Multiple priming for on-support nucleic acid amplification
The method generates compact DNA nanoballs using capture and pinning primers, and RCA to enhance sequencing quality in massively parallel sequencing by maintaining high signal intensity across large library sequences.
Patent Information
- Application Number
- PCT/US2025/022551
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-02
- Filing Date
- 2025-04-01
- Publication Date
- 2025-10-09
AI Technical Summary
Massively parallel sequencing methods face challenges in achieving high sequencing quality across large library sequences due to a decrease in signal intensity, particularly when sequencing the second strand, necessitating improved methods for conducting sequencing runs.
A method involving the generation and sequencing of compact DNA nanoballs immobilized to a support using capture and pinning primers, covalently closed circular polynucleotide molecules, and rolling circle amplification (RCA) to create concatemer template molecules, followed by sequencing these nanoballs to enhance sequencing quality.
The method improves sequencing quality by generating compact DNA nanoballs that maintain high signal intensity, addressing the drop in sequencing quality observed in pairwise sequencing runs.
Smart Images

Figure US2025022551_09102025_PF_FP_ABST
Abstract
Description
MULTIPLE PRIMING FOR ON-SUPPORTNUCLEIC ACID AMPLIFICATIONCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to, and benefit of, U.S. Provisional Application No. 63 / 573,392, filed on April 2, 2024, the contents of which are incorporated by reference in their entirety.INCORPORATION BY REFERENCE OF SEQUENCE LISTING
[0002] The contents of the electronic sequence listing (ELEM_026_001WO_SeqList_ST26.xml; Size: 158,086 bytes; and Date of Creation: March 28, 2025) are herein incorporated by reference in their entireties.TECHNICAL FIELD
[0003] The present disclosure provides compositions, apparatus and methods for generating a plurality of concatemer template molecules immobilized on a support for conducting massively parallel sequencing runs.BACKGROUND
[0004] Massively parallel sequencing methods have applications in biomedical research and healthcare settings as they allow for analyzing large quantities of biological samples. However, when conducting massively parallel sequencing runs, it is challenging to achieve high sequencing quality across the entire length of library sequences of large size, e.g., larger than 200 bases, because the sequencing quality drops in part due to a decrease in signal intensity. Achieving high sequencing quality in pairwise sequencing runs is particularly challenging because the signal intensity can drop precipitously when sequencing the second strand. Thus, there exists a need for improved methods for performing massively parallel sequencing.SUMMARY
[0005] In some aspects, provided herein is a method for generating and sequencing a plurality of compact DNA nanoballs immobilized to a support, comprising: providing a support comprising: a plurality of capture primers immobilized to the support, whereinindividual capture primers comprise a 3’ extendible end; a plurality of pinning primers immobilized to the support, wherein individual pinning primers comprise a 3’ non-extendible end; and a plurality of covalently closed circular polynucleotide molecules, wherein individual covalently closed circular polynucleotide molecules are hybridized to individual capture primers, thereby forming a plurality of immobilized circular molecule-capture primer duplexes; contacting the plurality of immobilized circular molecule-capture primer duplexes with a plurality of soluble amplification primers under a condition suitable for hybridizing at least one soluble amplification primer to an individual immobilized circular molecule-capture primer duplex thereby forming a plurality of immobilized circular molecule-capture primer duplexes; conducting a rolling circle amplification (RCA) reaction on the plurality of immobilized circular molecule-capture primer duplexes of step (b) in the presence of a plurality of compaction oligonucleotides, thereby generating a plurality of compact DNA nanoballs immobilized to the support, wherein individual compact DNA nanoballs comprise (i) a concatemer template molecule generated by RCA-extension of an immobilized capture primer and (ii) at least one concatemer template molecule generated by RCA-extension of a soluble amplification primer, wherein at least a portion of individual compact DNA nanoballs is hybridized to a pinning primer, thereby generating a plurality of compact DNA nanoballs immobilized to the support; removing the plurality of covalently closed circular polynucleotide molecules and retaining the plurality of compact DNA nanoballs; and sequencing the plurality of the compact DNA nanoballs.
[0006] In some embodiments, the support comprises glass, plastic and / or a polymer material. In some embodiments, the support is passivated with at least one hydrophilic polymer coating.
[0007] In some embodiments, the plurality of capture primers and the plurality of pinning primers are covalently joined to the at least one hydrophilic polymer coating. In some embodiments, the at least one hydrophilic polymer coating has a water contact angle of no more than 45 degrees.
[0008] In some embodiments, the plurality of capture primers are immobilized to the support at random locations or immobilized to the support at pre-determined locations.
[0009] In some embodiments, the plurality of pinning primers are immobilized to the support at random locations or immobilized to the support at pre-determined locations.
[0010] In some embodiments, the plurality of capture primers are immobilized to the support at a density of about 102- 1015capture primers per mm2.
[0011] In some embodiments, the plurality of pinning primers are immobilized to the support at a density of about 102- 1015pinning primers per mm2.
[0012] In some embodiments, the support lacks partitions or barriers that separate regions of the support.
[0013] In some embodiments, the plurality of covalently closed circular polynucleotide molecules comprises RNA or DNA, optionally wherein the DNA comprises complementary DNA (cDNA).
[0014] In some embodiments, individual covalently closed circular polynucleotide molecules comprise a sequence of interest that is 200 - 2000 nucleotides in length.
[0015] In some embodiments, individual covalently closed circular polynucleotide molecules comprise a sequence of interest and lack a universal adaptor sequence.
[0016] In some embodiments, individual covalently closed circular polynucleotide molecules comprise a sequence of interest and any one or any combination of two or more of: a universal sequence for binding a pinning primer or a complementary sequence thereof, a universal sequence for binding a capture primer or a complementary sequence thereof, at least one universal sequence for binding a first sequencing primer or a complementary sequence thereof, at least one universal sequence for binding a second sequencing primer or a complementary sequence thereof, at least one universal sequence for binding a soluble amplification primer or a complementary sequence thereof and / or a universal sequence for binding a compaction oligonucleotide or a complementary sequence thereof.
[0017] In some embodiments, individual soluble amplification primers bind to any one or more of: the sequence of interest, the universal sequence for binding a pinning primer or a complementary sequence thereof, the universal sequence for binding a capture primer or a complementary sequence thereof, the universal sequence for binding a first sequencing primer or a complementary sequence thereof, the universal sequence for binding a second sequencing primer or a complementary sequence thereof, the universal sequence for binding a compaction oligonucleotide or a complementary sequence thereof; or a combination thereof.
[0018] In some embodiments, individual covalently closed circular polynucleotide molecules are further hybridized to 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 soluble amplification primers.
[0019] In some embodiments, the at least one soluble amplification primer is hybridized to any one or more of: the sequence of interest, the universal sequence for binding a capture primer or a complementary sequence thereof, the universal sequence for binding a pinning primer or a complementary sequence thereof, the universal sequence for binding a firstsequencing primer, the universal sequence for binding a second sequencing primer, and / or the universal sequence for binding a compaction oligonucleotide or a complementary sequence thereof; or a combination thereof.
[0020] In some embodiments, the RCA reaction comprises contacting the plurality of the immobilized circular molecule-capture primer duplexes with a plurality of strand displacing polymerases, and a plurality of nucleotides.
[0021] In some embodiments, the plurality of nucleotides comprises at least one nucleotide having a scissile moiety that can be cleaved to generate an abasic site in the immobilized compact DNA nanoball. In some embodiments, the at least one nucleotide having a scissile moiety comprises uridine, 8-oxo-7,8-dihydrogunine or deoxyinosine.
[0022] In some embodiments, the plurality of compaction oligonucleotides comprises at least a first and a second compaction oligonucleotide, wherein the first compaction oligonucleotide comprises a first binding region that hybridizes to a first portion of the concatemer template molecule generated, and a second binding region that hybridizes to a second portion of the same concatemer template molecule thereby pulling together distal portions of the concatemer molecule causing compaction of the concatemer template molecule, and the second compaction oligonucleotide comprises a first binding region that hybridizes to a first portion of the concatemer template molecule generated, and a second binding that hybridizes to a second portion of the same concatemer template molecule thereby pulling together distal portions of the concatemer molecule causing compaction of the concatemer template molecule.
[0023] In some embodiments, the first and the second compaction oligonucleotides comprise the same sequence or different sequences.
[0024] In some embodiments, the plurality of compact DNA nanoballs are immobilized to the support at a high density, wherein at least some of the immobilized compact DNA nanoballs comprise nearest neighbor compact DNA nanoballs that touch each other and / or overlap each other when viewed from any angle of the support including above, below or side views of the support.
[0025] In some embodiments, the sequencing comprises contacting individual compact DNA nanoballs with a plurality of sequencing primers, a plurality of sequencing polymerases and a plurality of detectably labeled multivalent molecules, individual detectably labeled multivalent molecules comprising a core and a plurality of nucleotide arms and wherein individual polymer arms comprise at least one nucleotide moiety.
[0026] In some embodiments, the sequencing comprises: binding the concatemer template molecules with a plurality of sequencing primers, a plurality of sequencing polymerases, and a plurality of detectably labeled multivalent molecules, and / or binding the concatemer template molecules with a plurality of sequencing primers, a plurality of sequencing polymerases, and a plurality of detectably labeled multivalent molecules, thereby generating a compact DNA nanoball immobilized to the support that emits a detectable signal.
[0027] In some embodiments, individual detectably labeled multivalent molecules comprise a core; and a plurality of nucleotide arms comprising a core attachment moiety, a spacer, a linker, and a nucleotide moiety, wherein the core is attached to the plurality of nucleotide arms via their core attachment moiety, wherein the core attachment moiety is attached to the spacer, wherein the spacer is attached to the linker, and wherein the linker is attached to the nucleotide moiety.
[0028] In some embodiments, individual nucleotide arms comprise a core attachment moiety, a spacer and a nucleotide moiety, wherein the core is attached to the plurality of nucleotide arms via their core attachment moiety, wherein the core attachment moiety is attached to the spacer, wherein the spacer is attached to the nucleotide moiety.
[0029] In some embodiments, the linker comprises an aliphatic chain having 2-6 subunits or an oligo ethylene glycol chain having 2-6 subunits.
[0030] In some embodiments, the plurality of nucleotide arms attached to an individual core has the same type of nucleotide moiety selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.
[0031] In some embodiments, individual detectably labeled multivalent molecules have the same type of nucleotide moiety selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.
[0032] In some embodiments, the plurality of detectably labeled multivalent molecules comprises a mixture of two or more types of detectably labeled multivalent molecules, individual types of detectably labeled multivalent molecules having nucleotide moieties selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.
[0033] In some embodiments, individual detectably labeled multivalent molecules in the plurality comprise a core attached to a fluorophore, a nucleotide arm attached to a fluorophore, and / or a nucleotide moiety attached to a fluorophore.
[0034] In some embodiments, the sequencing further comprises contacting individual compact DNA nanoballs with a plurality of non-catalytic divalent cations that inhibitpolymerase-catalyzed nucleotide incorporation, wherein the non-catalytic divalent cations comprise strontium, calcium or barium.
[0035] In some embodiments, the sequencing comprises: binding a first sequencing primer, a first sequencing polymerase, and a first multivalent molecule to a first portion of the concatemer template molecule thereby forming a first binding complex, wherein a first nucleotide moiety of the first multivalent molecule binds to the first sequencing polymerase; and binding a second sequencing primer, a second sequencing polymerase, and the first multivalent molecule to a second portion of the same concatemer template molecule thereby forming a second binding complex, wherein a second nucleotide moiety of the first multivalent molecule binds to the second sequencing polymerase, and wherein the first and second binding complexes which include the same multivalent molecule form an avidity complex.
[0036] In some embodiments, the sequencing comprises: contacting different portions of the concatemer template molecule with a first plurality of sequencing polymerases and a first plurality of sequencing primers to form at least a first and a second polymerase complex on the same concatemer template molecule; contacting a plurality of detectably labeled multivalent molecules with the at least first and second polymerase complexes on the same concatemer template molecule to bind a single multivalent molecule to the first and the second polymerase complexes, wherein at least a first nucleotide moiety of the single multivalent molecule is bound to the first polymerase complex thereby forming a first binding complex, and wherein at least a second nucleotide moiety of the single multivalent molecule is bound to the second polymerase complex thereby forming a second binding complex, wherein the contacting is conducted under a condition suitable to inhibit polymerase-catalyzed incorporation of the bound first and second nucleotide moieties in the first and second binding complexes, and wherein the first and second binding complexes which are bound to the same multivalent molecule form an avidity complex; detecting the first and the second binding complexes on the same concatemer template molecule; and identifying the first nucleotide moiety in the first binding complex thereby determining the sequence of the first portion of the concatemer template molecule, and identifying the second nucleotide moiety in the second binding complex thereby determining the sequence of the second portion of the concatemer template molecule.
[0037] In some embodiments, contacting individual compact DNA nanoballs with a plurality of labeled nucleotides comprises: binding the concatemer template molecule of step (c) with a plurality of sequencing primers, a plurality of sequencing polymerases, and aplurality of detectably labeled nucleotides, and binding the concatemer template molecule of step (c) with a plurality of sequencing primers, a plurality of sequencing polymerases, and a plurality of detectably labeled nucleotides, thereby generating a compact DNA nanoball immobilized to the support that emits a detectable signal.
[0038] In some embodiments, individual detectably labeled nucleotides in the plurality comprise an aromatic base, a five-carbon sugar, and 1-10 phosphate groups.
[0039] In some embodiments, the plurality of detectably labeled nucleotides comprises one type of nucleotide selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.
[0040] In some embodiments, the plurality of detectably labeled nucleotides comprises two or more types of nucleotides selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.
[0041] In some embodiments, at least one detectably labeled nucleotide in the plurality is labeled with a fluor ophore.
[0042] In some embodiments, at least one nucleotide in the plurality lacks a fluorophore label.
[0043] In some embodiments, at least one of the detectably labeled nucleotides comprises a removable chain terminating moiety attached to the 3’ carbon position of the sugar group, wherein the removable chain terminating moiety comprises an alkyl group, an alkenyl group, an alkynyl group, an allyl group, an aryl group, a benzyl group, an azide group, an azido group, an O-azidomethyl group, an amine group, an amide group, a keto group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group, an acetal group or a silyl group, and wherein the removable chain terminating moiety is cleavable with a chemical compound to generate an extendible 3 ’OH moiety on the sugar group.
[0044] In some embodiments, the sequencing further comprises contacting individual compact DNA nanoballs with a plurality of catalytic divalent cations that promote polymerase-catalyzed nucleotide incorporation, wherein the catalytic divalent cations comprise magnesium or manganese.
[0045] In another aspect, provided herein is method for generating a plurality of compact DNA nanoballs, comprising: providing a support comprising: a plurality of capture primers immobilized to the support, wherein individual capture primers comprise a 3’ extendible end; a plurality of pinning primers immobilized to the support, wherein individual pinning primers comprise a 3’ non-extendible end; and a plurality of covalently closedcircular polynucleotide molecules, wherein individual covalently closed circular polynucleotide molecules are hybridized to individual capture primers, thereby forming a plurality of immobilized circular molecule-capture primer duplexes; contacting the plurality of immobilized circular molecule-capture primer duplexes with a plurality of soluble amplification primers under a condition suitable for hybridizing at least one soluble amplification primer to individual immobilized circular molecule-capture primer duplexes; conducting a rolling circle amplification (RCA) reaction on the plurality of immobilized circular molecule-capture primer duplexes of step (b) in the presence of a plurality of compaction oligonucleotides, thereby generating a plurality of compact DNA nanoballs immobilized to the support, wherein individual compact DNA nanoballs comprise a concatemer template molecule generated by RCA-extension of an immobilized capture primer and at least one concatemer template molecule generated by RCA-extension of a soluble amplification primer, wherein at least a portion of individual compact DNA nanoballs is hybridized to an immobilized pinning primer; removing the plurality of covalently closed circular polynucleotide molecules and retaining the plurality of compact DNA nanoballs immobilized to the support.
[0046] In some embodiments, the method further comprises sequencing the plurality of immobilized compact DNA nanoballs.BRIEF DESCRIPTION OF THE DRAWINGS
[0047] The features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:
[0048] FIG. 1 is a schematic of various exemplary configurations of multivalent molecules. Left (Class I): schematics of multivalent molecules having a “starburst” or “helter-skelter” configuration. Center (Class II): a schematic of a multivalent molecule having a dendrimer configuration. Right (Class III): a schematic of multiple multivalent molecules formed by reacting streptavidin with 4-arm or 8-arm PEG-NHS with biotin and dNTPs. Nucleotide moieties are designated ‘N’, biotin is designated ‘B’, and streptavidin is designated ‘SA’.
[0049] FIG. 2 is a schematic of an exemplary multivalent molecule comprising a generic core attached to a plurality of nucleotide-arms.
[0050] FIG. 3 is a schematic of an exemplary multivalent molecule comprising a dendrimer core attached to a plurality of nucleotide-arms.
[0051] FIG. 4 is a schematic of an exemplary multivalent molecule comprising a core attached to a plurality of nucleotide-arms, where the nucleotide arms comprise biotin, spacer, linker and a nucleotide moiety.
[0052] FIG. 5 is a schematic of an exemplary nucleotide-arm comprising a core attachment moiety, spacer, linker and nucleotide moiety.
[0053] FIG. 6 shows the chemical structure of an exemplary spacer (top), and the chemical structures of various exemplary linkers, including an 11 -atom Linker, 16-atom Linker, 23- atom Linker and an N3 Linker (bottom).
[0054] FIG. 7 shows the chemical structures of various exemplary linkers, including Linkers 1-9.
[0055] FIG. 8 shows the chemical structures of various exemplary linkers joined / attached to nucleotide moieties.
[0056] FIG. 9 shows the chemical structures of various exemplary linkers joined / attached to nucleotide moieties.
[0057] FIG. 10 shows the chemical structures of various exemplary linkers joined / attached to nucleotide moieties.
[0058] FIG. 11 shows the chemical structure of an exemplary biotinylated nucleotide-arm. In this non-limiting example, the nucleotide moiety is connected to the linker via a propargyl amine attachment at the 5 position of a pyrimidine base or the 7 position of a purine base.
[0059] FIG. 12 is a schematic of an exemplary low binding support comprising a glass substrate and alternating layers of hydrophilic coatings which are covalently or non- covalently adhered to the glass, and which further comprises chemically-reactive functional groups that serve as attachment sites for oligonucleotide primers (e.g., capture oligonucleotides). The support can be made of any material such as glass, plastic or a polymer material.
[0060] FIG. 13A is a pair of schematics of exemplary supports having a plurality of nucleic acid capture primers arranged thereon, (i) depicts a schematic of an exemplary support having a plurality of nucleic acid capture primers arranged on the support in a nonpredetermined and random manner. The capture primers can be attached to the support such that some of the nearest neighbor capture primers touch each other and / or overlap each other when viewed from any angle of the support including above, below or side views of the support. The dotted lines that surround the four capture primers represent nearest neighbor capture primers that touch each other, (ii) depicts a schematic of the same support shown in (i), where individual nucleic acid capture primers are attached to a nucleic acid templatemolecule having one of four different batch sequences. The different batch sequences of the template molecules are represented by horizontal stripes, vertical dashed, brick or solid black. The template molecules can attach to the support (e.g., via attachment to the capture primers) such that some of the nearest neighbor template molecules touch each other and / or overlap each other when viewed from any angle of the support including above, below or side views of the support. The dotted lines that surround the four template molecules represent nearest neighbor template molecules that touch each other.
[0061] FIG. 13B is a pair of schematics of exemplary supports having a plurality of template molecules immobilized thereon, (iii) is a schematic of an exemplary support having a plurality of template molecules immobilized to the support (e.g., via attachment to the capture primers) where the template molecules are arranged on the support in a predetermined manner. The template molecule comprise one of four different batch sequences. The different batch sequences of the template molecules are represented by horizontal stripes, vertical dashed, brick or solid black. For example, the template molecules can be immobilized to the support to form spots arranged in row and columns, (iv) is a schematic of an exemplary support having a plurality of template molecules immobilized to the support (e.g., via attachment to the capture primers) where the template molecules are arranged on the support in a predetermined manner. The template molecule comprises one of four different batch sequences. The different batch sequences of the template molecules are represented by horizontal stripes, vertical dashed, brick or solid black. For example, the template molecules can be immobilized to the support to form stripes.
[0062] FIG. 14A is a schematic of a guanine tetrad (e.g., G-tetrad).
[0063] FIG. 14B is a schematic of an exemplary intramolecular G-quadruplex structure.
[0064] FIG. 15 is a schematic showing an exemplary workflow where a covalently closed circular library molecule is distributed onto a support comprising an immobilized capture primer and an immobilized pinning primer. The covalently closed circular library molecule can comprise: a surface capture primer binding site sequence (130), a right sample index sequence (170), a reverse sequencing primer binding site sequence (150), an insert (110), a forward sequencing primer binding site sequence (140), a left sample index sequence (160), and a surface pinning primer binding site sequence (120). The surface capture primer binding site sequence (130) of the covalently closed circular library molecule can hybridize to the immobilized capture primer thereby generating an immobilized circular molecule-capture primer duplex. The covalently closed circular library molecule shown in FIG. 15 can be generated by the workflow shown in FIG. 25 using padlock probes. Alternatively, thecovalently closed circular library molecule shown in FIG. 15 can be generated by the workflow shown in FIGS. 26A-26C using single-stranded splint strands (200). As a further alternative, or in addition, the covalently closed circular library molecule shown in FIG. 15 can be generated by the workflow shown in FIGS. 27A-27C using double-stranded adaptors (500).
[0065] FIG. 16 is a schematic showing an exemplary workflow where the immobilized circular molecule-capture primer duplex shown in FIG. 15 is hybridized with a soluble amplification primer which can hybridize to any universal adaptor sequence (e.g., 150) in the covalently closed circular library molecule thereby generating an immobilized circular molecule-capture primer duplex. The immobilized circular molecule-capture primer duplex is subjected to a rolling circle amplification (RCA) reaction, thereby generating a compact DNA nanoball immobilized to the support. The compact DNA nanoball can comprise (i) a concatemer template molecule generated by RCA-extension of an immobilized capture primer and (ii) at least one concatemer template molecule generated by RCA-extension of a soluble amplification primer. The rolling circle amplification reaction can be conducted in the presence of a plurality of compaction oligonucleotides.
[0066] FIG. 17 is a schematic showing an exemplary workflow where the immobilized circular molecule-capture primer duplex shown in FIG. 15 is hybridized with first and second soluble amplification primers which can hybridize to any universal adaptor sequence (e.g., a reverse sequencing primer binding site sequence (150) and / or a forward sequencing primer binding site sequence (140)) in the covalently closed circular library molecule thereby generating an immobilized circular molecule-capture primer duplex. The immobilized circular molecule-capture primer duplex is subjected to a rolling circle amplification (RCA) reaction, thereby generating a compact DNA nanoball immobilized to the support. The compact DNA nanoball can comprise (i) a concatemer template molecule generated by RCA- extension of an immobilized capture primer and (ii) at least one concatemer template molecule generated by RCA-extension of a soluble amplification primer. The rolling circle amplification reaction can be conducted in the presence of a plurality of compaction oligonucleotides.
[0067] FIG. 18 is a schematic showing an exemplary workflow where the immobilized circular molecule-capture primer duplex shown in FIG. 15 is hybridized with four soluble amplification primers including a first, a second, a third and a fourth soluble amplification primer which can hybridize to any universal adaptor sequence (e.g., a reverse sequencing primer binding site sequence (150) and / or a forward sequencing primer binding site sequence(140)) in the covalently closed circular library molecule thereby generating a immobilized circular molecule-capture primer duplex. The immobilized circular molecule-capture primer duplex can be subjected to a rolling circle amplification (RCA) reaction, thereby generating a compact DNA nanoball immobilized to the support. The compact DNA nanoball can comprise (i) a concatemer template molecule generated by RCA-extension of an immobilized capture primer and (ii) at least one concatemer template molecule generated by RCA- extension of a soluble amplification primer. The rolling circle amplification reaction can be conducted in the presence of a plurality of compaction oligonucleotides.
[0068] FIG. 19 is a schematic showing an exemplary workflow where a covalently closed circular library molecule is distributed onto a support comprising an immobilized capture primer and an immobilized pinning primer. The covalently closed circular library molecule can comprise a sequence of interest (e.g., an insert (110)) and a forward sequencing primer binding site sequence (140). The covalently closed circular library molecule can lack a surface capture primer binding site sequence (130). The covalently closed circular library molecule can lack a surface pinning primer binding site sequence (120). The immobilized capture primer can comprise a target-specific sequence that can hybridize to a portion of the sequence of interest of the covalently closed circular polynucleotide molecule thereby generating an immobilized circular molecule-capture primer duplex. The immobilized circular molecule-capture primer duplex is hybridized with a soluble amplification primer which can hybridize to a portion of the sequence of interest in the covalently closed circular library molecule thereby generating a immobilized circular molecule-capture primer duplex. The immobilized circular molecule-capture primer duplex can be subjected to a rolling circle amplification (RCA) reaction, thereby generating a compact DNA nanoball immobilized to the support. The compact DNA nanoball can comprise (i) a concatemer template molecule generated by RCA-extension of an immobilized capture primer and (ii) at least one concatemer template molecule generated by RCA-extension of a soluble amplification primer. The RCA reaction can be conducted in the presence of a plurality of compaction oligonucleotides. The immobilized pinning primer can comprise a target-specific sequence that can hybridize to a portion of the sequence of interest of the concatemer template molecules, wherein the sequences of the immobilized capture primer and the immobilized pinning primer are different.
[0069] FIG. 20 is a schematic showing an exemplary workflow where a covalently closed circular polynucleotide molecule is distributed onto a support comprising an immobilized capture primer and an immobilized pinning primer. The covalently closed circularpolynucleotide molecule can comprise a sequence of interest (e.g., an insert(HO)) and can lack a universal adaptor sequence. The covalently closed circular polynucleotide molecule can lack a surface capture primer binding site sequence (130). The immobilized capture primer can comprise a target-specific sequence that can hybridize to a portion of the sequence of interest of the covalently closed circular library molecule thereby generating an immobilized circular molecule-capture primer duplex. The immobilized circular moleculecapture primer duplex is hybridized with a soluble amplification primer which can hybridize to a portion of the sequence of interest in the covalently closed circular library molecule thereby generating an immobilized circular molecule-capture primer duplex. The immobilized circular molecule-capture primer duplex can be subjected to a rolling circle amplification (RCA) reaction, thereby generating a compact DNA nanoball immobilized to the support. The compact DNA nanoball can comprise (i) a concatemer template molecule generated by RCA-extension of an immobilized capture primer and (ii) at least one concatemer template molecule generated by RCA-extension of a soluble amplification primer. The rolling circle amplification reaction can be conducted in the presence of a plurality of compaction oligonucleotides. The immobilized pinning primer can comprise a target-specific sequence that can hybridize to a portion of the sequence of interest of the concatemer template molecules, wherein the sequences of the immobilized capture primer and the immobilized pinning primer are different.
[0070] FIG. 21 is a schematic showing an exemplary concatemer template molecule generated from RCA-extension of an immobilized capture primer wherein at least a portion of the concatemer template molecule is hybridized to an immobilized pinning primer. The concatemer template molecule can be generated by conducting a workflow shown in any of FIGS. 15-18.
[0071] FIG. 22 shows two histograms that plot normalized intensities during pairwise sequencing of compact DNA nanoballs (e.g., polonies) generated by the methods described herein. FIG. 22A compares normalized intensities during a forward sequencing run (Rl) of compact DNA nanoballs generated using 1 or 3 soluble amplification primers. FIG. 22B compares normalized intensities during a reverse sequencing run (R2) of compact DNA nanoballs generated using 1 or 3 soluble amplification primers.
[0072] FIG. 23 shows two boxplots of quality scores at each base position during pairwise sequencing of compact DNA nanoballs (e.g., polonies) generated by the methods described herein. The x-axis indicates the base position in the forward reads. The y-axis indicates the quality scores. FIG. 23A shows the quality scores during a forward sequencing run (Rl) ofcompact DNA nanoballs generated using 1 soluble amplification primer. FIG. 23B shows the quality scores during a forward sequencing run (Rl) of compact DNA nanoballs generated using 3 soluble amplification primers.
[0073] FIG. 24 shows two boxplots of quality scores at each base position during pairwise sequencing of compact DNA nanoballs (e.g., polonies) generated by the methods described herein. The x-axis indicates the base position in the reverse reads. The y-axis indicates the quality scores. FIG. 24A shows the quality scores during a reverse sequencing run (R2) of compact DNA nanoballs generated using 1 soluble amplification primer. FIG. 24B shows the quality scores during a reverse sequencing run (R2) of compact DNA nanoballs generated using 3 soluble amplification primers. FIGS. 23A and 24A show quality scores from forward (FIG. 23 A) and reverse (FIG. 24A) pairwise sequencing of the same experiment. FIGS. 23B and 24B show quality scores from forward (FIG. 23B) and reverse (FIG. 24B) pairwise sequencing of the same experiment.
[0074] FIG. 25 is a schematic showing an exemplary workflow where a target sequence of interest is hybridized with a padlock probe thereby forming a circularized padlock probe with a nick or gap. The exemplary padlock probe can comprise: a surface pinning primer binding site sequence (120) (e.g., a batch-specific surface pinning primer binding site sequence); a left sample index sequence (160); a forward sequencing primer binding site sequence (140) (e.g., a batch-specific forward sequencing primer binding site sequence); a sequence of interest (e.g., an insert (110)); a reverse sequencing primer binding site sequence (150) (e.g., a batch-specific reverse sequencing primer binding site sequence); a right sample index sequence (170); a surface capture primer binding site sequence (130) (e.g., a batch-specific surface capture primer binding site sequence); and an optional unique identification sequence (e.g., UMI). The nick or gap can be enzymatically closed to generate a covalently closed padlock probe.
[0075] FIG. 26A is a schematic of an exemplary workflow of a linear single stranded library molecule (100) hybridizing with a single-stranded splint molecule / strand (ss-splint strand) (200) thereby circularizing the library molecule to form a library-splint complex (300) with a nick. The exemplary library molecule (100) can comprise: a surface pinning primer binding site sequence (120) (e.g., a batch-specific surface pinning primer binding site sequence); a left sample index sequence (160); a forward sequencing primer binding site sequence (140) (e.g., a batch-specific forward sequencing primer binding site sequence); a sequence of interest (e.g., an insert (110)); a reverse sequencing primer binding site sequence (150) (e.g., a batch-specific reverse sequencing primer binding site sequence); a right sampleindex sequence (170); a surface capture primer binding site sequence (130) (e.g., a batchspecific surface capture primer binding site sequence); and an optional unique identification sequence (e.g., UMI). The single-stranded splint strand (200) can comprise a first region (210) that hybridizes with the surface pinning primer binding site sequence (120) of the linear single-stranded library molecule (100), and a second region (220) that hybridizes with the surface capture primer binding site sequence (130) of the linear single-stranded library molecule (100).
[0076] FIG. 26B is a schematic of an exemplary workflow of a library-splint complex (300) shown in FIG. 26A where the nick is enzymatically ligated to generate a covalently closed circular library molecule (400) (also referred to herein as a “covalently closed circular polynucleotide molecule”).
[0077] FIG. 26C is a schematic showing an exemplary linear single-stranded library molecule (100) hybridizing with a single-stranded splint molecule / strand (ss-splint strand) (200) thereby circularizing the library molecule to form a library-splint complex (300) with a nick. The library molecule (100) can comprise: a first left junction adaptor sequence (121); a surface pinning primer binding site sequence (120); a second left junction adaptor sequence (125); a left sample index sequence (160); a third left junction adaptor sequence (165); a forward sequencing primer binding site sequence (140); a fourth left junction adaptor sequence (145); a sequence of interest (e.g., an insert; (110)); a fourth right junction adaptor sequence (155); a reverse sequencing primer binding site sequence (150); a third right junction adaptor sequence (175); a right sample index sequence (170); a second right junction adaptor sequence (135); a surface capture primer binding site (130); and a first right junction adaptor sequence (131). The single-stranded splint strand (ss-splint strand) (200) comprises a first region (210) that hybridizes with one end of the linear single stranded library molecule (100) including at least a portion of the surface pinning primer binding site sequence (120) and / or at least a portion of the first left junction adaptor sequence (121). The single-stranded splint strand (200) comprises a second region (220) that hybridizes with the other end of the linear single-stranded library molecule (100) including at least a portion of the surface capture primer binding site sequence (130) and / or at least a portion of the first right junction adaptor sequence (131). For the sake of simplicity, the library-splint complex (300) does not show any of the junction adaptors. The skilled artisan will recognize that the library-splint complex (300) can include any one or any combination of two or more of the junction adaptors that are depicted in the exemplary library molecule (100).
[0078] FIG. 27A is a schematic of an exemplary workflow of a linear single-stranded library molecule (100) hybridizing with a double-stranded adaptor (ds-splint adaptor) (500) thereby circularizing the library molecule to form a library-splint complex (800) with two nicks. The exemplary library molecule (100) can comprise: a surface pinning primer binding site sequence (120) (e.g., a batch-specific pinning primer binding site sequence); a left sample index sequence (160); a forward sequencing primer binding site sequence (140) (e.g., a batchspecific forward sequencing primer binding site sequence); a sequence of interest (e.g., an insert (110)); a reverse sequencing primer binding site sequence (150) (e.g., a batch-specific reverse sequencing primer binding site sequence); a right sample index sequence (170); and a surface capture primer binding site sequence (130) (e.g., a batch-specific surface capture primer binding site sequence); and an optional unique identification sequence (e.g., UMI). The double-stranded adaptor can comprise a first splint strand (600) hybridized to a second splint strand (700). In the double-stranded adaptor, the first splint strand (600) comprises a first region (620), an internal region (610), and a second region (630), wherein the internal region (610) of the first splint strand is hybridized to the second splint strand (700). The second splint strand (700) can comprise a first, a second, and a third subregions, and the internal region (610) of the first splint strand (600) can comprise a fourth, a fifth, and a sixth subregions. In some embodiments, the first region of the first splint strand (620) can hybridize to at least a portion of the surface pinning primer binding site sequence (120) of a single-stranded nucleic acid library molecule (100), and the second region of the first splint strand (630) can hybridize to at least a portion of the surface capture primer binding site sequence (130) of the same single-stranded nucleic acid library molecule (100).
[0079] FIG. 27B is a schematic of an exemplary workflow of a library-splint complex (800) shown in FIG. 27A where the two nicks are enzymatically ligated to generate a covalently closed circular library molecule (900) (also referred to herein as a “covalently closed circular polynucleotide molecule”).
[0080] FIG. 27C is a schematic showing an exemplary linear single-stranded library molecule (100) hybridizing with a double-stranded splint molecule (ds-splint adaptor) (200) thereby circularizing the library molecule to form a library-splint complex (500) with two nicks (solid arrowheads). The library molecule (100) can comprise: a first left junction adaptor sequence (121); a surface pinning primer binding site sequence (120); a second left junction adaptor sequence (125); a left sample index sequence (160); a third left junction adaptor sequence (165); a forward sequencing primer binding site sequence (140); a fourth left junction adaptor sequence (145); a sequence of interest (e.g., an insert; (HO)); a fourthright junction adaptor sequence (155); a reverse sequencing primer binding site sequence (150); a third right junction adaptor sequence (175); a right sample index sequence (170); a second right junction adaptor sequence (135); a surface capture primer binding site sequence (130); and a first right junction adaptor sequence (131). The double-stranded splint adaptor (500) comprises a first splint strand (600) having a first region (620) that hybridizes with one end of the linear single stranded library molecule (100) including at least a portion of the surface pinning primer binding site sequence (120) and / or at least a portion of the first left junction adaptor sequence (121). The double-stranded splint adaptor (500) comprises a first splint strand (600) having a second region (630) that hybridizes with the other end of the linear single-stranded library molecule (100) including at least a portion of the surface capture primer binding site sequence (130) and / or at least a portion of the first right junction adaptor sequence (131). The double-stranded splint adaptor (500) comprises a second splint strand (700) that is hybridized with an internal region (610) of the first splint strand (600). For the sake of simplicity, the library-splint complex (800) does not show any of the junction adaptors. The skilled artisan will recognize that the library-splint complex (800) can include any one or any combination of two or more of the junction adaptors that are present in the library molecule (100).
[0081] FIG. 28 is a graph showing the nucleotide base diversity of a right sample index sequence (170) including universal right sample index and a 3-mer random sequence (NNN). The graph shows a nucleotide diversity of the 3-mer random sequence (NNN) of approximately 30% for A and T base calls, and approximately 20% for C and G base calls.
[0082] FIG. 29 is a graph showing the nucleotide base diversity of a left sample index sequence (160) which lacks a 3-mer random sequence (NNN). The graph shows a nucleotide diversity of approximately 40% for A and T base calls, approximately 15% for C base calls, and approximately 5% for G base calls.
[0083] FIG. 30 shows schematics of several embodiments of linear compaction oligonucleotides each comprising a first binding region, an intervening linker, and a second binding region. For instance, a compaction oligonucleotide can comprise a first binding region arranged in a 5’ to 3’ orientation and a second binding region arranged in a 5’ to 3’ orientation (i). Alternatively, or in addition, a compaction oligonucleotide can comprise a first binding region arranged in a 3’ to 5’ orientation and a second binding region arranged in a 3’ to 5’ orientation ( (ii). Alternatively, or in addition, a compaction oligonucleotide can comprise a first binding region arranged in a 3’ to 5’ orientation and a second binding region arranged in a 5’ to 3’ orientation (iii). Alternatively, or in addition, a compactionoligonucleotide can comprise a first binding region arranged in a 5’ to 3’ orientation and a second binding region arranged in a 3’ to 5’ orientation (iv). The 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.
[0084] FIG. 31 A shows schematics of several embodiments of linear compaction oligonucleotides each comprising a first binding region, a first intervening linker, a second binding region, a second intervening linker, and a third binding region. For instance, a compaction oligonucleotide can comprise a first binding region arranged in a 5’ to 3’ orientation, a second binding region arranged in a 5’ to 3’ orientation, and a third binding region arranged in a 5’ to 3’ orientation i). Alternatively, or in addition, a compaction oligonucleotide can comprise a first binding region arranged in a 5’ to 3’ orientation, a second binding region arranged in a 5’ to 3’ orientation, and a third binding region arranged in a 3’ to 5’ orientation ii). Alternatively, or in addition, a compaction oligonucleotide can comprise a first binding region arranged in a 5’ to 3’ orientation, a second binding region arranged in a 3’ to 5’ orientation, and a third binding region arranged in a 3’ to 5’ orientation (iii). The 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.
[0085] FIG. 31B shows schematics of several embodiments of linear compaction oligonucleotides each comprising a first binding region, a first intervening linker, a second binding region, a second intervening linker, and a third binding region. For instance, a compaction oligonucleotide can comprise a first binding region arranged in a 5’ to 3’ orientation, a second binding region arranged in a 3’ to 5’ orientation, and a third binding region arranged in a 5’ to 3’ orientation iv). Alternatively, or in addition, a compaction oligonucleotide can comprise a first binding region arranged in a 3’ to 5’ orientation, a second binding region arranged in a 5’ to 3’ orientation, and a third binding region arranged in a 5’ to 3’ orientation v). Alternatively, or in addition, a compaction oligonucleotide can comprise a first binding region arranged in a 3’ to 5’ orientation, a second binding region arranged in a 3’ to 5’ orientation, and a third binding region arranged in a 5’ to 3’ orientation (vi). The 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.
[0086] FIG. 31C shows schematics of several embodiments of linear compaction oligonucleotides each comprising a first binding region, a first intervening linker, a second binding region, a second intervening linker, and a third binding region. For instance, a compaction oligonucleotide can comprise a first binding region arranged in a 3’ to 5’ orientation, a second binding region arranged in a 5’ to 3’ orientation, and a third binding region arranged in a 5’ to 3’ orientation (vii). Alternatively, or in addition, a compaction oligonucleotide can comprise a first binding region arranged in a 3’ to 5’ orientation, a second binding region arranged in a 3’ to 5’ orientation, and a third binding region arranged in a 5’ to 3’ orientation (viii). Alternatively, or in addition, a compaction oligonucleotide can comprise a first binding region arranged in a 3’ to 5’ orientation, a second binding region arranged in a 5’ to 3’ orientation, and a third binding region arranged in a 3’ to 5’ orientation (ix). The 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.
[0087] FIG. 32A shows schematics of several embodiments of compaction oligonucleotides each comprising three binding arms linked together by at least one inner intervening linker, wherein individual binding arms comprise a binding region. For instance, a compaction oligonucleotide can comprise: (1) an inner intervening linker and a first binding region arranged in a 5’ to 3’ orientation where the 3’ end of the first binding region is directed away from the inner intervening linker; (2) an inner intervening linker and a second binding region arranged in a 5’ to 3’ orientation where the 3’ end of the second binding region is directed away from the inner intervening linker; and (3) an inner intervening linker and a third binding region arranged in a 5’ to 3’ orientation where the 3’ end of the third binding region is directed away from the inner intervening linker (i). Alternatively, or in addition, a compaction oligonucleotide can comprise: (1) an inner intervening linker and a first binding region arranged in a 3’ to 5’ orientation where the 5’ end of the first binding region is directed away from the inner intervening linker; (2) an inner intervening linker and a second binding region arranged in a 3’ to 5’ orientation where the 5’ end of the second binding region is directed away from the inner intervening linker; and (3) an inner intervening linker and a third binding region arranged in a 3’ to 5’ orientation where the 5’ end of the third binding region is directed away from the inner intervening linker (ii). The 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.
[0088] FIG. 32B shows schematics of several embodiments of compaction oligonucleotides each comprising three binding arms linked together by at least one inner intervening linker, wherein individual binding arms comprise a binding region. For instance, a compaction oligonucleotide can comprise: (1) an inner intervening linker and a first binding region arranged in a 5’ to 3’ orientation where the 3’ end of the first binding region is directed away from the inner intervening linker; (2) an inner intervening linker and a second binding region arranged in a 5’ to 3’ orientation where the 3’ end of the second binding region is directed away from the inner intervening linker; and (3) an inner intervening linker and a third binding region arranged in a 3’ to 5’ orientation where the 5’ end of the third binding region is directed away from the inner intervening linker (iii). Alternatively, or in addition, a compaction oligonucleotide can comprise: (1) an inner intervening linker and a first binding region arranged in a 5’ to 3’ orientation where the 3’ end of the first binding region is directed away from the inner intervening linker; (2) an inner intervening linker and a second binding region arranged in a 3’ to 5’ orientation where the 5’ end of the second binding region is directed away from the inner intervening linker; and (3) an inner intervening linker and a third binding region arranged in a 3’ to 5’ orientation where the 5’ end of the third binding region is directed away from the inner intervening linker (iv). The 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.
[0089] FIG. 33 shows a schematic of an embodiment of a compaction oligonucleotide comprising three binding arms linked together by at least one inner intervening linker, wherein individual binding arms comprise a first binding region, an intervening linker, and a second binding region. A compaction oligonucleotide can comprise three binding arms where each binding arm comprises: an inner intervening linker, a first binding region arranged in a 5’ to 3’ orientation, an intervening linker, and a second binding region arranged in a 5’ to 3’ direction, where the 3’ end of each of the first and second binding region is directed away from the inner intervening linker. The 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.
[0090] FIG. 34 shows schematics of several embodiments of compaction oligonucleotides each comprising four binding arms linked together by at least one inner intervening linker, wherein individual binding arms comprise a binding region. For instance,a compaction oligonucleotide can comprise: (1) an inner intervening linker and a first binding region arranged in a 5’ to 3’ orientation where the 3’ end of the first binding region is directed away from the inner intervening linker; (2) an inner intervening linker and a second binding region arranged in a 5’ to 3’ orientation where the 3’ end of the second binding region is directed away from the inner intervening linker; (3) an inner intervening linker and a third binding region arranged in a 5’ to 3’ orientation where the 3’ end of the third binding region is directed away from the inner intervening linker; and (4) an inner intervening linker and a fourth binding region arranged in a 5’ to 3’ orientation where the 3’ end of the fourth binding region is directed away from the inner intervening linker (i). Alternatively, or in addition, a compaction oligonucleotide can comprise: (1) an inner intervening linker and a first binding region arranged in a 3’ to 5’ orientation where the 5’ end of the first binding region is directed away from the inner intervening linker; (2) an inner intervening linker and a second binding region arranged in a 3’ to 5’ orientation where the 5’ end of the second binding region is directed away from the inner intervening linker; (3) an inner intervening linker and a third binding region arranged in a 3’ to 5’ orientation where the 5’ end of the third binding region is directed away from the inner intervening linker; and (4) an inner intervening linker and a fourth binding region arranged in a 3’ to 5’ orientation where the 5’ end of the fourth binding region is directed away from the inner intervening linker (ii). The 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.
[0091] FIG. 35A shows a schematic of an embodiment of a double-sided comb shaped compaction oligonucleotide comprising a plurality of binding arms linked to a linker moiety, wherein individual binding arms comprise a binding region and an inner intervening linker. The compaction oligonucleotide can comprise at least three binding arms. The compaction oligonucleotide can comprise a plurality of binding arms having the same sequence. Individual binding arms can comprise a first binding region arranged in a 5’ to 3’ orientation where the 3’ end of the first binding region is directed away from the linker moiety. Individual binding arms can be joined to the linker moiety by the inner intervening linker. The 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.
[0092] FIG. 35B shows a schematic of an embodiment of a double-sided comb shaped compaction oligonucleotide comprising a plurality of binding arms linked to a linker moiety,wherein individual binding arms comprise a binding region and an inner intervening linker. The compaction oligonucleotide can comprise at least three binding arms. The compaction oligonucleotide can comprise a plurality of binding arms having one of two different sequences. For instance, individual binding arms can comprise a first binding region arranged in a 3’ to 5’ orientation where the 5’ end of the first binding region is directed away from the linker moiety. Individual binding arms can comprise a second binding region arranged in a 3’ to 5’ orientation where the 5’ end of the second binding region is directed away from the linker moiety. Individual binding arms can be joined to the linker moiety by the inner intervening linker. The first binding regions and the second binding regions can be arranged to be on different sides of the double-sided comb shaped compaction oligonucleotide. The 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.
[0093] FIG. 35C shows a schematic of an embodiment of a double-sided comb shaped compaction oligonucleotide comprising a plurality of binding arms linked to a linker moiety, wherein individual binding arms comprise a binding region and an inner intervening linker. The compaction oligonucleotide can comprise at least three binding arms. The compaction oligonucleotide can comprise a plurality of binding arms having one of three different sequences, such as a first binding region, a second binding region, and a third binding region. For instance, individual binding arms can comprise a first binding region arranged in a 5’ to 3’ orientation where the 3’ end of the first binding region is directed away from the linker moiety. Individual binding arms can comprise a second binding region arranged in a 5’ to 3’ orientation where the 3’ end of the second binding region is directed away from the linker moiety. Individual binding arms can comprise a third binding region arranged in a 5’ to 3’ orientation where the 3’ end of the third binding region is directed away from the linker moiety. Individual binding arms can be joined to the linker moiety by the inner intervening linker. The first binding regions, the second binding regions, and the third binding regions can be arranged to be on the same side of the double-sided comb shaped compaction oligonucleotide. The 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.DETAILED DESCRIPTIONINTRODUCTION
[0094] When conducting massively parallel sequencing runs, it is challenging to achieve high sequencing quality across the entire length of library insert regions larger than 200 bases, because the sequencing quality drops in part due to a decrease in signal intensity. Achieving high sequencing quality in pairwise sequencing runs is particularly challenging because the signal intensity drops precipitously when sequencing the second strand.
[0095] In some aspects, the present disclosure provides compositions, apparatus and methods for generating concatemer template molecules immobilized on a support for conducting massively parallel sequencing runs, including pairwise sequencing, and achieving high sequencing quality of Q30 or Q40 across the length of the library insert regions on both strands.
[0096] In some aspects, the present disclosure provides compositions, apparatus and methods for generating a plurality of concatemer template molecules (sometimes referred to herein as “concatemer template molecules” and the like) which form compact DNA nanoballs that are stably immobilized to a support. In some embodiments, the compact DNA nanoballs can be generated by conducting rolling circle amplification (RCA) reactions on a support comprising a mixture of immobilized capture and pinning primers. The RCA reaction comprises a plurality of circularized polynucleotide molecules and soluble amplification primers. Without wishing to be bound by theory, it is hypothesized that individual compact DNA nanoballs have increased DNA content compared to DNA nanoballs generated without the plurality of soluble amplification primers, because the immobilized capture primers and soluble amplification primers generate RCA-extension products. The immobilized capture primers can serve to capture circularized polynucleotide molecules, the rolling circle amplification reaction generates concatemer template molecules, and the immobilized pinning primers serve to hybridize to portions of the generated concatemers to produce compact DNA nanoballs that are stably immobilized to the support and retain their compact shape and size after multiple cycles of nucleic acid sequencing reactions. The RCA reaction can be conducted with compaction oligonucleotides which hybridize to portions of the concatemer template molecule to pull together distal portions of the concatemer template molecule which causes compaction of the concatemer template molecule to form compact DNA nanoballs. The resulting compact DNA nanoballs can then be sequenced in a massively parallel sequencing workflow using detectably labeled nucleotide reagents to yield increased signal intensity at any given sequencing cycle. For example, the compact DNA nanoballsexhibit increased signal intensity in long sequencing runs even beyond 300 sequencing cycles. In some embodiments, the compact DNA nanoballs also exhibit increased signal intensity in pairwise sequencing runs where the forward and reverse sequencing runs include more than 300 sequencing cycles. In some embodiments, the compact DNA nanoballs can be subjected to batch-sequencing and / or re-iterative sequencing.Definitions
[0097] The headings provided herein are not limitations of the various aspects of the disclosure, which aspects can be understood by reference to the specification as a whole.
[0098] Unless defined otherwise, technical and scientific terms used herein have meanings that are commonly understood by those of ordinary skill in the art unless defined otherwise. Generally, terminologies pertaining to techniques of molecular biology, nucleic acid chemistry, protein chemistry, genetics, microbiology, transgenic cell production, and hybridization described herein are those well-known and commonly used in the art. Techniques and procedures described herein are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the instant specification. For example, see Sambrook et al., Molecular Cloning: A Laboratory Manual (Third ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 2000). See also Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992). The nomenclatures utilized in connection with, and the laboratory procedures and techniques described herein are those well-known and commonly used in the art.
[0099] Unless otherwise required by context herein, singular terms shall include pluralities and plural terms shall include the singular. Singular forms “a”, “an” and “the”, and singular use of any word, include plural referents unless expressly and unequivocally limited on one referent.
[0100] It is understood the use of the alternative term (e.g., “or”) is taken to mean either one or both or any combination thereof of the alternatives.
[0101] The term “and / or” used herein is to be taken mean specific disclosure of each of the specified features or components with or without the other. For example, the term “and / or” as used in a phrase such as “A and / or B” herein is intended to include: “A and B”; “A or B”; “A” (A alone); and “B” (B alone). In a similar manner, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following aspects: “A,B, and C”; “A, B, or C”; “A or C”; “A or B”; “B or C”; “A and B”; “B and C”; “A and C”;“A” (A alone); “B” (B alone); and “C” (C alone).
[0102] As used herein and in the appended claims, terms “comprising”, “including”, “having” and “containing”, and their grammatical variants, as used herein are intended to be non-limiting so that one item or multiple items in a list do not exclude other items that can be substituted or added to the listed items. It is understood that wherever aspects are described herein with the language “comprising,” otherwise analogous aspects described in terms of “consisting of’ and / or “consisting essentially of’ are also provided.
[0103] As used herein, the terms “about” and “approximately” refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined, i.e., the limitations of the measurement system. For example, “about” or “approximately” can mean within one or more than one standard deviation per the practice in the art. Alternatively, “about” or “approximately” can mean a range of up to 10% (i.e., ±10%) or more depending on the limitations of the measurement system. For example, about 5 mg can include any number between 4.5 mg and 5.5 mg. Furthermore, particularly with respect to biological systems or processes, the terms can mean up to an order of magnitude or up to 5-fold of a value. When particular values or compositions are provided in the instant disclosure, unless otherwise stated, the meaning of “about” or “approximately” should be assumed to be within an acceptable error range for that particular value or composition. Also, where ranges and / or subranges of values are provided, the ranges and / or subranges can include the endpoints of the ranges and / or subranges.
[0104] The term “polymerase” and its variants, as used herein, comprises an enzyme comprising a domain that binds a nucleotide (or nucleoside) where the polymerase can form a complex having a template nucleic acid and a complementary nucleotide. The polymerase can have one or more activities including, but not limited to, base analog detection activities, DNA polymerization activity, reverse transcriptase activity, DNA binding, strand displacement activity, and nucleotide binding and recognition. A polymerase can be any enzyme that can catalyze polymerization of nucleotides (including analogs thereof) into a nucleic acid strand. Typically, but not necessarily such nucleotide polymerization can occur in a template-dependent fashion. Typically, a polymerase comprises one or more active sites at which nucleotide binding and / or catalysis of nucleotide polymerization can occur. In some embodiments, a polymerase includes other enzymatic activities, such as for example, 3' to 5' exonuclease activity or 5' to 3' exonuclease activity. In some embodiments, a polymerase hasstrand displacing activity. A polymerase can include without limitation naturally occurring polymerases and any subunits and truncations thereof, mutant polymerases, variant polymerases, recombinant, fusion or otherwise engineered polymerases, chemically modified polymerases, synthetic molecules or assemblies, and any analogs, derivatives or fragments thereof that retain the ability to catalyze nucleotide polymerization (e.g., catalytically active fragment). The polymerase includes catalytically inactive polymerases, catalytically active polymerases, reverse transcriptases, and other enzymes comprising a nucleotide binding domain. In some embodiments, a polymerase can be isolated from a cell, or generated using recombinant DNA technology or chemical synthesis methods. In some embodiments, a polymerase can be expressed in prokaryote, eukaryote, viral, or phage organisms. In some embodiments, a polymerase can be post-translationally modified proteins or fragments thereof. A polymerase can be derived from a prokaryote, eukaryote, virus or phage. A polymerase comprises DNA-directed DNA polymerase and RNA-directed DNA polymerase.
[0105] As used herein, the term “strand displacing” refers to the ability of a polymerase to locally separate strands of double-stranded nucleic acids and synthesize a new strand in a template-based manner. Strand displacing polymerases displace a complementary strand from a template strand and catalyze new strand synthesis. Strand displacing polymerases include mesophilic and thermophilic polymerases. Strand displacing polymerases include wild type enzymes, and variants including exonuclease minus mutants, mutant versions, chimeric enzymes and truncated enzymes. Examples of strand displacing polymerases include, without limitation, phi29 DNA polymerase, large fragment of Bst DNA polymerase, large fragment of Bsu DNA polymerase (exo-), Bea DNA polymerase (exo-), KI enow fragment of E. coli DNA polymerase, T5 polymerase, M-MuLV reverse transcriptase, HIV viral reverse transcriptase, Deep Vent DNA polymerase and KOD DNA polymerase. The phi29 DNA polymerase can be wild type phi29 DNA polymerase (e.g., MagniPhi® from Expedeon®), or variant EquiPhi29® DNA polymerase (e.g., from Thermo Fisher Scientific®), or chimeric QualiPhi® DNA polymerase (e.g., from 4basebio®).
[0106] The terms “nucleic acid”, "polynucleotide" and "oligonucleotide" and other related terms used herein are used interchangeably and refer to polymers of nucleotides and are not limited to any particular length. Nucleic acids include recombinant and chemically- synthesized forms. Nucleic acids can be isolated. Nucleic acids include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), analogs of the DNA or RNA generated using nucleotide analogs (e.g., peptide nucleic acids (PNA) and non-naturally occurring nucleotide analogs), and chimeric forms containing DNA and RNA. Nucleic acidscan be single-stranded or double-stranded. Nucleic acids comprise polymers of nucleotides, where the nucleotides include natural or non-natural bases and / or sugars. Nucleic acids comprise naturally-occurring internucleosidic linkages, for example and without limitation, phosphodiester linkages. Nucleic acids can lack a phosphate group. Nucleic acids can comprise non-natural internucleoside linkages, including phosphorothioate, phosphorothiolate, or peptide nucleic acid (PNA) linkages. In some embodiments, nucleic acids comprise a one type of polynucleotides or a mixture of two or more different types of polynucleotides.
[0107] The term “operably linked” and “operably joined” or related terms as used herein refers to juxtaposition of components. The juxtapositioned components can be linked together covalently. For example, two nucleic acid components can be enzymatically ligated together where the linkage that joins together the two components comprises phosphodiester linkage. A first and second nucleic acid component can be linked together, where the first nucleic acid component can confer a function on a second nucleic acid component. For example, linkage between a primer binding sequence and a sequence of interest forms a nucleic acid library molecule having a portion that can bind to a primer. In another example, a transgene (e.g., a nucleic acid encoding a polypeptide or a nucleic acid sequence of interest) can be ligated to a vector where the linkage permits expression or functioning of the transgene sequence contained in the vector. In some embodiments, a transgene is operably linked to a host cell regulatory sequence (e.g., a promoter sequence) that affects expression of the transgene. In some embodiments, the vector comprises at least one host cell regulatory sequence, including a promoter sequence, enhancer, transcription and / or translation initiation sequence, transcription and / or translation termination sequence, polypeptide secretion signal sequences, and the like. In some embodiments, the host cell regulatory sequence controls expression of the level, timing and / or location of the transgene.
[0108] The terms “linked”, “joined”, “attached”, “appended” and variants thereof comprise any type of fusion, bond, adherence or association between any combination of compounds or molecules that is of sufficient stability to withstand use in the particular procedure. The procedure can include but are not limited to: nucleotide binding; nucleotide incorporation; de-blocking (e.g., removal of chain-terminating moiety); washing; removing; flowing; detecting; imaging and / or identifying. Such linkage can comprise, for example, covalent, ionic, hydrogen, dipole-dipole, hydrophilic, hydrophobic, or affinity bonding, bonds or associations involving van der Waals forces, mechanical bonding, and the like. In some embodiments, such linkage occurs intramolecularly, for example linking together the ends ofa single-stranded or double-stranded linear nucleic acid molecule to form a circular molecule. In some embodiments,, such linkage can occur between a combination of different molecules, or between a molecule and a non-molecule, including but not limited to: linkage between a nucleic acid molecule and a solid surface; linkage between a protein and a detectable reporter moiety; linkage between a nucleotide and detectable reporter moiety; and the like. Some examples of linkages can be found, for example, in Hermanson, G., “Bioconjugate Techniques”, Second Edition (2008); Aslam, M., Dent, A., “Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences”, London: Macmillan (1998); Aslam, M., Dent, A., “Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences”, London: Macmillan (1998).
[0109] The term “primer” and related terms used herein refer to an oligonucleotide that is capable of hybridizing with a DNA and / or RNA polynucleotide template to form a duplex molecule. Primers comprise natural nucleotides and / or nucleotide analogs. Primers can be recombinant nucleic acid molecules. Primers may have any length, but typically range from 4-50 nucleotides. A typical primer comprises a 5’ end and 3’ end. The 3’ end of the primer can include a 3’ OH moiety which serves as a nucleotide polymerization initiation site in a polymerase-catalyzed primer extension reaction. Alternatively, the 3’ end of the primer can lack a 3’ OH moiety, or can include a terminal 3’ blocking group that inhibits nucleotide polymerization in a polymerase-catalyzed reaction. Any one nucleotide, or more than one nucleotide, along the length of the primer can be labeled with a detectable reporter moiety. A primer can be in solution (e.g., a soluble primer) or can be immobilized to a support (e.g., a capture primer).
[0110] The term “template nucleic acid”, “template polynucleotide”, “target nucleic acid” “target polynucleotide”, “template strand” and other variations refer to a nucleic acid strand that serves as the basis nucleic acid molecule for any of the methods describe herein e.g. sequencing or amplification methods. The template nucleic acid can be single-stranded or double-stranded, or the template nucleic acid can have single-stranded or double-stranded portions. The template nucleic acid can be obtained from a naturally-occurring source, recombinant form, or chemically synthesized to include any type of nucleic acid analog. The template nucleic acid can be linear, circular, or other forms. The template nucleic acids can include an insert portion having an insert sequence. The template nucleic acids can also include at least one adaptor sequence. The insert portion can be isolated in any form, including chromosomal, genomic, organellar (e.g., mitochondrial, chloroplast or ribosomal), recombinant molecules, cloned, amplified, cDNA, RNA such as precursor mRNA or mRNA,oligonucleotides, whole genomic DNA, obtained from fresh frozen paraffin embedded tissue, needle biopsies, circulating tumor cells, cell free circulating DNA, or any type of nucleic acid library. The insert portion can be isolated from any source including from organisms such as prokaryotes, eukaryotes (e.g., humans, plants and animals), fungus, viruses, cells, tissues, normal or diseased cells or tissues, body fluids including blood, urine, serum, lymph, tumor, saliva, anal and vaginal secretions, amniotic samples, perspiration, semen, environmental samples, culture samples, or synthesized nucleic acid molecules prepared using recombinant molecular biology or chemical synthesis methods. The insert portion can be isolated from any organ, including head, neck, brain, breast, ovary, cervix, colon, rectum, endometrium, gallbladder, intestines, bladder, prostate, testicles, liver, lung, kidney, esophagus, pancreas, thyroid, pituitary, thymus, skin, heart, larynx, or other organs. The template nucleic acid can be subjected to nucleic acid analysis, including sequencing and composition analysis.
[0111] The term “adaptor” and related terms refer to oligonucleotides that can be operably linked to a target polynucleotide, where the adaptor confers a function to the cojoined adaptor-target molecule. Adaptors comprise DNA, RNA, chimeric DNA / RNA, or analogs thereof. Adaptors can include at least one ribonucleoside residue. Adaptors can be single-stranded, double-stranded, or have single-stranded and / or double-stranded portions. Adaptors can be configured to be linear, stem-looped, hairpin, or Y-shaped forms. Adaptors can be any length, including 4-100 nucleotides or longer. Adaptors can have blunt ends, overhang ends, or a combination of both. Overhang ends can include 5’ overhang and / or 3’ overhang ends. The 5’ end of a single-stranded adaptor, or one strand of a double-stranded adaptor, can have a 5’ phosphate group or lack a 5’ phosphate group. Adaptors can include a 5’ tail that does not hybridize to a target polynucleotide (e.g., tailed adaptor), or adaptors can be non-tailed. An adaptor can include a sequence that is complementary to at least a portion of a primer, such as an amplification primer, a sequencing primer, or a capture primer (e.g., soluble or immobilized capture primers). Adaptors can include a random sequence or degenerate sequence. Adaptors can include at least one inosine residue. Adaptors can include at least one phosphorothioate, phosphorothiolate and / or phosphoramidate linkage. Adaptors can include a barcode sequence which can be used to distinguish polynucleotides (e.g., insert sequences) from different sample sources in a multiplex assay. Adaptors can include a unique identification sequence (e.g., unique molecular index, UMI; or a unique molecular tag) that can be used to uniquely identify a nucleic acid molecule to which the adaptor is appended. In some embodiments, a unique identification sequence can be used to increase error correction and accuracy, reduce the rate of false-positive variant calls and / or increase sensitivity ofvariant detection. Adaptors can include at least one restriction enzyme recognition sequence, including any one or any combination of two or more selected from a group consisting of type I, type II, type III, type IV, type Hs or type IIB.
[0112] In some embodiments, primer sequences, such as any of the amplification primer sequences, sequencing primer sequences, capture primer sequences, target capture sequences, circularization anchor sequences, sample barcode sequences, spatial barcode sequences, or anchor region sequences can be about 3-50 nucleotides in length, or about 5-40 nucleotides in length, or about 5-25 nucleotides in length.
[0113] The term “universal sequence” and related terms refer to a sequence in a nucleic acid molecule that is common among two or more polynucleotide molecules. For example, an adaptor having a universal sequence can be operably joined to a plurality of polynucleotides so that the population of co-joined molecules carry the same universal adaptor sequence. Examples of universal adaptor sequences include an amplification primer sequence, a sequencing primer sequence or a capture primer sequence (e.g., soluble or immobilized capture primers).
[0114] When used in reference to nucleic acid molecules, the terms “hybridize” or “hybridizing” or “hybridization” or other related terms refer to hydrogen bonding between two different nucleic acids to form a duplex nucleic acid. Hybridization also includes hydrogen bonding between two different regions of a single nucleic acid molecule to form a self-hybridizing molecule having a duplex region. Hybridization can comprise Watson-Crick or Hoogstein binding to form a duplex double-stranded nucleic acid, or a double-stranded region within a nucleic acid molecule. The double-stranded nucleic acid, or the two different regions of a single nucleic acid, may be wholly complementary, or partially complementary. Complementary nucleic acid strands need not hybridize with each other across their entire length. The complementary base pairing can be the standard A-T or C-G base pairing, or can be other forms of base-pairing interactions. Duplex nucleic acids can include mismatched base-paired nucleotides.
[0115] When used in reference to nucleic acids, the terms “extend”, “extending”, “extension” and other variants, refers to incorporation of one or more nucleotides into a nucleic acid molecule. Nucleotide incorporation comprises polymerization of one or more nucleotides into the terminal 3’ OH end of a nucleic acid strand, resulting in extension of the nucleic acid strand. Nucleotide incorporation can be conducted with natural nucleotides and / or nucleotide analogs. Typically, but not necessarily, nucleotide incorporation occurs in atemplate-dependent fashion. Any suitable method of extending a nucleic acid molecule may be used, including primer extension catalyzed by a DNA polymerase or RNA polymerase.
[0116] The term “nucleotides” and related terms refers to a molecule comprising an aromatic base, a five carbon sugar (e.g., a ribose or a deoxyribose), and at least one phosphate group. Canonical or non-canonical nucleotides are consistent with use of the term. The phosphate in some embodiments comprises a monophosphate, a diphosphate, or a triphosphate, or a corresponding phosphate analog. The term “nucleoside” refers to a molecule comprising an aromatic base and a sugar. Nucleotides and nucleosides can be nonlabeled or labeled with a detectable reporter moiety.
[0117] Nucleotides (and nucleosides) typically comprise a hetero cyclic base including substituted or unsubstituted nitrogen-containing parent heteroaromatic ring which are commonly found in nucleic acids, including naturally-occurring, substituted, modified, or engineered variants, or analogs of the same. The base of a nucleotide (or nucleoside) is capable of forming Watson-Crick and / or Hoogstein hydrogen bonds with an appropriate complementary base. Exemplary bases include, but are not limited to, purines and pyrimidines such as: 2-aminopurine, 2,6-diaminopurine, adenine (A), ethenoadenine, N6-A2- isopentenyladenine (6iA), N6-A2-isopentenyl-2-methylthioadenine (2ms6iA), N6- methyladenine, guanine (G), isoguanine, N2-dimethylguanine (dmG), 7-methylguanine (7mG), 2-thiopyrimidine, 6-thioguanine (6sG), hypoxanthine and O6-methylguanine; 7- deaza-purines such as 7-deazaadenine (7-deaza-A) and 7-deazaguanine (7-deaza-G); pyrimidines such as cytosine (C), 5-propynylcytosine, isocytosine, thymine (T), 4- thiothymine (4sT), 5,6-dihydrothymine, O4-methylthymine, uracil (U), 4-thiouracil (4sU) and 5,6-dihydrouracil (dihydrouracil; D); indoles such as nitroindole and 4-methylindole; pyrroles such as nitropyrrole; nebularine; inosines (I); hydroxymethylcytosines; 5-methycytosines; base (Y); as well as methylated, glycosylated, and acylated base moieties; and the like. Additional exemplary bases can be found in Fasman, 1989, in “Practical Handbook of Biochemistry and Molecular Biology”, pp. 385-394, CRC Press, Boca Raton, Fla.
[0118] Nucleotides (and nucleosides) typically comprise a sugar moiety, such as a carbocyclic moiety (Ferraro and Gotor 2000 Chem. Rev. 100: 4319-48), an acyclic moieties (Martinez, et al., 1999 Nucleic Acids Research 27: 1271-1274; Martinez, et al., 1997 Bioorganic & Medicinal Chemistry Letters vol. 7: 3013-3016), and other sugar moieties (Joeng, et al., 1993 J. Med. Chem. 36: 2627-2638; Kim, et al., 1993 J. Med. Chem. 36: 30-7; Eschenmosser 1999 Science 284:2118-2124; and U.S. Pat. No. 5,558,991). The sugar moiety comprises: ribosyl; 2'-deoxyribosyl; 3 '-deoxyribosyl; 2', 3 '-dideoxyribosyl; 2', 3'-didehydrodideoxyribosyl; 2'-alkoxyribosyl; 2'-azidoribosyl; 2'-aminoribosyl; 2'-fluororibosyl; 2'-mercaptoriboxyl; 2'-alkylthioribosyl; 3 '-alkoxyribosyl; 3 '-azidoribosyl; 3 '-aminoribosyl; 3 '-fluororibosyl; 3'-mercaptoriboxyl; 3 '-alkylthioribosyl carbocyclic; acyclic or other modified sugars.
[0119] In some embodiments, nucleotides comprise a chain of one, two or three phosphorus atoms where the chain is typically attached to the 5’ carbon of the sugar moiety via an ester or phosphoramide linkage. In some embodiments, the nucleotide is an analog having a phosphorus chain in which the phosphorus atoms are linked together with intervening O, S, NH, methylene or ethylene. In some embodiments, the phosphorus atoms in the chain include substituted side groups including O, S or BH3. In some embodiments, the chain includes phosphate groups substituted with analogs including phosphoramidate, phosphorothioate, phosphordithioate, and O-methylphosphoramidite groups.
[0120] The term “reporter moiety”, “reporter moieties” or related terms refer to a compound that generates, or causes to generate, a detectable signal. A reporter moiety is sometimes called a “label”. Any suitable reporter moiety may be used, including luminescent, photoluminescent, electroluminescent, bioluminescent, chemiluminescent, fluorescent, phosphorescent, chromophore, radioisotope, electrochemical, mass spectrometry, Raman, hapten, affinity tag, atom, or an enzyme. A reporter moiety generates a detectable signal resulting from a chemical or physical change (e.g., heat, light, electrical, pH, salt concentration, enzymatic activity, or proximity events). A proximity event includes two reporter moieties approaching each other, or associating with each other, or binding each other. It is well known to one skilled in the art to select reporter moieties so that each absorbs excitation radiation and / or emits fluorescence at a wavelength distinguishable from the other reporter moieties to permit monitoring the presence of different reporter moieties in the same reaction or in different reactions. Two or more different reporter moieties can be selected having spectrally distinct emission profiles, or having minimal overlapping spectral emission profiles. Reporter moieties can be linked (e.g., operably linked) to nucleotides, nucleosides, nucleic acids, enzymes (e.g., polymerases or reverse transcriptases), or support (e.g., surfaces).
[0121] A reporter moiety (or label) generally comprises a fluorescent label or a fluorophore. Exemplary fluorescent moieties which may serve as fluorescent labels or fluorophores include, but are not limited to fluorescein and fluorescein derivatives such as carboxyfluorescein, tetrachlorofluorescein, hexachlorofluorescein, carboxynapthofluorescein, fluorescein isothiocyanate, NHS-fluorescein, iodoacetamidofluorescein, fluoresceinmaleimide, SAMSA-fluorescein, fluorescein thiosemicarbazide, carbohydrazinomethylthioacetyl-amino fluorescein, rhodamine and rhodamine derivatives such as TRITC, TMR, lissamine rhodamine, Texas Red, rhodamine B, rhodamine 6G, rhodamine 10, NHS-rhodamine, TMR-iodoacetamide, lissamine rhodamine B sulfonyl chloride, lissamine rhodamine B sulfonyl hydrazine, Texas Red sulfonyl chloride, Texas Red hydrazide, coumarin and coumarin derivatives such as AMCA, AMCA-NHS, AMCA-sulfo- NHS, AMCA-HPDP, DCIA, AMCE-hydrazide, BODIPY and derivatives such as BODIPY FL C3-SE, BODIPY 530 / 550 C3, BODIPY 530 / 550 C3-SE, BODIPY 530 / 550 C3 hydrazide, BODIPY 493 / 503 C3 hydrazide, BODIPY FL C3 hydrazide, BODIPY FL IA, BODIPY 530 / 551 IA, Br-BODIPY 493 / 503, Cascade Blue and derivatives such as Cascade Blue acetyl azide, Cascade Blue cadaverine, Cascade Blue ethylenediamine, Cascade Blue hydrazide, Lucifer Yellow and derivatives such as Lucifer Yellow iodoacetamide, Lucifer Yellow CH, cyanine and derivatives such as indolium based cyanine dyes, benzo-indolium based cyanine dyes, pyridium based cyanine dyes, thiozolium based cyanine dyes, quinolinium based cyanine dyes, imidazolium based cyanine dyes, Cy 3, Cy5, lanthanide chelates and derivatives such as BCPDA, TBP, TMT, BHHCT, BCOT, Europium chelates, Terbium chelates, Alexa Fluor® dyes, DyLight® dyes, Atto™ dyes, LightCycler® Red dyes, CAL Flour dyes, JOE and derivatives thereof, Oregon Green™ dyes, WellRED dyes, IRD dyes, phycoerythrin and phycobilin dyes, Malachite green, stilbene, DEG dyes, NR dyes, nearinfrared dyes and others known in the art such as those described in Haugland, Molecular Probes Handbook, (Eugene, Oreg.) 6th Edition; Lakowicz, Principles of Fluorescence Spectroscopy, 2nd Ed., Plenum Press New York (1999), or Hermanson, Bioconjugate Techniques, 2nd Edition, or derivatives thereof, or any combination thereof. Cyanine dyes may exist in either sulfonated or non-sulfonated forms, and consist of two indolenin, benzo- indolium, pyridium, thiozolium, and / or quinolinium groups separated by a polymethine bridge between two nitrogen atoms. Commercially available cyanine fluorophores include, for example, Cy3, (which may comprise l-[6-(2,5-dioxopyrrolidin-l-yloxy)-6-oxohexyl]-2- (3-{ l-[6-(2,5-dioxopyrrolidin-l-yloxy)-6-oxohexyl]-3,3-dimethyl-l,3-dihydro-2H-indol-2- ylidenejprop- 1 -en- 1 -yl)-3 ,3 -dimethyl-3H-indolium or 1 - [6-(2, 5-dioxopyrrolidin- 1 -yloxy)-6- oxohexyl]-2-(3-{ l-[6-(2,5-dioxopyrrolidin-l-yloxy)-6-oxohexyl]-3,3-dimethyl-5-sulfo-l,3- dihydro-2H-indol-2-ylidene}prop-l-en-l-yl)-3,3-dimethyl-3H-indolium-5-sulfonate), Cy5 (which may comprise l-(6-((2,5-dioxopyrrolidin-l-yl)oxy)-6-oxohexyl)-2-((lE,3E)-5-((E)-l- (6-((2,5-dioxopyrrolidin-l-yl)oxy)-6-oxohexyl)-3,3-dimethyl-5-indolin-2-ylidene)penta-l,3- dien- 1 -yl)-3 ,3 -dimethyl-3H-indol- 1 -ium or 1 -(6-((2, 5-dioxopyrrolidin- 1 -yl)oxy)-6-oxohexyl)-2-((lE,3E)-5-((E)-l-(6-((2,5-dioxopyrrolidin-l-yl)oxy)-6-oxohexyl)-3,3-dimethyl- 5-sulfoindolin-2-ylidene)penta-l,3-dien-l-yl)-3,3-dimethyl-3H-indol-l-ium-5-sulfonate), and Cy7 (which may comprise l-(5-carboxypentyl)-2-[(lE,3E,5E,7Z)-7-(l-ethyl-l,3-dihydro-2H- indol-2-ylidene)hepta-l,3,5-trien-l-yl]-3H-indolium or l-(5-carboxypentyl)-2- [(lE,3E,5E,7Z)-7-(l-ethyl-5-sulfo-l,3-dihydro-2H-indol-2-ylidene)hepta-l,3,5-trien-l-yl]- 3H-indolium-5-sulfonate), where “Cy” stands for 'cyanine', and the first digit identifies the number of carbon atoms between two indolenine groups. Cy2 which is an oxazole derivative rather than indolenin, and the benzo-derivatized Cy3.5, Cy5.5 and Cy7.5 are exceptions to this rule. Additional suitable dyes are described, for example, in U.S. 2024 / 0240249A1, the contents of which are incorporated by reference in their entirety herein.
[0122] In some embodiments, the reporter moiety can be a FRET pair, such that multiple classifications can be performed under a single excitation and imaging step. As used herein, FRET may comprise excitation exchange (Forster) transfers, or electron-exchange (Dexter) transfers.
[0123] When used in reference to nucleic acids, the terms “amplify”, “amplifying”, “amplification”, and other related terms include producing multiple copies of an original polynucleotide template molecule, where the copies comprise a sequence that is complementary to the template sequence, or the copies comprise a sequence that is the same as the template sequence. In some embodiments, the copies comprise a sequence that is substantially identical to a template sequence, or is substantially identical to a sequence that is complementary to the template sequence.
[0124] The term “support” as used herein refers to a substrate that is designed for deposition of biological molecules or biological samples for assays and / or analyses. Examples of biological molecules to be deposited onto a support include nucleic acids (e.g., DNA, RNA), polypeptides, saccharides, lipids, a single cell or multiple cells. Examples of biological samples include but are not limited to saliva, phlegm, mucus, blood, plasma, serum, urine, stool, sweat, tears and fluids from tissues or organs.
[0125] A “capture primer” or “surface capture primer” and the like refers to an oligonucleotide immobilized to a support that is complementary to a portion of, and capable of hybridizing with a given oligonucleotide, such as the library molecules and / or template molecules described herein. A “pinning primer” or “surface pinning primer” and the like refers to an oligonucleotide immobilized to a support that is complementary to a second portion of, and capable of hybridizing with the given oligonucleotide, thereby “pinning” an additional portion of the nucleotide to the support.
[0126] In some embodiments, the support is solid, semi-solid, or a combination of both. In some embodiments, the support is porous, semi-porous, non-porous, or any combination of porosity. In some embodiments, the support can be substantially planar, concave, convex, or any combination thereof. In some embodiments, the support can be cylindrical, for example comprising a capillary or interior surface of a capillary.
[0127] In some embodiments, the surface of the support can be substantially smooth. In some embodiments, the support can be regularly or irregularly textured, including bumps, etched, pores, three-dimensional scaffolds, or any combination thereof.
[0128] In some embodiments, the support comprises a bead having any shape, including spherical, hemi-spherical, cylindrical, barrel-shaped, toroidal, disc-shaped, rod-like, conical, triangular, cubical, polygonal, tubular or wire-like.
[0129] The support can be fabricated from any material, including but not limited to glass, fused-silica, silicon, a polymer (e.g., polystyrene (PS), macroporous polystyrene (MPPS), polymethylmethacrylate (PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE), high density polyethylene (HDPE), cyclic olefin polymers (COP), cyclic olefin copolymers (COC), polyethylene terephthalate (PET)), or any combination thereof. Various compositions of both glass and plastic substrates are contemplated.
[0130] The support can have a plurality (e.g., two or more) of nucleic acid template molecules immobilized thereon. The plurality of immobilized nucleic acid template molecules have the same sequence or have different sequences. In some embodiments, individual template molecules in the plurality of nucleic acid template molecules are immobilized to a different site on the support. In some embodiments, two or more individual template molecules in the plurality of nucleic acid template molecules are immobilized to a site on the support.
[0131] The term “array” refers to a support comprising a plurality of sites located at predetermined locations on the support to form an array of sites. The sites can be discrete and separated by interstitial regions. In some embodiments, the pre-determined sites on the support can be arranged in one dimension in a row or a column, or arranged in two dimensions in rows and columns. In some embodiments, the plurality of pre-determined sites is arranged on the support in an organized fashion. In some embodiments, the plurality of pre-determined sites is arranged in any organized pattern, including rectilinear, hexagonal patterns, grid patterns, patterns having reflective symmetry, patterns having rotational symmetry, or the like. The pitch between different pairs of sites can be that same or can vary. In some embodiments, the support comprises at least 102sites, at least 103sites, at least 104sites, at least IO5sites, at least 106sites, at least 107sites, at least 108sites, at least 109sites, at least IO10sites, at least IO11sites, at least 1012sites, at least 1013sites, at least 1014sites, at least IO15sites, or more, where the sites are located at pre-determined locations on the support. In some embodiments, a plurality of pre-determined sites on the support (e.g., 102- 1015sites or more) are immobilized with nucleic acid template molecules to form a nucleic acid template array. In some embodiments, the support comprises about 102sites and about 1015sites, between about 105sites and about 1015sites, between about IO10sites and about1015sites, between about 103sites and about 1014sites, between about 104sites and about1013sites, between about 105sites and about 1012sites, between about 106and about 1011sites, between about 107sites and about IO10sites, or between about 108sites and about IO10sites, or any range therebetween, on the support. In some embodiments, the nucleic acid template molecules that are immobilized at a plurality of pre-determined sites by hybridization to immobilized surface capture primers, or the nucleic acid template molecules are covalently attached to the surface capture primer. In some embodiments, the nucleic acid template molecules that are immobilized at a plurality of pre-determined sites, for example immobilized at 102- 1015sites or more. In some embodiments, the immobilized nucleic acid template molecules are clonally-amplified to generate immobilized nucleic acid clusters (also referred to as “polonies”) at the plurality of pre-determined sites. In some embodiments, individual immobilized nucleic acid clusters comprise linear clusters, or comprise singlestranded or double-stranded concatemer template molecules.
[0132] In some embodiments, a support comprising a plurality of sites located at random locations on the support is referred to herein as a support having randomly located sites thereon. The location of the randomly located sites on the support are not pre-determined. The plurality of randomly-located sites is arranged on the support in a disordered and / or unpredictable fashion. In some embodiments, the support comprises at least 102sites, at least 103sites, at least 104sites, at least 105sites, at least 106sites, at least 107sites, at least 108sites, at least 109sites, at least IO10sites, at least 1011sites, at least 1012sites, at least 1013sites, at least 1014sites, at least 1015sites, or more, where the sites are randomly located on the support. In some embodiments, a plurality of randomly located sites on the support (e.g., 102- 1015sites or more) are immobilized with nucleic acid template molecules to form a support immobilized with nucleic acid template molecules. In some embodiments, the support comprises about 102sites and about 1015sites, between about 105sites and about 1015sites, between about IO10sites and about 1015sites, between about 103sites and about 1014sites, between about 104sites and about 1013sites, between about 105sites and about 1012sites, between about 106and about 1011sites, between about 107sites and about IO10sites, or between about 108sites and about IO10sites, or any range therebetween, on the support. In some embodiments, the nucleic acid template molecules that are immobilized at a plurality of randomly located sites by hybridization to immobilized surface capture primers, or the nucleic acid template molecules are covalently attached to the surface capture primer. In some embodiments, the nucleic acid template molecules that are immobilized at a plurality of randomly located sites, for example immobilized at 102- 1015sites or more. In some embodiments, the immobilized nucleic acid template molecules are clonally-amplified to generate immobilized nucleic acid clusters at the plurality of randomly located sites. In some embodiments, individual immobilized nucleic acid clusters comprise linear clusters, or comprise single-stranded or double-stranded concatemer template molecules.
[0133] In some embodiments, the support comprises a plurality of surface capture primer immobilized to the support (“immobilized surface capture primers”). In some embodiment, the plurality of immobilized surface capture primers on the support are in fluid communication with each other to permit flowing a solution of reagents (e.g., template molecules, soluble primers, enzymes, nucleotides, divalent cations, buffers, and the like) onto the support so that the plurality of immobilized surface capture primers on the support can be essentially simultaneously reacted with the reagents in a massively parallel manner. In some embodiments, the fluid communication of the plurality of immobilized surface capture primers can be used to conduct nucleic acid amplification reactions (e.g., RCA, MDA, PCR and bridge amplification) essentially simultaneously on the plurality of immobilized surface capture primers.
[0134] In some embodiment, the plurality of immobilized nucleic acid clusters on the support are in fluid communication with each other to permit flowing a solution of reagents (e.g., enzymes, nucleotides, divalent cations, and the like) onto the support so that the plurality of immobilized nucleic acid clusters on the support can be essentially simultaneously reacted with the reagents in a massively parallel manner. In some embodiments, the fluid communication of the plurality of immobilized nucleic acid clusters can be used to conduct nucleotide binding assays and / or conduct nucleotide polymerization reactions (e.g., primer extension or sequencing) essentially simultaneously on the plurality of immobilized nucleic acid clusters, and optionally to conduct detection and imaging for massively parallel sequencing.
[0135] When used in reference to immobilized enzymes, the term “immobilized” and related terms refer to enzymes (e.g., polymerases) that are attached to a support throughcovalent bond or non-covalent interaction, or attached to a coating on the support, or buried within a matrix formed by a coating on the support.
[0136] When used in reference to immobilized nucleic acids, the term “immobilized” and related terms refer to nucleic acid molecules that are attached to a support through covalent bond or non-covalent interaction, or attached to a coating on the support, or buried within a matrix formed by a coating on the support, where the nucleic acid molecules include surface capture primers, template molecules and extension products of capture primers. Extension products of capture primers includes nucleic acid concatemers (e.g., nucleic acid clusters).
[0137] In some embodiments, one or more nucleic acid template molecules are immobilized on the support, for example immobilized at the sites on the support, thereby generating immobilized nucleic acid template molecules. In some embodiments, the one or more nucleic acid template molecules are clonally-amplified. In some embodiments, the one or more nucleic acid template molecules are concatemer template molecules. In some embodiments, the one or more nucleic acid template molecules are clonally-amplified off the support (e.g., in-solution) and then deposited onto the support and immobilized on the support. In some embodiments, the clonal amplification reaction of the one or more nucleic acid template molecules is conducted on the support resulting in immobilization on the support. In some embodiments, the one or more nucleic acid template molecules are clonally- amplified (e.g., in solution or on the support) using a nucleic acid amplification reaction. Nucleic acid amplification reactions include, for example and without limitation, any one or any combination of: polymerase chain reaction (PCR), multiple displacement amplification (MDA), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), real-time SDA, bridge amplification, isothermal bridge amplification, rolling circle amplification (RCA), circle-to- circle amplification, helicase-dependent amplification, recombinase-dependent amplification, and / or single-stranded binding (SSB) protein-dependent amplification.
[0138] As used herein, the term “binding complex” refers to a complex formed by binding together a nucleic acid duplex, a polymerase, and a free nucleotide or a nucleotide moiety of a multivalent molecule, where the nucleic acid duplex comprises a nucleic acid template molecule hybridized to a nucleic acid primer. In the binding complex, the free nucleotide or nucleotide moiety may or may not be bound to the 3’ end of the nucleic acid primer at a position that is opposite a complementary nucleotide in the nucleic acid template molecule. A “ternary complex” is an example of a binding complex which is formed by binding together a nucleic acid duplex, a polymerase, and a free nucleotide or nucleotidemoiety of a multivalent molecule, where the free nucleotide or nucleotide moiety is bound to the 3’ end of the nucleic acid primer (as part of the nucleic acid duplex) at a position that is opposite a complementary nucleotide in the nucleic acid template molecule.
[0139] The term “persistence time” and related terms refers to the length of time that a binding complex, which is formed between the target nucleic acid, a primer, a polymerase, a conjugated or unconjugated nucleotide, remains stable without any binding component dissociates from the binding complex. The persistence time is indicative of the stability of the binding complex and strength of the binding interactions. Persistence time can be measured by observing the onset and / or duration of a binding complex, such as by observing a signal from a labeled component of the binding complex. For example, a labeled nucleotide or a labeled reagent comprising one or more nucleotides may be present in a binding complex, thus allowing the signal from the label to be detected during the persistence time of the binding complex. One exemplary label is a fluorescent label.Methods for Generating Compact DNA Nanoballs
[0140] The present disclosure provides methods for generating a plurality of compact DNA nanoballs immobilized to a support, comprising step (a): providing a support comprising (i) a plurality of surface capture primers immobilized to the support, wherein individual surface capture primers comprise a 3’ extendible end, (ii) a plurality of surface pinning primers immobilized to the support wherein individual surface pinning primers comprise a 3’ non-extendible end, and (iii) a plurality of covalently closed circular polynucleotide molecules (also referred to herein as “covalently closed circular library molecules” and the like), wherein individual covalently closed circular polynucleotide molecules are hybridized to a surface capture primer thereby forming a plurality of immobilized circular molecule-capture primer duplexes (e.g., FIGS. 15-20).
[0141] In some embodiments, in step (a), the support comprises glass, plastic and / or a polymer material. In some embodiments, in step (a), the support can be passivated with at least one hydrophilic polymer coating. In some embodiments, the plurality of surface capture primers and the plurality of surface pinning primers can be covalently joined to the at least one hydrophilic polymer coating. In some embodiments, in step (a), the at least one hydrophilic polymer coating can have a water contact angle of no more than 45 degrees.
[0142] In some embodiments, in step (a), the support comprises a plurality of immobilized surface primers including a mixture of capture primers and pinning primers which are immobilized to the support or immobilized to the coating on the support.
[0143] In some embodiments, in step (a), the plurality of surface capture primers can be immobilized to the support at random locations. In some embodiments, in step (a), the plurality of surface capture primers can be immobilized to the support at pre-determined locations. For example, the plurality of surface capture primers can be immobilized to the support in a pattern.
[0144] In some embodiments, in step (a), the plurality of immobilized surface capture primers include or lack a nucleotide having a scissile moiety that can be cleaved.
[0145] In some embodiments, in step (a), the plurality of surface pinning primers can be immobilized to the support at random locations. In some embodiments, in step (a), the plurality of surface pinning primers can be immobilized to the support at pre-determined locations. For example, the plurality of surface pinning primers can be immobilized to the support in a pattern.
[0146] In some embodiments, in step (a), the support comprises a plurality of surface capture primers immobilized thereon at a density of about 102- 1015surface capture primers per mm2, e.g., between about 102sites and about 1015sites, between about 105sites and about 1015sites, between about 1010sites and about 1015sites, between about 103sites and about1014sites, between about 104sites and about 1013sites, between about 105sites and about 1012sites, between about 106and about 1011sites, between about 107sites and about 1010sites, or between about 108sites and about 1010sites, or any range therebetween.
[0147] In some embodiments, in step (a), the support comprises a plurality of surface pinning primers immobilized thereon at a density of about 102- 1015surface pinning primers per mm2, e.g., between about 102sites and about 1015sites, between about 105sites and about1015sites, between about 1010sites and about 1015sites, between about 103sites and about1014sites, between about 104sites and about 1013sites, between about 105sites and about 1012sites, between about 106and about 1011sites, between about 107sites and about 1010sites, or between about 108sites and about 1010sites, or any range therebetween.
[0148] In some embodiments, in step (a), the support comprises a mixture of capture and pinning primers immobilized thereon at a density of about 102- 1015pinning primers per mm2, e.g., between about 102sites and about 1015sites, between about 105sites and about1015sites, between about 1010sites and about 1015sites, between about 103sites and about 1014sites, between about 104sites and about 1013sites, between about 105sites and about 1012sites, between about 106and about 1011sites, between about 107sites and about 1010sites, or between about 108sites and about 1010sites, or any range therebetween.
[0149] In some embodiments, in step (a), the support comprises a mixture of capture and pinning primers immobilized thereon at a density of about 102- 1015capture primers per mm2, e.g., between about 102sites and about 1015sites, between about 105sites and about 1015sites, between about IO10sites and about 1015sites, between about 103sites and about 1014sites, between about 104sites and about 1013sites, between about 105sites and about 1012sites, between about 106and about 1011sites, between about 107sites and about IO10sites, or between about 108sites and about 1010sites, or any range therebetween.
[0150] In some embodiments, in step (a), the support lacks partitions or barriers that separate regions of the support. In some embodiments, in step (a), the support comprises partitions or barriers that separate regions of the support.
[0151] In some embodiments, in step (a), the plurality of covalently closed circular polynucleotide molecules comprise RNA, cDNA or DNA. In some embodiments, in step (a), individual covalently closed circular polynucleotide molecules in the plurality comprise a sequence-of-interest (110) that is 200 - 5000 (e.g., between about 200 and about 3000, between about 500 and about 2000, between about 1000 and about 2500, or any range therebetween) nucleotides in length. In some embodiments, in step (a), individual covalently closed circular polynucleotide molecules in the plurality comprise a sequence-of-interest (110) and lack a universal adaptor sequence. For example individual covalently closed circular polynucleotide molecules comprise RNA, cDNA or DNA which are not appended to a universal adaptor sequence (e.g., FIG. 20).
[0152] In some embodiments, in step (a), individual covalently closed circular polynucleotide molecules in the plurality comprise a covalently closed circular nucleic acid library molecule which comprises a sequence of interest (110) and any one or any combination of two or more universal sequences including: (i) a surface pinning primer binding site sequence (120) (or a complementary sequence thereof), which can be universal; (ii) a surface capture primer binding site sequence (130) (or a complementary sequence thereof), which can be universal; (iii) at least one universal sequence for binding a first sequencing primer (e.g., a forward sequencing primer binding site sequence, (140)) (or a complementary sequence thereof); (iv) at least one universal sequence for binding a second sequencing primer (e.g., a reverse sequencing primer binding site sequence, (150)) (or a complementary sequence thereof); (v) at least one universal sequence for binding a soluble amplification primer (or a complementary sequence thereof); and / or (vi) a universal sequence for binding a compaction oligonucleotide (or a complementary sequence thereof) (e.g., FIGS. 15-19, 25, 26A-26C, 27A-27C). In some embodiments, the covalently closed circular nucleicacid library molecule comprise two or more universal adaptor sequences arranged in any order relative to the sequence of interest (110).
[0153] In some embodiments, the methods for generating a plurality of compact DNA nanoballs immobilized to a support, comprises step (b): contacting the plurality of immobilized circular molecule-capture primer duplexes with a plurality of soluble amplification primers under a condition suitable for hybridizing at least one soluble amplification primer to individual immobilized circular molecule-capture primer duplexes (e.g., FIGS. 15-20). In some embodiments, the circular molecule-capture primer duplexes bind to a plurality of soluble amplification primers, i.e. are multiply primed circular molecule-capture primer duplexes.
[0154] In some embodiments, in step (b), individual immobilized circular moleculecapture primer duplexes comprise a covalently closed circular polynucleotide molecule hybridized to (i) an immobilized capture primer and (ii) hybridized to 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 soluble amplification primers (e.g., FIGS. 15-20). In some embodiments, two or more soluble amplification primers can hybridize to the covalently closed circular polynucleotide molecule so that the two or more soluble amplification primers abut each other to form a nick between the two or more soluble amplification primers (e.g., FIG. 18). In some embodiments, two or more soluble amplification primers can hybridize to the covalently closed circular polynucleotide molecule so that the two or more soluble amplification primers are separated from each other to form a gap of at least one nucleotide distance between the two or more soluble amplification primers (e.g., FIG. 18).
[0155] In some embodiments, in step (b), individual immobilized circular moleculecapture primer duplexes comprise a covalently closed circular polynucleotide molecule hybridized to an immobilized capture primer and at least one soluble amplification primer, wherein the at least one soluble amplification primer is hybridized to any one or any combination of two or more of: (i) the sequence of interest (110); (ii) the surface capture primer binding site sequence (130) (or a complementary sequence thereof), which can be a universal sequence; (iii) the surface pinning primer binding site sequence (120) (or a complementary sequence thereof), which can be a universal sequence; (iv) the universal sequence for binding a first sequencing primer (e.g., a forward sequencing primer binding site sequence, (140)); (v) the universal sequence for binding a second sequencing primer (e.g., a reverse sequencing primer binding site sequence, (150)); and / or (vi) the universal sequence for binding a compaction oligonucleotide (or a complementary sequence thereof) (e.g., FIGS. 15-19).
[0156] In some embodiments, in step (b), individual soluble amplification primers can bind to a sequence in individual covalently closed circular polynucleotide molecules, wherein the soluble amplification primer can bind to any one or any combination of two or more of (i) at least a portion of the sequence of interest (110); (ii) at least a portion of the surface pinning primer binding site sequence (120) (or a complementary sequence thereof), which can be a universal sequence; (iii) at least a portion of the surface capture primer binding site sequence (130) (or a complementary sequence thereof), which can be a universal sequence; (iv) at least a portion of the universal sequence for binding a first sequencing primer (e.g., a forward sequencing primer binding site sequence, (140)); (v) at least a portion of the universal sequence for binding a second sequencing primer (e.g., a reverse sequencing primer binding site sequence, (150)); and / or (vi) at least a portion of the universal sequence for binding a compaction oligonucleotide (or a complementary sequence thereof) (e.g., FIGS. 15- 19).
[0157] In some embodiments, in step (b), the plurality of soluble amplification primers comprise at least one nucleotide analog and / or modified nucleotide linkages that inhibit nuclease digestion including for example phosphorothioate, 2’-O-methyl RNA, inverted dT, and / or 2’ 3’ dideoxy-dT.
[0158] In some embodiments, the methods for generating a plurality of compact DNA nanoballs immobilized to a support, comprises step (c): conducting rolling circle amplification reaction on the plurality of immobilized circular molecule-capture primer duplexes, in the presence of a plurality of compaction oligonucleotides, thereby generating a plurality of compact DNA nanoballs immobilized to the support. In some embodiments, individual compact DNA nanoballs comprise (i) a concatemer template molecule generated by RCA-extension of an immobilized capture primer and (ii) at least one concatemer template molecule generated by RCA-extension of a soluble amplification primer (e.g., FIGS. 15-20). In some embodiments, at least a portion of individual compact DNA nanoballs is hybridized to an immobilized pinning primer (e.g., FIG. 21).
[0159] In some embodiments, in step (c), the rolling circle amplification reaction generates a plurality of compact DNA nanoballs immobilized to the support at a density of about 102- 1015compact DNA nanoballs per mm2. In some embodiments, the rolling circle amplification reaction generates a plurality of compact DNA nanoballs immobilized to the support at a density of about 102- 103compact DNA nanoballs per mm2, or about 103- 104compact DNA nanoballs per mm2, or about 104- 105compact DNA nanoballs per mm2, or about 105- 106compact DNA nanoballs per mm2, or about 106- 107compact DNAnanoballs per mm2, or about 107- 108compact DNA nanoballs per mm2, or about 108- 109compact DNA nanoballs per mm2, or about 109- IO10compact DNA nanoballs per mm2, or about IO10- 1011compact DNA nanoballs per mm2, or about 1011- 1012compact DNA nanoballs per mm2, or about 1012- 1013compact DNA nanoballs per mm2, or about 1013- 1014compact DNA nanoballs per mm2, or about 1014- 1015compact DNA nanoballs per mm2, or any range therebetween.
[0160] In some embodiments, in step (c), the rolling circle amplification reaction generates a plurality of compact DNA nanoballs immobilized to the support that are in fluid communication with each other to permit flowing a solution of reagents onto the support so that the plurality of immobilized compact DNA nanoballs on the support react with the solution of reagents in a massively parallel manner.
[0161] In some embodiments, in step (c), the rolling circle amplification reaction comprises contacting the plurality of the immobilized circular molecule-capture primer duplexes of step (b) with a plurality of strand displacing polymerases, a plurality of nucleotides, and a plurality of compaction oligonucleotides. In some embodiments, the plurality of nucleotides comprise at least one nucleotide having a scissile moiety that can be cleaved to generate an abasic site in the immobilized compact DNA nanoball. In some embodiments, the at least one nucleotide having a scissile moiety comprises uridine, 8-oxo- 7,8-dihydrogunine or deoxyinosine.
[0162] In some embodiments, in step (c), the plurality of compaction oligonucleotides comprise at least a first and second compaction oligonucleotide. In some embodiments, the first compaction oligonucleotide comprises a first portion that hybridizes to a first portion of a concatemer template molecule generated by RCA-extension of an immobilized capture primer, and a second portion that hybridizes to a second portion of the same concatemer template molecule to pull together distal portions of the concatemer template molecule causing compaction of the concatemer molecule generated by RCA-extension of an immobilized capture primer. In some embodiments, the second compaction oligonucleotide comprises a first portion that hybridizes to a first portion of a concatemer template molecule generated by RCA-extension of a soluble amplification primer, and a second portion that hybridizes to a second portion of the same concatemer template molecule to pull together distal portions of the concatemer template molecule causing compaction of the concatemer template molecule generated by RCA-extension of a soluble amplification primer. In some embodiments, compaction of the concatemer template molecule generated by RCA-extension of an immobilized capture primer and compaction of the concatemer template moleculegenerated by RCA-extension of a soluble amplification primer generates a compact DNA nanoball. In some embodiments, the first and the second compaction oligonucleotides comprise the same sequence or different sequences.
[0163] In some embodiments, in step (c), individual compaction oligonucleotides in the plurality comprise nucleic acids and can have any shape including a linear, a branched, a star or a dendrimer shape (e.g., a bottle brush shape) (e.g., FIGS. 30-35C). In some embodiments, a compaction oligonucleotide can fold by forming intra-molecule base pairing having duplex portions via Watson-Crick base pairing, Hoogstein base pairing and / or a G-quadruplex structure. In some embodiments, the compaction oligonucleotides comprise nucleic acids that can fold into any shape having at least one hairpin, at least one stem-loop and / or at least one star shape. In some embodiments, individual compaction oligonucleotides comprise at least two binding regions that hybridize to at least a first and second portion of the same concatemer template molecule (e.g., FIGS. 30-35C). In some embodiments, individual compaction oligonucleotides comprise three binding regions that hybridize to a first, second and third portion of the same concatemer template molecule (e.g., FIGS. 31A-31C, 32A-32B, 35C). In some embodiments, individual compaction oligonucleotides comprise four binding regions that hybridize to a first, second, third and fourth portion of the same concatemer template molecule (e.g., FIG. 34).
[0164] In some embodiments, in step (c), the first portion of the first compaction oligonucleotide can hybridize to a first portion of a concatemer template molecule generated by RCA-extension of an immobilized capture primer. In some embodiments, the first portion of a concatemer template molecule generated by RCA-extension of an immobilized capture primer comprises: (i) at least a portion of the sequence of interest (110); (ii) at least a portion of the surface pinning primer binding site sequence (120) (or a complementary sequence thereof), which can be a universal sequence; (iii) at least a portion of the surface capture primer binding site sequence (130) (or a complementary sequence thereof), which can be a universal sequence; (iv) at least a portion of the universal sequence for binding a first sequencing primer (e.g., the forward sequencing primer binding site sequence, (140)); or (v) at least a portion of the universal sequence for binding a second sequencing primer (e.g., a reverse sequencing primer binding site sequence, (150)).
[0165] In some embodiments, in step (c), the second portion of the first compaction oligonucleotide can hybridize to a second portion of a concatemer template molecule generated by RCA-extension of an immobilized capture primer. In some embodiments, the second portion of a concatemer template molecule generated by RCA-extension of animmobilized capture primer comprises: (i) at least a portion of the sequence of interest (110); (ii) at least a portion of the surface pinning primer binding site sequence (120) (or a complementary sequence thereof), which can be a universal sequence; (iii) at least a portion of the surface capture primer binding site sequence (130) (or a complementary sequence thereof), which can be a universal sequence; (iv) at least a portion of the universal sequence for binding a first sequencing primer (e.g., the forward sequencing primer binding site sequence, (140)); or (v) at least a portion of the universal sequence for binding a second sequencing primer (e.g., a reverse sequencing primer binding site sequence, (150)).
[0166] In some embodiments, in step (c), the first portion of the second compaction oligonucleotide can hybridize to a first portion of a concatemer template molecule generated by RCA-extension of a soluble amplification primer. In some embodiments, the first portion of a concatemer template molecule generated by RCA-extension of an immobilized capture primer comprises: (i) at least a portion of the sequence of interest (110); (ii) at least a portion of the surface pinning primer binding site sequence (120) (or a complementary sequence thereof), which can be a universal sequence; (iii) at least a portion of the surface capture primer binding site sequence (130) (or a complementary sequence thereof), which can be a universal sequence; (iv) at least a portion of the universal sequence for binding a first sequencing primer (e.g., the forward sequencing primer binding site sequence, (140)); or (v) at least a portion of the universal sequence for binding a second sequencing primer (e.g., a reverse sequencing primer binding site sequence, (150)).
[0167] In some embodiments, in step (c), the second portion of the second compaction oligonucleotide can hybridize to a second portion of a concatemer template molecule generated by RCA-extension of a soluble amplification primer. In some embodiments, the second portion of a concatemer template molecule generated by RCA-extension of an immobilized capture primer comprises: (i) at least a portion of the sequence of interest (110); (ii) at least a portion of the surface pinning primer binding site sequence (120) (or a complementary sequence thereof), which can be a universal sequence; (iii) at least a portion of the surface capture primer binding site sequence (130) (or a complementary sequence thereof), which can be a universal sequence; (iv) at least a portion of the universal sequence for binding a first sequencing primer (e.g., the forward sequencing primer binding site sequence, (140)); or (v) at least a portion of the universal sequence for binding a second sequencing primer (e.g., a reverse sequencing primer binding site sequence, (150)).
[0168] In some embodiments, in step (c), the rolling circle amplification reaction further comprises at least one nucleic acid condenser agent. In some embodiments, the at least onenucleic acid condenser agent comprising a chemical compound which condenses DNA and / or RNA. In some embodiments, the at least one condenser agent comprises any one or any combination of two or more of a polyamine (e.g., MW approximately 600), spermine, spermidine, cadaverine, putrescene, 1,3-diaminopropane (1,3-DAP), polypeptide (e.g., poly(lysine), poly(arginine) or peptide octamers of alternating lysines and serines), manganese chloride, sodium ions, potassium ions, dextran sulfate (e.g., about 150 kDa or about 500 kDa), poly-L-lysine, ethylene glycol, polyethylene glycol (e.g., 2-10 kDa PEG) and / or polyethyleneimine (PEI). In some embodiments, the PEG comprises thiol reactive PEG, methoxy-PEG-maleimide or diamine PEG. In some embodiments, in step (c), the rolling circle amplification reaction lacks a nucleic acid condenser agent.
[0169] In some embodiments, in step (c), plurality of compact DNA nanoballs are immobilized to the support at a high density. In some embodiments, at least some of the immobilized compact DNA nanoballs comprise nearest neighbor compact DNA nanoballs that touch each other and / or overlap each other when viewed from any angle of the support including above, below or side views of the support (e.g., FIG. 13 A(ii)).
[0170] In some embodiments, the methods for generating a plurality of compact DNA nanoballs immobilized to a support, comprises step (d): removing the plurality of covalently closed circular polynucleotide molecules and retaining the plurality of compact DNA nanoballs immobilized to the support.
[0171] In some embodiments, in step (d), the removing comprises washing away the plurality of covalently closed circular polynucleotide molecules and retaining the plurality of compact DNA nanoballs immobilized to the support.
[0172] In some embodiments, the methods for generating a plurality of compact DNA nanoballs immobilized to a support, comprises step (e): sequencing the plurality of the immobilized compact DNA nanoballs.
[0173] In some embodiments, the sequencing of step (e) comprises sequencing the plurality of immobilized compact DNA nanoballs in a massively parallel manner.
[0174] In some embodiments, in step (e), the plurality of compact DNA nanoballs immobilized to the support are in fluid communication with each other to permit flowing a solution of reagents onto the support so that the plurality of immobilized compact DNA nanoballs on the support react with the solution of reagents in a massively parallel manner.
[0175] In some embodiments, the sequencing of step (e) comprises sequencing at least a portion of individual immobilized compact DNA nanoballs.
[0176] In some embodiments, the rolling circle amplification of step (c) can generate a plurality compact DNA nanoball each comprising (i) a concatemer template molecule generated by RCA-extension of an immobilized capture primer and (ii) at least one concatemer template molecule generated by RCA-extension of a soluble amplification primer.
[0177] In some embodiments, the concatemer template molecule generated by RCA- extension of an immobilized capture primer comprises a concatemer template molecule which can be sequenced in step (e). In some embodiments, the sequencing of step (e) comprises sequencing at least a portion of the concatemer template molecule generated by RCA-extension of an immobilized capture primer.
[0178] In some embodiments, the concatemer template molecule generated by RCA- extension of a soluble amplification primer comprises a concatemer template molecule which can be sequenced in step (e). In some embodiments, the sequencing of step (e) comprises sequencing at least a portion of the concatemer template molecule generated by RCA- extension of a soluble amplification primer.
[0179] In some embodiments, the sequencing of step (e) comprises conducting a plurality of cycles of sequencing reactions on the plurality of compact DNA nanoballs. In some embodiments, the sequencing of step (e) comprises sequencing the plurality of compact DNA nanoballs in a massively parallel sequencing workflow, wherein in any given sequencing cycle individual compact DNA nanoballs give increased signal intensity compared to conventional concatemer template molecules that are generated by RCA-extension of an immobilized capture primer in the absence of soluble amplification primers. In some embodiments, the increased signal intensity emitted by individual compact DNA nanoballs improves the sequencing quality score of individual bases undergoing sequencing. In some embodiments, the increased signal intensity emitted by individual compact DNA nanoballs generates a sequencing quality of Q30, Q40 or Q50 across the length of the library insert regions (110). In some embodiments, the increased signal intensity emitted by individual compact DNA nanoballs generates a sequencing quality of Q30, Q40 or Q50 across the length of the library insert regions (110) on both concatemer template molecule strands in a pairwise sequencing workflow.
[0180] In some embodiments, the sequence of step (e) comprises contacting individual compact DNA nanoballs with a plurality of sequencing primers, a plurality of sequencing polymerases and a plurality of nucleotide reagents. In some embodiments, the plurality of nucleotide reagents comprises nucleotides, nucleotide analogs and / or multivalent molecules.
[0181] In some embodiments, the sequencing of step (e) comprises conducting a two- stage sequencing reaction using a plurality of nucleotide reagents, including a plurality of detectably labeled multivalent molecules and a plurality of nucleotide analogs. In some embodiments, in step (e), the sequencing comprises contacting individual compact DNA nanoballs with a plurality of sequencing primers, a plurality of sequencing polymerases and a plurality of detectably labeled multivalent molecules. In some embodiments, individual detectably labeled multivalent molecules comprise a core attached to multiple polymer arms, and wherein individual polymer arms comprises at least one nucleotide moiety (e.g., FIGS. 1- 4).
[0182] In some embodiments, in step (e), the sequencing comprises: (i) binding a concatemer template molecule generated by RCA-extension of an immobilized capture primer with a plurality of sequencing primers, a plurality of sequencing polymerases, and a plurality of detectably labeled multivalent molecules, and (ii) binding a concatemer template molecule generated by RCA-extension of a soluble amplification primer with a plurality of sequencing primers, a plurality of sequencing polymerases, and a plurality of detectably labeled multivalent molecules, thereby generating a compact DNA nanoball immobilized to the support that emits a detectable signal.
[0183] In some embodiments, in step (e), individual detectably labeled multivalent molecules comprise (a) a core; and (b) a plurality of nucleotide arms which comprise (i) a core attachment moiety, (ii) a spacer, (iii) a linker, and (iv) a nucleotide moiety (e.g., FIGS. 2-5). In some embodiments, the core is attached to the plurality of nucleotide arms via their core attachment moiety. In some embodiments, the core attachment moiety is attached to the spacer. In some embodiments, the spacer is attached to the linker. In some embodiments, the linker is attached to the nucleotide moiety.
[0184] In some embodiments, in step (e), individual detectably labeled multivalent molecules comprise (a) a core; and (b) a plurality of nucleotide arms which comprise (i) a core attachment moiety, (ii) a spacer and (iii) a nucleotide moiety (e.g., FIGS. 2-5). In some embodiments, the core is attached to the plurality of nucleotide arms via their core attachment moiety. In some embodiments, the core attachment moiety is attached to the spacer. In some embodiments, the spacer is attached to the nucleotide moiety.
[0185] In some embodiments, in step (e), the linker of a detectably labeled multivalent molecule comprises an aliphatic chain having 2-6 subunits or an oligo ethylene glycol chain having 2-6 subunits (e.g., FIG. 6).
[0186] In some embodiments, in step (e), in a detectably labeled multivalent molecule, the plurality of nucleotide arms attached to a given core have the same type of nucleotide moiety. In some embodiments, the nucleotide moiety comprises dATP, dGTP, dCTP, dTTP or dUTP.
[0187] In some embodiments, in step (e), the plurality of multivalent molecules comprise one type of a multivalent molecule. In some embodiments, individual multivalent molecule in the plurality has the same type of nucleotide moiety selected from a group consisting of dATP, dGTP, dCTP, dTTP and dUTP.
[0188] In some embodiments, in step (e), the plurality of multivalent molecules comprise a mixture of any combination of two or more types of multivalent molecules, individual types of multivalent molecules having nucleotide moieties selected from the group consisting of dATP, dGTP, dCTP, dTTP and / or dUTP.
[0189] In some embodiments, in step (e), individual detectably labeled multivalent molecules in the plurality comprise a core attached to a fluorophore, a polymer arm attached to a fluorophore and / or a nucleotide moiety attached to a fluorophore.
[0190] In some embodiments, in step (e), the sequencing further comprises contacting individual compact DNA nanoballs with a plurality of non-catalytic divalent cations that inhibit polymerase-catalyzed nucleotide incorporation. In some embodiments, the non- catalytic divalent cations comprise strontium, calcium or barium.
[0191] In some embodiments, in step (e), the sequencing comprises: (i) binding a first sequencing primer, a first sequencing polymerase, and a first multivalent molecule to a first portion of a concatemer template molecule of a compact DNA nanoball thereby forming a first binding complex, wherein a first nucleotide moiety of the first multivalent molecule binds to the first sequencing polymerase; and (ii) binding a second sequencing primer, a second sequencing polymerase, and the first multivalent molecule to a second portion of the same concatemer thereby forming a second binding complex, wherein a second nucleotide moiety of the first multivalent molecule binds to the second sequencing polymerase. In some embodiments, the first and the second binding complexes which include the same multivalent molecule form an avidity complex.
[0192] In some embodiments, in step (e), the sequencing comprises: (i) contacting a first plurality of sequencing polymerases and a first plurality of sequencing primers with different portions of a concatemer template molecule of a compact DNA nanoball to form at least first and second polymerase complexes on the same concatemer template molecule; (ii) contacting a plurality of detectably labeled multivalent molecules to the at least first and secondpolymerase complexes on the same concatemer template molecule, under conditions suitable to bind a single multivalent molecule from the plurality to the first and second polymerase complexes, wherein at least a first nucleotide moiety of the single multivalent molecule is bound to the first polymerase complex which includes a first sequencing primer hybridized to a first portion of the concatemer template molecule thereby forming a first binding complex, and wherein at least a second nucleotide moiety of the single multivalent molecule is bound to the second polymerase complex which includes a second sequencing primer hybridized to a second portion of the same concatemer template molecule thereby forming a second binding complex, wherein the contacting is conducted under a condition suitable to inhibit polymerase-catalyzed incorporation of the bound first and second nucleotide moieties in the first and second binding complexes, and wherein the first and second binding complexes which are bound to the same multivalent molecule forms an avidity complex; (iii) detecting the first and second binding complexes on the same concatemer template molecule; and (iv) identifying the first nucleotide moiety in the first binding complex thereby determining the sequence of the first portion of the concatemer template molecule, and identifying the second nucleotide moiety in the second binding complex thereby determining the sequence of the second portion of the concatemer template molecule.
[0193] In some embodiments, in step (e), the sequencing comprises contacting individual compact DNA nanoballs with a plurality of sequencing primers, a plurality of sequencing polymerases and a plurality of nucleotides or a plurality of nucleotide analogs.
[0194] In some embodiments, in step (e), the sequencing comprises contacting individual compact DNA nanoballs with a plurality of detectably labeled nucleotides comprising: (i) binding a concatemer template molecule generated by RCA-extension of an immobilized capture primer with a plurality of sequencing primers, a plurality of sequencing polymerases, and a plurality of detectably labeled nucleotides, and (ii) binding a concatemer template molecule generated by RCA-extension of a soluble amplification primer with a plurality of sequencing primers, a plurality of sequencing polymerases, and a plurality of detectably labeled nucleotides, thereby generating a compact DNA nanoball immobilized to the support that emits a detectable signal.
[0195] In some embodiments, in step (e), individual detectably labeled nucleotides in the plurality comprise an aromatic base, a five carbon sugar, and 1-10 phosphate groups.
[0196] In some embodiments, in step (e), the plurality of detectably labeled nucleotides comprises one type of nucleotide selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.
[0197] In some embodiments, in step (e), the plurality of detectably labeled nucleotides comprises a mixture of any combination of two or more types of nucleotides selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.
[0198] In some embodiments, in step (e), at least one detectably labeled nucleotide in the plurality is labeled with a fluorophore. In some embodiments, in step (e), at least one nucleotide in the plurality lacks a fluorophore label.
[0199] In some embodiments, in step (e), at least one of the detectably labeled nucleotides in the plurality comprises a removable chain terminating moiety attached to the 3’ carbon position of the sugar group. In some embodiments, the removable chain terminating moiety comprises an alkyl group, an alkenyl group, an alkynyl group, an allyl group, an aryl group, a benzyl group, an azide group, an azido group, an O-azidomethyl group, an amine group, an amide group, a keto group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group, an acetal group or a silyl group. In some embodiments, the removable chain terminating moiety is cleavable with a chemical compound to generate an extendible 3 ’OH moiety on the sugar group.
[0200] In some embodiments, in step (e), the sequencing further comprises contacting individual compact DNA nanoballs with a plurality of catalytic divalent cations that promote polymerase-catalyzed nucleotide incorporation. In some embodiments, the catalytic divalent cations comprise magnesium or manganese.Capture Primers and Pinning Primers
[0201] In some embodiments of the methods disclosed herein, the plurality of surface capture primers immobilized to the support (immobilized capture primers) comprises single stranded oligonucleotides comprising DNA, RNA or a combination of DNA and RNA. The surface capture primers can be immobilized to the support or immobilized to a coating on the support (e.g., FIGS. 15-20). The immobilized capture primers can be embedded and attached (coupled) to the coating on the support. The immobilized capture primers can be covalently attached to the coating on the support. In some embodiments, the 5’ end of the immobilized capture primers are immobilized to the support or immobilized to a coating on the support. Alternatively, an interior portion or the 3’ end of the immobilized capture primers can be immobilized to the support or immobilized to a coating on the support. In some embodiments the support comprises a plurality of immobilized capture primers having the same sequence (e.g., a universal capture primer sequence). In some embodiments, individual immobilized capture primers comprise a sequence that can hybridize to at least a portion of individualcovalently closed circular polynucleotide molecules. The immobilized capture primers can be any length, for example 4-50 nucleotides, or 50-100 nucleotides, or 100-150 nucleotides, or any range therebetween, or longer lengths. In some embodiments, the 3’ terminal end of the immobilized capture primers comprise an extendible 3’ OH moiety. In some embodiments, the 3’ terminal end of the immobilized capture primers comprise a 3’ non-extendible moiety. In some embodiments, the non-extendible moiety at the 3 terminal end of individual capture primers can be converted to a 3’ extendible end.
[0202] In some embodiments, the plurality of immobilized capture primers comprise at least one phosphorothioate diester bond at their 5’ ends which can render the capture primers resistant to exonuclease degradation. In some embodiments, the plurality of immobilized capture primers comprise 2-5 or more consecutive phosphorothioate diester bonds at their 5’ ends. In some embodiments, the plurality of immobilized capture primers comprise at least one ribonucleotide and / or at least one 2’-O-methyl or 2’ -O-m ethoxy ethyl (MOE) nucleotide which can render the capture primers resistant to exonuclease degradation.
[0203] In some embodiments, the immobilized capture primers comprise at least one locked nucleic acid (LNA) which comprises a methylene bridge bond between a 2’ oxygen and 4’ carbon of the pentose ring. Immobilized capture primers that include at least one LNA can be resistant to nuclease digestion and can exhibit increased melting temperature when hybridized to a portion of the covalently closed circular polynucleotide molecules.
[0204] In some embodiments, the immobilized capture primers include or lack a nucleotide having a scissile moiety that can be cleaved to generate an abasic site in the capture primer. Exemplary nucleotides having a scissile moiety include uridine, 8-oxo-7,8- dihydrogunine and deoxyinosine.
[0205] In some embodiments, the plurality of surface pinning primers of comprise single stranded oligonucleotides comprising DNA, RNA or a combination of DNA and RNA. The pinning primers can be immobilized to the support or immobilized to a coating on the support (e.g., FIGS. 15-20) (immobilized pinning primers). The immobilized pinning primers can be embedded and attached (coupled) to the coating on the support. The immobilized pinning primers can be covalently attached to the coating on the support. In some embodiments, the 5’ end of the immobilized pinning primers are immobilized to the support or immobilized to a coating on the support. Alternatively, an interior portion or the 3’ end of the immobilized pinning primers can be immobilized to the support or immobilized to a coating on the support. The immobilized pinning primers can be any length, for example 4-50 nucleotides, or 50-100 nucleotides, or 100-150 nucleotides, or any range therebetween, or longer lengths.
[0206] In some embodiments the support comprises a plurality of immobilized pinning primers having the same sequence (e.g., a universal pinning primer sequence). In some embodiments, individual immobilized pinning primers comprise a sequence that can hybridize to at least a portion of individual concatemer template molecules in a compact DNA nanoball generated by conducting a rolling circle amplification reaction on the immobilized circular molecule-capture primer duplexes of step (c). In some embodiments, individual compact DNA nanoballs generated in step (c) comprise: (i) a concatemer template molecule generated by RCA-extension of an immobilized capture primer and (ii) at least one concatemer template molecule generated by RCA-extension of a soluble amplification primer. In some embodiments, at least a portion of individual compact DNA nanoballs is hybridized to an immobilize pinning primer.
[0207] In some embodiments, the 3’ terminal ends of the immobilized pinning primers comprise a 3’ non-extendible moiety. In some embodiments, the 3’ terminal end of the immobilized pinning primers comprise a moiety that blocks polymerase-catalyzed primer extension (e.g., non-extendible terminal 3’ end), such as for example a phosphate group, a dideoxycytidine group, an inverted dT, or an amino group. In some embodiments, the immobilized pinning primers are not extendible in a primer extension reaction. In some embodiments, the immobilized pinning primers lack a nucleotide having a scissile moiety. In some embodiments, the 3’ terminal ends of the immobilized pinning primers comprise an extendible 3’ OH moiety.
[0208] In some embodiments, the plurality of immobilized pinning primers comprise at least one phosphorothioate diester bond at their 5’ ends which can render the pinning primers resistant to exonuclease degradation. In some embodiments, the plurality of immobilized pinning primers comprise 2-5 or more consecutive phosphorothioate diester bonds at their 5’ ends. In some embodiments, the plurality of immobilized pinning primers comprise at least one ribonucleotide and / or at least one 2’-O-methyl or 2’ -O-m ethoxy ethyl (MOE) nucleotide which can render the pinning primers resistant to exonuclease degradation.
[0209] In some embodiments, the immobilized pinning primers comprise at least one locked nucleic acid (LNA) which comprises a methylene bridge bond between a 2’ oxygen and 4’ carbon of the pentose ring. Immobilized pinning primers that include at least one LNA can be resistant to nuclease digestions and can exhibit increased melting temperature when hybridized to a portion of individual concatemer template molecules in a compact DNA nanoball.Sources of Polynucleotides
[0210] In some embodiments of the methods disclosed herein, the covalently closed circular polynucleotide molecules comprise polynucleotide molecules that include at least one universal adaptor sequence or lack universal adaptor sequences. In some embodiments, a polynucleotide molecule that includes at least one universal adaptor sequence comprises a nucleic acid library molecule which includes a sequence of interest (110) appended to at least one universal adaptor sequence. In some embodiments, a polynucleotide molecule that lacks a universal adaptor sequence comprises a sequence of interest (110). In some embodiments, the polynucleotide molecules can be linear polynucleotide molecules prepared from any source and circularized to generate the covalently closed circular polynucleotide molecules.
[0211] In some embodiments, the sequence of interest (110) of a covalently closed circularized polynucleotide molecule can be any length, for example about 50-250, or about 250-500, or about 500-750, or about 750-1000, or about 1000-1500, or about 1500-2000, or about 2000-5000 nucleotides, , or any range therebetween, or more than 5000 nucleotides in length.
[0212] In some embodiments, the sequence of interest (110) of the covalently closed circularized polynucleotide molecules comprise RNA, cDNA or DNA.
[0213] In some embodiments, the sequence of interest (110) of the covalently closed circularized polynucleotide molecules can be extracted from any source, can be prepared by chemical synthesis methods, or can be prepared using recombinant nucleic acid technology including but not limited to any combination of vector cloning, transgenic host cell preparation, host cell culturing and / or PCR amplification.
[0214] In some embodiments, the sequence of interest (110) of the covalently closed circularized polynucleotide molecules can be extracted from any organism including viruses, prokaryotes, archaeal organisms, fungus or eukaryotes (e.g., humans, plants and animals).
[0215] In some embodiments, the sequence of interest (110) of the covalently closed circularized polynucleotide molecules can be isolated in any form, including without limitation chromosomal, genomic, organellar (e.g., mitochondrial, chloroplast or ribosomal), recombinant molecules, cloned, amplified, cDNA, RNA such as precursor mRNA (e.g., unspliced RNA or partially spliced RNA), mRNA, or whole genomic DNA.
[0216] In some embodiments, the sequence of interest (110) of the covalently closed circularized polynucleotide molecules can be obtained from fresh frozen paraffin embeddedtissue, needle biopsies, circulating tumor cells, cell free circulating DNA, or any type of nucleic acid library.
[0217] In some embodiments, the sequence of interest (110) of the covalently closed circularized polynucleotide molecules can be obtained from cells, tissues, normal or diseased cells or tissues, body fluids including blood, urine, serum, lymph, tumor, saliva, anal and vaginal secretions, amniotic samples, perspiration, smears, semen, environmental samples or culture samples.
[0218] In some embodiments, the sequence of interest (110) of the covalently closed circularized polynucleotide molecules can be isolated from any organ, including head, neck, brain, breast, ovary, cervix, colon, rectum, endometrium, gallbladder, intestines, bladder, prostate, testicles, liver, lung, kidney, esophagus, pancreas, thyroid, pituitary, thymus, skin, heart, larynx, or other organs.
[0219] In some embodiments, the sequence of interest (110) of a covalently closed circularized polynucleotide molecule can be obtained from any type of cells and from any organism including prokaryotes, archaebacteria, eubacteria or eukaryotes (such as animals, plants, fungi, protista). In some embodiments, the polynucleotides can be obtained from any type of cells and from any organism including human, simian, ape, canine, feline, bovine, equine, murine, porcine, caprine, lupine, ranine, piscine, plant, insect or bacteria.
[0220] In some embodiments, the sequence of interest (110) of a covalently closed circularized polynucleotide molecule can be obtained from any type of cells including skin, heart, lung, kidney, breath, bone marrow, stool, semen, vaginal fluid, interstitial fluids derived from tumorous tissue, breast, pancreas, cerebral spinal fluid, tissue, throat swab, biopsy, smears, placental fluid, amniotic fluid, liver, muscle, smooth muscle, bladder, gall bladder, colon, intestine, brain, cavity fluids, sputum, pus, micropiota, meconium, breast milk, prostate, esophagus, thyroid, serum, saliva, urine, gastric and digestive fluid, tears, ocular fluids, sweat, mucus, earwax, oil, glandular secretions, spinal fluid, hair, fingernails, skin cells, plasma, nasal swab, nasopharyngeal sample, oropharyngeal sample, bronchoalveolar lavage fluid, tracheal aspirate, bronchial wash, spinal fluid, cerebrospinal fluid, pericardial fluid, cord blood, emphatic fluids, and / or other excretions or body tissues.
[0221] In some embodiments, the sequence of interest (110) of a covalently closed circularized polynucleotide molecule can be obtained from any type of cells including white blood cells, red blood cells, platelets, epithelial cells, endothelial cells, neurons, glial cells, astrocytes, fibroblasts, skeletal muscle cells, smooth muscle cells, gametes, or cells from theheart, lungs, brain, liver, kidney, spleen, pancreas, thymus, bladder, stomach, colon, or small intestine.
[0222] In some embodiments, the polynucleotides can be obtained from any type of cells including cells belonging to a subset of cells, such as immune cells. In some embodiments, the immune cells are T cells, cytotoxic (killer) T cells, helper T cells, alpha beta T cells, gamma delta T cells, T cell progenitors, B cells, B-cell progenitors, lymphoid stem cells, myeloid progenitor cells, lymphocytes, granulocytes, Natural Killer cells, plasma cells, memory cells, neutrophils, eosinophils, basophils, mast cells, monocytes, dendritic cells, macrophages, undifferentiated human stem cells, or human stem cells that have been induced to differentiate.
[0223] In some embodiments, the sequence of interest (110) of a covalently closed circularized polynucleotide molecule can be obtained from any type of cells including healthy cells, diseased cells including cancerous cells, or pathogenic cells that are infected with a pathogen.
[0224] In some embodiments, the sequence of interest (110) of a covalently closed circularized polynucleotide molecule can be obtained from any type of cells including rare cells, for example circulating tumor cells (CTCs), circulating epithelial cells, circulating endothelial cells, circulating endometrial cells, bone marrow cells, progenitor cells, foam cells, mesenchymal cells, or trophoblasts.
[0225] In some embodiments, the sequence of interest (110) of a covalently closed circularized polynucleotide molecule can be obtained by any method including needle biopsy (e.g., fine needle biopsy or fine needle aspirate) or micro-forceps.
[0226] In some embodiments, the sequence of interest (110) of a covalently closed circularized polynucleotide molecule can be obtained from any type of plant cells including any plant part, including a fruit, a tuber, a leaf, a stem, a root, a seed, a branch, a pubescent, a nodule, a leaf axil, a flower, a pollen, a stamen, a pistil, a petal, a peduncle, a stalk, a stigma, a style, a bract, a trunk, a carpel, a sepal, an anther, an ovule, a pedicel, a needle, a cone, a rhizome, a stolon, a shoot, a pericarp, an endosperm, a placenta, a berry, a stamen or a leaf sheath.
[0227] In some embodiments, the sequence of interest (110) of a covalently closed circularized polynucleotide molecule can encode a polypeptide, or do not encode a polypeptide. In some embodiments, the polynucleotides comprises a mixture of nucleic acid molecules that encode a polypeptide and nucleic acid molecules that do not encode a polypeptide.
[0228] In some embodiments, the sequence of interest (110) of a covalently closed circularized polynucleotide molecule comprises mRNA, poly A RNA, or RNA lacking a poly A tail.
[0229] In some embodiments, the sequence of interest (110) of a covalently closed circularized polynucleotide molecule comprises tRNA, rRNA, small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), microRNA (miRNA), small interfering RNA (siRNA), piwi-interacting RNA (piRNA) or antisense RNA.
[0230] In some embodiments, the sequence of interest (110) of a covalently closed circularized polynucleotide molecule comprises pre-sliced RNA, RNA splice variants, and mature-spliced RNA comprising only exons. In some embodiments, the polynucleotides comprise an exon sequence, an intron sequence, an exon-intron junction sequence, or a mixture of exon sequence and intron sequences.
[0231] In some embodiments, the sequence of interest (110) of a covalently closed circularized polynucleotide molecule comprises at least one region of RNA including a 5’ untranslated region, a 5’ cap region, a region having a start codon, a coding region, a region having a stop codon, and / or a 5’ untranslated region. In some embodiments, the 5' cap site of an RNA comprises an N7-methylated guanosine residue joined to the 5'-most residue of the RNA via a 5 '-5' triphosphate linkage. In some embodiments, the 5' cap region of a RNA includes the 5' cap structure and the first 50 nucleotides adjacent to the 5’ cap site.Circularization of Polynucleotides
[0232] In some embodiments, the plurality of covalently closed circular polynucleotide molecules can be generated by circularizing linear polynucleotide molecules. There are several methods for generating a plurality of covalently closed circular polynucleotide molecules from a plurality of linear polynucleotide molecules. Exemplary methods of preparing covalently closed circular polynucleotide molecules, and generating concatemer template molecules therefrom, are described in WO2022266470, WO2023168444, WO2023168443, W02024040058, W02024011145 and W02024059550, the contents of each of which are incorporated by reference in their entireties herein.
[0233] In some embodiments, the covalently closed circular polynucleotide molecules comprise polynucleotide molecules that include at least one universal adaptor sequence or lack universal adaptor sequences. In some embodiments, a polynucleotide molecule that includes at least one universal adaptor sequence comprises a nucleic acid library molecule which includes a sequence of interest (110) appended to at least one universal adaptorsequence. In some embodiments, a polynucleotide molecule that lacks a universal adaptor sequence comprises a sequence of interest (110).
[0234] In some embodiments, the ends of single-stranded linear polynucleotide molecules can undergo intramolecular ligation using a single-stranded ligase (e.g., CircLigase from Epicentre™ or Lucigen™) thereby generating a plurality of covalently closed circular polynucleotide molecules.
[0235] In some embodiments, covalently closed circular polynucleotide molecules (e.g., circularized DNA molecules) can be generated using a protelomerase instead of a nucleic acid ligase. Protelomerase enzymes identifies an enzyme recognition sequence within a polynucleotide molecule, cleaves the enzyme recognition sequence to generate an end having a 5’ and 3’ exposed cleavage ends, rejoins 5’ and 3’ cleavage ends of a single exposed end at the enzyme recognition site to form a single linear molecule from the cleaved 5’ and 3’ ends. When this reaction is performed on both ends of a double-stranded polynucleotide molecule having the enzyme recognition sequence at each end, the result is a covalently closed circular polynucleotide molecule. An adaptor carrying the enzyme recognition sequence can be joined to both ends of the double-stranded DNA polynucleotide molecule via ligation or PCR using tailed PCR primers. A number of enzymes or enzyme combinations are compatible with this reaction, including a protelomerase. One exemplary type of protelomerase is TelN protelomerase, such as that from E. coli phage Nl.
[0236] In some embodiments, a population of double-stranded linear polynucleotide molecules can be circularized to generate covalently closed circular polynucleotide molecules. In some embodiments, the 5’ ends of linear polynucleotide molecules can be phosphorylated for subsequent enzymatic ligation. For example, a population of linear polynucleotide molecules can be contacted with an enzyme that catalyzes 5’ phosphorylation of the ends of the linear molecules, such as for example T4 polynucleotide kinase. In some embodiments, the population of linear polynucleotide molecules having blunt ends can be contacted with a ligase enzyme for intramolecular ligation, where the ligase enzyme comprises T3 or T4 DNA ligase. In some embodiments, the population of linear polynucleotide molecules having overhang ends (e.g., sticky ends) can be contacted with a T7 DNA ligase to generate covalently closed circular polynucleotide molecules. In some embodiments, the linear polynucleotide molecules can be reacted with the T4 polynucleotide kinase enzyme and the ligase enzyme either sequentially or simultaneously to generate covalently closed circular polynucleotide molecules. The non-circular molecules can bedegraded using at least one exonuclease enzyme, such as for example T7 exonuclease and / or exonuclease I (e.g., thermolabile exonuclease I).Circularizing Polynucleotides using Padlock Probes
[0237] In some embodiments, the covalently closed circular polynucleotide molecules can be generated using padlock probes. For a description of padlock probes see, for example, Szemes, M. et al. Nucleic Acids Research, Volume 33, Issue 8, 1 April 2005, Page e70, the contents of which are incorporated by reference in their entirety herein.
[0238] In some embodiments, a padlock probe workflow can be used to generate single stranded covalently closed circular molecules (e.g., FIG. 25). Typically, the arrangement of the sequence of interest (insert sequence) and adaptors in a padlock probe differs from a standard linear library molecule. In some embodiments, a padlock probe comprises a singlestranded linear oligonucleotide having a 5’ portion, an optional internal linker portion, and a 3’ portion. The 5’ and 3’ portions each comprise a portion that can hybridize to a target sequence of interest. The 5’ and 3’ portions are separately complementary to a target sequence of interest (e.g., a contiguous target sequence of interest), while the internal linker portion is designed to have little or no complementarity to the target sequence (e.g., FIG. 25). The 5’ and 3’ ends of the padlock probe can hybridize to adjacent positions on the target nucleic acid molecule to form an open circularized molecule with a nick between the hybridized 5’ and 3’ ends. The nick can be ligated to generate a covalently close circular molecule. Alternatively, the 5’ and 3’ ends of the padlock probe can hybridize to adjacent positions on the target nucleic acid molecule to form an open circularized molecule with a gap between the hybridized 5’ and 3’ ends. The gap can be subject to a polymerase-mediated filled-in reaction to form a nick, and the nick can be ligated to generate a covalently close circular molecule. In some embodiments, the padlock probe comprises: a surface pinning primer binding site sequence (120) (e.g., batch-specific surface pinning primer binding site sequence); a left sample index sequence (160); a forward sequencing primer binding site sequence (140) (e.g., batch-specific forward sequencing primer binding site sequence); a sequence of interest (110); a reverse sequencing primer binding site sequence (150) (e.g., batch-specific reverse sequencing primer binding site sequence); a right sample index sequence (170); a surface capture primer binding site sequence (130) (e.g., batch-specific surface capture primer binding site sequence); and an optional unique identification sequence (e g., UMI) (see, e g., FIG. 25).Circularizing Polynucleotides using Single-Stranded Splint Strands
[0239] In some embodiments, in the methods for generating a plurality of compact DNA nanoballs immobilized to a support, the covalently closed circular polynucleotide molecules of step (a) can be generated using single stranded splint strands. In some embodiments, a population of the single stranded linear polynucleotide molecules can be circularized to generate single stranded covalently closed circular polynucleotide molecules using single stranded splint strands (e.g., FIGS. 26A-26C). In some embodiments, individual single stranded linear polynucleotide molecules comprise a linear library molecule which includes a sequence of interest (an insert sequence, (110)) flanked at both ends with at least one universal adaptor sequence. For example, the single stranded linear library molecules comprises: a sequence of interest (110) and any one or any combination of two or more universal sequences including: (i) a surface pinning primer binding site sequence (120) (or a complementary sequence thereof), which can be a universal sequence; (ii) a surface capture primer binding site sequence (130) (or a complementary sequence thereof), which can be a universal sequence; (iii) at least one universal sequence for binding a first sequencing primer (e.g., the forward sequencing primer binding site sequence, (140)) (or a complementary sequence thereof); (iv) at least one universal sequence for binding a second sequencing primer (e.g., a reverse sequencing primer binding site sequence, (150)) (or a complementary sequence thereof); (v) at least one universal sequence for binding a soluble amplification primer (or a complementary sequence thereof); (vi) a universal sequence for binding a compaction oligonucleotide (or a complementary sequence thereof); and / or at least one sample index sequence ((160) and / or (170)) which can be used for distinguishing sequences of interest obtained from different sample sources in a multiplex assay (e.g., see FIG. 26A).
[0240] A population of double stranded linear library molecules can be denatured to generate single stranded linear library molecules. The single stranded linear library molecules (100) can be hybridized to single stranded splint strands (200) to generate library-splint complexes (300) with a nick (e.g., FIG. 26A). The single stranded splint strands (200) comprise a first and second region. In some embodiments, the first region (210) hybridizes with the surface pinning primer binding site sequence (120) (or a complementary sequence thereof) on one end of the linear single stranded library molecule (e.g., see FIG. 26A). In some embodiments, the second region (220) hybridizes with a surface capture primer binding site sequence (130) (or a complementary sequence thereof) on the other end of the same linear single stranded library molecule (e.g., see FIG. 26A).
[0241] In some embodiments, the single stranded library molecule (100) hybridizes to a single stranded splint strand to generate a library-splint complex (300) having one nick (e.g., see FIG. 26A). The library-splint complexes (300) can be reacted with T4 polynucleotide kinase and a ligase either sequentially or simultaneously, to (i) phosphorylate the 5’ end of the library molecule, the 5’ end of the splint strand, and to (ii) close the nick by enzymatic ligation, thereby generating a single stranded covalently closed circular library molecule (400) which is hybridized to the single stranded splint strand (e.g., see FIG. 26B). The ligase can comprise a T7 DNA ligase, a T3 ligase, a T4 ligase or a Taq ligase.
[0242] The non-circular molecules and the single stranded splint strands (200) can be degraded using at least one exonuclease enzyme, such as, for example and without limitation, a T7 exonuclease and / or an exonuclease I e.g., a thermolabile exonuclease I).
[0243] The remaining single stranded covalently closed circular library molecules (400) can be distributed onto a support having a plurality of immobilized capture primers and optionally pinning primers, and can be subjected to a rolling circle amplification reaction to generate concatemer template molecules. In some embodiments, the concatemer template molecules are generated by RCA-extension of an immobilized capture primer (e.g., see FIGS. 15-19).
[0244] The remaining single-stranded covalently closed circular library molecules (400) can be hybridized to at least one soluble amplification primer and subjected to a rolling circle amplification (RCA) reaction to generate a concatemer template molecule generated by RCA-extension of a soluble amplification primer (e.g., see FIGS. 15-19).
[0245] In some embodiments, a compact DNA nanoball comprises (i) a concatemer template molecule generated by RCA-extension of an immobilized capture primer and (ii) at least one concatemer template molecule generated by RCA-extension of a soluble amplification primer.
[0246] In some embodiments, an immobilized surface pinning primer can hybridize to at least one portion of the concatemer template molecule generated by RCA-extension of an immobilized capture primer or can hybridize to at least a portion of the concatemer template molecule generated by RCA-extension of a soluble amplification primer (e.g., FIG. 21).
[0247] In some embodiments, in any of the methods described herein, the surface pinning primer binding site sequence (120) in the library molecules comprise the sequence 5’- CATGTAATGCACGTACTTTCAGGGT -3’ (SEQ ID NO: 55).
[0248] In some embodiments, in any of the methods described herein, the surface pinning primer binding site sequence (120) in the library molecules comprise the sequence 5’- AATGATACGGCGACCACCGA-3’ (SEQ ID NO: 28).
[0249] In some embodiments, in any of the methods described herein, the forward sequencing primer binding site sequence (140) in the library molecules comprises the sequence
[0250] 5’-CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT -3’ (SEQ ID NO: 161).
[0251] In some embodiments, in any of the methods described herein, the forward sequencing primer binding site sequence (140) in the library molecules comprises the sequence
[0252] 5’- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3’ (SEQ ID NO: 150).
[0253] In some embodiments, in any of the methods described herein, the forward sequencing primer binding site sequence (140) in the library molecules comprise the sequence
[0254] 5’ - TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3’ (SEQ ID NO:174).
[0255] In some embodiments, in any of the methods described herein, the reverse sequencing primer binding site sequence (150) in the library molecules comprise the sequence5’- ATGTCGGAAGGTGTGCAGGCTACCGCTTGTCAACT -3’ (SEQ ID NO: 156).
[0256] In some embodiments, in any of the methods described herein, the reverse sequencing primer binding site sequence (150) in the library molecules comprise the sequence5’- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3’ (SEQ ID NO: 152).
[0257] In some embodiments, in any of the methods described herein, the reverse sequencing primer binding site sequence (150) in the library molecules comprise the sequence5’- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3’ (SEQ ID NO: 163).
[0258] In some embodiments, in any of the methods described herein, the surface capture primer binding site sequence (130) in the library molecules comprise the sequence 5’- AGTCGTCGCAGCCTCACCTGATC -3’ (SEQ ID NO: 109).
[0259] In some embodiments, in any of the methods described herein, the surface capture primer binding site sequence (130) in the library molecules comprise the sequence 5’- TCGTATGCCGTCTTCTGCTTG -3’ (SEQ ID NO: 173).Circularizing Polynucleotides using Double-Stranded Splint Adaptors
[0260] In some embodiments, in the methods for generating a plurality of compact DNA nanoballs immobilized to a support, the covalently closed circular polynucleotide molecules of step (a) can be generated using double stranded splint adaptors. In some embodiments, a population of the single-stranded linear polynucleotide molecules can be circularized to generate single-stranded covalently closed circular polynucleotide molecules using doublestranded splint adaptors (e.g., FIGS. 27A-27C). In some embodiments, individual single stranded linear polynucleotide molecules comprise a linear library molecule which includes a sequence of interest (an insert sequence, (110)) flanked at both ends with at least one universal adaptor sequence. For example, the single stranded linear library molecules comprises: a sequence of interest (110) and any one or any combination of two or more universal sequences including: (i) a surface pinning primer binding site sequence (120) (or a complementary sequence thereof), which can be a universal sequence; (ii) a surface capture primer binding site sequence (130) (or a complementary sequence thereof), which can be a universal sequence; (iii) at least one universal sequence for binding a first sequencing primer (e.g., the forward sequencing primer binding site sequence, (1 0)) (or a complementary sequence thereof); (iv) at least one universal sequence for binding a second sequencing primer (e.g., a reverse sequencing primer binding site sequence, (150)) (or a complementary sequence thereof); (v) at least one universal sequence for binding a soluble amplification primer (or a complementary sequence thereof); (vi) a universal sequence for binding a compaction oligonucleotide (or a complementary sequence thereof); and / or at least one sample index sequence ((160) and / or (170)) which can be used for distinguishing sequences of interest obtained from different sample sources in a multiplex assay (e.g., see FIGS. 27A- 27C).
[0261] A population of double stranded linear library molecules can be denatured to generate single stranded linear library molecules. The single stranded linear library molecules can be hybridized to double stranded splint adaptors (500) to generate library-splint complexes (800) comprising circular library molecules with two nicks (e.g., FIG. 27A).
[0262] The double-stranded splint adaptors (500) comprises a first splint strand (long splint strand (600)) and a second splint strand (short splint strand (700)), where the first andsecond splint strands are hybridized together to form the double-stranded splint adaptor (500) having a double-stranded region and two flanking single-stranded regions (e.g., see FIG. 27A).
[0263] In some embodiments, the first splint strand (600) comprises: (i) a left sequence (620) that hybridizes to a surface pinning primer binding sequence (120) of the linear library molecule; (ii) an internal portion (610) that hybridizes to the second splint strand; and (iii) a right sequence (630) that hybridizes to a surface capture primer binding sequence (130) of the linear library molecule (e.g., see FIG. 27 A).
[0264] The second splint strand (700) introduces one or more additional adaptor sequences into the covalently closed circularized library molecule (900). The second splint strand (700) carries the additional adaptor sequence(s), such as for example an additional universal sequence for binding a capture primer on the support, an additional universal sequencing for binding a pinning primer on the support and / or an additional sample index sequence. In some embodiments, the second splint strand (700) comprises three sub-regions for example arranged in a 3’ to 5’ direction: a first sub-region, a second sub-region and a third sub-region (e.g., FIG. 27A).
[0265] In some embodiments, the first sub-region comprises an additional universal sequence for binding a capture primer on the support, an additional universal sequencing for binding a pinning primer on the support or an additional sample index sequence. In some embodiments, the second sub-region comprises an additional universal sequence for binding a capture primer on the support, an additional universal sequencing for binding a pinning primer on the support or an additional sample index sequence. In some embodiments, the third sub-region comprises an additional universal sequence for binding a capture primer on the support, an additional universal sequencing for binding a pinning primer on the support or an additional sample index sequence.
[0266] In some embodiments, the second splint strand (700) comprises an additional universal sequence for binding a capture primer on the support which differs from the universal sequence for binding a capture primer (130) in the library molecule (100). In some embodiments, the second splint strand (700) comprises an additional universal sequence for binding a pinning primer on the support which differs from the universal surface pinning primer binding site sequence (120) in the library molecule (100).
[0267] In some embodiments, the internal portion (610) of the first splint strand (600) comprises a sequence that can hybridize to the second splint strand (700). The insert sequence of interest (110) does not hybridize to the first or second splint strands.
[0268] A single-stranded library molecule (100) can hybridize to a double stranded splint adaptor (500) to generate a library-splint complex (800) having two nicks (FIG. 27A). The first nick is located between the 5’ end of the library molecule and the 3’ end of the second splint strand. The second nick is located between the 3’ end of the library molecule and the 5’ end of the second splint strand.
[0269] The library-splint complexes can be reacted with T4 polynucleotide kinase and a ligase (e.g., T7 DNA ligase) either sequentially or simultaneously, to (i) phosphorylate the 5’ end of the library molecule, the 5’ end of the first splint strand, and the 5’ end of the second splint strand, and to (ii) close the first and second nicks by enzymatic ligation, thereby generating a single stranded covalently closed circular library molecule (900) which is hybridized to the first splint strand (600) (FIG. 27B). The ligase can comprise a T7 DNA ligase, a T3 ligase, a T4 ligase or a Taq ligase.
[0270] The non-circular molecules and the first splint strands can be degraded using at least one exonuclease enzyme, such as for example a T7 exonuclease and / or an exonuclease I (e.g., therm olabile exonuclease I).
[0271] The remaining single stranded covalently closed circular library molecules (900) can be distributed onto a support having a plurality of immobilized capture primers and pinning primers, and can be subjected to a rolling circle amplification reaction to generate concatemer template molecules. In some embodiments, the concatemer template molecules can be generated by RCA-extension of an immobilized capture primer (e.g., see FIGS. 15- 19).
[0272] The remaining single stranded covalently closed circular library molecules (900) can be hybridized to at least one soluble amplification primer and subjected to a rolling circle amplification (RCA) reaction to generate a concatemer template molecule generated by RCA-extension of a soluble amplification primer (e.g., see FIGS. 15-19).
[0273] In some embodiments, a compact DNA nanoball comprises (i) a concatemer template molecule generated by RCA-extension of an immobilized capture primer and (ii) at least one concatemer template molecule generated by RCA-extension of a soluble amplification primer.
[0274] In some embodiments, an immobilized pinning primer can hybridize to at least one portion of the concatemer template molecule generated by RCA-extension of an immobilized capture primer or can hybridize to at least a portion of the concatemer template molecule generated by RCA-extension of a soluble amplification primer (e.g., FIG. 21).
[0275] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (800) described herein, the library molecule includes a surface pinning primer binding site sequence, (120)) which binds the first region of the first splint strand (620), where the surface pinning primer binding site sequence (120) comprises the sequence 5’- AATGATACGGCGACCACCGA-3’ (SEQ ID NO: 28).
[0276] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (800) described herein, the library molecule includes a surface pinning primer binding site sequence, (120)) which binds the first region of the first splint strand (620), where the surface pinning primer binding site sequence (120) comprises the sequence 5’- CATGTAATGCACGTACTTTCAGGGT -3’ (SEQ ID NO: 55).
[0277] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (800) described herein, the library molecule includes a forward sequencing primer binding site sequence, (140)) where the forward sequencing primer binding site sequence comprises the sequence 5’- ACACTCTTTCCCTACACGACGCTCTTCCGATCT - 3’ (SEQ ID NO: 150).
[0278] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (800) described herein, the library molecule includes a forward sequencing primer binding site sequence, (1 0)) where the forward sequencing primer binding site sequence comprises the sequence 5’- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3’ (SEQ ID NO: 174).
[0279] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (800) described herein, the library molecule includes a forward sequencing primer binding site sequence, (140)) where the forward sequencing primer binding site sequence comprises the sequence 5’- CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT -3’ (SEQ ID NO: 161).
[0280] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (800) described herein, the library molecule includes a forward sequencing primer binding site sequence, (140)) where the forward sequencing primer binding site sequence comprises the sequence 5’ - GCTCACAGAACGACATGGCTACGATCCGACTT - 3’ (SEQ ID NO: 166).
[0281] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (800) described herein, the library molecule includes a forward sequencing primer binding site sequence, (140)) where the forward sequencing primer binding sitesequence comprises the sequence 5’ - GAACGACATGGCTACGATCCGACTT -3’ (SEQ ID NO: 164).
[0282] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (800) described herein, the library molecule includes a reverse sequencing primer binding site sequence, (150)) where the reverse sequencing primer binding site sequence comprises the sequence 5’- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3’ (SEQ ID NO: 152).
[0283] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (800) described herein, the library molecule includes a reverse sequencing primer binding site sequence, (150)) where the reverse sequencing primer binding site sequence comprises the sequence 5’- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -3’ (SEQ ID NO: 163).
[0284] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (800) described herein, the library molecule includes a reverse sequencing primer binding site sequence, (150)) where the reverse sequencing primer binding site sequence comprises the sequence 5’- ATGTCGGAAGGTGTGCAGGCTACCGCTTGTCAACT -3’ (SEQ ID NO: 156).
[0285] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (800) described herein, the library molecule includes a reverse sequencing primer binding site sequence, (150)) where the reverse sequencing primer binding site sequence comprises the sequence 5’ - AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA -3’ (SEQ ID NO: 148).
[0286] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (800) described herein, the library molecule includes a surface capture primer binding site sequence, (130)) which binds the second region (630) of the first splint strand (600), where the surface capture primer binding site sequence comprises the sequences’- TCGTATGCCGTCTTCTGCTTG -3’ (SEQ ID NO: 173).
[0287] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (800) described herein, the library molecule includes a surface capture primer binding site sequence, (130)) which binds the second region (630) of the first splint strand (600), where the surface capture primer binding site sequence comprises the sequence 5’- AGTCGTCGCAGCCTCACCTGATC -3’ (SEQ ID NO: 109).
[0288] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (800) described herein, the first sub-region of the second splint strand (700) comprises the sequence 5’- CATGTAATGCACGTACTTTCAGGGT-3’ (SEQ ID NO: 55).
[0289] In some embodiments, the second sub-region of the second splint strand (700) comprises the sequence 5’-AGTCGTCGCAGCCTCACCTGATC-3’ (SEQ ID NO: 109).
[0290] In some embodiments, the second splint strand (700) comprises a first and second sub-region comprising the sequence 5’- AGTCGTCGCAGCCTCACCTGATCCATGTAATGCACGTACTTTCAGGGT-3’ (SEQ ID NO: 155).
[0291] In some embodiments, in any of the methods for forming a plurality of librarysplint complexes (800) described herein, the first region (620) of the first splint strand (600) includes a first universal adaptor sequence which comprises a universal binding sequence (or a complementary sequence thereof) for a first surface primer (e.g., a pinning primer binding site sequence or a capture primer binding site sequence), where the first region (620) comprises the sequence 5’-TCGGTGGTCGCCGTATCATT-3’ (SEQ ID NO: 171). For example, the first region (620) of the first splint strand (600) can hybridize to a P5 surface primer or a complementary sequence of the P5 surface primer. For example, the P5 surface primer comprises the sequence5’- AATGATACGGCGACCACCGA-3’ (short P5; SEQ ID NO: 28), or the P5 surface primer comprises the sequence 5’- AATGATACGGCGACCACCGAGATC-3’ (long P5; SEQ ID NO: 149).
[0292] In some embodiments, the second region (630) of the first splint strand (600) includes a second universal adaptor sequence which comprises a universal binding sequence (or a complementary sequence thereof) for a second surface primer (e.g., a pinning primer binding site sequence or a capture primer binding site sequence), where the second region (630) comprises the sequence 5’- CAAGCAGAAGACGGCATACGA -3’ (SEQ ID NO: 157). For example, the second region (630) of the first splint strand (600) can hybridize to a P7 surface primer or a complementary sequence of the P7 surface primer. For example, the P7 surface primer comprises the sequence 5’- CAAGCAGAAGACGGCATACGA -3’ (short P7; SEQ ID NO: 157), or the P7 surface primer comprises the sequence 5’- CAAGCAGAAGACGGCATACGAGAT-3’ (long P7; SEQ ID NO: 79).
[0293] In some embodiments, the first splint strand (600) includes an internal region (610) which comprises a fourth sub-region having the sequence
[0294] 5’-ACCCTGAAAGTACGTGCATTACATG-3’ (SEQ ID NO: 151).
[0295] In some embodiments, the first splint strand (600) includes an internal region (610) which comprises a fifth sub-region having the sequence
[0296] 5’- GATCAGGTGAGGCTGCGACGACT -3’ (SEQ ID NO: 112).
[0297] In some embodiments, the first splint strand (600) comprises a first region (620), an internal region (610) having a fourth and fifth sub-region, and a second region (630), having the sequence 5’- TCGGTGGTCGCCGTATCATTACCCTGAAAGTACGTGCATTACATGGATCAGGTGA GGCTGCGACGACTCAAGCAGAAGACGGCATACGA-3’ (SEQ ID NO: 172).Soluble Amplification Primers
[0298] In some embodiments, in any of the methods disclosed herein, the plurality of soluble amplification primers comprises single stranded oligonucleotides comprising DNA, RNA or a combination of DNA and RNA. In some embodiments, the plurality of soluble amplification primers are not immobilized to the support or immobilized to a coating on the support. The soluble amplification primers can be any length, for example 4-50 nucleotides, or 50-100 nucleotides, or 100-150 nucleotides, or any range therebetween, ,or longer lengths. In some embodiments, the 3’ terminal end of the soluble amplification primers comprises an extendible 3’ OH moiety. In some embodiments, the 3’ terminal end of the soluble amplification primers comprises a 3’ non-extendible moiety. In some embodiments, the nonextendible moiety at the 3 -terminal end of individual soluble amplification primers can be converted to a 3’ extendible end.
[0299] In some embodiments the plurality of soluble amplification primers comprises the same sequence (e.g., a universal soluble amplification primer sequence). In some embodiments, the plurality of soluble amplification primers can bind to at least a portion of the covalently closed circular polynucleotide molecules. In some embodiments, the plurality of soluble amplification primers can bind to any one or any combination of two or more of: (i) at least a portion of the sequence of interest (110); (ii) at least a portion of the universal sequence for binding a pinning primer (e.g., a surface pinning primer binding site sequence, (120)) (or a complementary sequence thereof); (iii) at least a portion of the universal sequence for binding a capture primer (e.g., a surface capture primer binding site sequence, (130)) (or a complementary sequence thereof); (iv) at least a portion of the universal sequence for binding a first sequencing primer (e.g., a forward sequencing primer binding site sequence, (1 0)); (v) at least a portion of the universal sequence for binding a second sequencing primer (e.g., a reverse sequencing primer binding site sequence, (150)); and / or(vi) at least a portion of the universal sequence for binding a compaction oligonucleotide (or a complementary sequence thereof).
[0300] In some embodiments the plurality of soluble amplification primers comprise at least a first and second sub-population of soluble amplification primers, wherein the soluble amplification primers in the first and second sub-population have different sequences. In some embodiments, the first and second sub-populations of soluble amplification primers can bind to different portions of the covalently closed circular polynucleotide molecules.
[0301] For example, the soluble amplification primers in the first sub-population can bind to any one or any combination of two or more of: (i) at least a portion of the sequence of interest (110); (ii) at least a portion of the universal sequence for binding a pinning primer (e.g., a surface pinning primer binding site sequence, (120)) (or a complementary sequence thereof); (iii) at least a portion of the universal sequence for binding a capture primer (e.g., a surface capture primer binding site sequence, (130)) (or a complementary sequence thereof); (iv) at least a portion of the universal sequence for binding a first sequencing primer (e.g., a forward sequencing primer binding site sequence, (140)); (v) at least a portion of the universal sequence for binding a second sequencing primer (e.g., a reverse sequencing primer binding site sequence, (150)); and / or (vi) at least a portion of the universal sequence for binding a compaction oligonucleotide (or a complementary sequence thereof).
[0302] For example, the soluble amplification primers in the second sub-population can bind to a different portion of the covalently closed circular polynucleotide molecules including any one or any combination of two or more of: (i) at least a portion of the sequence of interest (110); (ii) at least a portion of the universal sequence for binding a pinning primer (e.g., a surface pinning primer binding site sequence, (120)) (or a complementary sequence thereof); (iii) at least a portion of the universal sequence for binding a capture primer (e.g., a capture primer binding site sequence, (130)) (or a complementary sequence thereof); (iv) at least a portion of the universal sequence for binding a first sequencing primer (e.g., a forward sequencing primer binding site sequence, (1 0)); (v) at least a portion of the universal sequence for binding a second sequencing primer (e.g., a reverse sequencing primer binding site sequence, (150)); and / or (vi) at least a portion of the universal sequence for binding a compaction oligonucleotide (or a complementary sequence thereof).
[0303] In some embodiments, the plurality of soluble amplification primers comprises at least one phosphorothioate diester bond at their 5’ ends which can render the soluble amplification primers resistant to exonuclease degradation. In some embodiments, the plurality of soluble amplification primers comprises at least one or 2-5 or more consecutivephosphorothioate diester bonds at their 5’ ends. In some embodiments, the plurality of soluble amplification primers comprises at least one ribonucleotide and / or at least one 2’-O- methyl or 2’-O-methoxyethyl (MOE) nucleotide which can render the soluble amplification primers resistant to exonuclease degradation.
[0304] In some embodiments, the soluble amplification primers comprise at least one locked nucleic acid (LNA) which comprises a methylene bridge bond between a 2’ oxygen and 4’ carbon of the pentose ring. The soluble amplification primers that include at least one LNA can be resistant to nuclease digestions and can exhibit increased melting temperature when hybridized to a portion of the covalently closed circular polynucleotide molecules.Rolling Circle Amplification with Uracil
[0305] In some embodiments, the rolling circle amplification (RCA) reaction of can be conducted with a plurality of strand displacing polymerases, a plurality of nucleotides, and a plurality of compaction oligonucleotides. The RCA reaction can generate a plurality of immobilized compact DNA nanoballs, wherein individual compact DNA nanoballs comprise (i) a concatemer template molecule generated by RCA-extension of an immobilized capture primer and (ii) at least one concatemer template molecule generated by RCA-extension of a soluble amplification primer. Individual covalently closed circular library molecules can be subjected to rolling circle amplification, using an immobilized capture primer and at least one soluble amplification primer, to generate multiple concatemer template molecules which increases the copy number of polynucleotide units of individual polonies. In some embodiments, each polynucleotide unit comprises a sequence of interest and at least one sequencing primer binding site. Individual polonies comprising increased copy number of polynucleotide units can increase the number of binding complexes formed on a given polony during sequencing. In some embodiments, a binding complex comprises a portion of a concatemer template molecule hybridized to a sequencing primer thereby forming a nucleic acid duplex, a sequencing polymerase, and a detectably labeled multivalent molecule or a detectably labeled free nucleotide. The increased number of binding complexes on a given polony can increase signal intensity during forward and reverse sequencing runs in a pairwise sequencing workflow (e.g., FIGS. 22A and 22B). The increased signal intensity can generate sequencing quality scores above Q30 across the length of the library insert regions (110) in pairwise sequencing runs. For example, in a forward sequencing run, the sequencing quality scores remain above Q40 at bases 100-150. FIG. 23A shows the sequencing quality scoresusing one soluble amplification primer, and FIG. 23B shows the sequencing quality scores using three soluble amplification primers. In a reverse sequencing run, the sequencing quality scores remain above Q35 at bases 100-150. FIG. 24A shows the sequencing quality scores using one soluble amplification primer, and FIG. 24B show the sequencing quality scores using three soluble amplification primers.
[0306] In some embodiments, in the rolling circle amplification reactions disclosed herein, the plurality of nucleotides comprises a nucleotide mixture containing dATP, dCTP, dGTP, dTTP and a nucleotide having a scissile moiety to generate immobilized compact DNA nanoballs which includes at least one nucleotide having a scissile moiety. The scissile moieties in the immobilized compact DNA nanoballs can be converted into abasic sites. In some embodiments, the nucleotide having the scissile moiety comprises uridine, 8-oxo-7,8- dihydroguanine (e.g., 8oxoG) or deoxyinosine. The uridine can be converted to an abasic site using uracil DNA glycosylase (UDG), the 8oxoG can be converted to an abasic site using FPG glycosylase, and the deoxyinosine can be converted to an abasic site using AlkA glycosylase.
[0307] In some embodiments, the nucleotide mixture can include an amount of dUTP so that a target percent of the thymidine in the resulting compact DNA nanoballs are replaced with dUTP. For example, when 30% of dTTP in the compact DNA nanoballs are to be replaced with dUTP (e.g., 30% is the target percent) then the nucleotide mixture can contain 7.5% dUTP (e.g., 30 / 4 = 7.5%), 17.5% dTTP, and 25% each for dATP, dCTP and dGTP. The target percent of dTTP to be replaced by dUTP can be about 0.1-1%, or about 1-5%, or about 5-10%, or about 10-20%, or about 20-30% , or about 30-45%, or about 45-50%, or any range therebetween, or a higher percent of the dTTP in the immobilized compact DNA nanoballs and are replaced with nucleotides having a scissile moiety.
[0308] In some embodiments, the nucleotide mixture can include an amount of deoxyinosine so that a target percent of the guanosine in the resulting compact DNA nanoballs are replaced with deoxyinosine. For example, when 30% of dGTP in the compact DNA nanoballs are to be replaced with deoxyinosine (e.g., 30% is the target percent) then the nucleotide mixture can contain 7.5% deoxyinosine (e.g., 30 / 4 = 7.5%), 17.5% dGTP, and 25% each for dATP, dCTP and dTTP. The target percent of dGTP to be replaced by deoxyinosine can be about 0.1-1%, or about 1-5%, or about 5-10%, or about 10-20%, or about 20-30% , or about 30-45%, or about 45-50%, or any range therebetween, or a higher percent of the dGTP in the immobilized compact DNA nanoballs and are replaced with nucleotides having a scissile moiety.
[0309] In some embodiments, the nucleotide mixture can include an amount of 8oxoG so that a target percent of the guanosine in the resulting compact DNA nanoballs are replaced with 8oxoG. For example, when 30% of dGTP in the compact DNA nanoballs are to be replaced with 8oxoG (e.g., 30% is the target percent) then the nucleotide mixture can contain 7.5% 8oxoG (e.g., 30 / 4 = 7.5%), 17.5% dGTP, and 25% each for dATP, dCTP and dTTP. The target percent of dGTP to be replaced by 8oxoG can be about 0.1-1%, or about 1-5%, or about 5-10%, or about 10-20%, or about 20-30% , or about 30-45%, or about 45-50%, or any range therebetween, or a higher percent of the dGTP in the immobilized compact DNA nanoballs and are replaced with nucleotides having a scissile moiety.
[0310] In some embodiments, the rolling circle amplification reaction generates immobilized compact DNA nanoballs with incorporated nucleotides having a scissile moiety that are distributed at random positions along individual concatemer template molecules within a given compact DNA nanoball. In some embodiments, the nucleotides having a scissile moiety are distributed at different positions in the different concatemer template molecules within a given compact DNA nanoball.Compaction Oligonucleotides
[0311] In some embodiments, the rolling circle amplification (RCA) reaction can be conducted with compaction oligonucleotides to generate single stranded concatemer template molecules having multiple copies of a polynucleotide unit arranged in tandem, where each polynucleotide unit comprises a sequence-of-interest and at least one binding site for a compaction oligonucleotide.
[0312] In some embodiments, the rolling circle amplification (RCA) reaction can be conducted with a plurality of strand displacing polymerases, a plurality of nucleotides, and a plurality of compaction oligonucleotides. The rolling circle amplification reaction can generate a plurality of immobilized compact DNA nanoballs, wherein individual compact DNA nanoballs comprise (i) a concatemer template molecule generated by RCA-extension of an immobilized capture primer and (ii) at least one concatemer template molecule generated by RCA-extension of a soluble amplification primer.
[0313] In some embodiments, inclusion of compaction oligonucleotides during rolling circle amplification can promote formation of compact DNA nanoballs having tighter size and shape compared to concatemer template molecules generated in the absence of the compaction oligonucleotides. The compact and stable characteristics of the compact DNAnanoballs can improve sequencing accuracy by increasing signal intensity and they retain their shape and size and resist unraveling during multiple sequencing cycles.
[0314] In some embodiments, individual compaction oligonucleotides in the plurality comprise at least one oligonucleotide comprising DNA, RNA, or a combination of DNA and RNA. The compaction oligonucleotides can be any length, including 20-150 nucleotides, or 30-100 nucleotides, or 40-80 nucleotides in length, or any range therebetween.
[0315] In some embodiments, individual compaction oligonucleotides in the plurality comprise one or more oligonucleotides and can have any shape including for example linear, branched, star, comb, dendrimer or other shape. In some embodiments, compaction oligonucleotides can include two, three, four or more regions that bind a concatemer template molecule (e.g., FIGS. 30-35C). The different binding regions of the compaction oligonucleotides are designed to hybridize to distal portions of the same concatemer template molecule and pull together the distal portions causing compaction of the concatemer to form a compact DNA nanoball.
[0316] In some embodiments, the compaction oligonucleotides comprise a 5’ region and a 3’ region, and optionally an intervening region between the 5’ and the 3’ regions. The intervening region can be any length, for example about 2-20 nucleotides in length. In some embodiments, the intervening region comprises a homopolymer having consecutive identical bases (e.g., AAA, GGG, CCC, TTT or UUU). In some embodiments, the intervening region comprises a non-homopolymer sequence.
[0317] The 5’ region of the compaction oligonucleotides can be wholly complementary or partially complementary along its length to a first portion of a concatemer template molecule. The 3’ region of the compaction oligonucleotides can be wholly complementary or partially complementary along its length to a second portion of the same concatemer template molecule. In some embodiments, the terminal 3’ end of the compaction oligonucleotides is not extendible in a polymerase-catalyzed extension reaction.
[0318] In some embodiments, the 5’ and the 3’ regions of individual compaction oligonucleotides can hybridize to different portions of the same concatemer template molecule generated by RCA-extension of an immobilized capture primer. In some embodiments, the 5’ and the 3’ regions of individual compaction oligonucleotides can hybridize to different portions of the same concatemer template molecule generated by RCA- extension of a soluble amplification primer.
[0319] In some embodiments, the 5’ and the 3’ regions of individual compaction oligonucleotides can hybridize to a portion of a concatemer template molecule generated byRCA-extension of an immobilized capture primer and a portion of a concatemer template molecule generated by RCA-extension of a soluble amplification primer. Individual compaction oligonucleotides can pull together a portion of a concatemer template molecule generated by RCA-extension of an immobilized capture primer and a portion of a concatemer template molecule generated by RCA-extension of a soluble amplification primer, thereby causing compaction of different concatemer template molecules generated from the same covalently closed circular library molecule (e.g., FIGS. 16-20). Inclusion of compaction oligonucleotides during RCA can promote formation of compact DNA nanoballs having tighter size and shape compared to concatemers generated in the absence of the compaction oligonucleotides.
[0320] In some embodiments, individual compaction oligonucleotides comprise at least a first and a second binding region (e.g., FIGS. 30-35C). In some embodiments, a first binding region of individual compaction oligonucleotides can hybridize to a portion of a concatemer template molecule generated by RCA-extension of an immobilized capture primer, and a second binding region of the same individual compaction oligonucleotides can hybridize to a portion of a concatemer template molecule generated by RCA-extension of a soluble amplification primer. The first and second binding regions of individual compaction oligonucleotides can pull together a portion of a concatemer template molecule generated by RCA-extension of an immobilized capture primer and a portion of a concatemer template molecule generated by RCA-extension of a soluble amplification primer, thereby causing compaction of different concatemer template molecules generated from the same covalently closed circular library molecule (e.g., FIGS. 16-20). Inclusion of compaction oligonucleotides during RCA can promote formation of compact DNA nanoballs having tighter size and shape compared to concatemers generated in the absence of the compaction oligonucleotides.
[0321] The 5’ and the 3’ regions of the compaction oligonucleotide can hybridize to binding sites in the concatemer template molecule to pull together distal portions of the concatemer template molecule causing compaction of the concatemer template molecule to form a compact DNA nanoball. For example, the 5’ region of the compaction oligonucleotide is designed to hybridize to a first portion of the concatemer template molecule, and the 3’ region of the compaction oligonucleotide is designed to hybridized to a second portion of the same concatemer template molecule. Inclusion of compaction oligonucleotides during RCA can promote formation of compact DNA nanoballs having tighter size and shape compared to concatemers generated in the absence of the compaction oligonucleotides. The compact andstable characteristics of the compact DNA nanoballs improves sequencing accuracy by increasing signal intensity and they retain their shape and size during multiple sequencing cycles.
[0322] Inclusion of compaction oligonucleotides in any rolling circle amplification reaction described herein can improve FWHM (full width half maximum) of a spot image of the compact DNA nanoball. The spot image can be represented as a Gaussian spot and the size can be measured as a FWHM. A smaller spot size as indicated by a smaller FWHM typically correlates with an improved image of the spot. In some embodiments, the FWHM of a nanoball spot can be about 10 um or smaller.
[0323] In some embodiments, the compaction oligonucleotides can include at least one region having consecutive guanines. For example, the compaction oligonucleotides can include at least one region having 2, 3, 4, 5, 6 or more consecutive guanines. In some embodiments, the compaction oligonucleotides comprise four consecutive guanines which can form a guanine tetrad structure (e.g., FIG. 14A). The guanine tetrad structure can be stabilized via Hoogsteen hydrogen bonding. The guanine tetrad structure can be stabilized by a central cation including potassium, sodium, lithium, rubidium or cesium. At least one compaction oligonucleotide can form a guanine tetrad (e.g., FIG. 14A) and hybridize to the universal binding sequences in a concatemer which can cause the concatemer to fold to form an intramolecular G-quadruplex structure (e.g., FIG. 14B). The concatemers can self-collapse to form compact DNA nanoballs. Formation of the guanine tetrads and G-quadruplexes in the nanostructures may increase the stability of the compact DNA nanoballs to retain their compact size and shape which can withstand changes in pH, temperature and / or repeated flows of reagents.
[0324] In some embodiments, individual compaction oligonucleotides in the plurality comprise nucleic acids and can have any shape including a linear, branched, star or dendrimer shape e.g., bottle brush shape) (FIGS. 30-35C). In some embodiments, a compaction oligonucleotide can fold by forming intra-molecule base pairing having duplex portions via Watson-Crick base pairing, Hoogstein base pairing and / or a G-quadruplex structure. In some embodiments, the compaction oligonucleotides comprise nucleic acids that can fold into any shape having at least one hairpin, at least one stem-loop and / or at least one star shape. In some embodiments, individual compaction oligonucleotides comprise at least two binding regions that hybridize to at least a first and a second portion of the same concatemer template molecule. In some embodiments, individual compaction oligonucleotides comprise three binding regions that hybridize to a first, second and third portion of the same concatemertemplate molecule. In some embodiments, individual compaction oligonucleotides comprise four binding regions that hybridize to a first, a second, a third and a fourth portion of the same concatemer template molecule. In some embodiments, individual compaction oligonucleotides comprise at least two binding sites, and each binding site hybridizes to a different concatemer template molecule.Linear Compaction Oligonucleotides with Two Binding Regions
[0325] In some embodiments, individual compaction oligonucleotides comprise a linear nucleic acid having a first binding region and a second binding region, and optionally an intervening linker between the first and second binding regions (e.g., FIG. 30). In some embodiments, the first binding region of a compaction oligonucleotide hybridizes to a first portion of a concatemer template molecule. In some embodiments, the second binding region of the same compaction oligonucleotide hybridizes to a second portion of the same concatemer template molecule. In some embodiments, the first binding region of the compaction oligonucleotide hybridizes to at least a portion of a first universal binding sequence in the concatemer template molecule. In some embodiments, the second binding region of the compaction oligonucleotide hybridizes to at least a portion of a second universal binding sequence in the concatemer template molecule. In some embodiments, the first and second binding regions of the compaction oligonucleotide comprise the same sequence or different sequences. In some embodiments, the second binding region of the compaction oligonucleotide comprises a reverse sequence of the first binding region of the compaction oligonucleotide. In some embodiments, the orientation of the first binding region of the compaction oligonucleotide is a 5’ to 3’ orientation or a 3’ to 5’ orientation. In some embodiments, the orientation of the second binding region of the compaction oligonucleotide is a 5’ to 3’ orientation or a 3’ to 5’ orientation (FIG. 30). In FIG. 30, the 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.
[0326] In some embodiments, a compaction oligonucleotide comprises a first binding region arranged in a 5’ to 3’ orientation and a second binding region arranged in a 5’ to 3’ orientation (FIG. 30 part (i)). In some embodiments, a compaction oligonucleotide comprises a first binding region arranged in a 3’ to 5’ orientation and a second binding region arranged in a 3’ to 5’ orientation (FIG. 30 part (ii)). In some embodiments, a compaction oligonucleotide comprises a first binding region arranged in a 3’ to 5’ orientation and asecond binding region arranged in a 5’ to 3’ orientation (FIG. 30 part (iii)). In some embodiments, a compaction oligonucleotide comprises a first binding region arranged in a 5’ to 3’ orientation and a second binding region arranged in a 3’ to 5’ orientation (FIG. 30 part (iv)).
[0327] In some embodiments, the intervening linker of a compaction oligonucleotide is designed to be flexible. In some embodiments, the intervening linker of a compaction oligonucleotide is designed to be rigid. In some embodiments, the intervening linker of a compaction oligonucleotide comprises any one or any combination of nucleotides, nucleotide analogs and / or a non-nucleotide linker. In some embodiments, the intervening linker of a compaction oligonucleotide exhibits little or no hybridization to any portion of the concatemer template molecule.Linear Compaction Oligonucleotides with Three Binding Regions
[0328] In some embodiments, the compaction oligonucleotides comprise a linear nucleic acid having a first binding region, a second binding region, a third binding region, and optionally two intervening linkers disposed between the binding regions. In some embodiments, the first intervening linker is located between the first and second binding regions. In some embodiments, the second intervening linker is located between the second and third binding regions (e.g., FIGS. 31A-31C). In some embodiments, the first binding region of the compaction oligonucleotide hybridizes to a first portion of a concatemer template molecule. In some embodiments, the second binding region of the compaction oligonucleotide hybridizes to a second portion of the same concatemer template molecule. In some embodiments, the third binding region of the compaction oligonucleotide hybridizes to a third portion of the same concatemer template molecule.
[0329] In some embodiments, a compaction oligonucleotide comprises a first binding region arranged in a 5’ to 3’ orientation, a second binding region arranged in a 5’ to 3’ orientation, and a third binding region arranged in a 5’ to 3’ orientation (FIG. 31 A part (i)). In some embodiments, a compaction oligonucleotide comprises a first binding region arranged in a 5’ to 3’ orientation, a second binding region arranged in a 5’ to 3’ orientation, and a third binding region arranged in a 3’ to 5’ orientation (FIG. 31A part (ii)). In some embodiments, a compaction oligonucleotide comprises a first binding region arranged in a 5’ to 3’ orientation, a second binding region arranged in a 3’ to 5’ orientation, and a third binding region arranged in a 3’ to 5’ orientation (FIG. 31A part (iii)).
[0330] In some embodiments, a compaction oligonucleotide comprises a first binding region arranged in a 5’ to 3’ orientation, a second binding region arranged in a 3’ to 5’ orientation, and a third binding region arranged in a 5’ to 3’ orientation (FIG. 3 IB part (iv)). In some embodiments, a compaction oligonucleotide comprises a first binding region arranged in a 3’ to 5’ orientation, a second binding region arranged in a 5’ to 3’ orientation, and a third binding region arranged in a 5’ to 3’ orientation (FIG. 3 IB part (v)). In some embodiments, a compaction oligonucleotide comprises a first binding region arranged in a 3’ to 5’ orientation, a second binding region arranged in a 3’ to 5’ orientation, and a third binding region arranged in a 5’ to 3’ orientation (FIG. 3 IB part (vi)).
[0331] In some embodiments, a compaction oligonucleotide comprises a first binding region arranged in a 3’ to 5’ orientation, a second binding region arranged in a 5’ to 3’ orientation, and a third binding region arranged in a 5’ to 3’ orientation (FIG. 31C part (vii)). In some embodiments, a compaction oligonucleotide comprises a first binding region arranged in a 3’ to 5’ orientation, a second binding region arranged in a 3’ to 5’ orientation, and a third binding region arranged in a 5’ to 3’ orientation (FIG. 31C part (viii)). In some embodiments, a compaction oligonucleotide comprises a first binding region arranged in a 3’ to 5’ orientation, a second binding region arranged in a 5’ to 3’ orientation, and a third binding region arranged in a 3’ to 5’ orientation (FIG. 31C part (ix)).
[0332] In FIGS. 31 A-31C, the 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.
[0333] In some embodiments, the first binding region of the compaction oligonucleotide hybridizes to at least a portion of a first universal binding sequence in the concatemer template molecule. In some embodiments, the second binding region of the compaction oligonucleotide hybridizes to at least a portion of a second universal binding sequence in the same concatemer template molecule. In some embodiments, the third binding region of the compaction oligonucleotide hybridizes to at least a portion of a third universal binding sequence in the same concatemer template molecule.
[0334] In some embodiments, the first binding region, the second binding region, and the third binding region of the compaction oligonucleotide comprise the same sequence or different sequences. In some embodiments, the second and the third binding regions of the compaction oligonucleotide have the same sequence, and the first binding region has a different sequence. In some embodiments, the first and the second binding regions of thecompaction oligonucleotide have the same sequence, and the third binding region has a different sequence. In some embodiments, the first and the third binding regions of the compaction oligonucleotide have the same sequence, and the second binding region has a different sequence.
[0335] In some embodiments, the third binding region of the compaction oligonucleotide comprises a reverse sequence of the first binding region of the compaction oligonucleotide. In some embodiments, the second binding region of the compaction oligonucleotide comprises a sequence that is a reverse of the first binding region.
[0336] In some embodiments, the intervening linker of a compaction oligonucleotide is designed to be flexible. In some embodiments, the intervening linker of a compaction oligonucleotide is designed to be rigid. In some embodiments, the intervening linker of a compaction oligonucleotide comprises any one or any combination of nucleotides, nucleotide analogs and / or non-nucleotide linker. In some embodiments, the intervening linker of a compaction oligonucleotide exhibits little or no hybridization to any portion of the concatemer template molecule.Star Structure Compaction Oligonucleotides with Three or More Binding Regions
[0337] In some embodiments, the compaction oligonucleotides comprise a star shape nucleic acid having three or more binding arms linked together by an inner intervening linker (e.g., FIGS. 32A, 32B, 33 and 34).
[0338] In some embodiments, the inner intervening linker comprises a star-shaped polymer comprising a multifunctional core and three of more identical polymer arms radiating outwards from the core (e.g., a homostar). In some embodiments, the polymer arms comprise polyethylene oxide (PEO). In some embodiments, the polymer arms comprise polyethylene glyocol (PEG) or polyethylene oxide (PEO). In some embodiments, the polymer polyethylene glyocol (PEG) arms or the polyethylene oxide (PEO) arms having a molecular weight of about 100-200 Da, 200-300 Da, 300-400 Da, 400-500 Da or IK Da.
[0339] In some embodiments, a compaction oligonucleotide comprises: (1) an inner intervening linker and a first binding region arranged in a 5’ to 3’ orientation where the 3’ end of the first binding region is directed away from the inner intervening linker; (2) an inner intervening linker and a second binding region arranged in a 5’ to 3’ orientation where the 3’ end of the second binding region is directed away from the inner intervening linker; and (3) an inner intervening linker and a third binding region arranged in a 5’ to 3’ orientation wherethe 3’ end of the third binding region is directed away from the inner intervening linker (FIG. 32 A part (i)).
[0340] In some embodiments, a compaction oligonucleotide comprises: (1) an inner intervening linker and a first binding region arranged in a 3’ to 5’ orientation where the 5’ end of the first binding region is directed away from the inner intervening linker; (2) an inner intervening linker and a second binding region arranged in a 3’ to 5’ orientation where the 5’ end of the second binding region is directed away from the inner intervening linker; and (3) an inner intervening linker and a third binding region arranged in a 3’ to 5’ orientation where the 5’ end of the third binding region is directed away from the inner intervening linker (FIG. 32 A part (ii)).
[0341] In some embodiments, a compaction oligonucleotide comprises: (1) an inner intervening linker and a first binding region arranged in a 5’ to 3’ orientation where the 3’ end of the first binding region is directed away from the inner intervening linker; (2) an inner intervening linker and a second binding region arranged in a 5’ to 3’ orientation where the 3’ end of the second binding region is directed away from the inner intervening linker; and (3) an inner intervening linker and a third binding region arranged in a 3’ to 5’ orientation where the 5’ end of the third binding region is directed away from the inner intervening linker (FIG. 32B part (iii)).
[0342] In some embodiments, a compaction oligonucleotide comprises: (1) an inner intervening linker and a first binding region arranged in a 5’ to 3’ orientation where the 3’ end of the first binding region is directed away from the inner intervening linker; (2) an inner intervening linker and a second binding region arranged in a 3’ to 5’ orientation where the 5’ end of the second binding region is directed away from the inner intervening linker; and (3) an inner intervening linker and a third binding region arranged in a 3’ to 5’ orientation where the 5’ end of the third binding region is directed away from the inner intervening linker (FIG. 32B part (iv)).
[0343] In FIGS. 32A-32B, the 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.
[0344] In some embodiments, the first binding region of the compaction oligonucleotide hybridizes to at least a portion of a first universal binding sequence in the concatemer template molecule. In some embodiments, the internal region of the compaction oligonucleotide hybridizes to at least a portion of a second universal binding sequence in theconcatemer template molecule. In some embodiments, the third binding region of the compaction oligonucleotide hybridizes to at least a portion of a third universal binding sequence in the concatemer template molecule. In some embodiments, the first binding region, the internal region, and the second binding region of the compaction oligonucleotide comprise the same sequence or different sequences. In some embodiments, the internal and the second binding regions of the compaction oligonucleotide have the same sequence, and the first binding region has a different sequence. In some embodiments, the first binding and the internal regions of the compaction oligonucleotide have the same sequence, and the second binding region has a different sequence. In some embodiments, the first binding and the second binding regions of the compaction oligonucleotide have the same sequence, and the internal region has a different sequence. In some embodiments, the second binding region of the compaction oligonucleotide comprises a reverse sequence of the first binding region of the compaction oligonucleotide. In some embodiments, the internal region of the compaction oligonucleotide comprises a sequence that is a reverse of the first binding region.
[0345] In some embodiments, the intervening linker of a compaction oligonucleotide is designed to be flexible or rigid. In some embodiments, the intervening linker of a compaction oligonucleotide comprises any one or any combination of nucleotides, nucleotide analogs and / or non-nucleotide linker. In some embodiments, the intervening linker of a compaction oligonucleotide exhibits little or no hybridization to any portion of the concatemer template molecule.
[0346] In some embodiments, a compaction oligonucleotide comprises three binding arms where each binding arm comprises: an inner intervening linker, a first binding region, an intervening linker, and a second binding region. In some embodiments, the first binding regions and second binding regions are both arranged in a 5’ to 3’ orientation. In some embodiments, the 3’ end of the second binding region is directed away from the intervening linker (e.g., FIG. 33). In some embodiments, the 3’ end of the first binding region is directed away from the inner intervening linker (e.g., FIG. 33). In some embodiments, each binding arm comprises, from 5’ to 3’, an inner intervening linker, a first binding region, an intervening linker, and a second binding region. In FIG. 33, the 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.
[0347] In some embodiments, a compaction oligonucleotide comprises four binding regions, and optionally four intervening linkers. In some embodiments, a compactionoligonucleotide comprises: (1) an inner intervening linker and a first binding region arranged in a 5’ to 3’ orientation where the 3’ end of the first binding region is directed away from the inner intervening linker; (2) an inner intervening linker and a second binding region arranged in a 5’ to 3’ orientation where the 3’ end of the second binding region is directed away from the inner intervening linker; (3) an inner intervening linker and a third binding region arranged in a 5’ to 3’ orientation where the 3’ end of the third binding region is directed away from the inner intervening linker; and (4) an inner intervening linker and a fourth binding region arranged in a 5’ to 3’ orientation where the 3’ end of the fourth binding region is directed away from the inner intervening linker (FIG. 34 part (i)).
[0348] In some embodiments, a compaction oligonucleotide comprises: (1) an inner intervening linker and a first binding region arranged in a 3’ to 5’ orientation where the 5’ end of the first binding region is directed away from the inner intervening linker; (2) an inner intervening linker and a second binding region arranged in a 3’ to 5’ orientation where the 5’ end of the second binding region is directed away from the inner intervening linker; (3) an inner intervening linker and a third binding region arranged in a 3’ to 5’ orientation where the 5’ end of the third binding region is directed away from the inner intervening linker; and (4) an inner intervening linker and a fourth binding region arranged in a 3’ to 5’ orientation where the 5’ end of the fourth binding region is directed away from the inner intervening linker (FIG. 34 part (ii)).
[0349] In FIG. 34, the 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.Comb Structure Compaction Oligonucleotides with a Plurality of Binding Regions
[0350] In some embodiments, the compaction oligonucleotide comprises at least three binding arms. In some embodiments, the compaction oligonucleotide comprises a plurality of binding arms having the same sequence. In some embodiments, individual binding arms comprise a first binding region arranged in a 5’ to 3’ orientation where the 3’ end of the first binding region is directed away from the linker moiety. In some embodiments, individual binding arms are joined to the linker moiety by an inner intervening linker (e.g., FIG. 35A).
[0351] In some embodiments, the compaction oligonucleotide comprises at least three binding arms. In some embodiments, the compaction oligonucleotide comprises a plurality of binding arms having one of two different sequences. In some embodiments, individualbinding arms comprise a first binding region arranged in a 5’ to 3’ orientation where the 3’ end of the first binding region is directed away from the linker moiety. In some embodiments, individual binding arms comprise a second binding region arranged in a 5’ to 3’ orientation where the 3’ end of the second binding region is directed away from the linker moiety. In some embodiments, individual binding arms are joined to the linker moiety by an inner intervening linker (e.g., FIG. 35B).
[0352] In some embodiments, the compaction oligonucleotide comprises at least three binding arms. In some embodiments, the compaction oligonucleotide comprises a plurality of binding arms having one of three different sequences. In some embodiments, individual binding arms comprise a first binding region arranged in a 5’ to 3’ orientation where the 3’ end of the first binding region is directed away from the linker moiety. In some embodiments, individual binding arms comprise a second binding region arranged in a 5’ to 3’ orientation where the 3’ end of the second binding region is directed away from the linker moiety. In some embodiments, individual binding arms comprise a third binding region arranged in a 5’ to 3’ orientation where the 3’ end of the third binding region is directed away from the linker moiety. In some embodiments, individual binding arms are joined to the linker moiety by an inner intervening linker (e.g., FIG. 35C).
[0353] In FIGS. 35A-35C, the 5’ to 3’ orientation of a binding region of a compaction oligonucleotide, or the 3’ to 5’ orientation of a binding region of a compaction oligonucleotide, refers to the orientation of the sugar-phosphate backbone of the binding region.Intervening Regions of Compaction Oligonucleotides
[0354] In some embodiments, the intervening linker of any of the compaction oligonucleotides described herein can be a polynucleotide linker. In some embodiments, the intervening linker comprises nucleotides, nucleotide analogs, or a combination thereof. The intervening linker can be any length, for example about 2-20 nucleotides in length. The intervening linker can comprise a homopolymer having consecutive identical bases (e.g., AAA, GGG, CCC, TTT or UUU). Alternatively, or in addition, the intervening linker can comprise a non-homopolymer sequence. In some embodiments, the intervening linker comprises at least one inosine. In some embodiments, the intervening linker comprises a homopolymer having consecutive identical bases (e.g., inosine).
[0355] In some embodiments, the intervening linker comprises a spacer. In some embodiments, the spacer comprises a non-nucleotide linker. In some embodiments, the spacercomprises an 18-carbon spacer (e.g., comprising a hexa-ethyleneglycol spacer), multiple C3 spacer phosphoramidites, or a spacer 9 (triethylene glycol chain that is 9 atoms long, and includes 6 carbons and 3 oxygens), which comprises a trimethylene glycol spacer. In some embodiments, the spacer comprises a polyethylene glycol spacer, including a PEG2, PEG3 or PEG4 spacer.
[0356] In some embodiments, the intervening linker comprises at least one nonnucleotide linker and at least one PEG spacer in any arrangement. For example, the intervening linker comprises 5 ’-right arm-([PEG-spacer]-[C18-spacer])n-left arm-3’ where “n” is 1-10. In another example, the intervening linker comprises 5’-right arm-([C18-spacer]- [PEG-spacer])n-left arm-3’ where “n” is 1-10.Sequences of Binding Regions of Compaction Oligonucleotides
[0357] Any of the binding regions of a compaction oligonucleotide can be wholly complementary or partially complementary along their length to a portion of a concatemer template molecule. In some embodiments, the binding regions of a compaction oligonucleotide are designed to hybridize to a universal binding sequencing in a concatemer template molecule.
[0358] In some embodiments, the compaction oligonucleotide comprises two or more binding regions, and all of the binding regions have the same sequence. In some embodiments, the compaction oligonucleotide comprises two binding regions having different sequences. In some embodiments, the compaction oligonucleotide comprises three or more binding regions and at least two of the binding regions have different sequences.
[0359] In some embodiments, the compaction oligonucleotide comprises two or more binding regions and all of the binding regions have the same sequence. In some embodiments, the compaction oligonucleotide comprises two binding regions having different sequences. In some embodiments, the compaction oligonucleotide comprises three or more binding regions and at least two of the binding regions have different sequences.
[0360] The first binding region of the compaction oligonucleotide can have the same sequence as the second binding region. The first binding region of the compaction oligonucleotide can have a sequence that is different from the second binding region.
[0361] In some embodiments, the first binding region of a compaction oligonucleotide comprises a sequence according to any of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 82, 85, 88, 91, 94, 97, 100, 103, 106, 109, 112, 115, 118, 121, 124, 127, 130, 133, 136, 139, 142, or 145 (see Table 6).
[0362] In some embodiments, the second, third, fourth, fifth or any subsequent binding region of the compaction oligonucleotide comprises a sequence that is a reverse sequence of the first binding region (e.g., the reverse sequence according to any of one of SEQ ID NOs: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65, 68, 71, 74, 77, 80, 83, 86, 89, 92, 95, 98, 101, 104, 107, 110, 113, 116, 119, 122, 125, 128, 131, 134, 137, 140, 143, or 146 (see Table 6). The sequence of the second, third, fourth, fifth or any subsequent binding region comprises the same sequence of the first binding region oriented in the opposite order.
[0363] In some embodiments, the first binding region of a compaction oligonucleotide comprises a sequence according to any of SEQ ID NOs: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65, 68, 71, 74, 77, 80, 83, 86, 89, 92, 95, 98, 101, 104, 107, 110, 113, 116, 119, 122, 125, 128, 131, 134, 137, 140, 143, or 146 (see Table 6).
[0364] In some embodiments, the second, the third, the fourth, the fifth or any subsequent binding region of the compaction oligonucleotide comprises a sequence that is a reverse sequence of the first binding region, where the second, third, fourth, fifth or any subsequence binding region comprises any of one of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 82, 85, 88, 91, 94, 97, 100, 103, 106, 109, 112, 115, 118, 121, 124, 127, 130, 133, 136, 139, 142, or 145 (see Table 6).
[0365] In some embodiments, first binding region of the compaction oligonucleotide can have a sequence that is a reverse sequence of the second binding region (e.g., the reverse sequence according to any of one of SEQ ID NOs: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65, 68, 71, 74, 77, 80, 83, 86, 89, 92, 95, 98, 101, 104, 107, 110, 113, 116, 119, 122, 125, 128, 131, 134, 137, 140, 143, or 146 (see Table 6).
[0366] In some embodiments, the second binding region of a compaction oligonucleotide comprises a sequence according to any of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 82, 85, 88, 91, 94, 97, 100, 103, 106, 109, 112, 115, 118, 121, 124, 127, 130, 133, 136, 139, 142, or 145 (see Table 6).
[0367] In some embodiments, the third binding region of a compaction oligonucleotide comprises a sequence according to any of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 82, 85, 88, 91, 94, 97, 100, 103, 106, 109, 112, 115, 118, 121, 124, 127, 130, 133, 136, 139, 142, or 145 (see Table 6).
[0368] In some embodiments, the fourth binding region of a compaction oligonucleotide comprises a sequence according to any of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31,34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 82, 85, 88, 91, 94, 97, 100, 103, 106, 109, 112, 115, 118, 121, 124, 127, 130, 133, 136, 139, 142, or 145 (see Table 6).
[0369] In some embodiments, the fifth binding region of a compaction oligonucleotide comprises a sequence according to any of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 82, 85, 88, 91, 94, 97, 100, 103, 106, 109, 112, 115, 118, 121, 124, 127, 130, 133, 136, 139, 142, or 145 (see Table 6).
[0370] In some embodiments, the subsequent binding region(s) of a compaction oligonucleotide comprise a sequence according to any of SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 52, 55, 58, 61, 64, 67, 70, 73, 76, 79, 82, 85, 88, 91, 94, 97, 100, 103, 106, 109, 112, 115, 118, 121, 124, 127, 130, 133, 136, 139, 142, or 145 (see Table 6).
[0371] In some embodiments, the compaction oligonucleotides comprise a full-length sequence according to any one of SEQ ID NOs: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, 141, 144, or 147 (see Table 6).
[0372] In some embodiments, the terminal 3’ end of any of the compaction oligonucleotides can include at least one additional base comprising one or more 2’-O-methyl RNA bases (e.g., designated mUmUmU) or the terminal 3’ end lacks additional 2’-O-methyl RNA bases.
[0373] In some embodiments, the compaction oligonucleotides comprise one or more modified bases or linkages at their 5’ or 3’ ends to confer certain functionalities. In some embodiments, the compaction oligonucleotides comprise at least one phosphorothioate linkages at their 5’ and / or 3’ ends to confer exonuclease resistance. In some embodiments, at least one nucleotide at or near the 3’ end comprises a 2’ fluoro base which confers exonuclease resistance. In some embodiments, the 3’ end of the compaction oligonucleotides comprise at least one 2’-O-methyl RNA base which blocks polymerase-catalyzed extension. For example, the 3’ end of the compaction oligonucleotide comprises at least one base comprising 2’-O-methyl RNA base (e.g., designated mUmUmU). In some embodiments, the compaction oligonucleotides comprise a 3’ inverted dT at their 3’ ends which blocks polymerase-catalyzed extension. In some embodiments, the compaction oligonucleotides comprise 3’ phosphorylation which blocks polymerase-catalyzed extension. In some embodiments, the compaction oligonucleotides comprise at least one locked nucleic acid (LNA) which increases the thermal stability of duplexes formed by hybridizing a compaction oligonucleotide to a concatemer template molecule.
[0374] The compaction oligonucleotides can include at least one region (e.g., hybridization / binding region) having consecutive guanines. For example, the compaction oligonucleotides can include at least one region having 2, 3, 4, 5, 6 or more consecutive guanines. In some embodiments, the compaction oligonucleotides comprise four consecutive guanines which can form a guanine tetrad structure (e.g., FIG. 14A). The guanine tetrad structure can be stabilized via Hoogsteen hydrogen bonding. The guanine tetrad structure can be stabilized by a central cation including potassium, sodium, lithium, rubidium, or cesium.
[0375] At least one compaction oligonucleotide can form a guanine tetrad (e.g., FIG.14 A) and hybridize to the universal binding sequences in a concatemer which can cause the concatemer to fold to form an intramolecular G-quadruplex structure (e.g., FIG. 14B). The concatemers can self-collapse to form compact nanostructures. Formation of the guanine tetrads and G-quadruplexes in the nanostructures may increase the stability of the nanostructures to retain their compact size and shape which can withstand changes in pH, temperature and / or repeated flows of reagents.
[0376] In some embodiments, the plurality of compaction oligonucleotides comprises the same sequence. In some embodiments, the plurality of compaction oligonucleotides comprise a sequence according to any one of SEQ ID NOs: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, 141, 144, or 147 (see Table 6). In some embodiments, the plurality of compaction oligonucleotides comprise a sequence according to any one of SEQ ID NOs: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, 141, 144, or 147 (see Table 6), where the 3’ end of the compaction oligonucleotide also includes three bases comprising 2’-O-methyl RNA base (e.g., designated mUmUmU).
[0377] In some embodiments, the plurality of compaction oligonucleotides comprises a mixture of two or more different populations of compaction oligonucleotides having different sequences. In some embodiments, the plurality of compaction oligonucleotides comprises a mixture of 2, 3, 4, 5, 6, 7, 8, 9 or 10 different populations of compaction oligonucleotides wherein the compaction oligonucleotides in the different populations have different sequences. In some embodiments, in the mixture of different compaction oligonucleotides, any given population of compaction oligonucleotides comprise a sequence according to any one of SEQ ID NOs: 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60,63, 66, 69, 72, 75, 78, 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, 141, 144, or 147 (see Table 6).Quality Scores
[0378] In some embodiments, the sequencing comprises sequencing the plurality of compact DNA nanoballs in a massively parallel sequencing workflow using detectably labeled nucleotide reagents to yield increased signal intensity at any given sequencing cycle. For example, the compact DNA nanoballs exhibit increased signal intensity in long sequencing runs up to and beyond 300 sequencing cycles (e.g., FIGS. 22A and 22B). The compact DNA nanoballs also exhibit increased signal intensity in pairwise sequencing runs where the forward and reverse sequencing runs include more than 300 sequencing cycles. The increased signal intensity results in quality scores that exceed Q30 for both forward and reverse strands in a pairwise sequencing run (e.g., FIGS. 23A-23B and 24A-24B) where the insert region is about 300-350 bases in length. By contrast, DNA concatemer template molecules generated by using immobilized capture and pinning primers but lacking soluble amplification primers during RCA generate lower signal intensity and quality scores for forward and reverse strands in a pairwise sequencing run.
[0379] In some embodiments, any of the disclosed nucleic acids sequencing methods and systems can be employed and provide an average base-calling accuracy of at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, or at least 99.9% correct over the course of a sequencing run.
[0380] In some embodiments, any of the disclosed nucleic acids sequencing methods and systems can be employed and provide an average base-calling accuracy of at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, at least 99%, at least 99.5%, at least 99.8%, or at least 99.9% correct per every 1,000 bases, 10,0000 bases, 25,000 bases, 50,000 bases, 75,000 bases, or 100,000 bases called.
[0381] In some embodiments, the quality or accuracy of a sequencing run may be assessed by calculating a Phred quality score (also referred to as a quality score or “Q- score”), which indicates the probability that a given base is called incorrectly by the sequencing system. For example, in some embodiments base calling accuracy for a specific sequencing chemistry and / or sequencing system may be assessed for a large empirical data set derived from performing sequencing runs on a library of known nucleic acid sequences. The Q-score may then be calculated according to the equation: Q = -10 logioP. In some embodiments, P is the base calling error probability. A Q-score of 30, for example, indicatesa probability of making a base calling error of 1 in every 1000 bases called (or a base calling accuracy of 99.9%).
[0382] In some embodiments, any of the disclosed nucleic acid sequencing methods and systems can be employed to provide a more accurate base readout. In some embodiments, for example, the disclosed nucleic acid sequencing methods and systems may provide a Q-score for base-calling accuracy over a sequencing run that ranges from about 20 to about 50. In some embodiments, the average Q-score for the run may be at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50.
[0383] In some embodiments, any of the disclosed nucleic acid sequencing methods and systems can be employed and provide a Q-score of greater than 20 for at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% of the nucleotide bases identified. In some embodiments, the disclosed nucleic acid sequencing methods and systems may provide a Q-score of greater than 25 for at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% of the nucleotide bases identified. In some embodiments, the disclosed nucleic acid sequencing methods and systems may provide a Q-score of greater than 30 for at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% of the nucleotide bases identified. In some embodiments, the disclosed nucleic acid sequencing methods and systems may provide a Q-score of greater than 35 for at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% of the nucleotide bases identified. In some embodiments, the disclosed nucleic acid sequencing methods and systems may provide a Q-score of greater than 40 for at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% of the nucleotide bases identified. In some embodiments, the disclosed nucleic acid sequencing methods and systems may provide a Q- score of greater than 45 for at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% of the nucleotide bases identified. In some embodiments, the disclosed compositions, methods, and systems for nucleic acid sequencing may provide a Q-score of greater than 50 for at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% of the nucleotide bases identified.Batch Sequencing
[0384] For massively parallel sequencing, the limit of optical resolution impedes the ability to perform highly multiplex sequencing. Batch-specific sequencing enables sequencing a desired subset (e.g., a batch) of the template molecules immobilized to the same flow cell using selected batch-specific sequencing primers to reduce over-crowding signals and images which are generated during sequencing. The use of batch-specific sequencing primers produces optical images that are intense and resolvable. The batch-specific sequencing methods described herein have many uses. For example, the number of spots that are imaged and associated with sequencing can be counted. The counted spots can be used as a measure for target nucleic acid levels in a sample.
[0385] In some aspects, the present disclosure provides compositions, apparatus and methods for conducting separate sequencing batches on a support having concatemer template molecules immobilized thereon, where the separate sequencing batches can be conducted using any massively parallel sequencing technology. In some embodiments, a plurality of sub-populations of concatemer template molecules are immobilized to the support including at least a first and second sub-population. In some embodiments, the first subpopulation of template molecules undergo first sequencing reactions (e.g., first batch sequencing) and a region of the support is imaged to detect the first sequencing reactions, wherein the second sub-population of template molecules do not undergo sequencing reactions. In some embodiments, the second sub-population of template molecules undergo second sequencing reactions (e.g., second batch sequencing) and the same region of the support is imaged to detect the second sequencing reactions, wherein the first sub-population of concatemer template molecules do not undergo sequencing reactions. Thus, the first and second sub-populations of concatemer template molecules undergo batch sequencing.
[0386] In some embodiments, the plurality of sub-populations of nucleic acid concatemer template molecules are immobilized to the support at a high density where at least some of the concatemer template molecules in the first and second sub-populations comprise nearest neighbor template molecules that touch each other and / or overlap each other when viewed from any angle of the support including above, below or side views of the support. For example, the plurality of sub-populations of template molecules are immobilized to the support at a density of about 102- 1015template molecules per mm2, e.g., between about 102- 1015template molecules per mm2, between about 105- 1015template molecules per mm2, between about 1010- 1015template molecules per mm2, between about 103- 1014template molecules per mm2, between about 104- 1013template molecules per mm2, between aboutIO5- 1012template molecules per mm2, between about 106- 1011template molecules per mm2, between about 107- IO10template molecules per mm2, or between about 108- IO10template molecules per mm2, or any range therebetween.
[0387] In some embodiments, the support comprises a plurality of concatemer template molecules immobilized at pre-determined positions on the support (e.g., a patterned support). In some embodiments, the support comprises a plurality of template molecules immobilized at random and non-pre-determined positions on the support. In some embodiments, the support comprises a mixture of at least two sub-populations of template molecules immobilized at random and non-pre-determined positions on the support.
[0388] In some embodiments, the support lacks any contours (e.g., wells, protrusions, and the like) arranged in a pre-determined pattern. In some embodiments, the support lacks contours which include features as sites for attachment of the template molecules. In some embodiments, the support lacks interstitial regions arranged in a pre-determined pattern where the interstitial regions are sites designed to have no attached surface capture primers and / or template molecules. In some embodiments, the support lacks features that can be prepared using photo-chemical, photo-lithography, or micron-scale or nano-scale printing.
[0389] In some embodiments, individual template molecules in a given sub-population of template molecules comprise a sequence of interest, a batch barcode sequence that corresponds to the sequence of interest, and a batch sequencing primer binding site sequence that corresponds to the sequence of interest. In some embodiments, a pre-determined batch barcode sequence can be linked to a given sequence of interest, thus the pre-determined batch barcode sequence corresponds to a given sequence of interest. In some embodiments, a predetermined batch sequencing primer binding site sequence can be linked to a given sequence of interest, thus the pre-determined batch sequencing primer binding site sequence corresponds to a given sequence of interest. In some embodiments, template molecules within a given sub-population have the same or different sequences of interest. In some embodiments, template molecules within a given sub-population have the same batch barcode sequence. In some embodiments, template molecules within a given sub-population have the same sequencing primer binding site sequence. Thus, the different sub-populations of template molecules can undergo batch sequencing using a batch-specific sequencing primer.
[0390] In some embodiments, the sequence of interest region need not undergo sequencing. Instead, the batch barcode can be sequenced by conducting a small number of sequencing cycles to reveal the batch barcode which corresponds to its sequence of interest. In some embodiments, the batch barcode and the sequence of interest can be sequenced.
[0391] In some embodiments, individual template molecules in a given sub-population of template molecules further comprise a sample index sequence that can be used to distinguish sequences of interest obtained from different sample sources in a multiplex assay. In some embodiments, template molecules within a given sub-population have the same or different sample index sequences.
[0392] In some embodiments, the sequence of interest region need not undergo sequencing. Instead, the batch barcode and the sample index can be sequenced by conducting a small number of sequencing cycles to reveal the batch barcode which corresponds to its sequence of interest and to reveal the sample index which corresponds to the sample source of the sequence of interest. In some embodiments, the template molecules lack a sample index and the batch barcode can serve as a sample index.
[0393] In some embodiments, the same portion of individual template molecules can be re-sequenced (e.g., reiterative sequencing) from the same start position to generate overlapping sequencing reads that can be aligned to a reference sequence. For example, the same portion of individual template molecules can be sequenced at least two, three, four, five, up to 50 times, up to 100 times, or more than 100 times. The start sequencing site can be any location of the template molecule and is dictated by the sequencing primers which are designed to anneal to a selected position within the template molecule. In some embodiments, the batch barcodes (or the batch barcodes and the sample indexes) can be reiteratively sequenced by repeatedly conducting a short number of sequencing cycles of the batch barcode region (or the batch barcode and the sample index regions) of a given template molecule. The reiterative sequencing reads increase the redundancy of sequencing information for individual bases in the template molecule. Reiteratively sequencing one strand of the template molecule provides enough base coverage so that pairwise sequencing of the complementary strand is not necessary.
[0394] In some embodiments, after sequencing the first and / or the second subpopulations of template molecules, the support can be re-seeded at least once with additional sub-populations of template molecules (e.g., a third sub-population) which can undergo additional batch sequencing. In some embodiments, an ongoing batch sequencing run can be stopped prior to completion (e.g., interrupted) to permit re-seeding the support with an additional sub-population of concatemer template molecules (e.g., the third sub-population) and then the interrupted batch sequencing can be resumed. Thus, the support can be re-seeded any time and / or before a previous sequencing batch is completed.
[0395] In some embodiments, the support comprises a plurality of template molecules immobilized at an initial low density where most of the nearest neighbor template molecules do not touch each other and / or do not overlap each other. In some embodiments, the initial low density support comprises a plurality of concatemer template molecules having interstitial space between the concatemer template molecules.
[0396] In some embodiments, the same support can undergo a first re-seeding with additional template molecules immobilized to the support, so that the first re-seeded density has some nearest template molecules (e.g., 10 - 30% of the first immobilized re-seeded template molecules) that touch each other and / or overlap each other. In some embodiments, the resulting first re-seeded support comprises a plurality of concatemer template molecules having a reduced number of interstitial space (and / or having a reduced size of interstitial space) between the concatemer template molecules compared to the initial low density support.
[0397] In some embodiments, the same support can undergo a second re-seeding with additional template molecules immobilized to the support, so that the second re-seeded density has an increase in nearest neighbor template molecules (e.g., 25 - 50% or more of the first immobilized re-seeded template molecules) that touch each other and / or overlap each other. In some embodiments, the resulting second re-seeded support comprises a plurality of concatemer template molecules having a further reduced number of interstitial space (and / or having a further reduced size of interstitial space) between the concatemer template molecules compared to the first re-seeded density support. In some embodiments, the support can undergo multiple re-seeding workflows to generate increasing nearest neighbor template molecules that touch each other and / or overlap each other.
[0398] In some embodiments, individual template molecules comprise concatemer template molecules. In some embodiments, a concatemer template molecule can be generated by conducting a rolling circle amplification of a circularized nucleic acid library molecule. In some embodiments, a concatemer template molecule comprises a single-stranded nucleic acid strand carrying numerous tandem copies of a polynucleotide unit. In some embodiments, individual polynucleotide units comprise a sequence of interest region and at least one batch sequencing primer binding site. In some embodiments, individual polynucleotide units further comprise at least one batch barcode sequence. In some embodiments, individual polynucleotide units further comprise at least one sample index sequence. Individual polynucleotide units can bind a sequencing primer, a sequencing polymerase and a detectably-labeled nucleotide reagent (e.g., detectably labeled multivalent molecules ornucleotide analogs), to form a detectable sequencing complex. In some embodiments, individual concatemer template molecules can collapse into a compact DNA nanoball. In some embodiments, individual compact DNA nanoballs carry numerous tandem copies of a polynucleotide unit along their lengths. During batch sequencing, individual compact DNA nanoballs carry numerous detectable sequencing complexes. Thus, the compact nature of the compact DNA nanoballs increases the local concentration of detectably-labeled nucleotide reagents that are used during batch sequencing which increases the signal intensity emitted from a compact DNA nanoball to give a discrete detectable signal which can be imaged as a fluorescent spot. In some embodiments, a spot corresponds to a concatemer and each concatemer corresponds to a sequence of interest. Multiple spots can be detected and imaged simultaneously on a support having a high density of concatemer template molecules immobilized thereon.
[0399] In some embodiments, the methods described herein employ batch sequencing on high density immobilized concatemer template molecules which offers an advantage of maximizing space on a support (e.g., flow cell). Furthermore, the same seeded support can be re-used by re-seeding the support with additional concatemer template molecules and conducting additional sequencing reactions on the re-seeded concatemer template molecules.
[0400] Batch sequencing can be conducted using concatemer template molecules arranged in a pre-determined manner on the support (e.g., a patterned support). Alternatively, batch sequencing can be conducted using concatemer template molecules arranged in a random manner on the support, which obviates the need to fabricate a support having organized and pre-determined features for attaching concatemer template molecules (e.g., fabrication via lithography is not needed).
[0401] By conducting short sequencing reads of the batch barcode regions of the concatemer template molecules, batch sequencing also may significantly reduce sequencing run times, reagent use, and reagent costs.
[0402] As a further advantage, when short sequencing reads of the batch barcode regions are conducted in a reiterative manner, it is not necessary to assemble the sequencing reads or to obtain a full length sequence of the sequence of interest which reduces the need for long assembly computations. Also, the redundant sequencing information obtained from the short sequencing reads can obviate the need to sequence the complementary strand of the template molecules, e.g., concatemer template molecule, thus pairwise sequencing is not necessary.
[0403] Batch sequencing can also offer the flexibility of re-seeding the support any time between sequencing different batches, or an ongoing sequencing batch can be interrupted topermit re-seeding and then the ongoing batch sequencing can be resumed. The ability to reseed the support at any time increases throughput and efficiency.
[0404] Conducting batch sequencing with immobilized concatemer template molecules offers advantages over one-copy template molecules (e.g., one-copy template molecule generated via bridge amplification). For example, concatemer template molecules carry multiple sequencing primer binding sites along the same concatemer template molecule. The multiple sequencing primer binding sites can be used to generate multiple sequencing reads for increased sequencing depth. Together, reiteratively sequencing one strand of the concatemer template molecules increases sequencing base coverage and sequencing depth compared to sequencing a one-copy template molecule.
[0405] Batch sequencing has many uses including but not limited to detecting specific nucleic acids of interest, mutant nucleic acid sequences, splice variants, and their abundance levels thereof.
[0406] In some aspects, the present disclosure provides methods for sequencing comprising step (a): providing a support comprising a plurality of template molecules (e.g., concatemer template molecules) immobilized to the support. In some embodiments, the plurality of template molecules comprises a plurality of sub-populations of template molecules including at least a first and a second sub-population of template molecules. In some embodiments, the first sub-population of template molecules comprises a first batch sequencing primer binding site and at least one first sequence-of-interest. In some embodiments, the second sub-population of template molecules comprises a second batch sequencing primer binding site and at least one second sequence-of-interest. In some embodiments, template molecules within the first sub-population have the same first batch sequencing primer binding site, and have the same sequence of interest or different sequences of interest. In some embodiments, the sequence of the first batch sequencing primer binding site sequence corresponds to the first sequence of interest, or the first batch sequencing primer binding site sequence corresponds to one of the first sequences of interest in the first sub-population. In some embodiments, a pre-determined first batch sequencing primer binding site sequence can be linked to a given sequence of interest in the first sub-population, thus the pre-determined first batch sequencing primer binding site sequence corresponds to a given sequence of interest in the first sub-population. In some embodiments, a predetermined first batch sequencing primer binding site sequence can be linked to different sequences of interest in a first sub-population.
[0407] In some embodiments, the sequences of interest in the first sub-population are about 50-250 bases in length, or about 250-500 bases in length, or about 500-800 bases in length, or about 800-1200 bases in length, or about 1200-2000 bases in length, or up to 2000 bases in length, or any range therebetween.
[0408] In some embodiments, template molecules within the second sub-population have the same second batch sequencing primer binding site, and have the same sequence of interest or different sequences of interest. In some embodiments, the sequence of the second batch sequencing primer binding site sequence corresponds to the second sequence of interest, or the sequence of the second batch sequencing primer binding site sequence corresponds to one of the second sequences of interest in the second sub-population. In some embodiments, a pre-determined second batch sequencing primer binding site sequence can be linked to a given sequence of interest in the second sub-population, thus the pre-determined second batch sequencing primer binding site sequence corresponds to a given sequence of interest in the second sub-population. In some embodiments, a pre-determined second batch sequencing primer binding site sequence can be linked to different sequences of interest in a second sub-population.
[0409] In some embodiments, the sequences of interest in the second sub-population are about 50-250 bases in length, or about 250-500 bases in length, or about 500-800 bases in length, or about 800-1200 bases in length, or about 1200-2000 bases in length, or any range therebetween, or up to 2000 bases in length.
[0410] In some embodiments, the first and the second batch sequencing primer binding sites have different sequences.
[0411] In some embodiments, the plurality of template molecules can be immobilized to the support at random and non-pre-determined positions on the support, or at pre-determined positions on the support (e.g., a patterned support).
[0412] In some embodiments, in the methods for sequencing of step (a), the support comprises a plurality of concatemer template molecules immobilized thereon at a density of about 102- 1015template molecules per mm2(immobilized concatemer template molecules). In some embodiments, the concatemer template molecules comprise a mixture of at least two sub-populations of template molecules including at least a first and second sub-population of template molecules. In some embodiments, the plurality of sub-populations of template molecules are immobilized to the support at a high density. In some embodiments, at least some of the concatemer template molecules in the first and the second sub-populations comprise nearest neighbor template molecules that touch each other and / or overlap each otherwhen viewed from any angle of the support including above, below or side views of the support. In some embodiments, the support comprises up to 500 million template molecules immobilized thereon, or up to 1 billion template molecules immobilized thereon, or up to 2 billion template molecules immobilized thereon, or up to 3 billion template molecules immobilized thereon, or up to 4 billion template molecules immobilized thereon, or up to 5 billion template molecules immobilized thereon, or up to 6 billion template molecules immobilized thereon. In some embodiments, the support comprises up to 7 billion template molecules immobilized thereon, or up to 8 billion template molecules immobilized thereon, or up to 9 billion template molecules immobilized thereon, or up to 10 billion template molecules immobilized thereon, or up to 20 billion template molecules immobilized thereon. In some embodiments, the support comprises between about 500 million and about 20 billion template molecules immobilized thereon, between about 1 billion and about 10 billion template molecules immobilized thereon, between about 2 billion and about 9 billion template molecules immobilized thereon, between about 3 billion and about 8 billion template molecules immobilized thereon, between about 4 billion and about 7 billion template molecules immobilized thereon, or between about 5 billion and about 6 billion template molecules immobilized thereon, or any range therebetween.
[0413] In some embodiments, in the methods for sequencing of step (a), the support comprises features that are located in a random and non-pre-determined manner, where the features are sites for attachment of the template molecules.
[0414] In some embodiments, the support is passivated with at least one polymer layer comprising a plurality of surface capture primers covalently tethered to the at least one polymer layer.
[0415] In some embodiments, the support is passivated with multiple polymer layers. In some embodiments, at least one of the polymer layers comprise oligonucleotide primers including capture primers, pinning primers, or a mixture of capture and pinning primers. In some embodiments, the plurality of oligonucleotide primers comprise one type of capture primer (e.g., having that same batch capture primer sequence) or a mixture of 2-500 different types of capture primers (e.g., having 2-500 different batch capture primer sequences). In some embodiments, the plurality of oligonucleotide primers comprise one type of pinning primer (e.g., having that same batch pinning primer sequence) or a mixture of 2-500 different types of pinning primers (e.g., having 2-500 different batch pinning primer sequences). In some embodiments, the plurality of oligonucleotide types comprises between 2 and 500, between 10 and 400, between 20 and 300, between 50 and 200, between 100 and 500,between 200 and 400, between 2 and 250, between 10 and 150, between 20 and 200, or between 20 and 100 or between 5 and 50 different capture primers and / or pinning primers, or any range therebetween.
[0416] In some embodiments, the plurality of surface capture primers comprise a plurality of sub-populations of surface capture primers including at least a first and second sub-population of surface capture primers. In some embodiments, the surface capture primers in the at least first and second sub-population have different sequences. In some embodiments, the surface capture primers in the at least first and second sub-population can hybridize to and capture different circularized library molecules carrying different surface capture primer binding site sequences.
[0417] In some embodiments, the plurality of surface capture primers are randomly distributed throughout and embedded within the at least one polymer layer.
[0418] In some embodiments, the support lacks any contours (e.g., wells, protrusions, and the like) arranged in a pre-determined pattern where the contours have features that are sites for attachment of the template molecules. In some embodiments, the support lacks interstitial regions arranged in a pre-determined pattern where the interstitial regions are sites designed to have no attached template molecules.
[0419] In some embodiments, in the methods for sequencing of step (a), the support lacks partitions and / or barriers that would create separate regions of the support. Thus, the concatemer template molecules immobilized to the support are in fluid communication with each other in a massively parallel manner with no barriers to physically separate different batches of template molecules.
[0420] In some embodiments, the plurality of surface capture primers are located at predetermined positions on the at least one polymer layer and / or the plurality of surface capture primers are embedded within the at least one polymer layer at pre-determined locations.
[0421] In some embodiments, the support includes contours (e.g., wells, protrusions, and the like) arranged in a pre-determined pattern where the contours have features that are sites for attachment of the template molecules. In some embodiments, the support includes interstitial regions arranged in a pre-determined pattern where the interstitial regions are sites designed to have no attached template molecules.
[0422] In some embodiments, in the methods for sequencing of step (a), individual template molecules in the first sub-population further comprise a first batch barcode sequence which corresponds to the first sequence of interest, or the first batch barcode sequence corresponds to one of the first sequences of interest in the first sub-population. In someembodiments, a pre-determined first batch barcode sequence can be linked to a given sequence of interest in the first sub-population, thus the pre-determined first batch barcode sequence corresponds to a given sequence of interest in the first sub-population. In some embodiments, a pre-determined first batch barcode sequence can be linked to different sequences of interest in a first sub-population.
[0423] In some embodiments, individual template molecules in the second subpopulation further comprise a second batch barcode sequence which corresponds to the second sequence of interest, or the second batch barcode sequence corresponds to one of the second sequences of interest in the second sub-population. In some embodiments, a predetermined second batch barcode sequence can be linked to a given sequence of interest in the second sub-population, thus the pre-determined second batch barcode sequence corresponds to a given sequence of interest in the second sub-population. In some embodiments, a pre-determined second batch barcode sequence can be linked to different sequences of interest in a second sub-population.
[0424] In some embodiments, in the methods for sequencing of step (a), individual template molecules in the first sub-population further comprises at least one sample index sequence that can be used in a multiplex assay to distinguish the first sequences of interest obtained from different sample sources. In some embodiments, individual template molecules in the second sub-population further comprises at least one sample index sequence that can be used in a multiplex assay to distinguish the second sequences of interest obtained from different sample sources.
[0425] In some embodiments, the first batch barcode and / or the first batch sample index can include a short random sequence (e.g., NNN) that is 3-20 in length. In some embodiments, the first batch sample index sequence can include a short random sequence (e.g., NNN) that is 3-20 in length. In some embodiments, both the first batch barcode sequence and the first batch sample index sequence both include a short random sequence (e.g., NNN) that is 3-20 in length. In some embodiments, sequencing the short random sequence can provide nucleotide diversity and color balance. In some embodiments, sequencing and imaging the short random sequence can be used for polony mapping, location, and template registration because the short random sequence provides sufficient nucleotide diversity and color balance.
[0426] In some embodiments, in the first sub-population of library molecules the short random sequence (e.g., NNN) has an overall base composition of about 25% or about 20-30% of all four nucleotide bases (e.g., A, G, C and T / U) to provide nucleotide diversity at each sequencing cycle during sequencing the short random sequence (e.g., NNN).
[0427] In some embodiments, in the first sub-population of library molecules the proportion of adenine (A) at any given position in the short random sequence is about 20- 30%, about 15-35%, or about 10-40%. In some embodiments, in the first sub-population of library molecules the proportion of guanine (G) at any given position in the short random sequence is about 20-30%, about 15-35%, or about 10-40%. In some embodiments, in the first sub-population of library molecules the proportion of cytosine (C) at any given position in the short random sequence is about 20-30%, about 15-35%, or about 10-40%. In some embodiments, in the first sub-population of library molecules the proportion of thymine (T) or uracil (U) at any given position in the short random sequence is about 20-30%, about 15- 35%, or about 10-40%.
[0428] In some embodiments, in the first sub-population of library molecules the proportion of adenine (A) and thymine (T), or the proportion of adenine (A) and uracil (U), at any given position in the short random sequence is about 10-65%. In some embodiments, in the first sub-population of library molecules the proportion of guanine (G) and cytosine (C) at any given position in the short random sequence is about 10-65%.
[0429] In some embodiments, the second batch barcode and / or the second batch sample index can include a short random sequence (e.g., NNN) that is 3-20 in length. In some embodiments, the second batch sample index can include a short random sequence (e.g., NNN) that is 3-20 in length. In some embodiments, both the second batch barcode sequence and the second batch sample index sequence both include a short random sequence (e.g., NNN) that is 3-20 in length. In some embodiments, sequencing the short random sequence can provide nucleotide diversity and color balance. In some embodiments, sequencing and imaging the short random sequence can be used for polony mapping and location and template registration because the short random sequence provides sufficient nucleotide diversity and color balance.
[0430] In some embodiments, in the second sub-population of library molecules the short random sequence (e.g., NNN) has an overall base composition of about 25% or about 20- 30% of all four nucleotide bases (e.g., A, G, C and T / U) to provide nucleotide diversity at each sequencing cycle during sequencing the short random sequence (e.g., NNN).
[0431] In some embodiments, in the second sub-population of library molecules the proportion of adenine (A) at any given position in the short random sequence is about 20- 30%, about 15-35%, or about 10-40%. In some embodiments, in the second sub-populationof library molecules the proportion of guanine (G) at any given position in the short random sequence is about 20-30%, about 15-35%, or about 10-40%. In some embodiments, in the second sub-population of library molecules the proportion of cytosine (C) at any given position in the short random sequence is about 20-30%, about 15-35%, or about 10-40%. In some embodiments, in the second sub-population of library molecules the proportion of thymine (T) or uracil (U) at any given position in the short random sequence is about 20- 30%, about 15-35%, or about 10-40%.
[0432] In some embodiments, in the second sub-population of library molecules the proportion of adenine (A) and thymine (T), or the proportion of adenine (A) and uracil (U), at any given position in the short random sequence is about 10-65%. In some embodiments, in the second sub-population of library molecules the proportion of guanine (G) and cytosine (C) at any given position in the short random sequence is about 10-65%.
[0433] In some embodiments, in the methods for sequencing of step (a), the plurality of template molecules comprises concatemer template molecules. In some embodiments, the concatemer template molecules comprise at least first and second sub-populations of concatemer template molecules. In some embodiments, the concatemer template molecules can be generated by conducting rolling circle amplification (RCA) using circularized library molecules and amplification primers. In some embodiments, a concatemer template molecule comprises numerous tandem copies of a polynucleotide unit, where each polynucleotide unit comprises a sequence of interest and at least one sequencing primer binding site. In some embodiments, concatemer template molecules immobilized to a support can be generated using circularized library molecules and conducting rolling circle amplification. In some embodiments, the circularized library molecules can be generated using padlock probes, single-stranded splint strands, or double-stranded adaptors. In some embodiments, the circularized library molecules comprise a mixture of any combination of circularized padlock probes, linear library molecules circularized using single-stranded splint strands, and / or linear library molecules circularized using double-stranded adaptors. Methods for generating circularized library molecules are described herein. Methods for generating circularized library molecules are described in WO2023168444, WO2023168443, W02024011145, W02024059550, WO2025024465, the contents of each of which are incorporated by reference in their entirety herein.
[0434] In some embodiments, individual concatemers in the first sub-population comprise a plurality of tandem polynucleotide units. In some embodiments, individual polynucleotide units comprise a first sequence of interest and a first batch sequencing primerbinding site sequence which corresponds to the first sequence of interest. In some embodiments, individual polynucleotide units further comprise a first batch barcode sequence which corresponds to the first sequence of interest. In some embodiments, individual polynucleotide units further comprise at least one sample index sequence that can be used in a multiplex assay to distinguish sequences of interest obtained from different sample sources. In some embodiments, concatemer template molecules in the first sub-population have the same first batch sequencing primer binding site, and have the same sequence of interest or different sequences of interest.
[0435] In some embodiments, individual concatemers in the second sub-population comprise a plurality of tandem polynucleotide units. In some embodiments, individual polynucleotide units comprise a second sequence of interest and a second batch sequencing primer binding site sequence which corresponds to the second sequence of interest. In some embodiments, individual polynucleotide units further comprise a second batch barcode sequence which corresponds to the second sequence of interest. In some embodiments, individual polynucleotide units further comprise at least one sample index sequence that can be used in a multiplex assay to distinguish sequences of interest obtained from different sample sources. In some embodiments, concatemer template molecules in the second subpopulation have the same second batch sequencing primer binding site, and have the same sequence of interest or different sequences of interest.
[0436] In some embodiments, in the methods for sequencing of step (a), the plurality of concatemer template molecules can be generated by conducting a rolling circle amplification reaction in the presence of a plurality of compaction oligonucleotides. Exemplary compaction oligonucleotides are described in W02024040058, the contents of which are incorporated by reference herein in their entirety. In some embodiments, individual compaction oligonucleotides can hybridize to two different locations on the same concatemer template molecule to pull together distal portions of the template molecule, thereby causing compaction of the concatemer template molecule to form a compact DNA nanoball. In some embodiments, individual immobilized concatemer template molecules collapse into a compact polony or nucleic acid (e.g., DNA) nanoball having a compact size and shape compared to a non-collapsed concatemer template molecule.
[0437] In some embodiments, the methods for sequencing further comprise step (b): sequencing the first sub-population of template molecules using a plurality of first batch sequencing primers, thereby generating a plurality of first batch sequencing read products. Insome embodiments, the sequencing of step (b) comprises imaging a region of the support to detect the sequencing reactions of the first sub-population of template molecules.
[0438] In some embodiments, the sequencing of step (b) comprises conducting any massively parallel nucleic acid sequencing method that employs a plurality of sequencing polymerases and a plurality of nucleotide reagents. In some embodiments, the plurality of nucleotide reagents comprises nucleotides, nucleotide analogs and / or multivalent molecules. Exemplary methods are described in WO2022266470, US20240191278A1 and WO2024159166, the contents of which are incorporated by reference in their entirety herein.
[0439] In some embodiments, the sequencing of step (b) comprises conducting a two- stage sequencing method. In some embodiments, the first stage comprises contacting the first sub-population of template molecules with a plurality of first batch sequencing primers, a first plurality of sequencing polymerase and a plurality of detectably labeled multivalent molecules. In some embodiments, the first stage comprises binding detectably labeled multivalent molecules to polymerase complexes to form multivalent-polymerase complexes, and detecting the multivalent-polymerase complexes. In some embodiments, individual multivalent molecules comprise a core attached to multiple nucleotide arms and each nucleotide arm is attached to a nucleotide (e.g., a nucleotide moiety) (e.g., FIGS. 1-5). In some embodiments, the multivalent molecules can be labeled with at least one detectable moiety that emits a signal. In some embodiments, the multivalent molecules can be labeled with at least one fluor ophore.
[0440] In some embodiments, individual polymerase complexes comprise a first sequencing polymerase bound to a nucleic acid duplex where the nucleic acid duplex comprises a template molecule hybridized to a sequencing primer. In some embodiments, the detectably labeled multivalent molecules bind to the polymerase complexes to form a plurality of multivalent-polymerase complexes. In some embodiments, the detectably labeled multivalent molecules are bound to the polymerase complexes in the presence of a trapping reagent. In some embodiments, the trapping reagent can be formulated to promote binding of the detectably labeled multivalent molecules to the polymerase complexes. In some embodiments, the trapping reagent can be formulated to inhibit incorporation of the nucleotide moiety of the multivalent molecules. In some embodiments, the trapping reagent comprises a plurality of multivalent molecules. In some embodiments, the trapping reagent comprises a first plurality of sequencing polymerases. In some embodiments, the at least one non-catalytic cation inhibits polymerase-catalyzed nucleotide incorporation.
[0441] In some embodiments, the multivalent-polymerase complexes can be exposed to excitation illumination to induce fluorescent signals from the multivalent-polymerase complexes. In some embodiments, prior to conducting the second sequencing stage, the detectably labeled multivalent molecules can be dissociated from the polymerase complexes and removed (e.g., washing). In some embodiments, prior to conducting the sequencing second stage, the first plurality of sequencing polymerases can be dissociated from the first sub-population of template molecules wherein the first sub-population of template molecules can remain immobilized to the support and the first batch sequencing primers can be retained and can remain hybridized to the first sub-population of template molecules.
[0442] In some embodiments, the second stage of the two-stage sequencing method comprises contacting the first sub-population of template molecules and the retained first batch sequencing primers with a second plurality of sequencing polymerases and a plurality of nucleotides (e.g., non-conjugated free nucleotides). In some embodiments, the second stage comprises binding the plurality of nucleotides to the polymerase complexes to form nucleotide-polymerase complexes, and promoting nucleotide incorporation. In some embodiments, the second stage of the two-stage sequencing method comprises nucleotide incorporation and extension of the first batch sequencing primer.
[0443] In some embodiments, the plurality of nucleotides comprises fluorophore-labeled nucleotides, or the nucleotides are non-labeled. In some embodiments, when the nucleotides are fluorophore-labeled, then detecting and imaging of the incorporated nucleotides can be performed. In some embodiments, when the nucleotides are non-labeled, detecting and imaging of the incorporated nucleotides can be omitted.
[0444] In some embodiments, the nucleotides comprises chain terminating nucleotides where individual nucleotides comprise a chain terminating moiety attached to the 3’ sugar position. In some embodiments, the nucleotides are not chain terminating nucleotides. In some embodiments, when the nucleotides comprise chain terminating nucleotides, then the chain terminating moieties can be cleaved from the incorporated chain terminating nucleotides to generate an extendible 3 ’OH group.
[0445] In some embodiments, nucleotide incorporation can be conducted in the presence of a stepping reagent. In some embodiments, the stepping reagent comprises a plurality of nucleotides (e.g., non-conjugated free nucleotides), a second plurality of sequencing polymerases and at least one catalytic cation promotes polymerase-catalyzed nucleotide incorporation. In some embodiments, in the stepping reagent, the plurality of nucleotides comprises chain terminating nucleotides where individual nucleotides comprise a chainterminating moiety attached to the 3’ sugar position. In some embodiments, in the stepping reagent, the plurality of nucleotides are not chain terminating nucleotides.
[0446] In some embodiments, the sequencing of step (b) comprises conducting a two- stage sequencing method including repeating the first stage and second stage at least once thereby generating a plurality of first batch sequencing read products. In some embodiments, when conducting a two-stage sequencing method, one sequencing cycle comprises completion of a first and a second stage. In some embodiments, the sequencing of step (b) comprises conducting 4-25 sequencing cycles, or 25-50 sequencing cycles, or 50-75 sequencing cycles, or 75-100 sequencing cycles, or 100-200 sequencing cycles, or 200-500 sequencing cycles, or 500-750 sequencing cycles, or 750-1000 sequencing cycles, or any range therebetween. In some embodiments, the sequencing of step (b) comprises sequencing at least a portion of the first batch barcode and / or sequencing at least a portion of the first sample index. In some embodiments, the sequencing of step (b) comprises sequencing at least a portion of the first sequence of interest.
[0447] In some embodiments, prior to sequencing the second sub-population of template molecules, the plurality of first batch sequencing read products can be removed from the first sub-population of template molecules and the first sub-population of template molecules can be retained on the support using a de-hybridization reagent. In some embodiments, the dehybridization reagent comprises an SSC buffer (e.g., saline-sodium citrate) buffer, with or without formamide.
[0448] In some embodiments, the de-hybridization step can be conducted at a temperature that promotes nucleic acid denaturation such as for example 50 - 90 °C. In some embodiments, the first batch sequencing read products are not removed from the first subpopulation of template molecules.
[0449] In some embodiments, the sequencing reactions of the first sub-population of template molecules is stopped before initiating the sequencing reactions of the second subpopulation of template molecules.
[0450] In some embodiments, the method for sequencing further comprises step (bl): conducting short read sequencing by performing up to 1000 sequencing cycles of the first sub-population of template molecules to generate a plurality of first batch sequencing read products that comprise up to 1000 bases in length. In some embodiments, step (bl) comprises conducting 5-25 sequencing cycles, or 25-50 sequencing cycles, or 50-75 sequencing cycles, or 75-100 sequencing cycles, or 100-200 sequencing cycles, or 200-500 sequencing cycles, or 500-750 sequencing cycles, or 750-1000 sequencing cycles, or any range therebetween. Insome embodiments, the first batch sequencing read products comprise a first batch barcode sequence. In some embodiments, the first batch sequencing read products comprise a first batch barcode sequence and a sample index sequence. In some embodiments, the first batch sequencing read products comprise a first batch barcode sequence and at least a portion of a first sequence of interest. In some embodiments, the first batch sequencing read products comprise a first batch barcode sequence, a sample index sequence, and at least a portion of a first sequence of interest. In some embodiments, the short read sequencing comprises hybridizing sequencing primers to sequencing primer binding sites on concatemer template molecules and conducting up to 1000 cycles of polymerase-catalyzed sequencing reactions using nucleotide reagents. In some embodiments, 500 million - 1 billion copies of the first sub-population of concatemer template molecules can be sequenced. In some embodiments, up to 1 billion, or up to 2 billion, or up to 3 billion, or up to 4 billion, or up to 5 billion copies of the first sub-population of concatemer template molecules can be sequenced. In some embodiments, up to 6 billion, or up to 7 billion, or up to 8 billion, or up to 9 billion, or up to 10 billion of the first sub-population of concatemer template molecules can be sequenced. In some embodiments, between about 500 million and about 10 billion, between about 1 billion and about 9 billion, between about 2 billion and about 8 billion, between about 3 billion and about 7 billion, between about 4 billion and about 6 billion, or any range therebetween of the first sub-population of concatemer template molecules can be sequenced.
[0451] In some embodiments, the sequencing of step (bl) comprises conducting any massively parallel nucleic acid sequencing method that employs a plurality of sequencing polymerases and a plurality of nucleotide reagents. In some embodiments, the plurality of nucleotide reagents comprise nucleotides, nucleotide analogs and / or multivalent molecules. In some embodiments, the reiterative sequencing of step (bl) comprises conducting a two- stage sequencing method described herein.
[0452] In some embodiments, the methods for sequencing further comprises step (b2): stopping / blocking the short read sequencing of step (bl). In some embodiments, the stopping / blocking comprises incorporating a chain terminating nucleotide to the 3’ terminal end of the first batch sequencing read products to inhibit further sequencing reactions. Exemplary chain terminating nucleotides include dideoxynucleotide or a nucleotide having a 2’ or 3’ chain terminating moiety.
[0453] In some embodiments, the methods for sequencing further comprise step (b3): removing the plurality of first batch sequencing read products from the template molecules of the first sub-population, and retaining the template molecules of the first sub-population. Insome embodiments, the first batch sequencing read products can be removed from the template molecules by denaturation using heat and / or a de-hybridization reagent.
[0454] In some embodiments, the methods for sequencing further comprise step (b4): reiteratively sequencing the template molecules of the first sub-population by repeating steps (bl) - (b3) at least once. In some embodimen...
Claims
CLAIMSWhat is claimed:
1. A method for generating and sequencing a plurality of compact DNA nanoballs immobilized to a support, comprising: a) providing a support comprising:(i) a plurality of capture primers immobilized to the support, wherein individual capture primers comprise a 3’ extendible end;(ii) a plurality of pinning primers immobilized to the support, wherein individual pinning primers comprise a 3’ non-extendible end; and(iii) a plurality of covalently closed circular polynucleotide molecules, wherein individual covalently closed circular polynucleotide molecules are hybridized to individual capture primers, thereby forming a plurality of immobilized circular molecule-capture primer duplexes; b) contacting the plurality of immobilized circular molecule-capture primer duplexes with a plurality of soluble amplification primers under a condition suitable for hybridizing at least one soluble amplification primer to an individual immobilized circular molecule-capture primer duplex thereby forming a plurality of immobilized circular molecule-capture primer duplexes; c) conducting a rolling circle amplification (RCA) reaction on the plurality of immobilized circular molecule-capture primer duplexes of step (b) in the presence of a plurality of compaction oligonucleotides, thereby generating a plurality of compact DNA nanoballs immobilized to the support,• wherein individual compact DNA nanoballs comprise (i) a concatemer template molecule generated by RCA-extension of an immobilized capture primer and (ii) at least one concatemer template molecule generated by RCA-extension of a soluble amplification primer,• wherein at least a portion of individual compact DNA nanoballs is hybridized to a pinning primer, thereby generating a plurality of compact DNA nanoballs immobilized to the support;d) removing the plurality of covalently closed circular polynucleotide molecules and retaining the plurality of compact DNA nanoballs; and e) sequencing the plurality of the compact DNA nanoballs of step (d).
2. The method of claim 1, wherein the support comprises glass, plastic and / or a polymer material.
3. The method of claim 1 or 2, wherein the support is passivated with at least one hydrophilic polymer coating.
4. The method of claim 3, wherein the plurality of capture primers and the plurality of pinning primers are covalently joined to the at least one hydrophilic polymer coating.
5. The method of claim 3, wherein the at least one hydrophilic polymer coating has a water contact angle of no more than 45 degrees.
6. The method of any one of claims 1-5, wherein the plurality of capture primers is immobilized to the support at random locations or immobilized to the support at predetermined locations.
7. The method of any one of claims 1-6, wherein the plurality of pinning primers is immobilized to the support at random locations or immobilized to the support at predetermined locations.
8. The method of any one of claims 1-7, wherein the plurality of capture primers is immobilized to the support at a density of about 102- 1015capture primers per mm2.
9. The method of any one of claims 1-8, wherein the plurality of pinning primers is immobilized to the at a density of about 102- 1015pinning primers per mm2.
10. The method of any one of claims 1-9, wherein the support lacks partitions or barriers that separate regions of the support.
11. The method of any one of claims 1-10, wherein the plurality of covalently closed circular polynucleotide molecules comprises RNA or DNA, optionally wherein the DNA comprises complementary DNA (cDNA).
12. The method of any one of claims 1-11, wherein individual covalently closed circular polynucleotide molecules comprise a sequence of interest that is 200 - 2000 nucleotides in length.
13. The method of any one of claims 1-11, wherein individual covalently closed circular polynucleotide molecules comprise a sequence of interest and lack a universal adaptor sequence.
14. The method of any one of claims 1-13, wherein individual covalently closed circular polynucleotide molecules comprise a sequence of interest and any one or any combination of two or more of:(i) a universal sequence for binding a pinning primer or a complementary sequence thereof,(ii) a universal sequence for binding a capture primer or a complementary sequence thereof,(iii) at least one universal sequence for binding a first sequencing primer or a complementary sequence thereof,(iv) at least one universal sequence for binding a second sequencing primer or a complementary sequence thereof,(v) at least one universal sequence for binding a soluble amplification primer or a complementary sequence thereof and / or(vi) a universal sequence for binding a compaction oligonucleotide or a complementary sequence thereof.
15. The method of claim 14, wherein individual soluble amplification primers provided on step (b) bind to any one or more of:(i) the sequence of interest,(ii) the universal sequence for binding a pinning primer or a complementary sequence thereof,(iii) the universal sequence for binding a capture primer or a complementary sequence thereof,(iv) the universal sequence for binding a first sequencing primer or a complementary sequence thereof,(v) the universal sequence for binding a second sequencing primer or a complementary sequence thereof,(vi) the universal sequence for binding a compaction oligonucleotide or a complementary sequence thereof; or(vii) a combination thereof.
16. The method of any one of claims 1-15, wherein individual covalently closed circular polynucleotide molecules are further hybridized to 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 soluble amplification primers.
17. The method of any one of claims 14-16, wherein the at least one soluble amplification primer of step (b) is hybridized to any one or more of:(i) the sequence of interest,(ii) the universal sequence for binding a capture primer or a complementary sequence thereof,(iii) the universal sequence for binding a pinning primer or a complementary sequence thereof,(iv) the universal sequence for binding a first sequencing primer,(v) the universal sequence for binding a second sequencing primer, and / or(vi) the universal sequence for binding a compaction oligonucleotide or a complementary sequence thereof; or(vii) a combination thereof.
18. The method of any one of claims 1-17, wherein the RCA reaction comprises contacting the plurality of the immobilized circular molecule-capture primer duplexes with a plurality of strand displacing polymerases, and a plurality of nucleotides.
19. The method of claim 18, wherein the plurality of nucleotides comprises at least one nucleotide having a scissile moiety that can be cleaved to generate an abasic site in the immobilized compact DNA nanoball.
20. The method of claim 19, wherein the at least one nucleotide having a scissile moiety comprises uridine, 8-oxo-7,8-dihydrogunine or deoxyinosine.
21. The method of any one of claims 1-20, wherein the plurality of compaction oligonucleotides comprises at least a first and a second compaction oligonucleotide, wherein(i) the first compaction oligonucleotide comprises a first binding region that hybridizes to a first portion of the concatemer template molecule generated in step (c), and a second binding region that hybridizes to a second portion of the same concatemer template molecule thereby pulling together distal portions of the concatemer molecule causing compaction of the concatemer template molecule, and(ii) the second compaction oligonucleotide comprises a first binding region that hybridizes to a first portion of the concatemer template molecule generated in step (c), and a second binding that hybridizes to a second portion of the same concatemer template molecule thereby pulling together distal portions of the concatemer molecule causing compaction of the concatemer template molecule.
22. The method of claim 21, wherein the first and the second compaction oligonucleotides comprise the same sequence or different sequences.
23. The method of any one of claims 1-22, wherein the plurality of compact DNA nanoballs is immobilized to the support at a high density, wherein at least some of the immobilized compact DNA nanoballs comprise nearest neighbor compact DNA nanoballs that touch each other and / or overlap each other when viewed from any angle of the support including above, below or side views of the support.
24. The method of any one of claims 1-23, wherein the sequencing comprises contacting individual compact DNA nanoballs with a plurality of sequencing primers, a plurality of sequencing polymerases and a plurality of detectably labeled multivalent molecules, individual detectably labeled multivalent molecules comprising (a) a core and (b) a plurality of nucleotide arms andwherein individual polymer arms comprise at least one nucleotide moiety.
25. The method of any one of claims 1-24, wherein the sequencing comprises:(i) binding the concatemer template molecules of step (c) with a plurality of sequencing primers, a plurality of sequencing polymerases, and a plurality of detectably labeled multivalent molecules, and / or(ii) binding the concatemer template molecules of step (c) with a plurality of sequencing primers, a plurality of sequencing polymerases, and a plurality of detectably labeled multivalent molecules, thereby generating a compact DNA nanoball immobilized to the support that emits a detectable signal.
26. The method of claim 25, wherein individual detectably labeled multivalent molecules comprise (a) a core; and (b) a plurality of nucleotide arms comprising (i) a core attachment moiety, (ii) a spacer, (iii) a linker, and (iv) a nucleotide moiety, wherein the core is attached to the plurality of nucleotide arms via their core attachment moiety, wherein the core attachment moiety is attached to the spacer, wherein the spacer is attached to the linker, and wherein the linker is attached to the nucleotide moiety.
27. The method of claim 24, wherein individual nucleotide arms comprise (i) a core attachment moiety, (ii) a spacer and (iii) a nucleotide moiety, wherein the core is attached to the plurality of nucleotide arms via their core attachment moiety, wherein the core attachment moiety is attached to the spacer, wherein the spacer is attached to the nucleotide moiety.
28. The method of claim 27, wherein the linker comprises an aliphatic chain having 2-6 subunits or an oligo ethylene glycol chain having 2-6 subunits.
29. The method of claim 26 or 27, wherein the plurality of nucleotide arms attached to an individual core has the same type of nucleotide moiety selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.
30. The method of claim 26 or 27, wherein individual detectably labeled multivalent molecules have the same type of nucleotide moiety selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.
31. The method of any one of claims 24-30, wherein the plurality of detectably labeled multivalent molecules comprises a mixture of two or more types of detectably labeled multivalent molecules, individual types of detectably labeled multivalent molecules having nucleotide moieties selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP32. The method of claim 24, wherein individual detectably labeled multivalent molecules in the plurality comprise• a core attached to a fluorophore,• a nucleotide arm attached to a fluorophore, and / or• a nucleotide moiety attached to a fluorophore.
33. The method of any one of claims 1-32, wherein the sequencing further comprises contacting individual compact DNA nanoballs with a plurality of non-catalytic divalent cations that inhibit polymerase-catalyzed nucleotide incorporation, wherein the non- catalytic divalent cations comprise strontium, calcium or barium.
34. The method of any one of claims 1-24, wherein the sequencing comprises: a) binding a first sequencing primer, a first sequencing polymerase, and a first multivalent molecule to a first portion of the concatemer template molecule of step (c) thereby forming a first binding complex, wherein a first nucleotide moiety of the first multivalent molecule binds to the first sequencing polymerase; and b) binding a second sequencing primer, a second sequencing polymerase, and the first multivalent molecule to a second portion of the same concatemer template molecule thereby forming a second binding complex, wherein a second nucleotide moiety of the first multivalent molecule binds to the second sequencing polymerase, and wherein the first and second binding complexes which include the same multivalent molecule form an avidity complex.
35. The method of any one of claims 1-24, wherein the sequencing comprises: a) contacting different portions of the concatemer template molecule of step (c) with a first plurality of sequencing polymerases and a first plurality ofsequencing primers to form at least a first and a second polymerase complex on the same concatemer template molecule; b) contacting a plurality of detectably labeled multivalent molecules with the at least first and second polymerase complexes on the same concatemer template molecule to bind a single multivalent molecule to the first and the second polymerase complexes, wherein at least a first nucleotide moiety of the single multivalent molecule is bound to the first polymerase complex thereby forming a first binding complex, and wherein at least a second nucleotide moiety of the single multivalent molecule is bound to the second polymerase complex thereby forming a second binding complex,• wherein the contacting is conducted under a condition suitable to inhibit polymerase-catalyzed incorporation of the bound first and second nucleotide moieties in the first and second binding complexes, and• wherein the first and second binding complexes which are bound to the same multivalent molecule form an avidity complex; c) detecting the first and the second binding complexes on the same concatemer template molecule; and d) identifying the first nucleotide moiety in the first binding complex thereby determining the sequence of the first portion of the concatemer template molecule, and identifying the second nucleotide moiety in the second binding complex thereby determining the sequence of the second portion of the concatemer template molecule.
36. The method of any one of claims 24-35, wherein contacting individual compact DNA nanoballs with a plurality of labeled nucleotides comprises:(i) binding the concatemer template molecule of step (c) with a plurality of sequencing primers, a plurality of sequencing polymerases, and a plurality of detectably labeled nucleotides, and(ii) binding the concatemer template molecule of step (c) with a plurality of sequencing primers, a plurality of sequencing polymerases, and a plurality of detectably labeled nucleotides, thereby generating a compact DNA nanoball immobilized to the support that emits a detectable signal.
37. The method of claim 36, wherein individual detectably labeled nucleotides in the plurality comprise an aromatic base, a five-carbon sugar, and 1-10 phosphate groups.
38. The method of claim 36 or 37, wherein the plurality of detectably labeled nucleotides comprises one type of nucleotide selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.
39. The method of claim 36, wherein the plurality of detectably labeled nucleotides comprises two or more types of nucleotides selected from the group consisting of dATP, dGTP, dCTP, dTTP and dUTP.
40. The method of any one of claims 36-39, wherein at least one detectably labeled nucleotide in the plurality is labeled with a fluorophore.
41. The method of any one of claims 36-40, wherein at least one nucleotide in the plurality lacks a fluorophore label.
42. The method of claim 36, wherein at least one of the detectably labeled nucleotides comprises a removable chain terminating moiety attached to the 3’ carbon position of the sugar group, wherein the removable chain terminating moiety comprises an alkyl group, an alkenyl group, an alkynyl group, an allyl group, an aryl group, a benzyl group, an azide group, an azido group, an O-azidomethyl group, an amine group, an amide group, a keto group, an isocyanate group, a phosphate group, a thio group, a disulfide group, a carbonate group, a urea group, an acetal group or a silyl group, and wherein the removable chain terminating moiety is cleavable with a chemical compound to generate an extendible 3 ’OH moiety on the sugar group.
43. The method of any one of claims 34-42, wherein the sequencing further comprises contacting individual compact DNA nanoballs with a plurality of catalytic divalent cations that promote polymerase-catalyzed nucleotide incorporation, wherein the catalytic divalent cations comprise magnesium or manganese.
44. A method for generating a plurality of compact DNA nanoballs, comprising: a) providing a support comprising:(i) a plurality of capture primers immobilized to the support, wherein individual capture primers comprise a 3’ extendible end;(ii) a plurality of pinning primers immobilized to the support, wherein individual pinning primers comprise a 3’ non-extendible end; and(iii) a plurality of covalently closed circular polynucleotide molecules, wherein individual covalently closed circular polynucleotide molecules are hybridized to individual capture primers, thereby forming a plurality of immobilized circular molecule-capture primer duplexes; b) contacting the plurality of immobilized circular molecule-capture primer duplexes with a plurality of soluble amplification primers under a condition suitable for hybridizing at least one soluble amplification primer to individual immobilized circular molecule-capture primer duplexes; c) conducting a rolling circle amplification (RCA) reaction on the plurality of immobilized circular molecule-capture primer duplexes of step (b) in the presence of a plurality of compaction oligonucleotides, thereby generating a plurality of compact DNA nanoballs immobilized to the support,• wherein individual compact DNA nanoballs comprise (i) a concatemer template molecule generated by RCA-extension of an immobilized capture primer and (ii) at least one concatemer template molecule generated by RCA-extension of a soluble amplification primer,• wherein at least a portion of individual compact DNA nanoballs is hybridized to an immobilized pinning primer; d) removing the plurality of covalently closed circular polynucleotide molecules and retaining the plurality of compact DNA nanoballs immobilized to the support.
45. The method of claim 44, further comprising sequencing the plurality of immobilized compact DNA nanoballs.
Citation Information
Patent Citations
Method and system for sequencing nucleic acids
US10246744B2
Engineered polymerases for improved sequencing
US10731141B2
Compositions and methods for pairwise sequencing
US11859241B2
Compositions and methods for pairwise sequencing
US20240191278A1
Cyanine derivatives and related uses
US20240240249A1
Cited By
PCR-free library preparation using double-stranded splint adaptors and methods of use
US12606819B2
Streamlined nucleic acid library preparation and sequencing workflows
WO2026096494A1
Direct in-sample sequencing
WO2026178234A1