133–134, 136–137, 139–140, 142–143, 145–146, 148–149, 151–152, or 154–155 that specifically amplifies a portion of Plesiomonas shigelloides genome; at least one primer pair selected from SEQ ID NO: 157-158, 160-161, 163-164, 166–167, 169–170, 172–173, 175–176, 178–179, 181–182, 184–185, 187–188, 190–191, or 193–194 that specifically amplifies a portion of Yersinia enterocolitica genome; or at least one primer pair selected from SEQ ID NO: 196-197, 199-200, 202-203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, 223–224, 226– 227, 229–230, or 232–233 that specifically amplifies a portion of Aeromonas hydrophila genome; and (b) subjecting the reaction mixture to reaction conditions suitable to amplify targeted nucleic acids, thereby generating one or more amplicons; wherein the presence or absence of at least one amplicon in the sample indicates the presence or absence of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, or A. hydrophila in the sample. Another embodiment described herein is a method for simultaneously determining the presence or absence of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, and A. hydrophila in a sample is provided, the method comprising the steps of: (a) creating a reaction mixture containing the sample and at least six primer pair sets; wherein the primer pair set comprises: at least one primer pair selected from SEQ ID NO: 1–2, 4–5, 7–8, 10– 11, 13–14, 16–17, 19–20, 22–23, 25–26, 28–29, 31–32, 34–35, or 37–38 that specifically amplifies a portion of Vibrio cholerae genome; at least one primer pair selected from SEQ ID NO: 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, 73–74, or 76– 77 that specifically amplifies a portion of Vibrio parahaemolyticus genome; at least one primer pair selected from SEQ ID NO: 79–80, 82–83, 85–86, 88–89, 91–92, 94–95, 97–98, 100–101, 103–104, 106–107, 109–110, 112–113, or 115–116 that specifically amplifies a portion of Vibrio vulnificus genome; at least one primer pair selected from SEQ ID NO: 118–119, 121–122, 124– 125, 127–128, 130–131, 133–134, 136–137, 139–140, 142–143, 145–146, 148–149, 151–152, or 154–155 that specifically amplifies a portion of Plesiomonas shigelloides genome; at least one primer pair selected from SEQ ID NO: 157-158, 160-161, 163-164, 166–167, 169–170, 172–173, 175–176, 178–179, 181–182, 184–185, 187–188, 190–191, or 193–194 that specifically amplifies a portion of Yersinia enterocolitica genome; and at least one primer pair selected from SEQ ID NO: 196-197, 199-200, 202-203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, 223–224, 226–227, 229–230, or 232–233 that specifically amplifies a portion of Aeromonas hydrophila genome; and (b) subjecting the reaction mixture to reaction conditions suitable to amplify targeted nucleic acids, thereby generating one or more amplicons; wherein the presence or absence of at least one amplicon in the sample indicates the presence or absence of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, and A. hydrophila in the sample. In an exemplary embodiment of the method, the generating of the at least one amplicon includes performing PCR. In an exemplary embodiment of the method, the at least one amplicon is one selected from an amplicon produced using one or more primer pairs selected from Primer Pair Set A (V. cholerae) and comprising a sequence selected from SEQ ID NO: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, or 39; an amplicon produced using one or more primer pairs selected from Primer Pair Set B (V. parahaemolyticus) and comprising a sequence selected from SEQ ID NO: 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, or 78; an amplicon produced using one or more primer pairs selected from Primer Pair Set C (V. vulnificus) and comprising a sequence selected from SEQ ID NO: 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, or 117; an amplicon produced using one or more primer pairs selected from Primer Pair Set D (P. shigelloides) and comprising a sequence selected from SEQ ID NO: 120, 123, 126, 129, 132, 135, 138, 141, 144, 147, 150, 153, or 156; an amplicon produced using one or more primer pairs selected from Primer Pair Set E (Y. enterocolitica) and comprising a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, or 195; and / or an amplicon produced using one or more primer pairs selected from Primer Pair Set F (A. hydrophila) and comprising a sequence selected from SEQ ID NO: 198, 201, 204, 207, 210, 213, 216, 219, 222, 225, 228, 231, or 234. In an exemplary embodiment of the method, the at least one amplicon is one selected from an amplicon produced using one or more primer pairs selected from Primer Pair Set G (Bacillus atrophaeus) and comprising a sequence selected from SEQ ID NO: 237, 240, 243, 243, 246, 249, 252, 255, 258, 261, 264, 267, 270, or 273. In one aspect, the amplicon for Bacillus atrophaeus or absence thereof is used as a control. In an exemplary embodiment of the method, the reaction mixture contains probes specific for the at least one amplicon. In an exemplary embodiment of the method, the reaction mixture further comprises probes suitable for use with a specific forward and reverse primer pair, and the probes are selected from the probe sequences provided in Tables 1a-1g. In an exemplary embodiment of the method, the primer pair comprises the following sequences: Primer Pair Set A comprises at least one forward and reverse primer pair selected from primer pair sequences selected from the sequences specific for Vibrio cholerae in Table 1a, Primer Pair Set B comprises at least one forward and reverse primer pair selected from primer pair sequences selected from the sequences specific for Vibrio parahaemolyticus in Table 1b, Primer Pair Set C comprises at least one forward and reverse primer pair selected from primer pair sequences selected from the sequences specific for Vibrio vulnificus in Table 1c, Primer Pair Set D comprises at least one forward and reverse primer pair selected from primer pair sequences selected from the sequences specific for Plesiomonas shigelloides in Table 1d, Primer Pair Set E comprises at least one forward and reverse primer pair selected from primer pair sequences selected from the sequences specific for Yersinia enterocolitica in Table 1e; and / or Primer Pair Set F comprises at least one forward and reverse primer pair selected from primer pair sequences selected from the sequences specific for Aeromonas hydrophila in Table 1f. In an exemplary embodiment of the method, the reaction mixture further comprises probes suitable for use with said primer pairs in Tables 1a-1f. In an exemplary embodiment of the method, Primer Pair Set A comprises at least one forward and reverse primer pair selected from primer sequences in Table 1a; Primer Pair Set B comprises at least one forward and reverse primer pair selected from primer sequences in Table 1b; Primer Pair Set C comprises at least one forward and reverse primer pair selected from primer sequences in Table 1c; Primer Pair Set D comprises at least one forward and reverse primer pair selected from primer sequences in Table 1d; Primer Pair Set E comprises at least one forward and reverse primer pair selected from primer sequences in Table 1e; and / or Primer Pair Set F comprises at least one forward and reverse primer pair selected from primer sequences in Table 1f. In an exemplary embodiment of the method, the reaction mixture further contains a control sample and a Primer Pair Set G and, optionally, a probe, that specifically amplify the target nucleic acid of a control sample. In an exemplary embodiment of the method the Primer Pair Set G comprises forward and reverse primer pairs selected from Table 1g and the probe sequence is selected from Table 1g. In an exemplary embodiment of the method, the probes each contain a fluorescent reporter. In an exemplary embodiment of the method, the probes each contain a quencher. In an exemplary embodiment of the method, each of the probes is labeled at or near the 5′-end with a dye selected from FAM, VIC, ABY, JUN, or AF647. In an exemplary embodiment of the method, each of the probes is labeled at the 3′-end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, and DFQ. In an exemplary embodiment of the method, the probes specific for amplicons generated using one or more primer pairs from Primer Pair Sets A, B, and C are labeled with FAM; the probes specific for amplicons generated using one or more primer pairs from Primer Pair Set D are labeled with VIC; the probes specific for amplicons generated using one or more primer pairs from Primer Pair Set E are labeled with ABY; and / or the probes specific for amplicons generated using one or more primer pairs from Primer Pair Set F are labeled with JUN. In an exemplary embodiment of the method, the probes specific for amplicons generated using one or more primer pairs from Primer Pair Set G are labeled with AF647. In an exemplary embodiment, a composition for individually determining the presence or absence of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, and A. hydrophila in a sample, comprises a set of at least one primer pair wherein the primer pair set comprises: at least one primer set selected from Primer Pair Set A that specifically amplifies a portion of Vibrio cholerae genome; at least one primer set selected from Primer Pair Set B that specifically amplifies a portion of Vibrio parahaemolyticus genome; at least one primer set selected from Primer Pair Set C that specifically amplifies a portion of Vibrio vulnificus genome; a at least one primer set selected from Primer Pair Set `D that specifically amplifies a portion of Plesiomonas shigelloides genome; at least one primer set selected from Primer Pair Set E that specifically amplifies a portion of Yersinia enterocolitica genome; or at least one primer set selected from Primer Pair Set F that specifically amplifies a portion of Aeromonas hydrophila genome. In an exemplary embodiment, a composition for simultaneously determining the presence or absence of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, and A. hydrophila in a sample, comprises a set of at least six primer pairs wherein the primer pair set comprises: at least one primer set selected from Primer Pair Set A that specifically amplifies a portion of Vibrio cholerae genome; at least one primer set selected from Primer Pair Set B that specifically amplifies a portion of Vibrio parahaemolyticus genome; at least one primer set selected from Primer Pair Set C that specifically amplifies a portion of Vibrio vulnificus genome; a at least one primer set selected from Primer Pair Set `D that specifically amplifies a portion of Plesiomonas shigelloides genome; at least one primer set selected from Primer Pair Set E that specifically amplifies a portion of Yersinia enterocolitica genome; and at least one primer set selected from Primer Pair Set F that specifically amplifies a portion of Aeromonas hydrophila genome. In an exemplary embodiment of the composition, the primer pair set comprises the following sequences: Primer Pair Set A comprises at least one forward and reverse primer pair selected from primer pair sequences specific for Vibrio cholerae in Table 1a; Primer Pair Set B comprises at least one forward and reverse primer pair selected from primer pair sequences specific for Vibrio parahaemolyticus in Table 1b; Primer Pair Set C comprises at least one forward and reverse primer pair selected from primer pair sequences specific for Vibrio vulnificus in Table 1c; Primer Pair Set D comprises at least one forward and reverse primer pair selected from primer pair sequences specific for Plesiomonas shigelloides in Table 1d; Primer Pair Set E comprises at least one forward and reverse primer pair selected from primer sequences specific for Yersinia enterocolitica in Table 1e; and / or Primer Pair Set F comprises at least one forward and reverse primer pair selected from primer sequences specific for Aeromonas hydrophila in Table 1f. In an exemplary embodiment of the composition, further comprising probes specific for amplicons produced using the Primer Pair Sets of Primer Pair Set A, Primer Pair Set B, Primer Pair Set C, Primer Pair Set D, Primer Pair Set E, and / or Primer Pair Set F in Tables 1a-1f. In an exemplary embodiment of the composition, the probes suitable for use with a specific forward and reverse primer pair are selected from the probe sequences provided for said primer pair in Tables 1a-1f. In an exemplary embodiment of the composition, the composition further includes a polymerase, a buffer, and deoxynucleotide triphosphates (dNTPs). In an exemplary embodiment of the composition, the composition further includes a sample. In an exemplary embodiment of the composition, the composition further contains a primer set from Primer Pair Set G that comprises forward and reverse primer pair selected from Table 1g and, optionally, at least one probe selected from Table 1g. One embodiment described herein is a single assay of a forward primer, reverse primer, and probe for detecting gastrointestinal bacterial nucleic acids in a sample, including Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Plesiomonas shigelloides, Yersinia enterocolitica, or Aeromonas hydrophila. Another embodiment described herein is a single assay of a forward primer, reverse primer, and probe as described above. One embodiment described herein is a multiplex panel of forward primers, reverse primers, and probes for detecting gastrointestinal bacterial nucleic acids in a sample, including Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Plesiomonas shigelloides, Yersinia enterocolitica, and / or Aeromonas hydrophila. Another embodiment described herein is a multiplex panel of forward primers, reverse primers, and probes described above. In one aspect, at least one probe contains a fluorescent reporter. In one aspect, at least one probe contains a quencher. In one aspect, at least one probe is labeled at or near the 5′-end with a dye selected from FAM, VIC, ABY, JUN, or AF647. In one aspect, at least one probe is labeled at the 3′-end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, and DFQ. In one aspect, at least one probe specific for amplicons generated using one or more primer pairs from Primer Pair Sets A, B, and C are labeled with FAM; the probes specific for amplicons generated using one or more primer pairs from Primer Pair Set D are labeled with VIC; the probes specific for amplicons generated using one or more primer pairs from Primer Pair Set E are labeled with ABY; and / or the probes specific for amplicons generated using one or more primer pairs from Primer Pair Set F are labeled with JUN. In an exemplary embodiment of the method, the probes specific for amplicons generated using one or more primer pairs from Primer Pair Set G are labeled with AF647. Another embodiment described herein is a kit for simultaneously determining the presence or absence of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, and / or A. hydrophila in a sample comprising any of the compositions described herein. In one aspect, the kit comprises any of the multiplex panels, single assays, or combination of single assays of forward primers, reverse primers, and probes for detecting gastrointestinal bacterial nucleic acids in a sample. In one embodiment, the kit further comprises one or more primer sets from Primer Pair Set G, and, optionally, a probe, that specifically amplify the target nucleic acid of a control sample. In one aspect, the primer sets from Primer Pair Set G comprises one or more forward and reverse primer pairs in Table 1g and a probe in Table 1g. In another embodiment, the kit comprises a multiplex panel, single assays, or combination of single assays of forward primers, reverse primers, and probes as described above. It will be apparent to one of ordinary skill in the relevant art that suitable modifications and adaptations to the compositions, formulations, methods, processes, and applications described herein can be made without departing from the scope of any embodiments or aspects thereof. The compositions and methods provided are exemplary and are not intended to limit the scope of any of the specified embodiments. All of the various embodiments, aspects, and options disclosed herein can be combined in any variations or iterations. The scope of the compositions, formulations, methods, and processes described herein include all actual or potential combinations of embodiments, aspects, options, examples, and preferences herein described. The exemplary compositions and formulations described herein may omit any component, substitute any component disclosed herein, or include any component disclosed elsewhere herein. The ratios of the mass of any component of any of the compositions or formulations disclosed herein to the mass of any other component in the formulation or to the total mass of the other components in the formulation are hereby disclosed as if they were expressly disclosed. Should the meaning of any terms in any of the patents or publications incorporated by reference conflict with the meaning of the terms used in this disclosure, the meanings of the terms or phrases in this disclosure are controlling. Furthermore, the foregoing discussion discloses and describes merely exemplary embodiments. All patents and publications cited herein are incorporated by reference herein for the specific teachings thereof. Various embodiments and aspects of the inventions described herein are summarized above. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows an exemplary amplification plot depicting the detection of Vibrio cholerae using a synthetic template. FIG. 2 shows an exemplary amplification plot depicting the detection of Vibrio parahaemolyticus using a synthetic template. FIG.3 shows an exemplary amplification plot depicting the detection of Vibrio vulnificus using a synthetic template. FIG. 4 shows an exemplary amplification plot depicting the detection of Plesiomonas shigelloides using a synthetic template. FIG. 5 shows an exemplary amplification plot depicting the detection of Yersinia enterocolitica using a synthetic template. FIG. 6 shows an exemplary amplification plot depicting the detection of Aeromonas hydrophila using a synthetic template. DETAILED DESCRIPTION Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For example, any nomenclatures used in connection with, and techniques of biochemistry, molecular biology, immunology, microbiology, genetics, cell and tissue culture, and protein and nucleic acid chemistry described herein are well known and commonly used in the art. In case of conflict, the present disclosure, including definitions, will control. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the embodiments and aspects described herein. As used herein, the terms “amino acid,” “nucleotide,” “polynucleotide,” “vector,” “polypeptide,” and “protein” have their common meanings as would be understood by a biochemist of ordinary skill in the art. Standard single letter nucleotides (A, C, G, T, U) and standard single letter amino acids (A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y) are used herein. As used herein, the terms such as “include,” “including,” “contain,” “containing,” “having,” and the like mean “comprising.” The present disclosure also contemplates other embodiments “comprising,” “consisting essentially of,” and “consisting of” the embodiments or elements presented herein, whether explicitly set forth or not. As used herein, the term “a,” “an,” “the” and similar terms used in the context of the disclosure (especially in the context of the claims) are to be construed to cover both the singular and plural unless otherwise indicated herein or clearly contradicted by the context. In addition, “a,” “an,” or “the” means “one or more” unless otherwise specified. As used herein, the term “or” can be conjunctive or disjunctive. As used herein, the term “and / or” refers to both the conjunctive and disjunctive. As used herein, the term “substantially” means to a great or significant extent, but not completely. As used herein, the term “about” or “approximately” as applied to one or more values of interest, refers to a value that is similar to a stated reference value, or within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, such as the limitations of the measurement system. In one aspect, the term “about” refers to any values, including both integers and fractional components that are within a variation of up to ± 10% of the value modified by the term “about.” Alternatively, “about” can mean within 3 or more standard deviations, per the practice in the art. Alternatively, such as with respect to biological systems or processes, the term “about” can mean within an order of magnitude, in some embodiments within 5-fold, and in some embodiments within 2-fold, of a value. As used herein, the symbol “~” means “about” or “approximately.” All ranges disclosed herein include both end points as discrete values as well as all integers and fractions specified within the range. For example, a range of 0.1–2.0 includes 0.1, 0.2, 0.3, 0.4...2.0. If the end points are modified by the term “about,” the range specified is expanded by a variation of up to ±10% of any value within the range or within 3 or more standard deviations, including the end points. As used herein, the terms “control,” or “reference” are used herein interchangeably. A “reference” or “control” level may be a predetermined value or range, which is employed as a baseline or benchmark against which to assess a measured result. “Control” also refers to control experiments. As used herein, the term “subject” refers to an animal. Typically, the subject is a mammal. A subject also refers to primates (e.g., humans, male or female; infant, adolescent, or adult), non- human primates, rats, mice, rabbits, pigs, cows, sheep, goats, horses, dogs, cats, fish, birds, and the like. In one embodiment, the subject is a primate. In one embodiment, the subject is a human. As used herein, a subject is “in need of treatment” if such subject would benefit biologically, medically, or in quality of life from such treatment. A subject in need of treatment does not necessarily present symptoms, particular in the case of preventative or prophylaxis treatments. As used herein, the terms “inhibit,” “inhibition,” or “inhibiting” refer to the reduction or suppression of a given biological process, condition, symptom, disorder, or disease, or a significant decrease in the baseline activity of a biological activity or process. As used herein, “treatment” or “treating” refers to prophylaxis of, preventing, suppressing, repressing, reversing, alleviating, ameliorating, or inhibiting the progress of biological process including a disorder or disease, or completely eliminating a disease. A treatment may be either performed in an acute or chronic way. The term “treatment” also refers to reducing the severity of a disease or symptoms associated with such disease prior to affliction with the disease. “Repressing” or “ameliorating” a disease, disorder, or the symptoms thereof involves administering a cell, composition, or compound described herein to a subject after clinical appearance of such disease, disorder, or its symptoms. “Prophylaxis of” or “preventing” a disease, disorder, or the symptoms thereof involves administering a cell, composition, or compound described herein to a subject prior to onset of the disease, disorder, or the symptoms thereof. “Suppressing” a disease or disorder involves administering a cell, composition, or compound described herein to a subject after induction of the disease or disorder thereof but before its clinical appearance or symptoms thereof have manifest. The polynucleotides described herein may include variants that have substitutions, deletions, and / or additions that can involve one or more nucleotides. Some embodiments described herein include nucleic acid molecules comprising polynucleotides having nucleotide sequences about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, and more preferably at least about 95–99% or 100% identical to (a) nucleotide sequences of SEQ ID NO: 1–273 and capable of being used as primers or probes as described herein; or (b) nucleotide sequences capable of hybridizing to the complement of any of the nucleotide sequences of SEQ ID NO: 1–273 and capable of being used as primers or probes as described herein. As used herein, a nucleotide having a nucleotide sequence at least 90–99% “identical” to a reference nucleotide sequence indicates that the nucleotide sequence is identical to the reference sequence except that the nucleotide sequence can include up to about 10-to-1 point mutations, additions, or deletions per each 100 nucleotides of the reference nucleotide sequence. In other words, to obtain a nucleotide having a nucleotide sequence at least 90–99% identical to a reference nucleotide sequence, up to 10% of the nucleotides in the reference sequence can be deleted, added, or substituted with another nucleotide, or a number of nucleotides up to 10% of the total nucleotides in the reference sequence can be inserted into the reference sequence. These mutations of the reference sequence can occur at the 5′- or 3′-terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. These may include standard nucleotides, modified nucleotides, fluorescent dyes, linkers, or other modifications. As described above, two or more polynucleotide sequences can be compared by determining their percent identity. The percent identity of two sequence is generally described as the number of exact matches between two aligned sequences divided by the length of the shorter sequence and multiplied by 100. Alignment for nucleic acid sequences can be performed using by the global alignment method of Needleman and Wunsch, J. Mol. Biol.48 (3): 443-453 (1970) or the local homology algorithm of Smith and Waterman, Adv. Appl. Math.2: 482-489 (1981). Described herein are primers, primer sets, and probes designed for target sequences and compatible for use in a multiplex qPCR determining the presence of multiple diarrhea-causing pathogens. Multiplex PCR presents a challenge for quantitation of the pathogen DNA: the different amplicons compete for the same PCR reaction components (such as e.g., DNA polymerase and MgCl2) and this can compromise the quantitative comparison between samples. It is known in the art that there is bias in the amplification efficiencies between different template amounts or lengths so that e.g., short amplicons are favored in the expense of longer ones. At the same time, undesired cross-reactions of multiplex set oligo combinations must be avoided. Finding suitable primer and probe sequences for the detection of a diverse group of pathogenic microbes is far from trivial especially when designing multiplex set ups. Described herein are primer sets and probes for detecting the presence or absence of each of Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Plesiomonas shigelloides, Yersinia enterocolitica, and Aeromonas hydrophila. The selected primers and probes of the assay do not cross-react with other closely-related pathogens. The disclosed detection method and assay may contain an internal process control, such as Bacillus atrophaeus (BA). In addition, the assay may have a real time PCR positive control. The probes that target genomic regions of different pathogens utilize four distinct fluorophores, while a fifth fluorophore is designated for the process control detection. Therefore, a 5-plex qPCR assay is described herein, wherein the detection takes place in a single-well reaction, to meet the speed and high-throughput needs for rapid clinical gastrointestinal pathogen testing. When an exemplary “embodiment” or a particular “assay” is described herein, it will be understood that the features of that embodiment may be applicable to a composition (e.g., the particular physical components of an assay such as primers and / or probes), a kit (e.g., primers and / or probes and additional buffers, reagents, etc.), or a method (e.g., a process for detecting target nucleic acids) as appropriate. For simplicity, embodiments are presented by describing “assays,” but it will be understood that the associated methods for the assays, and the compositions for carrying out the assays (primers, probes, and primer sets), are also intended to be part of this disclosure. One embodiment described herein is a method for individually or simultaneously determining the presence or absence of Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Plesiomonas shigelloides, Yersinia enterocolitica, and / or Aeromonas hydrophila in a sample. In one embodiment, the method comprises the steps of: (a) creating a reaction mixture containing the sample and at least one Primer Pair Set; wherein the primer pair set comprises: at least one primer pair selected from Primer Pair Set A that specifically amplifies a portion of V. cholerae genome; at least one primer pair selected from Primer Pair Set B that specifically amplifies a portion of V. parahaemolyticus genome; at least one primer pair selected from Primer Pair Set C that specifically amplifies a portion of V. vulnificus genome; at least one primer pair selected from Primer Pair Set D that specifically amplifies a portion of P. shigelloides genome; at least one primer pair selected from Primer Pair Set E that specifically amplifies a portion of Y. enterocolitica genome; or at least one primer pair selected from Primer Pair Set F that specifically amplifies a portion of A. hydrophila genome; and (b) subjecting the reaction mixture to reaction conditions suitable to amplify targeted nucleic acids, thereby generating one or more amplicons; wherein the presence or absence of at least one amplicon in the sample indicates the presence or absence of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, or A. hydrophila in the sample. In another embodiment, the method comprises the steps of: (a) creating a reaction mixture containing the sample and at least six Primer Pair Sets; wherein the primer pair set comprises: at least one primer pair selected from Primer Pair Set A that specifically amplifies a portion of V. cholerae genome; at least one primer pair selected from Primer Pair Set B that specifically amplifies a portion of V. parahaemolyticus genome; at least one primer pair selected from Primer Pair Set C that specifically amplifies a portion of V. vulnificus genome; at least one primer pair selected from Primer Pair Set D that specifically amplifies a portion of P. shigelloides genome; at least one primer pair selected from Primer Pair Set E that specifically amplifies a portion of Y. enterocolitica genome; and at least one primer pair selected from Primer Pair Set F that specifically amplifies a portion of A. hydrophila genome; and (b) subjecting the reaction mixture to reaction conditions suitable to amplify targeted nucleic acids, thereby generating one or more amplicons; wherein the presence or absence of at least one amplicon in the sample indicates the presence or absence of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, and A. hydrophila in the sample. Another embodiment described herein is a method for individually or simultaneously determining the presence or absence of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, and / or A. hydrophila in a sample. In an embodiment, the method comprises the steps of: (a) creating a reaction mixture containing the sample and at least six primer pair sets; wherein the primer pair set comprises: at least one primer pair selected from SEQ ID NO: 1–2, 4–5, 7–8, 10–11, 13–14, 16–17, 19–20, 22–23, 25–26, 28–29, 31–32, 34–35, or 37–38 that specifically amplifies a portion of V. cholerae genome; at least one primer pair selected from SEQ ID NO: 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, 73–74, or 76–77 that specifically amplifies a portion of V. parahaemolyticus genome; at least one primer pair selected from SEQ ID NO: 79–80, 82–83, 85–86, 88–89, 91– 92, 94–95, 97–98, 100–101, 103–104, 106–107, 109–110, 112–113, or 115–116 that specifically amplifies a portion of V. vulnificus genome; at least one primer pair selected from SEQ ID NO: 118–119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, 139–140, 142–143, 145– 146, 148–149, 151–152, or 154–155 that specifically amplifies a portion of P. shigelloides genome; at least one primer pair selected from SEQ ID NO: 157–158, 160–161, 163–164, 166– 167, 169–170, 172–173, 175–176, 178–179, 181–182, 184–185, 187–188, 190–191, or 193–194 that specifically amplifies a portion of Y. enterocolitica genome; or at least one primer pair selected from SEQ ID NO: 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217– 218, 220–221, 223–224, 226–227, 229–230, or 232–233 that specifically amplifies a portion of A. hydrophila genome; and (b) subjecting the reaction mixture to reaction conditions suitable to amplify targeted nucleic acids, thereby generating one or more amplicons; wherein the presence or absence of at least one amplicon in the sample indicates the presence or absence of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, or A. hydrophila in the sample. According to another embodiment, the method comprises the steps of: (a) creating a reaction mixture containing the sample and at least six primer pair sets; wherein the primer pair set comprises: at least one primer pair selected from SEQ ID NO: 1–2, 4–5, 7–8, 10–11, 13–14, 16–17, 19–20, 22–23, 25–26, 28–29, 31–32, 34–35, or 37–38 that specifically amplifies a portion of V. cholerae genome; at least one primer pair selected from SEQ ID NO: 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, 73–74, or 76–77 that specifically amplifies a portion of V. parahaemolyticus genome; at least one primer pair selected from SEQ ID NO: 79–80, 82–83, 85–86, 88–89, 91–92, 94–95, 97–98, 100–101, 103–104, 106–107, 109– 110, 112–113, or 115–116 that specifically amplifies a portion of V. vulnificus genome; at least one primer pair selected from SEQ ID NO: 118–119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, 139–140, 142–143, 145–146, 148–149, 151–152, or 154–155 that specifically amplifies a portion of P. shigelloides genome; at least one primer pair selected from SEQ ID NO: 157–158, 160–161, 163–164, 166–167, 169–170, 172–173, 175–176, 178–179, 181–182, 184–185, 187–188, 190–191, or 193–194 that specifically amplifies a portion of Y. enterocolitica genome; and at least one primer pair selected from SEQ ID NO: 196–197, 199– 200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, 223–224, 226–227, 229–230, or 232–233 that specifically amplifies a portion of A. hydrophila genome; and (b) subjecting the reaction mixture to reaction conditions suitable to amplify targeted nucleic acids, thereby generating one or more amplicons; wherein the presence or absence of at least one amplicon in the sample indicates the presence or absence of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, and A. hydrophila in the sample. In one embodiment, the method and / or assay comprises a panel comprising one or more primer pairs and one or more probes for the simultaneous detection of the presence or absence of one or more of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, and A. hydrophila in a sample. In one aspect, the method has one or more primer pairs and one or more probes for the detection of a control sample of Bacillus atrophaeus (BA). One embodiment described herein is a multiplex panel for the simultaneous detection of the presence or absence of one or more of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, and A. hydrophila in a sample. In one aspect, the multiplex panel comprises at least one forward primer, at least one reverse primer, and at least one probe for each organism. All primer pairs (forward primers and reverse primers), and the requisite probes are consecutively numbered in multiples of three, e.g., 1, 2, 3; ... ; 271, 272, 273, as forward primer; reverse primer; and probe, respectively. As an exemplary aspect, for detecting V. cholerae, a primer pair and probe set could include: a forward primer such as SEQ ID NO: 1, a reverse primer such as SEQ ID NO: 2, and a probe such as SEQ ID NO: 3. Optionally, the multiplex panel comprises a control, comprising at least one forward primer, at least one reverse primer, and a probe for the control organism BA (SEQ ID NO: 253–273). In another embodiment, the method and / or assay comprises one or more primer pairs and one or more probes for the simultaneous detection of the presence or absence of one or more of V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, and A. hydrophila in a sample. Specifically, an embodiment of the method and / or assay comprises one or more of the following primer pairs and probes: SEQ ID NO: 1-3, SEQ ID NO: 40-42, SEQ ID NO: 79-81, SEQ ID NO: 118-120, SEQ ID NO: 157-159 and SEQ ID NO: 196-198. In another embodiment, the method and / or assay comprises the following primer pairs and probes: SEQ ID NO: 1-3, 40-42, 79-81, 118-120, 157-159, and 196-198. In another embodiment, the primer pairs and probes are SEQ ID NO: 4-6, 43-45, 82-84, 121-123, 160-162, and 199-201. In another embodiment, the primer pairs and probes are SEQ ID NO: 7-9, 46-48, 85-87, 124-126, 163-165, and 202-204. In another embodiment, the primer pairs and probes are SEQ ID NO:10-12, 49-51, 88-90, 127-129, 166-168, and 205-207. In another embodiment, the primer pairs and probes are SEQ ID NO: 13-15, 52-54, 91-93, 130-132, 169-171, 208-210. In another embodiment, the primer pairs and probes are SEQ ID NO: 16-18, 55-57, 94-96, 133-135, 172-174, and 211-213. In another embodiment, the primer pairs and probes are SEQ ID NO: 19-21, 58-60, 97-99, 136-138, 175-177, and 214-216. In another embodiment, the primer pairs and probes are SEQ ID NO: 22- 24, 61-63, 100-102, 139-141, 178-180, and 217-219. In another embodiment, the primer pairs and probes are SEQ ID NO: 25-27, 64-66, 103-105, 142-144, 181-183, and 220-222. In another embodiment, the primer pairs and probes are SEQ ID NO: 28-30, 67-69, 106-108, 145-147, 184- 186, and 223-225. In another embodiment, the primer pairs and probes are SEQ ID NO: 31-33, 70-72, 109-111, 148-150, 187-189, and 226-228. In another embodiment, the primer pairs and probes are SEQ ID NO: 34-36, 73-75, 112-114, 151-153, 190-192, and 229-231. In another embodiment, the primer pairs and probes are SEQ ID NO: 37-39, 76-78, 115-117, 154-156, 193- 195, and 232-234. Table 1a. Gastrointestinal Bacterial Multiplex Primers and Probes (5′→3′) Vibrio cholerae Primer SEQ Pair SetForward PrimerSEQ ID ANO Reverse PrimerID NO1GTCAATGGTACCACGCACCACAGTAG CCTTCGTTTGCCAGC ATGCGAATGT 1 GTTCCT2TTG3ACCCTTCGTTTGCGCTGCCGTCAAGA CAATACAGCTCAGGA Table 1b. Gastrointestinal Bacterial Multiplex Primers and Probes (5′→3′) 4GACTGGCAGCAAGCCAGTGCAAAGTGC ACCCAGTTGCTCTT CTGTTATTG 49 CAAACT50TACTC515TGGGTGACACTTGTGTAACTCACATCC CCAAACTGGTGCAG GAACGATTATTT 52 AGTGCAAAGT53TTAA546GTTTGGCACTTTGCACTGGAT 55GGAATCATGCTGCC ATCGTCCATGTAAC GATATACGT56 57CGCATGCATCTA 7ACTTTGCACTGGACA TGTGAGTTACA 58 CTTGGAATCA59AGCATC608GAGTTACATGGACGATGCTACGTAT 61GACCGCATGCATCT ATCGGCAGCATGAT ACACTTG62TC639GCAGCATGATTCCCCTTTTACCGCTCG ATGCGGTCGCTACT AAGTGTAGATG 64 AACAACAG65TCTTTTTTA6610CATGCGGTCGCTACAATACTGTGCTGC CCGCTCGAACAACA CTTCTTTT 67 TTTGCCTTTTA68GT6911CTGTTGTTCGAGCTCTTCAGTCCAGCC CAAAGCAGCACAGT GGTAAAAGG 70 ACTTTGTG71ATTG7212GAGCGGTAAAAGGCGCTAGAGTCTGGC C CAAAGCA 73TTTGTGCCCAATA TATCTTCAGT74CTG7513GGCAAAGCAGCACAGCGCTAGAGTCTG CAGTCCAGCCACTT AGTATTGG 76 GCTATCTT77TGT78Table 1c. Gastrointestinal Bacterial Multiplex Primers and Probes (5′→3′) Vibrio vulnificus Primer SEQSEQ ID SEQ Pair SetForward PrimerID NOReverse PrimerNOID NO C AGCAGTTGATTAC CTGCTT 1TGGTTGAAAGCTTCGCACTTCT TGCACTCAT 79GCCCAGTAG80TCC GTTTTGGCTGATC CATCTCACTATCTG 84 87 90 939699 Table 1d. Gastrointestinal Bacterial Multiplex Primers and Probes (5′→3′) Plesiomonas shigelloides Primer SEQ IDSEQ ID SEQ ID 5CGTTTTGTTCACACCACCTTGGATTAT TCCAACCAACGG TAGGCAGTTACG 130 CGCCTGAAT131CTATC1326133CCGTGATTTCAATA CCACCTTGGAT1347136AACCCGTGATTTCA ATACCACCTT137GCAGCAGAAAACC 8GGATTCAG 139C GTGATTT140ATCG1419GGCGATAATCCAACAGATGGTCA GGTGGTATTGAA 142GCAC ACGGGTTTTCTG CTCAGT143CTGCACC14410AGGTGGTATTGAAATCACAGATGGTCA CTGCACCAGCGG ATCACGGGTTTT 145 GCACCTC146CACT14711GGCGGTTCTTCCCCTGCTGAGCCTGAC CTCGCCTTGGGT TTCCC 148 CTATGG149TTTA15012CGGTCTGGGATTGGCGAGGGAGCCCAT CTGGCCGATGAT TTGAGCTAT 151 CTG152CAGCA15313GGTCTGGGATTGTTGAGCTATCTG 154GAGCCCATCTGCCA TCGCGCAGTTGC AAGC155TGATCA156Table 1e. Gastrointestinal Bacterial Multiplex Primers and Probes (5′→3′) Yersinia enterocolitica Primer ward PrimerSEReverse PriSEQ ID SEQ PairForQ IDNO merNOID NO Set E 1 GTGAGCGTAATGGT AAGGTTGTTG158CATTTTTACATCGGT ACTCCGTTCCAATA TTGTCTCGTCTAAT 2 TTGGTTCTTTGCT 160TGGCACAT161TTCA162T 3CGGTTTGGTTCTTACTCCGTTCCAATA ACGAGACAATGCCA TGCTTAGTGAAA 163 TGGCACAT164CACCC1654CCACACCCAAGCC166ACTCCGTTCCAATA CACAATCCATTCAA TGGCACAT167AATC5GCCATATTGGAACAGCTAAAGGCAAGC CAGTATTAACGCAA GGAGTGATTTTC 169 AAAAGCAAT170CTGCG171 6TGAGGAATT 172 GCGAGCTA173CA174GCAGAGCC 7GAATT 175GAGAGG TGAG AATAAAGC176CTCGCA1778CGCAACTGCGTATCGCAGAGCCGAGAG AAGCCCCTTGCGAG TGAGGAATTATT 178 GAAT179CTA1809CGCAACTGCGTATGGGCGGTTGCCTAA CCGAGAGGAATAAA TGAGGAATTATT 181 ATGG182GC18310CGCAACTGCGTAT18CTCCATAAATTTCT TCGGCTCTGCGCCA TGAGGAATTATT 4 GCAACCGTTCT185TT18611GGCTCTGCGCCATGCCGAATTCTCGCG CAACCGCCCAGAAG TTAGG 187 CAAAT188AA18912CGGTTGCAGAAATTGGTTAATCCCATG AAGGGTGGAAACTA TTATGGAGGAAA 190 CCGAATTCTC191AGCAAAT19213CGGTTGCAGAAATCGTGGTGAAATGCC TTCTCGCGCAAATT TTATGGAGGAAA 193 ATAAACTGTAC194T195Table 1f. Gastrointestinal Bacterial Multiplex Primers and Probes (5′→3′) Aeromonas hydrophila Primer SEPair Set FForward PrimerIDPrimerQ ID NO 1GGCACCGACCCCAGCCCTTGGCCTGGTA ATCGGCGTGGTGC AGAC 196 CAT197ATC1982GCGATGTTTTGCAAGGGCAGTTGCACCA CCAAGGCGGTGGA CTATC200CAA3TGCCCTGGCAACAGGTCGCAAGGTGACA CCAGTTTGCCGGT TCCA203TATT4GCCAGAGGCTTCTCATCACCTCGTTGAC CCGGGCTGGATGT CACATTG206CAC5GTCACCGGCACCACCGCTGACCCCGTAC ATTGCCCGACATC TG209ACC6GGTGATGTCGGGCACGACCTGCTGGCCA CTGCTGCTGGCGC TT212GTGC7GTGCTGGCCTCCACGCCGGTTGACGAAT CATTCCCCGCTGG 215 TGCT8GCGGCCCGACATT217CCGGGCTCCAGCATC CAACCGGCGGATC CG AG218TG2199GGCAAACGGCTGACCTGTTCATAAGGCA CTGCAGATCTACC GCTTGCT221TCAATCG10CGAGCAGCGCCTTCA G224GGCA11CCATCCGGGCCAGAT AGAAG227CTAC12GTTGTCACCGTAGAA ATCGAAGTC230TCTC13CGCAGCTGGGTACGA ATGA233AG Table 1g. Gastrointestinal Multiplex Primers and Probes (5′→3′) Bacillus atrophaeus (Control) Primer Pair SetForward Primer SEQID NOReverse PrimerID NOProbeID NO G 1AGGAAATCAGGGAGTCCGTGAATCGCGT TTCAACCGTCACC GACGTACGAT 235 TGAAAA236TCTCCGTCCTGA2372CCCGTTTGTAGTAAGATGAAGTTCGGCA CAACAAACA GTGGATAACTGT 238CGAA TGCATGAT239GGAAAA2403241ACTGCTGCCGAGATG AAGTTC TCA4CGGTTGAATTGCACACCCAGCAAATGCC CAGGTCACTGACA GGATACGTTTT 244 GTT245ACAAA2465247GGATTCTGCCGAACG TGTCA ATCTCG 6GGAATCCGTCGAGGGATTCTGCCGAACG CTGCTGCCGAGAT TATTATCAAAGCA 250 TGTCA251GAAGT2527TCGGCAGCAGTCTTCCTCACTCTCAAGC CACGTTCGGCAGA GATTCATTTT 253 TGAAGTATGA254ATC255TCCGTCGAGTATT ACGTTTTCAGCTTTTCATCTCGGCAGCA TCCGTCGAGTATT ACGTTCGGCAGCAGTCT 11 ATCAAAGCATCTTTTTCAGCTTTT CGATTC12ACTGCTGCCGAGATG AAGTTC G13CCCGTTTGTAGTAACTGCTGCCGAGATG TTTTAATATCCCC AAGTTC GCCGAAGAT Sample or Specimen Described herein are compositions, kits, and method for the detection (i.e., the presence or absence) of diarrhea-causing pathogens including V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, and A. hydrophila in a specimen or a sample. DNA is extracted from one or more specimen / sample, multiplied using real-time amplification, and detected using specific primers and a fluorescent reporter dye probe for V. cholerae, V. parahaemolyticus, V. vulnificus, P. shigelloides, Y. enterocolitica, and A. hydrophila. As will be appreciated by those in the art, the specimen / sample may comprise any number of things, including, but not limited to, include stool samples, rectal swabs, or tissue samples (for example, taken during a biopsy) obtained from human patients; research samples; purified samples, such as purified genomic DNA, RNA, proteins, etc.; and raw samples (bacteria, virus, genomic DNA, etc.). As will be appreciated by those in the art, any experimental manipulation can have been performed on the sample before analysis. In some embodiments, the specimen / sample type for diagnosis of diarrhea-causing pathogens is a stool sample or a rectal swab. If required, nucleic acid from the sample / specimen is isolated using known techniques. For example, the sample / specimen may be treated to lyse the cells, using known lysis buffers, sonication, electroporation, etc., with purification occurring as needed, as will be appreciated by those in the art. In addition, the reactions outlined herein may be accomplished in a variety of ways, as will be appreciated by those in the art. Components of the reaction may be added simultaneously, or sequentially, in any order, with preferred embodiments outlined below. In addition, the reaction may include a variety of other reagents that may be included in the assays. These include reagents like salts, buffers, neutral proteins, e.g., albumin, detergents, etc., which may be used to facilitate optimal hybridization and detection, and / or reduce non-specific or background interactions. Reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc., may be used, depending on the sample / specimen preparation methods and purity of the target diarrhea-causing pathogens. In some embodiments, total nucleic acid extraction from a stool sample or a rectal swab is performed. The specimen / sample may be collected and transported in the Remel™ Cary-Blair Transport Medium by Thermo Fisher Scientific according to appropriate laboratory procedures. Remel™ Cary-Blair Transport Medium is a semisolid medium recommended for use in the collection, transportation, and preservation of sample / specimens, especially stool samples and rectal swabs. Nucleic acids may be isolated and purified from the specimen / sample using a nucleic acid isolation, such as, e.g., the MagMAX™ Microbiome Ultra Nucleic Acid Isolation Kit with Bead Plate by Applied Biosystems™. Nucleic acid extraction may be performed via an automated process using, e.g., the Kingfisher™ Flex Purification System. For RNA viruses, the RNA is reverse transcribed into cDNA. The cDNA and genomic DNA (from DNA viruses) are then subjected for amplification using the currently disclosed composition, method, or kit. Process Control, Control Organism, or Control Sample In addition, the disclosed kit and method of detection may further include a process control (“process control” is herein referred to, interchangeably, as “control organism” or “control sample”). This is an exogenous control that has the added advantage of being a bacterial lysis control in addition to being a nucleic acid extraction and recovery control. Controls are treated and tested in parallel with target pathogen and are used to generate a predetermined expected result. When the expected result is reported, one or more aspects of the diagnostic test are confirmed to be working as intended, enabling the user of to verify the diagnostic test as valid. The process control may be Bacillus atrophaeus, which is a gram- positive, endospore forming bacterium. Preferably, the process control can function as a positive control for lysis, purification and amplification within the cartridges described herein. One exemplified process control is lyophilized Bacillus atrophaeus, such as, e.g., the TaqMan™ Universal Extraction Control Organism by Thermo Fisher Scientific. The process control may be supplied lyophilized in a quantity of 1 × 109copies / vial, and reconstituted in 200 µL of 1× PBS, pH 7.4 to a final concentration 5 × 106copies / µL. During nucleic acid isolation, 10 µL of the process control is processed as a stand-alone sample in a background of universal transport media. The process control can be added to a negative extraction control. The process control may be added to one or more samples / specimens at the start of the extraction process. The process control is carried through the remainder of the workflow with the samples / specimens. It is recommended that at least one stand-alone control sample is run per extraction plate. Another exemplified process control is a bacterial spore, such as a spore of a Bacillus species. Suitable spores can be comprised of any species of Bacillus, including, e.g., Bacillus globigii, Bacillus atrophaeus, Bacillus subtilis, or Bacillus stearothermophilus. In one embodiment, the process control may be a Bacillus atrophaeus bacterial spore. In one embodiment, vicinal oxygen chelate (VOC) genes (accession number cll463) of Bacillus atrophaeus are detected as a process control. Positive Control In addition, the disclosed method of detection may further include a positive control to determine the validity of the assay. The positive control is a mixture of plasmids of the target pathogens. For instance, an exemplified positive control is a mixture of plasmids of V. parahaemolyticus, P. shigelloides, Y. enterocolitica, and A. hydrophila. Yet another exemplified positive control is a mixture of plasmids of any one of: V. parahaemolyticus, P. shigelloides, Y. enterocolitica, or A. hydrophila. Reaction Mixture The terms “reaction mixture,” “amplification mixture,” or “PCR mixture” as used herein refer to a mixture of components necessary to amplify at least one amplicon from nucleic acid templates. The mixture may comprise nucleotides (dNTPs, such as A, C, G, and T), a thermostable polymerase, primers, and a plurality of nucleic acid templates. The mixture may further comprise a buffer. As used herein, “buffer” refers a solution that can include multiple components such buffers that maintain a specific pH (e.g., Tris·HCl), mono and divalent salts (e.g., NaCl, KCl, (NH4)2SO4, MgCl2, MgSO4), cofactors, detergents (e.g., Polysorbate 20 (Tween™ 20), t-octylphenoxy polyethoxyethanol (Triton™ X-100), octylphenoxy polyethoxyethanol (Nonidet™ P-40)), and other additives (e.g., glycerol, polyethylene glycol, betaine, formamide, dimethyl sulfoxide, dithiothreitol, tetramethylammonium chloride, bovine serum albumin, gelatin, inter alia), The working concentration range of each component is known in the art and can be optimized as needed. An exemplary PCR reaction mixture comprises: 0.1– 50 ng of target DNA; 0.1–1 μM of each primer and probe; 1–2 units of Taq DNA polymerase; 0.2 mM of each dNTP; 20 mM Tris·HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2, and water to the requisite volume. Typically, the PCR mixture is dispensed into a PCR microtube or plate, the mixture is mixed by vortexing, and either capped, sealed, or overlayed with mineral oil or silicone oil to prevent evaporation. Amplification “Amplification” as used herein refers to the use of any amplification procedures to increase the concentration of a particular nucleic acid sequence within a mixture of nucleic acid sequences. In one embodiment and as describe more fully herein, a sequence from a sample is amplified to produce a secondary target (e.g., an amplicon) that is detected, as outlined herein. Amplification involves the amplification (replication) of the sequence to be detected, such that the number of copies of the sequence is increased. Suitable amplification techniques include, but are not limited to, the polymerase chain reaction (PCR), strand displacement amplification (SDA), transcription mediated amplification (TMA) and nucleic acid sequence-based amplification (NASBA). In one embodiment, the amplification technique is PCR. The polymerase chain reaction (PCR) is well known and involves the use of primer extension combined with thermal cycling to amplify a target sequence. As used herein, “PCR”, unless specifically defined, refers to either single-plex or multiplex PCR assays, and can be real time or quantitative PCR (wherein detection occurs during amplification), end-point PCR (when detection occurs at the end amplification), or reverse transcription PCR, including but not limited to, “real-time PCR” or “quantitative PCR” or “qPCR”, “digital PCR” or “dPCR”, “reverse transcriptase PCR” or “RT-PCR”, “multiplex PCR”, “nested PCR”, “hot start PCR”, “long-range PCR”, “assembly PCR”, “asymmetric PCR”, “in situ PCR,” “single-cell PCR,” or “fast-cycling PCR,” among others. An exemplary PCR amplification typically consists of 25–35 cycles of: a denaturing step a 94 °C for 30–45 seconds; an annealing step at 55 °C for 20–60 seconds; and an extension step at 72 °C for 30–90 seconds. The amplification may be preceded by an initial denaturation step at 94 °C for 2–3 minutes. The amplification may be followed by a final extension step at 72 °C for 10 min, and then cooled to 4 °C and maintained at this temperature until the samples are removed from the thermocycler. Example embodiments of amplification are not limited to PCR. For instance, signal amplification, single base extension (SBE) or minisequencing, oligonucleotide ligation amplification (OLA) and / or rolling-circle amplification can be used for amplification. In an embodiment, amplification can include OLA followed by RCA. A skilled person would be knowledgeable of the real-time PCR systems that can be used for a multiplex detection using several dyes, or nucleic acid amplification assays as described herein. Exemplary systems include a real-time quantitative PCR (qPCR) instrument, including for example a QuantStudio™ Real-Time PCR system, such as the QuantStudio™5 Real-Time PCR System (QS5), QuantStudio™ 7 Real-Time PCR System (QS7), QuantStudio™ 12K Flex System (QS12K), QuantStudio™ DX Real-Time PCR System (QS Dx or QS5 Dx), or a 7500 Real-Time PCR system, such as the 7500 Fast Dx system, all from Applied Biosystems™ – a Thermo Fisher Scientific brand. Amplicon The terms “amplified product” or “amplicon” refer to a fragment of DNA amplified by a polymerase using a pair of primers in an amplification method such as PCR. Probe “Probe” as used herein, is a non-extendable oligonucleotide attached to a fluorescent reporter dye and a quencher moiety. Primer “Primer” as used herein can refer to more than one primer and refers to an oligonucleotide, whether occurring naturally or produced synthetically, which is capable of acting as an initiation- point for primer extension synthesis when placed under conditions that produce a primer extension product which is complementary to a nucleic acid strand, e.g., in the presence of nucleotides and an agent for polymerization such as DNA polymerase, at a suitable temperature for a sufficient amount of time and in the presence of a buffering agent. Such conditions can include, for example, the presence of at least four different deoxyribonucleoside triphosphates (such as A, C, G, and T) and a polymerization-inducing agent such as DNA polymerase or reverse transcriptase, in a suitable buffer, and at a suitable temperature. In some embodiments, the primer may be single-stranded for maximum efficiency in amplification. The primers herein are selected to be substantially complementary to the different strands of each specific sequence to be amplified. This means that the primers must be sufficiently complementary to hybridize with their respective strands. A non-complementary nucleotide fragment may be attached to the 5′-end of the primer, with the remainder of the primer sequence being complementary, or partially complementary, to the target region of the target nucleic acid. Commonly, the primers are complementary, except when non-complementary nucleotides may be present at a predetermined sequence location, such as a primer terminus as described. The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5′-end of one sequence is paired with the 3′-end of the other, is in “antiparallel association.” Complementarity need not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases. Dyes, Detectable Labels, or Fluorescent Labels The primers and / or probes described herein may further comprise a dye, fluorescent label, or other detectable label. It should be appreciated that when using multiple fluorescent or detectable labels, particularly in a multiplex format, each fluorescent or detectable label preferably differs in its spectral properties from the other detectable labels used therewith such that the labels may be distinguished from each other, or such that together the fluorescent or detectable labels emit a signal that is not emitted by either fluorescent or detectable label alone. Exemplary fluorescent or detectable labels include, for instance, a fluorescent dye or fluorophore (e.g., a chemical group that can be excited by light to emit fluorescence or phosphorescence), “acceptor dyes” capable of quenching a fluorescent signal from a fluorescent donor dye, and the like, as described above. Suitable fluorescent or detectable labels may include, for example, fluoresceins (e.g., 5-carboxy-2,7-dichlorofluorescein; 5-carboxyfluorescein (5-FAM); 5-hydroxy tryptamine (5- HAT); 6-JOE; 6-carboxyfluorescein (6-FAM); Mustang Purple, VIC, ABY, JUN; FITC; 6-carboxy- 4′,5′-dichloro-2′,7′­dimethoxy-fluorescein (JOE)); 6-carboxy-1,4-dichloro-2′,7′-dichloro-fluorescein (TET); 6-carboxy-1,4-dichloro-2′,4′,5′,7′-tetra-chlorofluorescein (HEX); Alexa Fluor fluorophores (e.g., 350, 405, 430, 488, 500, 514, 532, 546, 555, 568, 594, 610, 633, 635, 647, 660, 680, 700, 750); BODIPY fluorophores (e.g., 492 / 515, 493 / 503, 500 / 510, 505 / 515, 530 / 550, 542 / 563, 558 / 568, 564 / 570, 576 / 589, 581 / 591, 630 / 650-X, 650 / 665-X, 665 / 676, FL, FL ATP, FI-Ceramide, R6G SE, TMR, TMR-X conjugate, TMR-X, SE, TR, TR ATP, TR-X SE), Cascade Blue, Cascade Yellow; Cy™ dyes (e.g., 3, 3.18, 3.5, 5, 5.18, 5.5, 7), cyan GFP, cyclic AMP Fluorosensor (FiCRhR), fluorescent proteins (e.g., green fluorescent protein (e.g., GFP, EGFP), blue fluorescent protein (e.g., BFP, EBFP, EBFP2, Azurite, mKalamal), cyan fluorescent protein (e.g., ECFP, Cerulean, CyPet), yellow fluorescent protein (e.g., YFP, Citrine, Venus, YPet), FRET donor / acceptor pairs (e.g., fluorescein / fluorescein, fluorescein / tetramethylrhodamine, IAEDANS / fluorescein, EDANS / dabcyl, BODIPY FL / BODIPY FL, Fluorescein / QSY7 and QSY9), LysoTracker and LysoSensor (e.g., LysoTracker Blue DND-22, LysoTracker Blue-White DPX, LysoTracker Yellow HCK-123, LysoTracker Green DND-26, LysoTracker Red DND-99, LysoSensor Blue DND-167, LysoSensor Green DND-189, LysoSensor Green DND-153, LysoSensor Yellow / Blue DND-160, LysoSensor Yellow / Blue 10,000 MW dextran), Oregon Green (e.g., 488, 488-X, 500, 514); rhodamines (e.g., 110, 123, B, B 200, BB, BG, B extra, 5- carboxytetramethylrhodamine (5-TAMRA), 5 GLD, 6-Carboxyrhodamine 6G, Lissamine, Lissamine Rhodamine B, Phallicidin, Phalloidine, Red, Rhod-2, ROX (6-carboxy-X-rhodamine), 5-ROX (carboxy-X-rhodamine), Sulphorhodamine B can C, Sulphorhodamine G Extra, TAMRA (6-carboxytetramethyl-rhodamine), Tetramethylrhodamine (TRITC), Texas Red, Texas Red-X, among others as would be known to those of skill in the art. Exemplary fluorescent labels include but are not limited to FAM, VIC, ABY, JUN, AF647, or 6FAM. In one exemplary multiplex dye scheme, the fluorescent labels include FAM, VIC, ABY, JUN, or AF647; or 6FAM, VIC, ABY, JUN, or FAM. In another exemplary multiplex dye scheme, the fluorescent labels include FAM, HEX (JOE / VIC), Texas Red, and Cy5 dyes. Exemplary dye schemes are shown in Table 2. Table 2. Exemplary Dyes for Multiplex Primers and Probes Target Pathogen Dye Scheme Vibrio cholerae FAM Vibrio parahaemolyticus FAM Vibrio vulnificus FAM Plesiomonas shigelloides VIC Yersinia enterocolitica ABY Aeromonas hydrophila JUN Bacillus atrophaeus AF647 Referring to Table 2, the probes specific for amplicons generated using one or more primer pair A (target – V. cholerae) are labeled with FAM; the probes specific for amplicons generated using one or more primer pair B (target – V. parahaemolyticus) are labeled with FAM; the probes specific for amplicons generated using one or more primer pair C (target – V. vulnificus) are labeled with FAM; the probes specific for amplicons generated using one or more primer pair D (target – P. shigelloides) are labeled with VIC; the probes specific for amplicons generated using one or more primer pair E (target – Y. enterocolitica) are labeled with ABY; the probes specific for amplicons generated using one or more primer pair F (target – A. hydrophila) are labeled with JUN; and the probes specific for amplicons generated using one or more primer pair H (target – Bacillus atrophaeus) are labeled with AF647. Other detectable labels may be used in addition to or as an alternative to labelled probes. For example, primers can be labeled and used to both generate amplicons and to detect the presence (or concentration) of amplicons generated in the reaction, and such may be used in addition to or as an alternative to labeled probes described herein. As a further example, primers may be labeled and utilized as described in Nazarenko et al., Nucleic Acids Res. 30(9): e37 (2002), Hayashi et al., Nucleic Acids Res.17(9): 3605 (1989), and / or Neilan et al., Nucleic Acids Res.25(14): 2938-2939 (1997). Those of skill in the art are capable of utilizing the PCR processes (and associated probe and primer design techniques) described in Zhu et al., Biotechniques (4): 317-325 (2020). In some embodiments, the primers and / or probes may further comprise a quencher. Suitable quenchers include but are not limited to QSY (e.g., QSY7 and QSY21), BHQ (Black Hole Quencher) and DFQ (Dark Fluorescent Quencher). In an exemplary embodiment, the quencher is QSY7. Detector probes may also include two probes, wherein, for example, a fluorophore is associated with one probe and a quencher is associated with a complementary probe such that hybridization of the two probes on a target quenches the fluorescent signal or hybridization on the target alters the signal signature via a change in fluorescence. Detector probes may also include sulfonate derivatives of fluorescein dyes with SO3 instead of the carboxylate group, phosphoramidite forms of fluorescein, phosphoramidite forms of Cy5. Any of these systems and detectable labels, as well as many others, may be used to detect amplified target nucleic acids. In some embodiments, intercalating labels can be used such as ethidium bromide, SYBR Green I, SYBR GreenER, and PicoGreen (all products of Applied Biosystems – a brand of Thermo Fisher Scientific), thereby allowing visualization in real- time, or end point, of an amplification product in the absence of a detector probe. In some embodiments, real-time visualization may include both an intercalating detector probe and a sequence-based detector probe. In some embodiments, the detector probe is at least partially quenched when not hybridized to a complementary sequence in the amplification reaction and is at least partially unquenched when hybridized to a complementary sequence in the amplification reaction. In some embodiments, probes may further comprise various modifications such as a minor groove binder (MGB) to further provide desirable thermodynamic characteristics. In some embodiments, the amplicon is labeled by incorporation of, or hybridization to labeled primer. In some embodiments, the amplicon is labeled by hybridization to a labeled probe. In some embodiments, the amplicon is labeled by binding of a DNA-binding dye. In some embodiments, the dye may be a single-strand DNA binding dye. In other embodiments, the dye may be a double-stranded DNA binding dye. In other embodiments, the amplicon is labeled via polymerization or incorporation of labeled nucleotides in a template-dependent (or template- independent) polymerization reaction. This can be part of the amplifying step or alternatively the labeled nucleotide can be added after amplifying is completed. The labeled amplicon (or labeled derivative thereof) can be detected using any suitable method such as, for example, electrophoresis, hybridization-based detection (e.g., microarray, molecular beacons, and the like), chromatography, NMR, and the like. In one exemplary embodiment, the labeled amplicon is detected using qPCR. In some embodiments, a plurality of different amplicons is formed, and optionally labeled, within a single reaction volume via a single amplification reaction. For example, a multiplex reaction (e.g., 4- plex) carried out in a single tube or reaction vessel (e.g., “single-tube” or” I-tube” or “single-vessel” reaction) can produce a plurality of amplicons that are labeled. In some embodiments, the plurality of amplicons can be differentially labeled. In some embodiments, each of the plurality of amplicons produced during amplification is labeled with a different label. Assay Mixture The terms “assay mixture” or “assay mix” or “assay composition,” as used herein, include mixture containing the primer-probe pairs described above that are used in PCR. Another aspect provided herein is a method of detecting or quantifying a target nucleic acid molecule in a sample by polymerase chain reaction (PCR), such as by quantitative real-time polymerase chain reaction (qPCR). In one embodiment, the method includes: (i) contacting a sample comprising one or more target nucleic acid molecules with (a) at least one probe, such as those described herein, being sequence specific for the target nucleic acid molecule, where the at least one probe undergoes a detectable change in fluorescence upon amplification of the one or more target nucleic acid molecules; and with (b) at least one oligonucleotide primer pair; (ii) incubating the mixture of step (i) with a DNA polymerase under conditions sufficient to amplify one or more target nucleic acid molecules; and (iii) detecting the presence or absence or quantifying the amount of the amplified target nucleic acid molecules by measuring fluorescence of the probe. In some embodiments, the DNA polymerase comprises 5′-exonuclease activity. In some other embodiments, the DNA polymerase is a Thermus aquaticus (Taq) DNA polymerase. In some embodiments, the probe is a hydrolysis probe, such as a TaqMan™ probe. Another aspect provided herein is a kit for PCR, such as quantitative real-time polymerase chain reaction (qPCR) and reverse transcription polymerase chain reaction (RT-PCR). In an exemplary embodiment, the kit includes the assay mixture, the process control, and the positive control each described above, as well as a multiplex master mix. In an embodiment, the multiplex master mix is a RT-qPCR mix that provides for sensitive, reproducible detection of at least four different target pathogens in a single multiplex reaction. In an embodiment, the multiplex master mix may include an enzyme (for instance, DNA polymerase), a thermostable enzyme, enzyme cofactors, deoxynucleotide triphosphates (dNTPs) including dUTP, an enzyme inhibitor (for instance, RNase inhibitor), a dye and / or a buffer agent. In an exemplary embodiment, the multiplex master mix can be, for instance, TaqPath™ 1-step Multiplex Master Mix by Applied Biosystems – a brand of Thermo Fisher Scientific. In an embodiment, the master mix may be concentrated. For instance, the master mix may be provided at a 4× concentration. In some embodiments, the master mix is prepared such that it requires less than a 3× dilution prior to use in PCR, e.g., 2× dilution, 1.5× dilution, 1.2× dilution, etc. In some embodiments, the kit also includes instructions for conducting the PCR, and one or more of the following: a buffering agent, deoxynucleotide triphosphates (dNTPs), an organic solvent, an enzyme, enzyme cofactors, and an enzyme inhibitor. In another embodiment, the kit for PCR comprises the described dye and / or quencher moiety, instructions for conjugating or labeling the dye and / or quencher moiety to a biomolecule, such as an oligonucleotide, instructions for conducting the PCR, and one or more of the following: a buffering agent, deoxynucleotide triphosphates (dNTPs), an organic solvent, an enzyme, enzyme cofactors, and an enzyme inhibitor. In some embodiments, the systems, compositions, methods, and devices used for nucleic acid amplification comprise a “point-of-service” (POS) system. In some embodiments, samples may be collected and / or analyzed at a “point-of-care” (POC) location. In some embodiments, analysis at a POC location typically does not require specialized equipment and has rapid and easy-to-read visual results. In some embodiments, analysis can be performed in the field, in a home setting, and / or by a lay person not having specialized skills. In certain embodiments, for example, the analysis of a small-volume clinical sample may be completed using a POS system in a short period of time (e.g., within hours or minutes). Optionally, a POS system is utilized at a location that is capable of providing a service (e.g., testing, monitoring, treatment, diagnosis, guidance, sample collection, verification of identity (ID verification), and other services) at or near the site or location of the subject. A service may be a medical service, or it may be a non-medical service. In some situations, a POS system provides a service at a predetermined location, such as a subject’s home, school, or work, or at a grocery store, a drug store, a community center, a clinic, a doctor’s office, a hospital, an outdoor triage tent, a makeshift hospital, a border check point, etc. A POS system can include one or more point of service devices, such as a portable virus / pathogen detector. In some embodiments, a POS system is a point of care system. In some embodiments, the POS system is suitable for use by non-specialized workers or personnel, such as nurses, police officers, civilian volunteers, or the patient. In certain embodiments, a POC system is utilized at a location at which medical-related care (e.g., treatment, testing, monitoring, diagnosis, counseling, etc.) is provided. A POC may be, e.g., at a subject’s home, work, or school, or at a grocery store, a community center, a drug store, a doctor’s office, a clinic, a hospital, an outdoor triage tent, a makeshift hospital, a border check point, etc. A POC system is a system which may aid in, or may be used in, providing such medical-related care, and may be located at or near the site or location of the subject or the subject’s health care provider (e.g., subject’s home, work, or school, or at a grocery store, a community center, a drug store, a doctor’s office, a clinic, a hospital, etc.). In embodiments, a POS system is configured to accept a clinical sample obtained from a subject at the associated POS location. In embodiments, a POS system is further configured to analyze the clinical sample at the POS location. In embodiments, the clinical sample is a small volume clinical sample. In embodiments, the clinical sample is analyzed in a short period of time. In embodiments, the short period of time is determined with respect to the time at which sample analysis began. In embodiments, the short period of time is determined with respect to the time at which the sample was inserted into a device for the analysis of the sample. In embodiments, the short period of time is determined with respect to the time at which the sample was obtained from the subject. In some embodiments, a POS system or a POC system can include the amplification- based methods, compositions and kits disclosed herein, including any of the described assays and / or assay panels. Such assays are contemplated for use with both thermal cycling amplification workflows and protocols, such as in PCR, as well as isothermal amplification workflows and protocols, such as in LAMP. In some embodiments, a POS or a POC system comprises self-collection of a biological sample, such as a stool sample or rectal swab. In some embodiments, the self-collection may comprise the use of a self-collection kit and / or device, such as a swab or a tube (e.g., a stool collection tube or similar sample collection device). In some embodiments, the self-collection kit comprises instructions for use, including collection instructions, sample preparation or storage instructions, and / or shipping instructions. For example, the self-collection kit and / or device may be used by an individual, such as lay person, not having specialized skills or medical expertise. In some embodiments, self-collection may be performed by the patient themselves or by any other individual in proximity to the patient, such as but not limited to a parent, a care giver, a teacher, a friend, or other family member. Notably, in some embodiments, the nucleic acid amplification protocol can be configured for rapid processing (e.g., in less than about 45 minutes) and high throughput, allowing for a minimally invasive method to quickly screen large numbers of individuals in a scalable way. This can be particularly useful to perform asymptomatic testing (e.g., high frequency / widespread testing at schools, workplaces, conventions, sporting events, large social gatherings, etc.) or for epidemiological purposes. The disclosed embodiments can also beneficially provide a lower cost sample collection system and method that enables self-collection (reducing health care professional staffing needs) using a low-cost collection device. This eliminates the requirements for swabs, buffers, virus transmission media (or other specialized transport medium), and the like. The disclosed embodiments also allow for a reduction in Personal Protective Equipment (PPE) requirements and costs. There is also a beneficial reduced dependence on supply-constrained items, and the compatibility of these methods and kit components with existing equipment improves the flexibility and simplicity of their implementation to the masses. Overall, such embodiments allow for a less expensive assay that can be accomplished more quickly from sample collection through result generation. EXAMPLES Example 1 Single Template Performance Analysis Initial tests were performed using single synthetic amplification templates to test the sensitivity and linearity of the assays. Pathogen specific primer pairs and probes (see e.g., SEQ ID NO: 1-234) were amplified with synthetic amplification templates using an Applied Biosystems™ QuantStudio™ 5 Real-Time PCR system and the results were analyzed. Results are shown in Table 3. Table 3. Single-Template Linearity and Sensitivity (synthetic template) 1h Incubation Target Efficiency% R2100 cp / rxn hit rate Vibrio cholerae102 0.998719 2 / 2Vibrio parahaemolyticus103 0.998561 2 / 2Vibrio vulnificus100 0.998629 2 / 2Plesiomonas shigelloides101 0.998698 2 / 2Yersinia enterocolitica103 0.999717 2 / 2Aeromonas hydrophila108 0.99842 2 / 2 The assays had linear ranges from 100 copies to 10E8 copies of target per reaction for synthetic DNA templates. The efficiency for each target is within 100–108%, after 1h incubation at 4°C. Each of two replicates of samples having 100 target copies per reaction were detected. Example 2 Combined Templates Performance Analysis Multiplex panel amplifications were performed using genomic samples of the target organisms. Dilutions of each analyte were prepared over a 5-log10concentration range, e.g., 101, 102, 103, 104and 105copies / reaction (Table 4). B. atrophaeus internal controls were prepared and added to each sample at a concentration of 5 × 103copies / reaction. Table 4. Multiplex Assay Target Concentrations Test Level ID Final Concentration L1 100,000 copies / rxn L2 10,000 copies / rxn L3 1,000 copies / rxn L4 100 copies / rxn L5 10 copies / rxn L6 0 copy / rxn Pathogen specific primer pairs and probes and B. atrophaeus control primers / probes were amplified with the diluted analyte samples using an Applied Biosystems™ QuantStudio™ 5 Real- Time PCR system and the results were analyzed. Results are shown in Table 5. FIGS.1-6 show the amplification plots depicting the detection of Vibrio cholerae (FIG.1), Vibrio parahaemolyticus (FIG.2), Vibrio vulnificus (FIG.3), Plesiomonas shigelloides (FIG.4), Yersinia enterocolitica (FIG. 5), and Aermonas hydrophilia (FIG.6) using a synthetic DNA template. Table 5. Multiplex Assay Linearity and Efficiency Analyte Test Level Copies / rxn Log Conc. Cq Vibrio cholerae L1 1 × 1055 21.3 L2 1 × 1044 24.9 L3 1 × 1033 28.2 L4 1 × 1022 31.4 L5 1 × 1011 34.3 Vibrio parahaemolyticusL1 1 × 1055 22.6 L2 1 × 1044 26.1 L3 1 × 1033 29.4 L4 1 × 1022 32.8 L5 1 × 1011 36.5 Vibrio vulnificus L1 1 × 1055 23.0 L2 1 × 1044 26.3 L3 1 × 1033 29.7 L4 1 × 1022 33.0 L5 1 × 1011 35.7 Plesiomonas shigelloidesL1 1 × 1055 26.0 L4 1 × 1022 27.7 L5 1 × 1011 30.6 Aeromonas hydrophilaL1 1 × 1055 23.5 L2 1 × 1044 26.9 L3 1 × 1033 30.0 L4 1 × 1022 33.4 L5 1 × 1011 35.8 Example 3 Exemplary Test Sample Preparation A sample is obtained from a subject. The sample typically is a stool sample or rectal swab. The sample is processed to isolate genomic DNA. Alternatively frozen samples may be used. Frozen samples are thawed on ice. Control Sample Preparation The TaqMan™ Universal Extraction Control Organism (B. atrophaeus) (BA process control) is used to verify the efficacy of the sample preparation and the absence of inhibitors in the real-time PCR reaction. A 1× solution of the control is added to each sample and negative control before extraction. The BA process control is sample contains a lyophilized pellet at 1 × 109copies / vial. A 25× stock solution of the BA process control is prepared by adding 200 µL of 1× phosphate buffered saline (1× PBS: 137 mM NaCl, 2.7 mM KCl: 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4) to the vial containing the lyophilized pellet and vortexing until the pellet is resuspended. A working 1× stock solution is prepared by combining 24 µL of a 25× stock solution with 576 µL 1× PBS, pH 7.4 to achieve a total volume of 600 µL. The prepared BA process control is added to the genomic DNA extraction reaction, to each sample and to the negative extraction control immediately before lysis during nucleic acid extraction. Real‑time PCR Reaction Preparation Genomic DNA samples are thawed or placed on ice. All reagents are gently vortexed, briefly centrifuged to collect the liquid at the bottom of the container and kept on ice until use. The amplification control is prepared by combining 495.0 µL of 1× TE buffer (1× TE: 10 mM Tris·HCl, 1 mM EDTA·Na2, pH 8.0) into a microcentrifuge tube, and adding 5.0 µL of the amplification control. The sample is mixed well and briefly centrifuged. A 5.0 µL aliquot of the diluted sample is combined with 170 µL of 1× TE buffer, mixed, and centrifuged briefly. For each 96‑well plate, the following components are combined in sufficient amounts for the number of samples plus the amplification control and negative control. Table 6. PCR Multiplex Master Mix and Primer / Probes ComponentVolume per sample orVolume for n samples plus control2 controls Multiplex Master Mix 6.25 µL 6.25 × (1.2 × n) µL Multiplex Primer / Probe Panel 1.25 µL 1.25 × (1.2 × n) µL Total Volume 7.50 µL — The Multiplex Master Mix contains components for the PCR reaction (buffer, MgCl2, dNTPs, and DNA polymerase, inter alia) and the Multiplex Primer / Probe Panel contains the primer pairs and probes specific for the target organisms and controls. The reaction plate is set up by dispensing 7.5 µL of the reaction mix prepared as shown in Table 6 to each well of a MicroAmp™ Optical 96-Well Reaction Plate, 0.2 mL. 17.5 µL of either the extracted materials (target DNA), the diluted amplification control, or nuclease- free water is added to the designated wells. The plate is sealed thoroughly with MicroAmp™ Optical Adhesive Film, ensuring that pressure is applied across the entire plate and that there is a tight seal across every individual well. The plate is vortexed the plate at the highest setting speed for 30–60 seconds as follows: 5–10 seconds in the center of the plate, 5–10 seconds in each plate corner, and 5–10 seconds, again in the center. The reaction plate is centrifuged for 1–2 minutes at ≥ 650 × g to remove bubbles and to collect the liquid at the bottom. The real-time PCR reaction plate is maintained at 2–8 °C and protected from light until it is loaded into the real‑time PCR instrument. The real-time PCR reaction is run within an hour after preparation of the plate. The real‑time PCR reaction is performed, and the results are analyzed using the software accompanying the instrument.

Claims

CLAIMS What is claimed:

1. A method for simultaneously determining the presence or absence of Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Plesiomonas shigelloides, Yersinia enterocolitica, or Aeromonas hydrophila in a sample, the method comprising the steps of: (a) creating a reaction mixture containing the sample and at least six Primer Pair Sets, wherein the Primer Pair Sets comprise: at least one primer pair selected from Primer Pair Set A that specifically amplifies a portion of Vibrio cholerae genome; at least one primer pair selected from Primer Pair Set B that specifically amplifies a portion of Vibrio parahaemolyticus genome; at least one primer pair selected from Primer Pair Set C that specifically amplifies a portion of Vibrio vulnificus genome; at least one primer pair selected from Primer Pair Set D that specifically amplifies a portion of Plesiomonas shigelloides genome; at least one primer pair selected from Primer Pair Set E that specifically amplifies a portion of Yersinia enterocolitica genome; at least one primer pair selected from Primer Pair Set F that specifically amplifies a portion of Aeromonas hydrophila genome; and (b) subjecting the reaction mixture to reaction conditions suitable to amplify targeted nucleic acids, thereby generating at least one amplicon when the targeted nucleic acids are present in the sample; wherein the presence or absence of at least one amplicon in the sample indicates the presence or absence of Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Plesiomonas shigelloides, Yersinia enterocolitica, or Aeromonas hydrophila in the sample.

2. The method of claim 1, wherein the Primer Pair Sets comprise the following sequences: Primer Pair Set A comprises at least one forward and reverse primer pair specific for Vibrio cholerae selected from SEQ ID NO: 1–2, 4–5, 7–8, 10–11, 13–14, 16–17, 19–20, 22–23, 25–26, 28–29, 31–32, 34–35, or 37–38;Primer Pair Set B comprises at least one forward and reverse primer pair specific for Vibrio parahaemolyticus selected from SEQ ID NO: 40–41, 43–44, 46–47, 49–50, 52– 53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, 73–74, or 76–77; Primer Pair Set C comprises at least one forward and reverse primer pair specific for Vibrio vulnificus selected from SEQ ID NO: 79–80, 82–83, 85–86, 88–89, 91–92, 94–95, 97–98, 100–101, 103–104, 106–107, 109–110, 112–113, or 115–116; Primer Pair Set D comprises at least one forward and reverse primer pair specific for Plesiomonas shigelloides in selected from SEQ ID NO: 118–119, 121–122, 124– 125, 127–128, 130–131, 133–134, 136–137, 139–140, 142–143, 145–146, 148– 149, 151–152, or 154–155; Primer Pair Set E comprises at least one forward and reverse primer pair specific for Yersinia enterocolitica selected from SEQ ID NO: 157–158, 160–161, 163–164, 166–167, 169–170, 172–173, 175–176, 178–179, 181–182, 184–185, 187–188, 190–191, or 193–194 and / or Primer Pair Set F comprises at least one forward and reverse primer pair specific for Aeromonas hydrophila selected from SEQ ID NO: 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, 223–224, 226–227, 229–230, or 232–233.

3. The method of claim 1 or 2, wherein the generating of the at least one amplicon comprises performing PCR.

4. The method of any one of claims 1–3, wherein the at least one amplicon is one selected from: an amplicon specific for Vibrio cholerae produced using at least one primer pair selected from SEQ ID NO: 1–2, 4–5, 7–8, 10–11, 13–14, 16–17, 19–20, 22–23, 25–26, 28– 29, 31–32, 34–35, or 37–38, and a sequence selected from SEQ ID NO: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, or 39; an amplicon specific for Vibrio parahaemolyticus produced using at least one primer pair selected from SEQ ID NO: 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, 73–74, or 76–77, and a sequence selected from SEQ ID NO: 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, or 78; an amplicon specific for Vibrio vulnificus produced using at least one primer pair selected from SEQ ID NO: 79–80, 82–83, 85–86, 88–89, 91–92, 94–95, 97–98, 100–101,103–104, 106–107, 109–110, 112–113, or 115–116, and a sequence selected from SEQ ID NO: 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, or 117; an amplicon specific for Plesiomonas shigelloides produced using at least one primer pair selected from SEQ ID NO: 118–119, 121–122, 124–125, 127–128, 130–131, 133– 134, 136–137, 139–140, 142–143, 145–146, 148–149, 151–152, or 154–155, and a sequence selected from SEQ ID NO: 120, 123, 126, 129, 132, 135, 138, 141, 144, 147, 150, 153, or 156; an amplicon specific for Yersinia enterocolitica produced using at least one primer pair selected from SEQ ID NO: 157–158, 160–161, 163–164, 166–167, 169–170, 172– 173, 175–176, 178–179, 181–182, 184–185, 187–188, 190–191, or 193–194, and a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, or 195; and / or an amplicon specific for Aeromonas hydrophila produced using at least one primer pair selected from SEQ ID NO: 196–197, 199–200, 202–203, 205–206, 208–209, 211– 212, 214–215, 217–218, 220–221, 223–224, 226–227, 229–230, or 232–233, and a sequence selected from SEQ ID NO: 198, 201, 204, 207, 210, 213, 216, 219, 222, 225, 228, 231, or 234.

5. The method any one of claims 1–4, wherein the reaction mixture further comprises probes specific for the at least one amplicon.

6. The method of any one of claims 1–5, wherein the reaction mixture further comprises probes specific for the at least one amplicon and suitable for use with a Primer Pair Set, the probes comprising: a probe specific for Vibrio cholerae having a sequence selected from SEQ ID NO: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, or 39; a probe specific for Vibrio parahaemolyticus having a sequence selected from SEQ ID NO: 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, or 78; a probe specific for Vibrio vulnificus selected from SEQ ID NO: 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, or 117; a probe specific for Plesiomonas shigelloides selected from SEQ ID NO: 120, 123, 126, 129, 132, 135, 138, 141, 144, 147, 150, 153, or 156; a probe specific for Yersinia enterocolitica selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, or 195; ora probe specific for Aeromonas hydrophila selected from SEQ ID NO: 198, 201, 204, 207, 210, 213, 216, 219, 222, 225, 228, 231, or 234;.

7. The method of any one of claims 1–6, wherein the reaction mixture further contains a control sample and a Primer Pair Set G; and, optionally, a control probe, that specifically amplifies a target nucleic acid of a control sample.

8. The method of claim 7, wherein the Primer Pair Set G comprises forward and reverse primer pair selected from SEQ ID NO: 235-236, 238-239, 241-242, 244-245, 247-248, 250-251, 253-254, 256-257, 259-260, 262-263, 265-266, 268-269, or 271-272; and the control probe comprises a probe sequence selected from SEQ ID NO: 237, 240, 243, 243, 246, 249, 252, 255, 258, 261, 264, 267, 270, or 273.

9. The method of any one of claims 1–8, wherein the probe comprises a fluorescent reporter.

10. The method of claim 9, wherein the probe comprises a quencher.

11. The method of claim 9 or 10, wherein the probe is labeled at or near the 5′-end with a dye selected from FAM, VIC, ABY, JUN, or AF647.

12. The method of any one of claims 9–11, wherein the probe is labeled at or near the 3′ end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, or DFQ.

13. The method of claim 11 or 12, wherein: the probe specific for amplicons generated using one or more primer pairs from Primer Pair Sets A, B, and C is labeled with FAM; the probe specific for amplicons generated using one or more primer pairs from Primer Pair Set D is labeled with VIC; the probe specific for amplicons generated using one or more primer pairs from Primer Pair Set E is labeled with ABY; and the probe specific for amplicons generated using one or more primer pairs from Primer Pair Set F is labeled with JUN.

14. The method of any one of claims 9–13, wherein the probe specific for amplicons generated from a control sample using one or more primer pairs from Primer Pair Set G is labeled with AF647.

15. A composition for simultaneously determining the presence or absence of Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Plesiomonas shigelloides, Yersinia enterocolitica, and Aeromonas hydrophila in a sample, comprising at least six Primer Pair Sets, wherein the Primer Pair Sets comprise: at least one primer pair selected from Primer Pair Set A that specifically amplifies a portion of Vibrio cholerae genome; at least one primer pair selected from Primer Pair Set B that specifically amplifies a portion of Vibrio parahaemolyticus genome; at least one primer pair selected from Primer Pair Set C that specifically amplifies a portion of Vibrio vulnificus genome; at least one primer pair selected from Primer Pair Set D that specifically amplifies a portion of Plesiomonas shigelloides genome; at least one primer pair selected from Primer Pair Set E that specifically amplifies a portion of Yersinia enterocolitica genome; and at least one primer pair selected from Primer Pair Set F that specifically amplifies a portion of Aeromonas hydrophila genome.

16. The composition of claim 15, wherein the Primer Pair Sets comprises the following sequences: Primer Pair Set A comprises at least one forward and reverse primer pair specific for Vibrio cholerae selected from SEQ ID NO: 1–2, 4–5, 7–8, 10–11, 13–14, 16–17, 19–20, 22–23, 25–26, 28–29, 31–32, 34–35, or 37–38; Primer Pair Set B comprises at least one forward and reverse primer pair specific for Vibrio parahaemolyticus selected from SEQ ID NO: 40–41, 43–44, 46–47, 49–50, 52– 53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, 73–74, or 76–77; Primer Pair Set C comprises at least one forward and reverse primer pair specific for Vibrio vulnificus selected from SEQ ID NO: 79–80, 82–83, 85–86, 88–89, 91–92, 94–95, 97–98, 100–101, 103–104, 106–107, 109–110, 112–113, or 115–116; Primer Pair Set D comprises at least one forward and reverse primer pair specific for Plesiomonas shigelloides in selected from SEQ ID NO: 118–119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, 139–140, 142–143, 145–146, 148– 149, 151–152, or 154–155; Primer Pair Set E comprises at least one forward and reverse primer pair specific for Yersinia enterocolitica selected from SEQ ID NO: 157–158, 160–161, 163–164, 166–167, 169–170, 172–173, 175–176, 178–179, 181–182, 184–185, 187–188, 190–191, or 193–194; and Primer Pair Set F comprises at least one forward and reverse primer pair specific for Aeromonas hydrophila selected from SEQ ID NO: 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, 223–224, 226–227, 229–230, or 232–233.

17. The composition of claim 15 or 16, further comprising a probe specific for amplicons produced using the at least one primer pair selected from Primer Pair Set A, Primer Pair Set B, Primer Pair Set C, Primer Pair Set D, Primer Pair Set E, and Primer Pair Set F.

18. The composition of any one of claims 15–17, wherein the probe suitable for use with a specific forward and reverse primer pair are selected from: a probe specific for Vibrio cholerae having a sequence selected from SEQ ID NO: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, or 39; a probe specific for Vibrio parahaemolyticus produced using a sequence selected from SEQ ID NO: 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, or 78; a probe specific for Vibrio vulnificus selected from SEQ ID NO: 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, or 117; a probe specific for Plesiomonas shigelloides selected from SEQ ID NO: 120, 123, 126, 129, 132, 135, 138, 141, 144, 147, 150, 153, or 156; a probe specific for Yersinia enterocolitica selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, or 195; or a probe specific for Aeromonas hydrophila selected from SEQ ID NO: 198, 201, 204, 207, 210, 213, 216, 219, 222, 225, 228, 231, or 234.

19. The composition of any one of claims 15–18, further including a polymerase, a buffer, and deoxynucleotide triphosphates (dNTPs).

20. The composition of any one of claims 15–19, further including a sample.

21. The composition of any one of claims 15–20, further comprising at least one forward and reverse primer selected from Primer Pair Set G; and, optionally, a control probe, that specifically amplifies the target nucleic acid of a control sample.

22. The composition of claim 21 wherein the Primer Pair Set G comprises forward and reverse primer pair selected from SEQ ID NO: 235-236, 238-239, 241-242, 244-245, 247-248, 250-251, 253-254, 256-257, 259-260, 262-263, 265-266, 268-269, or 271-272; and the probe sequence is selected from SEQ ID NO: 237, 240, 243, 243, 246, 249, 252, 255, 258, 261, 264, 267, 270, or 273.

23. The composition of any one of claims 15–22, wherein the probe contains a fluorescent reporter.

24. The composition of claim 23, wherein the probe contains a quencher.

25. The composition of any one of claims 23 or 24, wherein the probe is labeled at or near the 5′ end with a dye selected from FAM, VIC, ABY, JUN, or AF647.

26. The composition of any one of claims 24–26, wherein the probe is labeled at or near the 3′ end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, or DFQ.

27. The composition of any one of claims 17–26, wherein: the probes specific for amplicons generated using one or more Primer Pairs from Primer Pair Sets A, B, and C are labeled with FAM; the probes specific for amplicons generated using one or more primer pairs from Primer Pair Set D are labeled with VIC; the probes specific for amplicons generated using one or more primer pairs from Primer Pair Set E are labeled with ABY; and the probes specific for amplicons generated using one or more primer pairs from Primer Pair Set F are labeled with JUN.

28. The composition of any one of claims 21–27, wherein the probes specific for amplicons generated using one or more primer pairs from Primer Pair Set G are labeled with AF647.

29. A kit for simultaneously determining the presence or absence of Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Plesiomonas shigelloides, Yersinia enterocolitica, and Aeromonas hydrophila in a sample, comprising the compositions of any one of claims 15– 20.

30. The kit of claim 29, further comprising the compositions of any one of claims 21–28.

31. The kit of claim 29 or 30, wherein the Primer Pair Set comprises forward and reverse primers selected from SEQ ID NO: 1–2, 40–41, 79–80, 118–119, 157–158, or 196-197; and the Probe Set comprises probes selected from SEQ ID NO: 3, 42, 81, 120, 159, or 198.

32. The kit of claim 29 or 30, wherein the Primer Pair Set comprises forward and reverse primers selected from SEQ ID NO: 4–5, 43–44, 82–83, 121–122, 160–161, or 199-200; and the Probe Set comprises probes selected from SEQ ID NO: 6, 45, 84, 123, 162, or 201.

33. The kit of claim 29 or 30, wherein the Primer Pair Set comprises forward and reverse primers selected from SEQ ID NO: 7–8, 46–47, 85–86, 124–125, 163-164, or 202-203; and the Probe Set comprises probes selected from SEQ ID NO: 9, 48, 87, 126, 165, or 204.

34. The kit of claim 29 or 30, wherein the Primer Pair Set comprises forward and reverse primers selected from SEQ ID NO: 10–11, 49–50, 88–89, 127–128, 166-167, or 205-206; and the Probe Set comprises probes selected from SEQ ID NO: 12, 51, 90, 129, 168, or 207.

35. The kit of claim 29 or 30, wherein the Primer Pair Set comprises forward and reverse primers selected from SEQ ID NO: 13–14, 52–53, 91–92, 130–131, 169-170, or 208-209; and the Probe Set comprises probes selected from SEQ ID NO: 15, 54, 93, 132, 171, or 210.

36. The kit of claim 29 or 30, wherein the Primer Pair Set comprises forward and reverse primers selected from SEQ ID NO: 16–17, 55–56, 94–95, 133–134, 172-173, or 211-212; and the Probe Set comprises probes selected from SEQ ID NO: 18, 57, 96, 135, 174, or 213.

37. The kit of claim 29 or 30, wherein the Primer Pair Set comprises forward and reverse primers selected from SEQ ID NO: 19–20, 58–59, 97–98, 136–137, 175-176, or 214-215; and the Probe Set comprises probes selected from SEQ ID NO: 21, 60, 99, 138, 177, or 216.

38. The kit of claim 29 or 30, wherein the Primer Pair Set comprises forward and reverse primers selected from SEQ ID NO: 22–23, 61–62, 100–101, 139–140, 178-179, or 217- 218; and the Probe Set comprises probes selected from SEQ ID NO: 24, 63, 102, 141, 180, or 219.

39. The kit of claim 29 or 30, wherein the Primer Pair Set comprises forward and reverse primers selected from SEQ ID NO: 25–26, 64–65, 103–104, 142–143, 181-182, or 220- 221; and the Probe Set comprises probes selected from SEQ ID NO: 27, 66, 105, 144, 183, or 222.

40. The kit of claim 29 or 30, wherein the Primer Pair Set comprises forward and reverse primers selected from SEQ ID NO: 28–29, 67–68, 106–107, 145–146, 184-185, or 223- 224; and the Probe Set comprises probes selected from SEQ ID NO: 30, 69, 108, 147, 186, or 225.

41. The kit of claim 29 or 30, wherein the Primer Pair Set comprises forward and reverse primers selected from SEQ ID NO: 31–32, 70–71, 109–110, 148–149, 187-188, or 226- 227; and the Probe Set comprises probes selected from SEQ ID NO: 33, 72, 111, 150, 189, or 228.

42. The kit of claim 29 or 30, wherein the Primer Pair Set comprises forward and reverse primers selected from SEQ ID NO: 34–35, 73–74, 112–113, 151–152, 190-191, or 229- 230; and the Probe Set comprises probes selected from SEQ ID NO: 36, 75, 114, 153, 192, or 231.

43. The kit of claim 29 or 30, wherein the Primer Pair Set comprises forward and reverse primers selected from SEQ ID NO: 37–38, 76–77, 115–116, 154–155, 193-194, or 232- 233; and the Probe Set comprises probes selected from SEQ ID NO: 39, 78, 117, 156, 195, or 234.

Citation Information

Patent Citations

  • Kit for detecting 23 food pathogenic bacteria through single tube

    CN117051138A

  • Multiplex panel for upper respiratory pathogens

    WO2024006845A1