Nucleic acid aptamers recognizing the extra cellular domain of alpha7 / beta1 integrin dimers and uses thereof

Abstract

The present invention relates to aptamers that specifically bind to the extra-cellular domain of alpha7 / beta1 integrin dimers, conjugates or particles comprising said aptamers, in muscles cells such as skeletal muscle fibres and satellite cells, or in cells aberrantly expressing said domain e.g. tumour cells such as rhabdomyosarcoma (muscle-derived tumours), or glioblastoma cancer stem cells, as well as conjugates comprising said aptamers, therapeutic or diagnostic compositions comprising said conjugates or said aptamers, and their use as a medicament and in diagnostic methods.

Description

[0001] NUCLEIC ACID APTAMERS RECOGNIZING THE EXTRA CELLULAR DOMAIN OF ALPHA7 / BETA1 INTEGRIN DIMERS AND USES THEREOF

[0002] ABSTRACT

[0003] The present invention relates to aptamers that specifically bind to the extra-cellular domain of alpha7 / beta1 integrin dimers, conjugates, or particles comprising said aptamers, in muscles cells such as skeletal muscle fibres and muscle stem cells ( satellite cells), or in cells aberrantly expressing said domain e.g., tumour cells such as rhabdomyosarcoma (muscle-derived tumours), or glioblastoma cancer stem cells, as well as conjugates comprising said aptamers, therapeutic or diagnostic compositions comprising said conjugates or said aptamers, and their use as a medicament and in diagnostic methods.

[0004] STATE OF THE ART

[0005] The delivery of therapeutic molecules (i.e. small molecules, oligonucleotides, such as microRNAs, siRNAs, or antisense oligonucleotides, proteins, ribonucleoproteins, and plasmids) into skeletal muscle is a promising therapeutic strategy for many muscle disorders, such as muscular dystrophies, muscle wasting or sarcopenia. However, selective delivery into skeletal muscle presents several caveats, including the vast extension of the tissue and the need to reach all muscles in the body with minimal off- target effects.

[0006] Several strategies are currently under investigation to improve payload availability and tissue uptake of different therapeutic molecules, such as the conjugation of the therapeutic molecule to muscle-targeting molecules (Avidity Biosciences) or nanocarriers. Nanoscale materials are extensively used in drug delivery systems (DDSs) by exploiting the fact that endogenous transport at the cellular level is actively driven at the nanometer length scale. The high surface-to-volume ratio of nanoparticles (NPs) facilitates the loading of growth factors, oligonucleotides, cytokines, and other bioactive agents to promote tissue regeneration, while the abundant surface chemistry allows modifying the NPs with targeting ligands to assure a more precise delivery. By protecting their payload from degradation, NPs enhance their pharmacokinetics and bioavailability. Several types of NPs have been recently developed as delivery systems for therapeutic molecules into skeletal muscle cells, but only a few of them have been tested in animal models. For instance, tricycloDNA antisense oligonucleotides, which spontaneously assemble into 40-100 nm NPs, target skeletal muscles in a mouse model of Duchenne muscular dystrophy, a highly debilitating muscle disorder affecting children. Similarly, several nanomaterials such as PMMA / N-isopropylacrylamide (NIPAM) and poly(ethylene imine) (PEI) and poly(ethylene glycol) (PEG) copolymers have been used to deliver antisense oligonucleotides into the same mouse model, achieving a therapeutic effect. Finally, NPs have also been used to deliver plasmids, gene editing systems, and small molecules, such as prednisone, rapamycin, and gentamycin, into dystrophic mice.

[0007] However, several issues, and, in particular, selective and efficient skeletal muscle uptake upon systemic delivery, still need to be solved, including delivery systems that efficiently target muscle stem cells (satellite cells), which are the cells responsible for skeletal muscle regeneration. Targeting satellite cells is desirable to obtain a long-lasting effect of the therapeutic molecule.

[0008] Selective targeting can be improved by the addition of molecules, such as peptides, antibodies, enzymes, and aptamers, to the therapeutic molecule or to the NP. Different targeting peptides have been shown to target muscle cells efficiently in vitro and in vivo. For instance, Jativa et al. (2019) used G5-PAMAM conjugated to the muscle-homing heptapeptide ASSLNIA (Samoylova & Smith, 1999) to enhance gene delivery into C2C12 muscle cells. Similarly, Acharya and Hill (2014) used a cysteine-terminated KDEL (Lys-Asp-Glu-Leu) peptide, to deliver gold NPs containing siRNAs into the same cell line. In addition to homing peptides, both small molecules and aptamers are currently explored as targeting molecules. Aptamers are a class of nucleic acid ligands, which are biocompatible, have low immunogenicity, small size, a high binding affinity to the target molecule, and are easy to modify. Recently, muscle-internalizing aptamers have been developed using a cell internalization Systematic Evolution of Ligands by Exponential Enrichment (SELEX) approach, but they have only been tested in cell lines.

[0009] Muscle targeting has also been partially achieved in mouse models. For instance, PLGA- PEG NPs functionalized with a skeletal muscle targeting 12-mer peptide (M12) have been recently used to deliver PTEN inhibitors into dystrophic mdx mice. A different approach, based on the use of enzyme-targeted NPs, was recently used to target peptide-conjugated polymeric NPs into ischemic muscle via systemic delivery. This approach exploits the abundance of ECM metalloproteinases in the remodelling muscle, which induce selective MM9-mediated peptide cleavage, and induction of a conformational change of the NP. The main bottlenecks of targeted delivery into skeletal muscle tissue are the vast extension of the target tissue, the low tissue uptake, and the lack of targeting of satellite cells.

[0010] However, although some of these molecules can be used to deliver the therapeutic cargo to some extent into skeletal muscle, none of these approaches efficiently target satellite cells when delivered systemically, which is essential for obtaining a long-lasting effect of the therapeutic molecule. SUMMARY OF THE INVENTION

[0011] The present invention provides aptamers that are capable of selectively binding the alpha7 / beta1 integrin dimer expressed on the cellular membrane as defined in the claims. Said aptamers comprise a conserved motif identified by the inventors and show a surprising binding affinity for the above-mentioned dimer. The present description provides proof of the therapeutic effectiveness of said aptamers as well as a delivery system that further improves the aptamer's performance.

[0012] The aptamers selected by the inventors selectively bind the extra-cellular portion of the alpha7 / beta1 integrin dimer, a surface protein dimer highly enriched in skeletal muscle fibres and satellite cells but virtually absent in most tissues or organs. In addition, despite alpha7 / beta1 integrin is usually muscle-tissue specific, high levels of said dimers are also aberrantly expressed on the cell surface of various tumours. Therefore, the aptamers of the invention are also useful for targeting these tumours selectively.

[0013] The aptamers disclosed herein, therefore, can be advantageously used in therapy, in diagnosis as well as in research.

[0014] The inventors identified a conserved nucleic acid motif, of SEQ ID NO 33 (SGGTRT wherein S is either a G or a C and R is either G or A), and selected a number of aptamers comprising one or more of said motifs, that selectively bind the alpha7 / beta1 integrin extracellular dimer with a surprising nanomolar efficiency.

[0015] In addition, the authors demonstrated that the aptamers of the invention allow efficient delivery of therapeutic molecules, in particular in nanoformulations, in cells expressing the alpha7 / beta1 integrin extracellular dimer such as cells of the skeletal muscle tissue, comprising satellite cells, in a mouse model of muscular dystrophy. In addition, the delivery of the therapeutic molecules was also observed into highly inaccessible muscles, such as the diaphragm, when administered via intra-venous injection.

[0016] As described above, there are currently some muscle-targeting molecules under development, including antibodies, peptides, and aptamers, but most of them have been only tested in cellular models. For those of them tested in animal models, their overall efficiency in targeting skeletal muscles in vivo is low. In addition, none of them has been shown to target satellite muscle cells efficiently. The aptamers of the present invention are the first recognition molecules able to target both skeletal muscle fibres and muscle satellite cells. They allow efficient delivery of therapeutic molecules into muscle tissue when administered systemically. In addition to their use as an alpha7 / beta1 integrin extracellular dimer expressing cells targeting molecules in therapeutic applications, the aptamers of the present invention can also be used as a probe in diagnostic and research applications. These aptamers are the first molecules designed to detect functional alpha 7 / beta 1 integrin dimers present in the cell surface, such as muscle cells and tissues. Despite the existence of several commercial antibodies that recognize either alpha7 or betal integrins separately, there are currently no platforms (antibodies, aptamers, or other functional molecules) that selectively bind to the alpha7 / beta1 dimers. Given that said integrins are always found as functional dimers on the surface of expressing cells, and that the particular combination of alpha7 with betal integrin precisely defines muscle tissue and some tumour aberrantly expressing said dimers, the aptamers of the present invention are more selective than the individual antibodies in the recognition of alpha7 with betal integrin dimer expressing cells and could substitute the individual antibodies in therapeutic, diagnostic and research applications. As a proof-of-principle for these applications, protocols and experimental data are herein provided, demonstrating the suitability for said uses with a fluorophore-labelled alpha7 / beta1 aptamers as a probe in histological and flow cytometry applications.

[0017] In particular, the aptamers of the present invention, all comprising the conserved motif of SEQ ID NO 33, show a high affinity towards both recombinant alpha7 / beta1 integrins and skeletal muscle C2C12 cells as demonstrated in a cross-over SELEX process (Figure 1A). This allowed to develop highly selective recognition molecules for cells that express on their surface the protein dimer formed by alpha7 / betal integrin subunits, such as skeletal muscle cells, including satellite cells.

[0018] Other important aspects of aptamers of the invention are the following: i) being alpha7 / betal integrin dimer expressing cells targeting moieties, they can be used for the release of therapeutic molecules and nanoformulations into said cells, such as skeletal muscle tissue, satellite cells, and tumour cells; and ii) being selective probes against alpha7 / beta1 integrin dimers, they can be used for diagnostic and research applications, replacing the respective antibodies.

[0019] The substitution of antibodies with aptamers in biomedical applications has important economical and ethical advantages, such as reduced production costs, higher batch reproducibility, and the fact that aptamers do not require laboratory animals for their production. Hence, objects of the present invention are:

[0020] An aptamer from 30 to 100 nucleotides in length which comprises at least one conserved motif of SEQ ID NO. 33 and binds to an extra-cellular domain of the alpha7 / beta1 integrin dimers. ;

[0021] Conjugates comprising said aptamer;

[0022] Nanoformulations functionalised or loaded with said aptamer or conjugate;

[0023] Compositions comprising said aptamer, conjugate or nanoformulation, including pharmaceutical compositions;

[0024] Aptamer, conjugate, nanoformulation, or pharmaceutical composition as defined above and in the detailed description and claims for use as a medicament;

[0025] A medical treatment comprising the administration of the aptamer, conjugate, nanoformulation, or pharmaceutical composition as defined above to a subject in need thereof;

[0026] Use of the aptamer or conjugate or composition as defined above, in the detailed description or in the claims for the detection of skeletal muscle cells or fibers, satellite cells, cells presenting on their surface the alpha7 / beta1 integrin dimers including cancer cells;

[0027] An in vitro method for detecting alpha7 / beta1 integrin dimers the method comprising the steps of detecting the binding of an aptamer or conjugate as defined above, in the detailed description or in the claims to a cell, tissue, organoid or biological sample.

[0028] GLOSSARY

[0029] • Aptamers, i.e. , nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith, aptamers are single-stranded short sequences of artificial DNA, RNA or XNA, wherein XNA is a xeno-nucleic acid, i.e. oligos with nonnatural moieties. They exhibit a range of affinities to specific targets (KD in the pM to pM range), and are sometimes classified as “chemical antibodies”. Aptamers and antibodies can be used in many of the same applications, but the nucleic acid-based structure of aptamers, which are mostly oligonucleotides, is very different from the amino acid-based structure of antibodies, which are proteins. This difference can make aptamers a better choice than antibodies for some purposes.

[0030] • microRNA: short non-coding RNAs that regulate gene expression in cells. Modulation of microRNA levels can be used as a therapeutic strategy for a wide array of applications, including muscle diseases. • Nucleic acid therapeutics (NATs): A class of therapeutic molecules based on nucleic acids (RNA or DNA)

[0031] • Satellite cells or muscle satellite cells: Muscle-resident stem cells responsible for skeletal muscle regeneration. They represent an important cellular target in the design of therapies for muscle diseases.

[0032] • According to the present invention, the sequence indicated as NM3 corresponds to SEQ ID NO.1 , the sequence indicated as NM4 corresponds to SEQ ID NO.5, the sequence indicated as NM5 corresponds to SEQ ID NO.9, the sequence indicated as NM6 corresponds to SEQ ID NO.13, the sequence indicated as NM7 corresponds to SEQ ID NO.17, the sequence indicated as NM8 corresponds to SEQ ID NO.21 , the sequence indicated as NM13 corresponds to SEQ ID NO.25, the sequence indicated as NM15 correspond to SEQ ID NO.29, the sequence indicated as NM15.2 correspond to SEQ ID NO.32.

[0033] According to the present invention, the expression “aberrant expression” or “aberrantly expressing” indicates cells which present the alpha7 / beta1 integrin dimer in the cell surface.

[0034] Biological sample according to the present invention comprises tissue, cells, bodily fluid, or other biological material collected from a living organism for analysis, experimentation, or diagnostic purposes. These samples can come from various sources such as blood, saliva, tissue biopsies, or even whole organs.

[0035] Nanoformulation according to the present invention has the meaning commonly intended in the state of the art; a nanoformulation refers to the development of a drug or therapeutic agent in a nano-sized form, typically ranging from 1 to 1000 nanometers in size. This can involve encapsulating active ingredients within nanoparticles or structuring them into nanoscale formulations to enhance their efficacy, bioavailability, stability, and targeting capabilities.

[0036] A nanoformulation according to the invention may comprise the aptamers of the invention as targeting ligands in combination with one or more of Active Pharmaceutical Ingredient (API), polymer matrix, lipids, surfactants, stabilizers, Imaging agents, chelating agents.

[0037] DETAILED DESCRIPITION OF THE DRAWINGS

[0038] Figure 1 - Selection of aptamers against alpha7 / beta1 integrin dimers. A) Scheme of the cross-over SELEX process. B) Sensorgram obtained by surface plasmon resonance (SPR) for the association with and dissociation from alpha7 / beta1 dimer of the selected candidates (NM3, NM4, NM5, NM6, NM7, NM8, NM13, NM15. C) Sensorgram representing the two part-association rate of NM15.2 . D) Representative flow cytometry plot showing alpha7 / beta1 aptamer-positive C2C12 muscle cells. E) Graph showing the percentage of alpha7 / beta1 aptamer-positive C2C12 muscle cells, Rh30 rhabdomyosarcoma cells, BTSC3 glioblastoma cancer stem cells, and HEK293 cells (negative control). The percentage of cells labelled with a scramble aptamer is included as a negative control. Statistical analysis was performed using two-way Anova analysis with Turkey’s post hoc test.

[0039] Figure 2 - Characterization of an alpha7 / beta1 aptamer in muscle cells and tissues.

[0040] A) Representative flow cytometry plot showing alpha7 / betal aptamer-positive cells (y- axis) and Seal-positive cells (x-axis) on hematopoietic lineage (CD31 , CD45, CD11b)- negative muscle resident cells. A scramble aptamer was included as a negative control.

[0041] B) Percentage of alpha7 / betal aptamer-positive, Seal-negative cells, alpha7 / betal aptamer-negative, Seal -positive cells and hematopoietic lineage positive cells analyzed by flow cytometry in A.C) Confocal microscopy analysis on transversal sections of Tibialis Anterior (TA) muscles using an Alexa 5945’ end labelled alpha7 / betal aptamer. Staining using an antibody against laminin is shown as a control. Statistical analysis was performed using two-way Anova analysis with Turkey’s post hoc test. Scale bar: 50 m. Figure 3 Characterization of aptamer-conjugated gold nanoparticles containing different types of oligonucleotides.. A) Transmission Electronic Microscopy (TEM) image of AuNP with size distribution. The AuNP mean size was 14.49 ± 3.49 nm. B) Absorbance spectrum of AuNPs alone or conjugated with the alpha7 / beta1 aptamer and two different oligonucleotides cargo (miR-206 and oligodT). C) Hydrodynamic size of the different nanoformulations measured by NTA in the absence (without corona) and presence (with corona) of serum. D) Z-potential of the different AuNPs in the absence (without corona) and presence (with corona) of serum.

[0042] Figure 4 - Aptamer-conjugated AuNPs efficiently deliver a functional oligonucleotide (miR-206 mimic) and stimulate satellite cells differentiation ex vivo. A) Flow cytometry and B) Confocal microscopy analysis of C2C12 cells treated with empty alpha7 / beta1 AuNPs or alpha7 / beta1 AuNPs containing oligodT-cy5 for 24 hours. C) Luciferase experiments performed in C2C12 cells transfected with the reporter plasmid pmirGLO 206 and miR-206 (5pM) or treated with alpha7 / beta1 AuNPs functionalized with miR-206 mimics D) Immunofluorescence performed in satellite cells derived from mdx mice isolated by FACS as hematopoietic lineage (CD31 , CD45, CD11b)-negative, Seal -negative, alpha7 integrin-positive and treated with the indicated AuNPs in growth medium. Top, MyHC (MF20), Bottom, DAPI. E) Graph showing the percentage of nuclei contained in MyHC- fibres containing 1 , 2 to 5 or more than 5 nuclei in the same conditions as in D. F) Graph showing the number of total nuclei in D. Statistical analysis was performed using one-way Anova or two-way Anova (panel E) analysis with Turkey’s post hoc test. Scale bar: 100 .m.

[0043] Figure 5 - Aptamer-conjugated AuNPs containing microRNAs efficiently stimulate muscle regeneration in DBA2 mdx mice when injected locally. A) Scheme of the experimental protocol. B) Silver enhancement performed on transversal sections on TA muscles of mice treated once a week for three weeks with intramuscular injections of either PBS, alpha7 / beta1 AuNPs containing oligo dT (control AuNPs), or alpha7 / beta1 AuNPs containing miR-206. Scale bar 150 pm. C) miR-206 staining in TA muscles of mice treated as in B. Scale bar 100 pm. D) Graph showing the percentage of stained area (in pixels) quantified in C. E) Immunofluorescence for embryonic myosin heavy chain (eMyHC-top) and laminin (middle) in the same conditions as in B. Nuclei were counterstained with DAPI (bottom) Scale bar 100 pm. F) Graph showing the percentage of eMyHC positive fibres. G) Sirius red staining performed on TA muscles. Scale bar 150 pm. H) Graph showing the percentage of fibrotic area in the different conditions. Scale bar 150 pM. Statistical analysis was performed using one-way Anova analysis with Turkey’s post hoc test.

[0044] Figure 6 - Aptamer-conjugated AuNPs containing microRNAs efficiently target skeletal muscle and satellite cells and stimulate muscle regeneration after intravenous injection. qRT-PCR showing the levels of miR-206 normalized against U6 in the gastrocnemius (A) and diaphragm (B) muscles of mdx mice treated via intra-venous injection with PBS or with control or alpha7 / beta1 AuNPs miR-206 for three weeks C) qRT-PCR showing the levels of miR-206 normalized against U6 in the indicated muscleresident cell populations of dystrophic mice treated as above. D) Immunofluorescence for eMyHC-(top) and laminin (middle) in TA muscles of mice treated as above. Nuclei were counterstained with DAPI (bottom). Scale bar: 100 pm E) Graph showing the quantifications of the percentage of eMyHC positive fibres. F) Sirius red stainig performed on TA muscles. Scale bar 150pM. G) Graph showing the percentage of fibrotic area in the different conditions. Statistical analysis was performed using one-way Anova (in panels A-B-E-G) and two-way Anova (in panel C) analysis with T urkey’s post hoc test. Figure 7 - Alpha7 / beta1 AuNPs containing oligonucleotides do not elicit an immunogenic response in dystrophic muscles. A) Representative flow cytometry plot showing hematopoietic (Lin-positive) cells on muscles isolated from mdx mice treated via intra-venous injection with PBS or with control or alpha7 / beta1 AuNPs miR-206 for three weeks. B) Percentage of Lin-positive cells in mice treated as in A. C) Representative flow cytometry plot showing F4 / 80 CD11 b- positive cells (macrophages) on the Lin-positive population in A. D) Percentage of macrophages on the Lin-positive cells in mice treated as in A. E) Immunofluorescence for F4 / 80 (top) and laminin(bottom) in TA muscles of mice treated as above.. Scale bar: 100 .m F) Percentage of the F4 / 80 positive area in E.

[0045] Figure 8 - Aptamer-conjugated AuNPs containing miR-206 improve muscle function in dystrophic mice. Graph showing the normalized maximal strength (Fmax) of dystrophic mice treated via intra-venous injection with PBS or with control or alpha7 / beta1 AuNPs miR-206 for five weeks. Data are presented as mean values + / - SEM. Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. **** indicates statistically significant differences between alpha7 / beta1 AuNPs miR-206 and untreated animals; #### indicates statistically significant differences between alpha7 / beta1 AuNPs miR-206 and control AuNPs.

[0046] SEQUENCES DESCRIPTION

[0047] SEQ ID NO 1 APTAMER NM3 FULL LENGTH

[0048] GCCTGTTGTGAGCCTCCTGTCGAATAGCTCTAGTCTGGGTGSGGTRTGTCTAGTG GGTGTGGTCTTGAGCGTTTATTCTTGTCTCCC

[0049] R being G or A, preferably A

[0050] S being C or G, preferably G

[0051] SEQ ID NO 2 APTAMER NM3 NO FWD

[0052] TAGCTCTAGTCTGGGTGSGGTRTGTCTAGTGGGTGTGGTCTTGAGCGTTTATTCTT GTCTCCC

[0053] R being G or A, preferably A

[0054] S being C or G, preferably G

[0055] SEQ ID NO 3 APTAMER NM3 NO REV

[0056] GCCTGTTGTGAGCCTCCTGTCGAATAGCTCTAGTCTGGGTGSGGTRTGTCTAGTG GGTGTGGTC

[0057] R being G or A, preferably A

[0058] S being C or G, preferably G

[0059] SEQ ID NO 4 APTAMER NM3 SHORT

[0060] TAGCTCTAGTCTGGGTGSGGTRTGTCTAGTGGGTGTGGTC

[0061] R being G or A, preferably A

[0062] S being C or G, preferably G

[0063] SEQ ID NO 5 APTAMER NM4 FULL LENGTH

[0064] GCCTGTTGTGAGCCTCCTGTCGAACCCAACCATAGGTAACTSGGTRTTGGCTCCG CATGTATCATTGAGCGTTTATTCTTGTCTCCC R being G or A, preferably G

[0065] S being C or G, preferably C

[0066] SEQ ID NO 6 APTAMER NM4 NO FWD

[0067] CCCAACCATAGGTAACTSGGTRTTGGCTCCGCATGTATCATTGAGCGTTTATTCTT

[0068] GTCTCCC

[0069] R being G or A, preferably G

[0070] S being C or G, preferably C

[0071] SEQ ID NO 7 APTAMER NM4 NO REV

[0072] GCCTGTTGTGAGCCTCCTGTCGAACCCAACCATAGGTAACTSGGTRTTGGCTCCG

[0073] CATGTATCA

[0074] R being G or A, preferably G

[0075] S being C or G, preferably C

[0076] SEQ ID NO 8 APTAMER NM4 SHORT

[0077] CCCAACCATAGGTAACTSGGTRTTGGCTCCGCATGTATCA

[0078] R being G or A, preferably G

[0079] S being C or G, preferably C

[0080] SEQ ID NO 9 APTAMER NM5 FULL LENGTH

[0081] GCCTGTTGTGAGCCTCCTGTCGAACGGCACCCAATGTGCATCSGGTRTGGGCTTC

[0082] GTTGCTCTATTGAGCGTTTATTCTTGTCTCCC

[0083] R G or A, preferably A

[0084] S being C or G, preferably C

[0085] SEQ ID NO 10 APTAMER NM5 NO FWD

[0086] CGGCACCCAATGTGCATCSGGTRTGGGCTTCGTTGCTCTATTGAGCGTTTATTCTT

[0087] GTCTCCC

[0088] R being G or A, preferably A

[0089] S being C or G, preferably C

[0090] SEQ ID NO 11 APTAMER NM5 NO REV

[0091] GCCTGTTGTGAGCCTCCTGTCGAACGGCACCCAATGTGCATCSGGTRTGGGCTTC

[0092] GTTGCTCTA

[0093] R being G or A, preferably A

[0094] S being C or G, preferably C

[0095] SEQ ID NO 12 APTAMER NM5 SHORT

[0096] CGGCACCCAATGTGCATCSGGTRTGGGCTTCGTTGCTCTA

[0097] R being G or A, preferably A

[0098] S being C or G, preferably C

[0099] SEQ ID NO 13 APTAMER NM6 FULL LENGTH GCCTGTTGTGAGCCTCCTGTCGAATGACACTCGTTGAATCSGGTRTTGGCTTCGT

[0100] GTCTCCTGGTTGAGCGTTTATTCTTGTCTCCC

[0101] R being G or A, preferably A

[0102] S being C or G, preferably C

[0103] SEQ ID NO 14 APTAMER NM6 NO FWD

[0104] TGACACTCGTTGAATCSGGTRTTGGCTTCGTGTCTCCTGGTTGAGCGTTTATTCTT

[0105] GTCTCCC

[0106] R being G or A, preferably A

[0107] S being C or G, preferably C

[0108] SEQ ID NO 15 APTAMER NM6 NO REV

[0109] GCCTGTTGTGAGCCTCCTGTCGAATGACACTCGTTGAATCSGGTRTTGGCTTCGT

[0110] GTCTCCTGG

[0111] R being G or A, preferably A

[0112] S being C or G, preferably C

[0113] SEQ ID NO 16 APTAMER NM6 SHORT

[0114] TGACACTCGTTGAATCSGGTRTTGGCTTCGTGTCTCCTGG

[0115] R being G or A, preferably A

[0116] S being C or G, preferably C

[0117] SEQ ID NO 17 APTAMER NM7 FULL LENGTH

[0118] GCCTGTTGTGAGCCTCCTGTCGAATACGCGCAACASGGTRTGAGAGGTGGGTGG

[0119] GTATGGTGTTGAGCGTTTATTCTTGTCTCCC

[0120] R being G or A, preferably G

[0121] S being C or G, preferably C

[0122] SEQ ID NO 18 APTAMER NM7 NO FWD

[0123] TACGCGCAACASGGTRTGAGAGGTGGGTGGGTATGGTGTTGAGCGTTTATTCTTG

[0124] TCTCCC

[0125] R being G or A, preferably G

[0126] S being C or G, preferably C

[0127] SEQ ID NO 19 APTAMER NM7 NO REV

[0128] GCCTGTTGTGAGCCTCCTGTCGAATACGCGCAACASGGTRTGAGAGGTGGGTGG

[0129] GTATGGTG

[0130] R being G or A, preferably G

[0131] S being C or G, preferably C

[0132] SEQ ID NO 20 APTAMER NM7 SHORT

[0133] TACGCGCAACASGGTRTGAGAGGTGGGTGGGTATGGTG

[0134] R being G or A, preferably G S being C or G, preferably C

[0135] SEQ ID NO 21 APTAMER NM8 FULL LENGTH

[0136] GCCTGTTGTGAGCCTCCTGTCGAAGTGATGTCCTSGGTRTGGAGTGGTGGGTATG

[0137] ATGGCAGCATTGAGCGTTTATTCTTGTCTCCC

[0138] R being G or A, preferably G

[0139] S being C or G, preferably G

[0140] SEQ ID NO 22 APTAMER NM8 NO FWD

[0141] GTGATGTCCTSGGTRTGGAGTGGTGGGTATGATGGCAGCATTGAGCGTTTATTCT

[0142] TGTCTCCC

[0143] R being G or A, preferably G

[0144] S being C or G, preferably G

[0145] SEQ ID NO 23 APTAMER NM8 NO REV

[0146] GCCTGTTGTGAGCCTCCTGTCGAAGTGATGTCCTSGGTRTGGAGTGGTGGGTATG

[0147] ATGGCAGCA

[0148] R being G or A, preferably G

[0149] S being C or G, preferably G

[0150] SEQ ID NO 24 APTAMER NM8 SHORT

[0151] GTGATGTCCTSGGTRTGGAGTGGTGGGTATGATGGCAGCA

[0152] R being G or A, preferably G

[0153] S being C or G, preferably G

[0154] SEQ ID NO 25 APTAMER NM13 FULL LENGTH

[0155] GCCTGTTGTGAGCCTCCTGTCGAATGSGGTRTGTGGTGGGTGGGATGCCATTCG

[0156] CACTGTGTGGTTGAGCGTTTATTCTTGTCTCCC

[0157] R being G or A, preferably G

[0158] S being C or G, preferably C

[0159] SEQ ID NO 26 APTAMER NM13 NO FWD

[0160] TGSGGTRTGTGGTGGGTGGGATGCCATTCGCACTGTGTGGTTGAGCGTTTATTCT

[0161] TGTCTCCC

[0162] R being G or A, preferably G

[0163] S being C or G, preferably C

[0164] SEQ ID NO 27 APTAMER NM13 NO REV

[0165] GCCTGTTGTGAGCCTCCTGTCGAATGSGGTRTGTGGTGGGTGGGATGCCATTCG

[0166] CACTGTGTGG

[0167] R being G or A, preferably G

[0168] S being C or G, preferably C

[0169] SEQ ID NO 28 APTAMER NM13 SHORT TGSGGTRTGTGGTGGGTGGGATGCCATTCGCACTGTGTGG

[0170] R being G or A, preferably G

[0171] S being C or G, preferably C

[0172] SEQ ID NO 29 APTAMER NM15 FULL LENGTH

[0173] GCCTGTTGTGAGCCTCCTGTCGAAACGCGAGATTTGGGTSGGTRTGTCAGCTGCS

[0174] GGTRTGGTGTTGAGCGTTTATTCTTGTCTCCC

[0175] R in position 44 being G or A , preferably A

[0176] R in position 59 being G or A , preferably G

[0177] S in position 40 being G or C, preferably G

[0178] S in position 55 being G or C, preferably G

[0179] SEQ ID NO 30 APTAMER NM15 NO FWD

[0180] ACGCGAGATTTGGGTSGGTRTGTCAGCTGCSGGTRTGGTGTTGAGCGTTTATTCT TGTCTCCC

[0181] R in position 20 being G or A, preferably A

[0182] R in position 35 being G or A, preferably G

[0183] S in position 16 being G or C, preferably G

[0184] S in position 31 being G or C, preferably G

[0185] SEQ ID NO 31 APTAMER NM15 NO REV

[0186] GCCTGTTGTGAGCCTCCTGTCGAAACGCGAGATTTGGGTSGGTRTGTCAGCTGCS

[0187] GGTRTGGTG

[0188] R in position 44 being G or A, preferably A

[0189] R in position 59 being G or A , preferably G

[0190] S in position 40 being G or C, preferably G

[0191] S in position 55 being G or C, preferably G

[0192] SEQ ID NO 32 APTAMER NM15 SHORT OR NM15.2

[0193] ACGCGAGATTTGGGTSGGTRTGTCAGCTGCSGGTRTGGTG

[0194] R in position 20 being G or A, preferably A

[0195] R in position 35 being G or A , preferably G

[0196] S in position 16 being G or C, preferably G

[0197] S in position 31 being G or C, preferably G

[0198] SEQ ID NO 33 CONSERVED MOTIF

[0199] SGGTRT wherein S is G or C and R is G or A. All the sequences are nucleotide sequences 5’ to 3’. Underlined, 5’ to 3’, when present, the forward primer of the aptamer’s library, 3’ to 5’ the reverse primer of the aptamer’s library.

[0200] In bold in sequences from 1 to 32 the conserved motif SGGTRT with indication of the preferred S and R. SEQ ID NO 34 Forward primer of the aptamer library and 5’ to 3’ initial nucleotides of the aptamers in the library used in the examples GCCTGTTGTGAGCCTCCTGTCGAA

[0201] SEQ ID NO 35 antisense of reverse primer of the aptamer library TTGAGCGTTTATTCTTGTCTCCC

[0202] SEQ ID NO 36 Reverse primer for aptamer primary GGGAGACAAGAATAAACGCTCAA

[0203] All sequences above are depicted 5’ to 3’.

[0204] DETAILED DESCRIPTION OF THE INVENTION

[0205] Object of the present invention is hence an aptamer from 30 to 100 nucleotides in length which comprises at least one conserved motif of SEQ ID NO. 33 and (selectively) binds to an extra-cellular domain of the alpha7 / beta1 integrin dimers.

[0206] The aptamers bind to mammals alpha7 / beta1 integrin dimers, in particular mouse and human dimers. To note, alpha7 / beta1 integrin dimers are strongly conserved in mammals, e.g. the mouse alpha7 extra-cellular heavy chain shares 89% sequence identity with human alpha7 integrin and the mouse betal extra-cellular domain shares 93-94 amino acid identity with human betal integrin. Of note, most of the differences among amino acids in human and mouse proteins are conservative or semiconservative, indicating that the 3D structure is very similar. The mouse a7 heavy chain shares 89%, 90%, 87% and 85% aa sequence identity with human, rat, feline and bovine □7, and the mouse pi ECD shares 98% aa identity with rat and 93-94%with human, bovine, porcine, ovine, canine and feline pi .

[0207] The aptamers selected by the inventors selectively bind the extra-cellular portion of the alpha7 / beta1 integrin dimer, a surface protein dimer highly enriched in skeletal muscle fibres and in satellite cells but virtually absent in most tissues or organs. In addition, despite alpha7 / beta1 integrin is normally muscular-tissue specific, high levels of said dimers are also present on the cell surface of various tumours, therefore the aptamers of the invention are useful also to selectively target these tumours.

[0208] The inventors identified a conserved nucleic acid motif (SEQ ID 33), and selected a number of aptamers comprising one or more copies of said motif that selectively bind the alpha7 / beta1 integrin extracellular dimer with surprising efficiency.

[0209] In particular, the aptamers of the present invention, all comprising the conserved motif of SEQ ID NO 33, show a high affinity towards both recombinant alpha7 / beta1 integrins and skeletal muscle C2C12 cells as demonstrated in a cross-over SELEX process (Figure 1A). This allowed to develop highly selective recognition molecules for the protein dimer formed by alpha? / betal integrin subunits such as skeletal muscle cells, including satellite cells. The aptamer also efficiently binds tumor cells expressing alpha? / betal integrin subunits in their surface, such as rhabdomyosarcoma or glioblastoma stem cells, but not other cell types such as HEK293, fibroadipogenic progenitors or immune cells.

[0210] The cross-over SELEX process which allowed the recognition of the aptamers of the present invention incorporates several unique steps that go far beyond standard SELEX, as described below:

[0211] - the use of a proprietary oligonucleotide library containig unique primer regions and a window of N nucleotides.

[0212] - the application of a particular selection pressure modulated by

[0213] - the ionic conditions,

[0214] - the number, volume and time of washes for eliminating non-binders and low affinity-binders'

[0215] - the relative concentration of the target and of the oligonucleotide candidates

[0216] - the number of the selection rounds and the steps at which the selection switched from molecule to cell

[0217] - the use of bioinformatics algorithm for analyzing the oligonucleotide pools obtained at the last selection round, extracting the key constitutive elements of the functional anti alpha7 / beta1 integrin and the choice of oligonucleotides to be synthesized

[0218] - the the implementation of a proprietary procedure for the final truncation of the parent aptamers, to obtain shorter, easier to synthesize aptamer variants such as NM15.2.

[0219] This proprietary protocol produced unique aptamers with unprecedented specificity toward the alpha7 / beta1 integrin dimer present in the surface of muscle progenitor cells and differentiated muscle fibers, and could not have been achieved using standard SELEX procedures.

[0220] The affinity between the aptamer and its protein target is unambiguously demonstrated by the SPR analysis (Figure 1 B-C). For NM15.2, the affinity for the cellular target is shown by cytofluorimetry and confocal microscopy.

[0221] Within the meaning of the present invention, the term “integrin(s)” is used in its standard meaning and thus, refers to protein receptors, expressed on the surface of cells that are responsible for outside-in and inside-out cell signaling.

[0222] In an embodiment, said aptamer is from 30 to 100 nucleotides in length or between 40 to 90 nucleotides in length. More preferably, the aptamer of the invention is of about 40 nucleotides in length. According to an embodiment that can be present together with one or more of any other embodiment disclosed herein, the Kd of the aptamer of the invention to an alpha7 / beta1 integrin recombinant protein is less than 2.0*1 O'6or less than 6.0*1 O'7or less than 45*1 O'9when measured by Surface Plasmon Resonance (SPR) analysed by Biacore 3000.

[0223] In an embodiment, which can be present together with one or more of any other embodiment disclosed herein, the aptamer of the present invention is of any SEQ ID selected from 1 to 32. The conserved motif in all sequences is SGGTRT, wherein S is C or G and R is A, or G. It is noted that in the detailed description of the sequences, the preferred R nucleotide for each sequence is indicated.

[0224] In an embodiment, which can be present together with one or more of any other embodiment disclosed herein, one or more nucleotides of the aptamer of the present invention are chemically modified.

[0225] Possible chemical modifications of one or more nucleotides of the aptamer of the present invention include modifications in the nucleobase, backbone, or sugar moieties. Preferably, the chemical modifications are aimed at improving resistance to nuclease degradation, thereby enhancing stability in biological environments, as well as at improving binding affinity and specificity to the alpha7 / beta1 integrin dimer, and at enabling additional functionalities such as conjugation with therapeutic molecules or imaging agents.

[0226] Modifications in the nucleobase can be of different types and purposes, such as for structural studies, such as halogenated derivatives. Also, the modifications can introduce new functional groups, which, according to the present invention can be fluorescent or chromophore tags, facilitating detection in imaging or biosensing applications, biotin or other affinity tags, which aid in purification or immobilization on solid surfaces, polyethylene glycol (PEG) functionalization, thereby adding hydrophilicity and reducing immunogenicity; mirror-image aptamers made of D-nucleotides, called Spiegelmers, which are resistant to nuclease degradation and enzymatic modification, Aptamer Conjugation with drugs or nanostructures as nanoparticles; structural modifications such as g-quadruplex structures, which have enhanced stability and binding affinity; aptamer truncation or optimization. Also, through nucleobase modification other molecules can be incorporated or conjugated, such as non-natural nucleotides, high molecular weight non-immunogenic compounds, lipophilic compounds, sugars, another oligonucleotide such as siRNAs, antisense oligonucleotides, ribozymes and DNA / RNA chimeras.

[0227] Nucleotide Backbone Modifications, according to the present invention, can be phosphorothioates, by replacing the non-bridging oxygen with sulfur, which increases the resistance to exonuclease degradation, Peptide nucleic acids (PNAs), which are synthetic DNA analogs with a peptide backbone, which enhances stability and binding affinity, or XNA, containing a boron-nucleotide, improving target binding affinity.

[0228] Modification in the sugar can be 2'-O-methyl (2'-0Me) or 2'-fluoro (2'-F) modifications, which increase nuclease resistance, improving aptamer stability in biological environments, locked nucleic acids (LNA) modifications, which enhance binding affinity and nuclease resistance,

[0229] Further object of the present invention is a conjugate comprising an aptamer according to the present invention and a therapeutically active principle or molecule or a diagnostic molecule or an imaging oligonucleotide.

[0230] In an embodiment, which can be present together with one or more of any other embodiment disclosed herein, said therapeutically active principle or molecule is a small molecule drug, a biomolecule, such as miRNA, siRNA, ASO, peptide, protein, DNA, RNA, mRNA or a sugar.

[0231] Advantageously, the therapeutically active principle or molecule can be a miRNA, such as miR-206.

[0232] In an embodiment, diagnostic molecules are selected from fluorophores, chromophores, biotin-streptavidin, radionuclide. Preferably, said fluorophores are Cy3, Cy3.5, Cy5, Cy5.5, Cy7 or related thereto, such as, e.g. Alexa Fluor 594, Alexa Fluor 633 or Alexa Fluor 680.

[0233] Object of the present invention is also a conjugate comprising an aptamer according to any of the embodiments disclosed herein, and a nano or microstructure, nanoparticles, such asquantum dots, lipid nanoparticles, protein nanoparticles, gold nanoparticles. In particular, the conjugate of the present invention is an aptamer-nanostructure conjugate. In a preferred embodiment, said nanoparticle is a gold nanoparticle.

[0234] The conjugation of the aptamer with gold nanoparticles enhances its therapeutic and diagnostic applications as the nanoparticles protect the aptamers from enzymatic degradation, provide a multifunctional platform for simultaneous targeting and delivery of therapeutic molecules, such as microRNAs (e.g., miR-206). Moreover, the specific functionalization of nanoparticles with the aptamers of the invention is unique in targeting the alpha7 / beta1 integrin dimer in both muscle fibers and progenitor cells.

[0235] In an embodiment, which can be present together with one or more of any other embodiment disclosed herein, said aptamer-gold nanoparticles conjugate shows a peak of absorbance from 480 to 560 nm, preferably from 500 to 550 nm, measured by UV-Vis spectrophtometry. In another embodiment, which can be present together with one or more of any other embodiment disclosed herein, said aptamer-gold nanoparticles conjugate have a diameter from 10 to 200 nm. This size allows the conjugate to evade renal clearance and enhance tissue targeting.

[0236] Preferably, said nanoparticle is a nanorod or a spherical nanoparticle.

[0237] In an embodiment, which can be present together with one or more of any other embodiment disclosed herein, the conjugate, according to the present invention, further comprises a therapeutically active principle or molecule or a diagnostic molecule as defined above or an imaging oligonucleotide.

[0238] In an embodiment, which can be present together with one or more of any other embodiment disclosed herein, said therapeutically active principle or molecule is a drug, small molecule drug, a biomolecule, such as a miRNA, a siRNA, ASO, or a peptide, DNA, RNA, mRNA, protein or sugar.

[0239] Advantageously, the therapeutically active principle or molecule can be a miRNA, such as miR-206.

[0240] In an embodiment, diagnostic molecules are selected from fluorophores, chromophores, biotin-streptavidin, radionuclide. Preferably, said fluorophores are Cy3, Cy3.5, Cy5, Cy5.5, Cy7 or related thereto, such as, e.g. Alexa Fluor 594, Alexa Fluor 633 or Alexa Fluor 680.

[0241] The data provided in the experimental section reported below, demonstrate that functionalized gold nanoparticles (AuNPs) conjugated to the aptamer of the invention and miR-206 efficiently target skeletal muscle cells ex vivo and increase their differentiation potential. When tested in vivo, the functionalized gold nanoparticles (AuNPs) conjugated to the aptamer of the invention and miR-206 increased the levels of the miRNA in skeletal muscle tissue when injected in the tail vein, including the highly inaccessible diaphragm (Figure 6A and 6B) and in particular in satellite cells, but not in other muscle-resident populations such as FAPs or macrophages (Fig. 6C). Surprisingly, treatment with control AuNPs conjugated with the aptamer of the invention also partially stimulated miR-206 expression in skeletal muscle and satellite cells (Fig. 6Aand 6C). Moreover, immunofluorescence analysis of skeletal muscle regeneration in mdx mice showed that intra-venous delivery of the conjugate of AuNPs and the aptamer of the invention, conjugated to miR206, induced a significant increase in the number of regenerating eMyHC-positive fibres as compared to PBS-treated animals and mice injected with control aptamer-AuNPs (Figure 6D-E). In summary, the inventors developed a novel muscle-targeting molecule that can be used for selective delivery into skeletal muscle tissue, including muscle satellite cells via systemic delivery Such platform was successfully used to deliver miRNAs mimics (miR206) into skeletal muscles and to improve regeneration in a mouse model of Duchenne Muscular Dystrophy.

[0242] Gold nanoparticles (AuNPs), according to the present invention, can be synthesized according to the methods known to skilled persons. Preferably, AuNPs are synthesized following the Turkevich method. Briefly, in such method, a solution of hydrogen tetrachloroaurate (III) hydrate in RNAse-free water is stirred and heated under reflux until boiling. Then, a solution of sodium citrate tribasic is added, and the mixture is stirred. Afterwards, the solution is allowed to reach room temperature, and then the as- synthetized AuNPs are first filtered through a fritted filter, followed by a second filtration through a PES filter. AuNPs can be functionalized with different oligonucleotides such as microRNAs, imaging oligonucleotides (ie. oligo dT-cy5) and / or aptamers. These oligonucleotides were dsRNA or ssDNA with the pass strand modified with a thiol group linker. A general protocol for the formulation of functionalized AuNPs is as follows. First, the thiol group from the oligonucleotide is deprotected by incubating them with an excess of tris(2-carboxyethyl) phosphine hydrochloride at room temperature. Then, the oligonucleotides are added to the AuNP solution, vortexed, and shaken. After that, a NaCI solution is sequentially added every 20-30 min until a final concentration of 0.3M is reached. Of note, the nanoparticles need to be quickly vortexed after each salt addition to avoid aggregation. Afterward, the nanoparticles are shaken overnight and subsequently centrifuged and washed multiple times with water. Finally, the nanoparticles are redispersed in RNA-free water and stored in the fridge until used.

[0243] Objects of the present invention are also nanoformulations functionalised or loaded with the aptamer as defined in the present invention, or with the conjugate of the present invention.

[0244] Another object of the present invention is a composition comprising an aptamer of the invention or any conjugate of the invention or the nanoformulations of the invention according to any of the embodiments disclosed herein, and a carrier or excipient.

[0245] Further object of the present invention is a pharmaceutical composition comprising an aptamer of the invention or any conjugate of the invention or the nanoformulations of the invention according to any of the embodiments disclosed herein, and a pharmaceutically acceptable carrier and / or excipient.

[0246] The composition and pharmaceutical compositions can be in the form of injectable compositions or the form of compositions for topic administration. These compositions may comprise one or more pharmaceutically acceptable carriers, diluents and / or excipients. The compositions can be in any form deemed appropriate by the skilled person, such as solid, semi-solid, liquid, granular, and all suitable forms known to the skilled person.

[0247] The liquid forms may be appropriate forms for systemic administration.

[0248] Generally, a liquid formulation consists of a suspension or solution of the compounds mentioned above in one or more pharmaceutically liquid-suitable vehicles, such as an aqueous solvent such as water, ethanol or glycerine, or a non-aqueous solvent, such as polyethylene glycol or oil. The formulation may also contain a suspending agent, preservative, flavouring and / or dye.

[0249] Compositions suitable for parenteral administration may include sterile aqueous or nonaqueous solution for injection which may contain antioxidants, buffers, bacteriostatic and solutes which render the solution isotonic with the blood of the intended recipient, and aqueous or non-aqueous sterile suspensions which may include suspending and thickening agents.

[0250] A parenteral composition may include a solution or suspension of the compounds in a vehicle such as sterile water or a parenterally acceptable oil. Alternatively, the solution can be lyophilised; the lyophilised parenteral pharmaceutical composition can be reconstituted with a suitable solvent just prior to administration.

[0251] The formulations may be presented in single dose or multi-dose containers, for example, sealed ampoules or vials, and may be stored in lyophilised condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from powders, granules, lyophilized and sterile compresses.

[0252] In the case of parenteral administration, the composition may also be provided with the active ingredients in separate containers that can be suitably admixed according to the desired dosage taking into account the weight, age, gender and health status of the patient in need thereof.

[0253] In an embodiment, the aptamer or the conjugate or the nanoformulations or the pharmaceutical composition of the present invention are for use as a medicament.

[0254] The use as a medicament is experimentally validated with the experiments showing increased regeneration upon delivery of alpha7 / beta1 aptamer conjugated nanoparticles containing a therapeutic molecule, microRNA-206 (Figure 5-6), without eliciting an immunogenic response in the tissue (Figure 7). In the same conditions, increased muscle strength is also confirmed by functional data (Figure 8). In a preferred embodiment, the aptamer or the conjugate or the nanoformulations or the pharmaceutical composition according to the present invention are for use in the treatment of muscular diseases or of diseases in which at least a population of diseased cells aberrantly express the alpha7 / beta1 integrin dimers. In particular, said muscular diseases are muscular dystrophies and neuromuscular diseases Duchenne Muscular Dystrophy (DMD), Becker Muscular Dystrophy (BMD), Myotonic Dystrophy, Congenital muscular dystrophies (CMD), Distal Muscular Dystrophy, Emery-Dreifuss muscular dystrophy (EDMD), Facioscapulohumeral muscular dystrophy (FSHD), Limb-girdle muscular dystrophies (LGMDs), Oculopharyngeal muscular dystrophy (OPMD), Bethlem Myopathy, Ulrich Congenial Muscular Dystrophy, idiopathic inflammatory myositis (IIM), Dermatomyositis (DM), Polymyositis (PM), Anti-Synthetase Antibody Syndrome (aSS), Spinal Muscular Atrophy (SMA), Amyotrophic lateral sclerosis (SLA), Charcot Marie Tooth, cancer-induced cachexia, muscular atrophy, sarcopenia and wherein said diseases in which at least a population of diseased cells aberrantly express the alpha7 / beta1 integrin dimers are tumours.

[0255] Preferably, said tumour is a tumour of neuroectodermal origin, a mesenchymal tumour, an epithelial tumour, a tumour showing a epithelial-mesenchymal transition, a CNS tumour selected from primary brain tumours or lower grade brain tumours, Head / Neck (Oral, Nasopharyngeal) tumour, digestive system tumours, respiratory system tumours, bone tumours, skin tumours, blood tumours, urogenital tumours, nervous system tumours, endocrine system tumours, sarcomas and gynaecological cancers, primary brain tumours lower grade brain tumours, glioblastoma, glioblastoma multiforme, astrocytoma grade IV, glioma, astrocytomas grade l-lll, cerebral meningiomas, pituitary adenomas, non-small cell lung cancer (NSCLC) including lung adenocarcinoma, lung squamous cell carcinoma and lung large cell carcinoma., colon carcinoma, breast carcinoma, all types of melanoma, all types of ovarian cancer and sarcomas, Ewing's sarcoma and osteosarcoma, soft tissue sarcomas leiomyosarcoma, rhabdomyosarcoma.

[0256] Cytofluorimetry experiments demonstrate that the aptamer of the invention effectively binds tumour cells, in particular glioblastoma and rhabdomyosarcoma (Figure 1 E).

[0257] Another object of the present invention is the use of the aptamers, or of the conjugate, or of the composition according to the present invention, in the detection of skeletal muscle fibers, satellite cells, cells aberrantly expressing the alpha7 / beta1 integrin dimers including cancer cells. In particular, the use in the detection of skeletal muscle fibers, satellite cells, cells aberrantly expressing the alpha7 / beta1 integrin dimers including cancer cells is an in vitro or ex vivo use.

[0258] In another aspect, the present invention relates to an in vitro method for detecting alpha7 / beta1 integrin dimers, the method comprising the step of detecting the binding of an aptamer or of the conjugate as defined in the present invention to a cell, tissue or sample obtained from a subject. In an embodiment, said subject is a subject suffering from muscular diseases or of diseases in which at least a population of diseased cells aberrantly express the the alpha7 / beta1 integrin dimers. In particular, said muscular diseases are muscular dystrophies and neuromuscular diseases, Duchenne Muscular Dystrophy (DMD), Becker Muscular Dystrophy (BMD), Myotonic Dystrophy, Congenital muscular dystrophies (CMD), Distal Muscular Dystrophy, Emery-Dreifuss muscular dystrophy (EDMD), Facioscapulohumeral muscular dystrophy (FSHD), Limb-girdle muscular dystrophies (LGMDs), Oculopharyngeal muscular dystrophy (OPMD), Bethlem Myopathy, Ulrich Congenial Muscular Dystrophy, idiopathic inflammatory myositis (IIM), Dermatomyositis (DM), Polymyositis (PM), Anti-Synthetase Antibody Syndrome (aSS), Spinal Muscular Atrophy (SMA), Amyotrophic lateral sclerosis (SLA), Charcot Marie Tooth, cancer-induced cachexia, muscular atrophy, sarcopenia and wherein said diseases in which at least a population of diseased cells aberrantly express the alpha7 / beta1 integrin dimers are tumours.

[0259] Preferably, said tumour is a tumour of neuroectodermal origin, a mesenchymal tumour, an epithelial tumour, a tumour showing a epithelial-mesenchymal transition, a CNS tumour selected from primary brain tumours or lower grade brain tumours, Head / Neck (Oral, Nasopharyngeal) tumour, digestive system tumours, respiratory system tumours, bone tumours, skin tumours, blood tumours, urogenital tumours, nervous system tumours, endocrine system tumours, sarcomas and gynaecological cancers, primary brain tumours lower grade brain tumours, glioblastoma, glioblastoma multiforme, astrocytoma grade IV, glioma, astrocytomas grade l-lll, cerebral meningiomas, pituitary adenomas, non small cell lung cancer (NSCLC) including lung adenocarcinoma, lung squamous cell carcinoma and lung large cell carcinoma, colon carcinoma, breast carcinoma, all types of melanoma, all types of ovarian cancer and sarcomas, Ewing's sarcoma and osteosarcoma, soft tissue sarcomas leiomyosarcoma, rhabdomyosarcoma.

[0260] In a preferred embodiment said cells obtained from a subject are skeletal muscle fiber cells, satellite cells, rhabdomyosarcoma cells, or glioblastoma cancer stem cells. Further object of the present invention is a kit comprising the aptamer according to the present invention, and a conjugable therapeutically active principle or molecule or a diagnostic molecule or an imaging oligonucleotide. The therapeutically active principle or molecule or a diagnostic molecule or an imaging oligonucleotide can be conjugated with the aptamer of the invention.

[0261] In an embodiment, which can be present together with one or more of any other embodiment disclosed herein, said conjugable therapeutically active principle or molecule is a drug, small molecule drug, a biomolecule , such as a miRNA, a siRNA, ASO, or a peptide, protein, DNA, RNA, mRNA, or sugar.

[0262] Advantageously, the conjugable therapeutically active principle or molecule can be a miRNA, such as miR-206.

[0263] In an embodiment, conjugable diagnostic molecules are selected from fluorophores, chromophores, biotin-streptavidin, radionuclide. Preferably, said conjugable fluorophores are Cy3, Cy3.5, Cy5, Cy5.5, Cy7 or related thereto, such as, e.g. Alexa Fluor 594, Alexa Fluor 633 or Alexa Fluor 680.

[0264] The present invention also relates to a kit comprising the aptamer according to the present invention or a conjugate of the present invention or a nanoformulation according to the present invention, and one or more reagent.

[0265] In any part of the description and of the claims the term comprising can be substituted by the term consisting of.

[0266] In compliance with Art. 170bis paragraph 2 C.P.I and in accordance with Art. 21 paragraph 2 of the Implementation Regulation of the C.P.I. adopted with Ministerial Decree 13.1.2010 n.33, it is declared that: the material of Animal / vegetal origin at the basis of the invention, which is the subject of the aforementioned application are D2.B10-Drndmdx / J (mdx) mice provided by Jackson Laboratory (Bar Harbor, ME, USA).

[0267] In compliance with Art. 170bis paragraph 4 C.P.I, it is declared that: with reference to the biological material, containing microorganisms or genetically modified organisms, object or used in this application, the obligations deriving from the national or community regulations have been respected, and in particular, from the provisions referred to in paragraph 6 of the legislative decree of 12 April 2001 n. 206 and 8 July 2003 n. 224, regarding such changes. EXAMPLES

[0268] To develop the alpha7 / beta1 aptamer a Systematic Evolution of Ligands by Exponential Enrichment (SELEX) was performed from a library of 1014of DNA sequences. Briefly, cross-over SELEX was performed sequentially against His-tagged alpha7 / beta1 integrin recombinant protein and C2C12 muscle cells (Figure 1A) as described previously (Fellows et al. 2020). After 14 rounds of selection, the pools eluted from each round were sequenced and after Next Generation Sequencing analyses, 8 aptamer candidates were selected based on the presence of a common SGGTRT motif (where S can be either G or C and R can be any purine base A or G) (Table 1 , sequences NM3, NM4, NM5, NM6, NM7, NM8, NM13 and NM15). Their binding properties were further investigated by Surface Plasmon Resonance (SPR) against recombinant His. tagged alpha7 / beta1 integrin (Figure 1B).

[0269] Table 1 - Sequence and Kd of the aptamer candidates obtained from SPR

[0270] The most efficient binder, SEQ ID NO 29, was further truncated to obtain SEQ ID NO 32, with a Kd of around 40 nM (Figure 1C). The ability of NM15.2 (SEQ ID NO. 32) to recognize C2C12, cells was then investigated by cytofluorimetry, using an Alexa-594 labelled aptamer as a probe. The results shown in Figure 1D demonstrate that over 85% of C2C12 cells are labelled with the alpha7 / beta1 aptamer. In addition, results shown in Figure 1 E demonstrate that the aptamer labels also Rh30 rhabdomyosarcoma cells and BTSC3 glioblastoma cancer stem cells, but not HEK293 cells.

[0271] The specificity of SEQ ID NO 32, hereinafter alpha7 / beta1 aptamer, towards skeletal muscle fibres and satellite cells was assessed using Alexa-594 5’ end labelled oligonucleotides. Flow cytofluorimetry experiments using CD31 , CD45, CD11 b and Seal antibodies and labelled alpha7 / beta1 aptamer confirmed the specificity of NM15.2 towards a muscle-resident population defined as hematopoietic (CD31 , CD45, CD11b)- negative and Seal-negative, and corresponding to satellite cells. A scramble oligonucleotide probe containing the same nucleotide composition was used as a negative control (Figure 2A-B). Finally, staining on transversal sections of Tibialis Anterior (TA) muscles from dystrophic mice with the Alexa-594 NM15.2 aptamer showed the localization of the alpha7 / beta1 integrin dimers on the muscle fibres membrane, as expected (Vachon et al. 1997; Sarathy et al. 2017) (Figure 2C). Altogether, these results indicate that alpha7 / beta1 aptamer efficiently recognizes both skeletal muscle fibers and satellite cells.

[0272] The potential use of the alpha7 / beta1 aptamer was assessed as a targeting molecule able to deliver therapeutic molecules specifically into skeletal muscles. To this end the alpha7 / beta1 aptamer was conjugated to gold nanoparticles (AuNPs) containing different therapeutic molecules. As a proof of principle, it is described the use of aptamer- conjugated AuNP for the delivery of a type of nucleic acid therapeutics (NATs) called microRNAs.

[0273] AuNPs were first synthetized through the Turkevich method, yielding spherical nanoparticles with a size of ca. 15 nm (Figure 3A). Then, the aptamer and the thiol- containing microRNAs mimics were added to the AuNPs, which were further salt-aged to improve the packing of the nucleic acids. The successful coating was verified by the lack of changes in the absorbance spectrum, showing all of them a maximum at 520 nm, typical of this kind of nanomaterials (Figure 3B). The colloidal stability of the different nanoparticles was evaluated using Nanoparticle Tracking Analysis (NTA), which demonstrated that the hydrodynamic size of the different carriers remained essentially constant regardless of the nucleic acid employed (ca. 30-40 nm, Figure 3C). The small differences found might be ascribed to the particular composition of each nucleic acid. In consequence, these nanoparticles present an appropriate size to be systemically administered as drug delivery systems (>10 nm to avoid renal clearance and <200 nm to reduce immune response). The z-potential was measured in a Zeta Sizer Nano-ZS (Malvern Instruments). The nanoparticles were diluted in water at 1 nM, and the measurement was done I a z-potential cell (Malvern Instruments) at 25 C (Figure 2D).

[0274] After a complete physic-chemical characterization, the alpha7 / beta1 AuNPs were tested in a cellular model of murine myoblasts, the C2C12 cell line. To assess for oligonucleotide incorporation, the alpha7 / beta1 AuNPs containing a fluorescent oligonucleotide (oligo dT-cy5) have been used. Results depicted in Figure 4A-B show that over 95% of C2C12 cells incorporate oligo dT-cy5, which remains mostly cytoplasmatic. Then, to investigate the ability of our nanoformulation to release functional miRNAs a luciferase reporter assay has been used. Briefly, C2C12 cells were stably transfected with a luciferase reporter containing the miR-206 seed sequencing in the 3’ UTR. As shown in Figure 4C, AuNPs containing miR-206 efficiently release a functional miR-206, able to repress the luciferase reporter. The efficiency mimics the one obtained when miR-206 was transfected using lipofectamine. To investigate if functionalized AuNPs can deliver a functional miRNA in dystrophic satellite cells, hematopoietic lineage (CD31 , CD45, CD11b)-negative, Seal-negative, alpha7 integrin-positive satellite cells have been isolated from dystrophic DBA2 mdx mice by fluorescence-activated cell sorting (FACS) and treated ex vivo with control or miR-206 containing AuNPs. Previous works demonstrated that over-expression of miR-206 in satellite cells stimulates muscle differentiation (Chen et al. 2006). Consistently, it is here observed that AuNPs-mir206 increases the fusion of satellite cells cultured in proliferation medium, over untreated cells and control AuNPs (AuNPs-oligo dT) (Figure 4D-E). Interestingly, treatment with AuNPs containing oligo dT partially stimulates the differentiation of isolated satellite cells, even in the absence of miR-206. This is demonstrated by the increase in the number of MyHC-positive cells (Figure 4D-E). Interestingly, an increase was observed in the number of DAPI-positive nuclei upon incubation with both control and miR-206 containing AuNPs (Figure 4F). These results are in agreement with previously published work using gold / silver (Au / Ag) NPs (Ge et al. 2018), suggesting inorganic NPs modulate both the activation and differentiation potential of satellite cells. Altogether, these data demonstrate that functionalized AuNPs containing alpha7 / beta1 aptamer and miR-206 efficiently target skeletal muscle cells ex vivo and increase their differentiation potential. The delivery of functionalized AuNPs into dystrophic muscles by local (intra-muscular) injection has also been tested. TA muscles of 8-weeks old DBA2 mdx mice (a mouse model of Duchenne Muscular Dystrophy) were injected with 20 ml of AuNPs-miR-206 (0,3mg / kg of miR-206), once a week for three weeks (Figure 5A). After sacrifice, histological analysis was performed to assess AuNPs delivery (Figure 5B), miR-206 levels (figure 5C-D), skeletal muscle regeneration (Figure 5E-F), and fibrotic deposition (Figure 5G-H). Local delivery into TA muscles induced a strong increase in the number of regenerating embryonic MyHC (eMyHC)-positive fibers as compared to PBS-treated animals and mice injected with control AuNPs (figure 5E-F). This correlates with an increase of miR-206 in treated muscles, as compared to mice treated with PBS / AuNPs (Figure 5C-D). However, miR-206 delivery did not change fibrotic deposition (figure 5E- F), indicating a specific effect of the treatment exclusively on muscle fibers and / or satellite cells.

[0275] Finally, the effect on skeletal muscle regeneration after systemic delivery of functionalized AuNPs containing miR-206 in dystrophic mice has been investigated. To this end, 8-weeks old mdx mice have been injected intravenously with 50 ul of aptamer- conjugated AuNPs, once a week for three weeks. It was first confirmed that alpha7 / beta1 aptamer conjugated AuNPs efficiently target skeletal muscles by qRT-PCR experiments. The results show an increase in miR-206 levels in quadriceps (Figure 6A) and diaphragm (Figure 6B) isolated from control or a7 / b1 AuNP miR-206 treated mice. In addition, it was investigated if once in the skeletal muscle tissue a7 / b1 AuNPs are able to selectively target the satellite cells compartment. To this end, different muscle-resident cell populations by FACS were isolated. In particular, satellite cells (CD31 , CD45, CD11b)-negative, Seal-negative, alpha7 integrin-positive cells), FAPs (CD31 , CD45, CD11b)-negative, Seal-positive, alpha7 integrin-negative cells) and macrophages (CD31 , CD45, CD11b)-positive, F4 / 80-positive cells) were sorted and qRT-PCR was performed to investigate miR-206 levels after treatment with PBS, a7 / b1 AuNPs oligodT or a7 / b1 AuNPs miR-206 (Figure 6C). The data demonstrate that treatment with a7 / b1 AuNPs miR-206, increased the levels of the therapeutic miRNA only in satellite cells, but not in other muscle-resident populations such as FAPs or macrophages (Figure 6C). Interestingly, treatment with control AuNPs also partially stimulated miR-206 expression in skeletal muscle (Figure 6A) and satellite cells (Figure 6C), probably due to the intrinsic ability of AuNP to muscle cells as observed ex vivo (Figure 3C-E). Finally, it was investigated if treatment with alpha7 / beta1 AuNPs-miR206 modulates skeletal muscle regeneration or fibrotic deposition after systemic delivery. Immunofluorescence analysis of skeletal muscle regeneration in mdx mice showed that intra-venous delivery of alpha7 / beta1 AuNPs-miR206 induced a significant increase in the number of regenerating eMyHC-positive fibres as compared to PBS-treated animals and mice injected with control AuNPs (Figure 6D-E). Moreover, it was not observed any changes in the amount of fibrotic deposition after treatment, as shown by Syrius red staining (Figure 6F-G). This is consistent with a selective effect of the treatment towards the skeletal muscle lineage. Finally, it was investigated if treatment with alpha7 / beta1 AuNPs-miR206 altered the inflammatory infiltrate in dystrophic muscles. Flow cytometry and immunofluorescence analysis show that treatment with either alpha7 / beta1 AuNPs- miR206 or control AuNPs did not modulate the number of hematopoietic cells recruited resident in dystrophic muscles (Figure 7A_B), nor the percentage of tissue resident macrophages (Figure 7C-7F) suggesting the treatment does not elucidate an immunogenic response within the target tissue. Finally, a positive effect on muscle strength was observed in mice treated with alpha7 / beta1 AuNPs miR-206, as compared to controls (Figure 8).

[0276] In summary, the inventors developed a novel muscle-targeting molecule that can be used for selective delivery into skeletal muscle tissue, including muscle satellite cells. Such platform was successfully used to deliver miRNAs mimics (miR206) into skeletal muscles and to improve muscle regeneration and function in a mouse model of Duchenne Muscular Dystrophy.

[0277] SELEX protocol

[0278] Cross-over SELEX with random region of 40 de-oxyribo nucleotides (A,T,G,C) was carried out. DNA aptamer library containing approximately 1014random oligonucleotides were considered as a starting pool for this SELEX. The sequence of aptamer library is : 5’ GCCTGTTGTGAGCCTCCTGTCGAA (SEQ ID NO 34) -N40-

[0279] TTGAGCGTTTATTCTTGTCTCCC 3’ (SEQ ID NO35) and forward primer (SEQ ID NO 34) 5’- GCC TGT TGT GAG CCT CCT GTC GAA -3’ and reverse primer (SEQ ID NO 36) 5’- GGGAGACAAGAATAAACGCTCAA -3’ to amplify eluted pools after each round. It was started with 500 picomoles of aptamer library and 10 picomoles of recombinant histidine tagged alpha7 beta 1 integrin (R&D Systems, catalog number: 7958-A7) which was immobilized on Ni-NTA beads. His-GST tagged protein was used as a counter selection in each protein-SELEX round. After initial 4 rounds of protein SELEX, it was moved to cell SELEX (4 rounds) where around 7.5x106C2C12 muscle cells were used. Protein and cell SELEX were alternated for a total of 14 rounds. As the rounds proceeded, selection pressure was introduced by varying the pool and target ratio and more stringent washing condition. After 14 rounds of evolution process, each pool was sequenced by high throughput sequencing NGS. It was obtained 89% to 95% of the pool, which are sequences with 40 nucleotides (random region). After MAFFT analyses (multiple sequence alignment) it was found the top 10 clusters correspond to 26% of the total sequences and good evolution pattern was observed. After motif analyses and secondary structure analyses 8 sequences were selected for further binding studies, based on the presence of a common motif, SGGTRT (where S can be C or G and R can be A or G).

[0280] Surface Plasmon Resonance

[0281] Surface Plasmon Resonance (SPR) assay was performed to assess the binding affinity of the aptamer sequences to alpha7 / beta1 integrin recombinant protein. Typically, biotinylated aptamer candidates were immobilized onto the streptavidin chip (CM5) and analysed by Biacore 3000 (GE Healthcare). In this assay, the association and dissociation rate constants of the aptamer-protein complex were also evaluated. Initially, 10 pM of biotinylated aptamers were immobilized and 3.3 pM of protein was injected. After the initial screening of several candidates, the saturation studies of the best binding aptamer sequence were performed. To further investigate, the best candidate was truncated, and measured the binding constant of the truncated candidate.

[0282] Staining of cryosections and isolated myofibres with labelled alpha? / betal aptamer

[0283] The alpha7 / beta1 aptamer can be labelled with different fluorophores as diagnostic molecules (figure 2 shows an example with Alexa 594-labelled aptamer). To fold alpha? / betal aptamer for the staining applications, the oligonucleotide is heated at 90°C for 3 minutes in a solution containing 5mM magnesium acetate and then cooled down in ice for 5 minutes.

[0284] Cryosections are fixed in PFA 4% and permeabilized with 100% methanol at - 20 °C for 6 minutes. Single myofibres are fixed in PFA 4% and permeabilized in 0,1 % Triton-X 100 (#T8787) for 20 minutes at room temperature. Cryosections and myofibres are blocked for 1 h with a solution containing 4% BSA and 0,1mg / ml salmon sperm DNA (#AM9680- Thermo fisher).

[0285] Finally, cryosections and myofibres are incubated with 100nM of folded alpha7 / beta aptamer or scramble aptamer for 1h at 4°C and washed for three times in PBS. Nuclei were counterstained with DAPI. Images were acquired with fluorescent microscope and by four-laser Leica confocal microscopy (Microsystems, Concord, ON, Canada) integrated with image capture system and analytical software. The protocol is compatible with antibody co-staining (Figure 2).

[0286] Staining of cells with labelled alpha? / betal aptamer for cytofluorimetry and FACS isolation protocols

[0287] The protocol has been optimized for the staining of cell lines and muscle satellite cells isolated from murine hindlimb muscles. For cell lines, cells are first trypsinized while for satellite cells labelling hindlimb muscles are first digested in PBS containing Mg and Ca (# 14040133, Gibco) with 2pg / ml Collagenase A (Roche) and 2,4 U / rnL Dispase I (Roche) and incubated at 37°C for 40 minutes.

[0288] Cells are then blocked in either PBS or HBSS buffer containing 10% goat serum and 1 mg / ml yeast RNA and incubated with alpha7 / beta1 aptamer conjugated with a fluorophore at a concentration of 100 nM. alpha7 / beta1 aptamers was previously folded by heating it at 90°C for 3 minutes in a solution containing 5mM magnesium acetate and then cooled down in ice for 5 minutes.

[0289] The protocol is compatible with antibody co-staining (Figure 2).

[0290] AuNPs synthesis and functionalization with the alpha7 / beta1 aptamer and therapeutic oligonucleotides

[0291] AuNPs are synthesized following the Turkevich method. Briefly, a solution of 945.2 pM hydrogen tetrachloroaurate (III) hydrate in RNAse free water is stirred and heated at 140°C under reflux until boiling. Then, a solution of 40 mM sodium citrate tribasic is added, and the mixture is stirred for 15 minutes. Afterwards, the solution is allowed to reach room temperature, and then the as-synthetized AuNPs are first filtered through a 0.3 pm fritted filter, followed by a second filtration through a 0.22 pM PES filter. AuNPs concentration is calculated using the Beer-Lambert law from the value of absorbance at 520 nm, and employing an extinction coefficient of 2.7 x 108for 13 nm nanoparticles (Prigodich et al. 2009).

[0292] AuNPs can be functionalized with different oligonucleotides such as microRNAs, imaging oligonucleotides (oligo dT-cy5) and / or aptamers. These oligonucleotides were dsRNA or ssDNA with the pass strand modified with a thiol group linker. A general protocol for the formulation of SNA is as follows. First, the thiol group from the oligonucleotide is deprotected by incubating them with an excess of tris(2-carboxyethyl) phosphine hydrochloride (100 eq) for 2h at room temperature. Then, the oligonucleotides are added to the AuNP solution, vortexed and shaken for 20 min. After that, a 5M NaCI solution is sequentially added every 20-30 min until a final concentration of 0.3M is reached. Of note, the nanoparticles need to be quickly vortexed after each salt addition to avoid aggregation. Afterward, the nanoparticles are shaken overnight and subsequently centrifuged and washed 3 times with water. The oligonucleotide loading is calculated from the supernatant of the first centrifugation. Finally, the nanoparticles are redispersed in RNA-free water and stored in the fridge until used (Milan-Rois et al. 2022). AuNPs oligonucleotide loadings were 2 ± 0.1 pM. The concentration of all groups was adjusted to 33.6 nM and they were filtered with a syringe filter 0.2 pm in a laminar flow hood.

[0293] Protocol for local delivery of aptamer conjugated gold nanoparticles

[0294] The protocol was optimized in D2.B10-Dmdmdx / J (mdx) mice, obtained from the Jackson Laboratory (Bar Harbor, ME, USA).

[0295] Alpha7 / beta1 aptamer conjugated AuNPs are injected by intra-muscle injection in Tibialis anterior muscle. Mice are injected with a maximum volume of 25 pl of resuspended AuNPs. The injection is performed under anesthesia by intraperitoneal injection of 40 mg / kg ketamine (Zoletil®) and 10 mg / kg xylazine (Rampum®). Nanoparticles are delivered at a minimal concentration of 0.4 mg / kg per injection, with injections performed once a week for a total of three weeks. After the treatment mice are sacrificed, and the amount miRNAs can be quantified by RT-PCR or in situ hybridization, as in Figures 5 and 6.

[0296] Protocol for systemic delivery of aptamer conjugated gold nanoparticles

[0297] The protocol was optimized in D2.B10-Dmdmdx / J (mdx) mice, obtained from the Jackson Laboratory (Bar Harbor, ME, USA).

[0298] Alpha7 / beta1 aptamer conjugated AuNPs are injected by intra-venous injection in the lateral tail vein. Briefly, the injection is performed under anesthesia by intraperitoneal injection of 40 mg / kg ketamine (Zoletil®) and 10 mg / kg xylazine (Rampum®). Mice are injected with a maximum volume of150 pl of resuspended AuNPs. Nanoparticles are delivered at a minimal concentration of 0.8 mg / kg per injection, with injections performed once a week for a total of three weeks. After the treatment mice are sacrificed and the amount of miRNAs in the different organs or muscle-resident populations can be quantified by RT-PCR or in situ hybridization, as in Figures 5 and 6.

Claims

CLAIMS1. An aptamer from 30 to 100 nucleotides in length, which comprises at least one conserved motif of SEQ ID NO. 33 and is capable of binding an extra-cellular domain of alpha7 / beta1 integrin dimers.

2. The aptamer according to claim 1 wherein said aptamer from 30 to 100 nucleotides in length or between 40 to 90 nucleotides in length.

3. The aptamer according to anyone of claims 1 to 2, wherein the Kd of the aptamer to an alpha7 / beta1 integrin recombinant protein is less than 2.0*1 O'6or less than 6.0*1 O'7or less than 45*1 O'9when measured by Surface Plasmon Resonance (SPR) analysed by Biacore 3000.

4. The aptamer according to anyone of claims 1 to 3 wherein said aptamer is of a SEQ ID from 1 to 32, preferably SEQ ID NO. 32.

5. The aptamer according to claims 1 to 4, wherein one or more nucleotides are chemically modified.

6. A conjugate comprising of an aptamer according to claims 1 to 5 and therapeutically active principle or molecule or a diagnostic molecule or an imaging oligonucleotide.

7. The conjugate according to claim 6 wherein said therapeutically active principle or molecule is a drug, a small molecule drug, a biomolecule, such as a miRNA, a siRNA, ASO, a peptide, protein, DNA, RNA, mRNA or sugar.

8. A conjugate comprising an aptamer according to claims 1 to 5 and a nanoparticle preferably a gold quantum dot or gold nanoparticle.

9. The conjugate according to claim 8 wherein said nanoparticle is a gold nanorod or a gold spherical nanoparticle.

10. The conjugate according to anyone of claims 8 or 9 further comprising a therapeutically active principle or molecule or a diagnostic molecule or an imaging oligonucleotide.

11. The conjugate according to claim 10 wherein said therapeutically active principle or molecule is a drug, a small molecule drug, a biomolecule, such as a miRNA, a siRNA, ASO,a peptide, protein, DNA, RNA, mRNA or sugar.

12. Nanoformulations functionalised or loaded with the aptamer as defined in claims 1 to5 or with the conjugate according to claims 6 to 11 .

13. A composition comprising an aptamer as defined in claims 1 to 5 or a conjugate as defined in claims 6-11 or a nanoformulation according to claim 12.

14. A pharmaceutical composition comprising an aptamer as defined in claims 1 to 5 or a conjugate as defined in claims 6-11 or the nanoformulations according to claim 12 and a pharmaceutically acceptable carrier.

15. The aptamer according to claims 1 to 5 or the conjugate according to any of claims6 to 11 or the nanoformulations according to claim 12 or the pharmaceutical composition according to claim 14, for use as a medicament.

16. The aptamer or the conjugate or the nanoformulations or the pharmaceutical composition for use according to claim 15 in the treatment of muscular diseases or of diseases in which at least a population of diseased cells aberrantly express the alpha7 / beta1 integrin dimers.

17. The aptamer or the conjugate or the nanoformulations or the pharmaceutical composition for use according to claim 16 wherein said muscular diseases are muscular dystrophies and neuromuscular diseases Duchenne Muscular Dystrophy (DMD), Becker Muscular Dystrophy (BMD), Myotonic Dystrophy, Congenital muscular dystrophies (CMD), Distal Muscular Dystrophy, Emery-Dreifuss muscular dystrophy (EDMD), Facioscapulohumeral muscular dystrophy (FSHD), Limb-girdle muscular dystrophies (LGMDs), Oculopharyngeal muscular dystrophy (OPMD), Bethlem Myopathy, Ulrich Congenial Muscular Dystrophy, idiopathic inflammatory myositis (I IM), Dermatomyositis (DM), Polymyositis (PM), Anti-Synthetase Antibody Syndrome (aSS), Spinal MuscularAtrophy (SMA), Amyotrophic lateral sclerosis (SLA), Charcot Marie Tooth, cancer- induced cachexia, muscular atrophy, sarcopenia and wherein said diseases in which at least a population of diseased cells present the alpha7 / beta1 integrin dimers in the cell surface are tumours.

18. The aptamer or the conjugate or the nanoformulations or the pharmaceutical composition for use according to claim 17 wherein said tumour is a tumour of neuroectodermal origin, a mesenchymal tumour, an epithelial tumour, a tumour showing a epithelial-mesenchymal transition, a CNS tumour selected from primary brain tumours or lower grade brain tumours, Head / Neck (Oral, Nasopharyngeal) tumour, digestive system tumours, respiratory system tumours, bone tumours, skin tumours, blood tumours, urogenital tumours, nervous system tumours, endocrine system tumours, sarcomas and gynaecological cancers, primary brain tumours lower grade brain tumours, glioblastoma, glioblastoma multiforme, astrocytoma grade IV, glioma, astrocytomas grade l-lll, cerebral meningiomas, pituitary adenomas, non-small cell lung cancer (NSCLC) including lung adenocarcinoma, lung squamous cell carcinoma and lung large cell carcinoma., colon carcinoma, breast carcinoma, all types of melanoma, all types of ovarian cancer and sarcomas, Ewing's sarcoma and osteosarcoma, soft tissue sarcomas leiomyosarcoma, rhabdomyosarcoma.

19. Use of the aptamers as defined in claims 1 to 5, or of the conjugate as defined in claims 6 to 11 , or the nanoformulation according to claim 12, or of the composition according to claim 13 in the detection of skeletal muscle cells or fibers, satellite cells, cells presenting the alpha7 / beta1 integrin dimers in their cell surface, including cancer cells.

20. An in vitro method for detecting alpha7 / beta1 integrin dimers, the method comprising the step of detecting the binding of an aptamer as defined in any one of claims 1 to 5 or of the conjugate as defined in claims 6 to 11 to a cell, tissue, or biological sample.

21. A kit comprising the aptamer according to any one of claims 1 to 5, and a conjugable therapeutically active principle or molecule or a diagnostic molecule or an imaging oligonucleotide.

22. The kit according to claim 21 , wherein said conjugable therapeutically active principle or molecule is a drug, small molecule drug, a biomolecule, such as a miRNA, a siRNA,ASO,a peptide, protein, DNA, RNA, mRNA or sugar, and said diagnostic molecules are selected from fluorophores, chromophores, biotin-streptavidin, radionuclide, preferably, said fluorophores are Cy3, Cy3.5, Cy5, Cy5.5, Cy7 or related thereto, preferably Alexa Fluor 594, Alexa Fluor 633 or Alexa Fluor 680.

23. A kit comprising the aptamer according to any one of claims 1 to 5 or a conjugate as defined in claims 6-11 or a nanoformulation according to claim 12 and one or more reagent.

Images