Use of doxorubicin-tetrahedral framework nucleic acid in preparing drug for reducing electric conduction recurrence after radio frequency catheter ablation

Abstract

Disclosed in the present invention is use of a doxorubicin-tetrahedral framework nucleic acid in preparing a drug for reducing electric conduction recurrence after radio frequency catheter ablation. The doxorubicin-tetrahedral framework nucleic acid is prepared from doxorubicin and a tetrahedral framework nucleic acid, and the molar ratio of the doxorubicin to the tetrahedral framework nucleic acid is (80-120):1. The doxorubicin-tetrahedral framework nucleic acid provided by the present invention enables targeted accumulation in an ablation site area after radio frequency catheter ablation, and can successfully induce the death of cells in the area, thereby effectively avoiding electric conduction recurrence caused by cell survival at an ablation site.

Description

Use of doxorubicin-tetrahedral framework nucleic acid in preparation of a drug for reducing electrical conduction recurrence after radiofrequency ablation TECHNICAL FIELD

[0001] The present application relates to the technical field of medicine, in particular to use of doxorubicin-tetrahedral framework nucleic acid in preparation of a drug for reducing electrical conduction recurrence after radiofrequency ablation. BACKGROUND

[0002] Atrial fibrillation (AF) is one of the most common arrhythmia diseases, with high incidence, which is extremely easy to cause serious consequences such as stroke and lower limb arterial embolism, resulting in extremely high disability rate and mortality, and seriously affecting the quality of life of patients.

[0003] Radiofrequency catheter ablation (RFCA) is currently a first-line treatment for atrial fibrillation, and its treatment mechanism mainly uses radiofrequency current to touch and kill cells in heart tissue that cause arrhythmia, thereby preventing the transmission of abnormal electrical signals and restoring normal heart rhythm.

[0004] The point where the radiofrequency current touches the heart is called an ablation point. In atrial fibrillation radiofrequency ablation, there are hundreds of ablation points, and any incomplete ablation (i.e., the cells at the ablation point are not completely killed, and there are still surviving cells at the ablation point) can lead to electrical conduction recurrence, thereby leading to recurrence of atrial fibrillation. Studies have shown that the early electrical conduction recurrence rate of atrial fibrillation patients after the first ablation is 30% to 40%, and the long-term electrical conduction recurrence rate is even as high as 70%. Even if the antiarrhythmic drugs are used after the operation, the long-term electrical conduction recurrence rate after the operation cannot be significantly reduced. For patients with atrial fibrillation recurrence, the clinical often adopts the way of secondary ablation, however, repeated ablation significantly increases the risk of pulmonary vein stenosis, cardiac tamponade and death of patients. SUMMARY

[0005] The purpose of the present application is to solve the technical problem of high electrical conduction recurrence rate of patients after radiofrequency ablation.

[0006] In order to achieve the above purpose, the present application provides use of doxorubicin-tetrahedral framework nucleic acid in preparation of a drug for reducing electrical conduction recurrence after radiofrequency ablation, wherein the doxorubicin-tetrahedral framework nucleic acid is made of doxorubicin and tetrahedral framework nucleic acid, and the molar ratio of doxorubicin to tetrahedral framework nucleic acid is (80-120): 1.

[0007] Optionally, the molar ratio of doxorubicin to tetrahedral framework nucleic acid is 100: 1.

[0008] Optionally, the tetrahedral framework nucleic acid is made of 8 DNA single strands, which are complementary to each other in pairs; the sequences of the 8 DNA single strands are shown in SEQ ID NO. 1-8.

[0009] Optionally, the drug is used after radiofrequency ablation, and is an injection preparation.

[0010] The application also provides a preparation method of the doxorubicin-tetrahedral framework nucleic acid, which comprises the following steps:

[0011] Step S1, preparing a tetrahedral framework nucleic acid:

[0012] The 8 DNA single strands complementary to each other in pairs are added into a buffer solution, and maintained at 85-105℃ for 5-15 min, and then maintained at 2-8℃ for 10-30 min, to obtain the tetrahedral framework nucleic acid;

[0013] Step S2, preparing a doxorubicin-tetrahedral framework nucleic acid:

[0014] The doxorubicin is taken, and the doxorubicin and the tetrahedral framework nucleic acid are mixed and incubated together to obtain the doxorubicin-tetrahedral framework nucleic acid.

[0015] Optionally, in step S1, the concentrations of the 8 DNA single strands in the buffer solution are the same.

[0016] Optionally, in step S1, the final concentration of the 8 DNA single strands is 80-120 μM.

[0017] Optionally, in step S1, after the 8 DNA single strands are added into the buffer solution, they are maintained at 95℃ for 10 min, and then maintained at 4℃ for 20 min, to obtain the tetrahedral framework nucleic acid.

[0018] Optionally, in step S1, the buffer solution is a TM buffer solution.

[0019] Compared with the prior art, the application has the following beneficial effects:

[0020] The application firstly proposes that doxorubicin (Dox) is compounded with a tetrahedral framework nucleic acid (TDF) to prepare a doxorubicin-tetrahedral framework nucleic acid (TDF-Dox), which has the following advantages:

[0021] (1) The TDF-Dox provided by the application can effectively induce the death of cells in the ablation point region after radiofrequency ablation, thereby avoiding the recurrence of electrical conduction caused by the survival of cells in the ablation point:

[0022] The TDF-Dox provided by the application has the functions of drug carrier and drug targeted delivery. The TDF carries the Dox and targets, enriches and delivers the Dox to the ablation point area of the heart. Since the Dox has a certain cytotoxicity, it can induce the death of cells in the ablation point area, thereby effectively avoiding the electrical conduction recurrence caused by the survival of cells at the ablation point.

[0023] (2) Compared with doxorubicin (Dox) alone, the TDF-Dox provided by the application is more easily entered into the cell interior, increases the intracellular concentration of doxorubicin, and makes it possible to induce the death of cells in the ablation point area with a low dose of TDF-Dox. BRIEF DESCRIPTION OF DRAWINGS

[0024] Fig. 1 is a detection result diagram of doxorubicin-tetrahedral framework nucleic acid according to the application; wherein:

[0025] A is a result diagram of detecting doxorubicin-tetrahedral framework nucleic acid by total internal reflection fluorescence microscopy technology;

[0026] B is a result diagram of detecting doxorubicin-tetrahedral framework nucleic acid by single molecule localization microscopy technology.

[0027] Fig. 2 is a comparison diagram of the intracellular amount of doxorubicin alone and doxorubicin-tetrahedral framework nucleic acid; wherein:

[0028] A is an in situ imaging result diagram analyzed by laser confocal microscopy imaging technology;

[0029] B is a columnar comparison diagram of the intracellular amount of doxorubicin alone and doxorubicin-tetrahedral framework nucleic acid.

[0030] Fig. 3 is a result diagram of the distribution of doxorubicin-tetrahedral framework nucleic acid in the heart after radiofrequency ablation in vivo imaging analysis. DETAILED DESCRIPTION

[0031] The technical solutions of the application will be further described below in combination with the drawings and examples.

[0032] Based on the background art, the prior art has the technical problem of high electrical conduction recurrence rate after radiofrequency ablation of patients. To solve this technical problem, the application provides a doxorubicin-tetrahedral framework nucleic acid (TDF-Dox), which can be targeted and enriched in the ablation point area of the heart after radiofrequency ablation, and can induce the death of cells in the area, effectively avoiding the problem of electrical conduction recurrence caused by the survival of cells at the ablation point.

[0033] The doxorubicin-tetrahedral framework nucleic acid provided by the application is prepared by compounding doxorubicin and tetrahedral framework nucleic acid.

[0034] Doxorubicin (Dox) is a widely used chemotherapeutic drug, which has excellent efficacy in fighting a variety of cancers and is considered as one of the most effective chemotherapy drugs approved by the US Food and Drug Administration. However, doxorubicin has certain cytotoxicity, and high-dose administration is easy to cause organ damage.

[0035] Tetrahedral framework nucleic acid (TDF) is a three-dimensional structure material based on DNA nanotechnology, which has good biocompatibility, editability and high stability, and has shown great potential and application prospect in the field of biomedicine. The complex of TDF and drug mainly reflects the application of TDF as a drug carrier. TDF can load and deliver drug molecules and release drug molecules in vivo.

[0036] The present application is prepared by compounding doxorubicin with tetrahedral framework nucleic acid to form doxorubicin-tetrahedral framework nucleic acid, and further found that the doxorubicin-tetrahedral framework nucleic acid can enrich in the ablation point area and induce cell death in the ablation point area, which can effectively avoid the occurrence of electrical conduction reconnection phenomenon induced by cell survival in the fusion point.

[0037] The following is described in conjunction with specific embodiments.

[0038] Example 1 Preparation of doxorubicin-tetrahedral framework nucleic acid

[0039] Experimental method

[0040] The preparation of doxorubicin-tetrahedral framework nucleic acid comprises the following steps:

[0041] (1) Dissolve 8 pairs of complementary paired DNA single strands in TM buffer solution (10 mM Tris-HCl, 50 mM MgCl2, pH = 8.0) in equal amounts, so that the final concentration of 8 DNA single strands is 100 μM. The sequences of 8 DNA single strands are shown in SEQ ID NO. 1-8.

[0042] SEQ ID NO. 1: CCCTGTACTGGCTAGGAATTCACGTTTTAATCTGGGCTTTGGGTTAAGAAACTCCCCG;

[0043] SEQ ID NO. 2: CGCTGGAGGCGCATCACCGTTTGCGTATGTGTTCTGTGCGGCCTGCCGTCCCGTGTGGG;

[0044] SEQ ID NO. 3: CGGTGATGCGCCTCCAGCGCGGGGAGTTTCTTAACCCTTTCCGACTTACAAGAGCCGG;

[0045] SEQ ID NO. 4: GCGAGACTCAGGTGGTGCCTTTGGCATTCGACCAGGAGATATCGCGTTCAGCTATGCCC;

[0046] SEQ ID NO. 5: CCCATGAGAATAATACCGCCGATTTACGTCAGTCCGGTTTCCCACACGGGACGGCAGGC;

[0047] SEQ ID NO. 6: CGCACAGAACACATACGCTTTGGGCATAGCTGAACGCGATATCTCCTGGTCGAATGCC;

[0048] SEQ ID NO. 7: GCCCAGATTAAAACGTGAATTCCTAGCCAGTACAGGGTTTCCGGACTGACGTAAATCGG;

[0049] SEQ ID NO. 8: CGGTATTATTCTCATGGGTTTGGCACCACCTGAGTCTCGCCCGGCTCTTGTAAGTCGG.

[0050] (2) The TM buffer solution with 8 DNA single strands dissolved above was kept at 95°C for 10 min, and then cooled to 4°C for 20 min to obtain a tetrahedral framework nucleic acid.

[0051] (3) 1.16 mg of doxorubicin (purchased from MCE, CAS: 25316-40-9, with fluorescence) was weighed and dissolved in the TM buffer solution to make the final concentration of doxorubicin 20 μM.

[0052] (4) The doxorubicin (20 μM = 20000 nM) was mixed with the tetrahedral framework nucleic acid (100 nM), and incubated for 24 hours at room temperature in the dark with shaking to obtain doxorubicin-tetrahedral framework nucleic acid.

[0053] After the doxorubicin and the tetrahedral framework nucleic acid were incubated with shaking, the free doxorubicin (doxorubicin not combined with the tetrahedral framework nucleic acid) was removed by centrifugation at 6000g for 10 min for 3 times through a 30 kDa ultrafiltration tube to retain the purified doxorubicin-tetrahedral framework nucleic acid.

[0054] Further, the amount of free doxorubicin was determined by UV method with 480 nm as the detection wavelength of doxorubicin to indirectly determine the amount of doxorubicin loaded by the tetrahedral framework nucleic acid.

[0055] Experimental results

[0056] The UV method determines that the amount of free doxorubicin accounts for about 50% of the total amount of doxorubicin, and the amount of doxorubicin loaded by the tetrahedral framework nucleic acid accounts for about another 50% of the total amount of doxorubicin. It is shown that the molar ratio of doxorubicin to tetrahedral framework nucleic acid in doxorubicin-tetrahedral framework nucleic acid is about 20000x50%:100=100:1.

[0057] Further, the doxorubicin-tetrahedral framework nucleic acid prepared is detected by total internal reflection fluorescent microscope (TIRFM) and single molecule localization microscopy (SMLM). As shown in FIG. 1A, in the total internal reflection fluorescent microscope (TIRFM), doxorubicin shows green fluorescence. In FIG. 1A, the lower picture is the picture actually observed by the microscope, and the upper picture is the picture modeled by the computer according to the actually observed picture.

[0058] As shown in FIG. 1B, in the single molecule localization microscopy (SMLM), SMLM locates a single Dox by calculating the distribution of fluorescence intensity. The area circled by a circle in the figure represents a doxorubicin-tetrahedral framework nucleic acid (TDF-Dox), and it can be seen from the figure that each TDF-Dox loads a large amount of Dox, which can improve the local concentration of Dox in vivo. In FIG. 1B, the lower picture is the picture actually observed by the microscope, and the upper picture is the picture modeled by the computer according to the actually observed picture.

[0059] Example 2: Doxorubicin-tetrahedral framework nucleic acid can quickly enter cells

[0060] Experimental method

[0061] (1) The Cy5 fluorescently labeled doxorubicin-tetrahedral framework nucleic acid is prepared by the preparation method of Example 1, in which the Cy5 dye is modified at the 3' end of the above-mentioned 8 DNA single strands.

[0062] (2) The stably cultured H9c2 cells (purchased from the Chinese Academy of Sciences Cell Bank, catalog number GNR5) are resuspended after trypsin digestion, and are planted in a glass dish at a density of 1000 cells per square millimeter, and are adherent cultured for 4 hours.

[0063] (3) The cells adherent cultured in step (2) are randomly divided into three groups, which are Ctrl group, Dox alone group, and TDF-Dox group, respectively.

[0064] The cells in the Ctrl group are added with DAPI dye, and are incubated for 10 min;

[0065] Dox alone group cells were added with doxorubicin (doxorubicin concentration 0.2 mg / kg), incubated for 12 hours; added with DAPI dye and incubated for 10 min;

[0066] TDF-Dox group cells were added with Cy5 fluorescently labeled doxorubicin-tetrahedron framework nucleic acid (doxorubicin concentration 0.2 mg / kg), incubated for 12 hours; added with DAPI dye and incubated for 10 min.

[0067] As shown in Figure 2, the above three groups of cells were imaged and analyzed using a laser confocal microscope, and the intracellular amounts of free Dox and TDF-Dox were compared. The results showed that TDF-Dox can quickly enter the cells, and at the same Dox concentration, TDF-Dox has a higher intracellular amount than free Dox, significantly increases the local concentration of Dox inside the cell nucleus, and effectively promotes cell apoptosis.

[0068] Example 3 Doxorubicin-tetrahedron framework nucleic acid effectively reduces electrical conduction recurrence after radiofrequency ablation

[0069] Experimental method

[0070] Thirty adult New Zealand rabbits were randomly divided into four groups: sham operation group (Sham group, n = 5), left atrial appendage radiofrequency catheter ablation group (RFCA group, n = 8), left atrial appendage radiofrequency catheter ablation combined with doxorubicin group (RFCA + Dox group, n = 9), and left atrial appendage radiofrequency catheter ablation combined with doxorubicin-tetrahedron framework nucleic acid group (RFCA + TDF-Dox group, n = 8):

[0071] Sham group rabbits: simply open the chest and suture;

[0072] RFCA group rabbits: open the chest, left atrial appendage radiofrequency ablation, and suture;

[0073] RFCA + Dox group rabbits: open the chest, left atrial appendage radiofrequency ablation, and when the rabbit electrical conduction recurrence is monitored by the electrophysiological monitor (about 20 minutes after ablation), give auricular vein injection of Dox (0.2 mg / kg);

[0074] RFCA + TDF-Dox group rabbits: open the chest, left atrial appendage radiofrequency ablation, and when the rabbit electrical conduction recurrence is monitored by the electrophysiological monitor (about 20 minutes after ablation), give auricular vein injection of TDF-Dox (0.2 mg / kg).

[0075] Experimental results

[0076] One week later, the electrical conduction recurrence rate of each group of rabbits was monitored using an electrophysiological monitor, and the results are shown in Table 1. The results show that, compared with Dox, TDF-Dox can effectively reduce the electrical conduction recurrence after radiofrequency ablation, and there is a significant statistical difference between the two, P<0.05.

[0077] Table 1 Electrical conduction recurrence of each group of rabbits in the animal experiment

[0078] Example 4 Doxorubicin-tetrahedral framework nucleic acid enrichment at the ablation point area

[0079] Experimental method

[0080] (1) The Cy7 dye was modified at the 3' end of the 8 DNA single strands in Example 1, and the Cy7 fluorescently labeled doxorubicin-tetrahedral framework nucleic acid was prepared using the preparation method of Example 1.

[0081] (2) 30 adult New Zealand rabbits were randomly divided into 3 groups: sham operation combined with normal saline group (Sham+saline group, n=10), sham operation combined with doxorubicin-tetrahedral framework nucleic acid group (Sham+Cy7-TDF group, n=10), and left atrial appendage radiofrequency catheter ablation combined with doxorubicin-tetrahedral framework nucleic acid group (RFCA+Cy7-TDF group, n=10):

[0082] Sham+saline group: open chest treatment, inject normal saline after suturing;

[0083] Sham+Cy7-TDF group: open chest treatment, inject Cy7 fluorescently labeled doxorubicin-tetrahedral framework nucleic acid after suturing;

[0084] RFCA+Cy7-TDF group: open chest, left atrial appendage radiofrequency ablation, and inject Cy7 fluorescently labeled doxorubicin-tetrahedral framework nucleic acid after ablation.

[0085] (3) Two days later, each group of rabbits was euthanized, and the heart tissue was dissected and imaged.

[0086] Experimental results

[0087] As shown in FIG. 3, from the in vivo imaging diagram of FIG. 3, it can be seen that in the rabbits without radiofrequency ablation (Sham+saline group, Sham+Cy7-TDF group), there is no doxorubicin-tetrahedral framework nucleic acid enrichment in the rabbit's heart; in the rabbits that have undergone radiofrequency ablation (RFCA+Cy7-TDF group), doxorubicin-tetrahedral framework nucleic acid (red fluorescent label) is enriched in the ablation point area of the rabbit's heart.

[0088] The above experiments can show that:

[0089] (1) The TDF-Dox provided by the application can be enriched in the ablation point area after radiofrequency ablation, and can successfully induce the death of cells in the area, effectively avoiding the recurrence of electrical conduction induced by the survival of cells at the ablation point.

[0090] Further, the TDF-Dox provided by the application is enriched in the ablation point area of the heart, so that the concentration of Dox in the remaining organs other than the heart is low, reducing the damage of Dox to the remaining organs.

[0091] (2) Compared with doxorubicin (Dox) alone, the TDF-Dox provided by the application is more easily entered into the interior of cells, and a low dose of administration can successfully induce the death of cells in the ablation point area.

[0092] In summary, to solve the technical problem of high recurrence rate of electrical conduction after radiofrequency ablation, the application provides a doxorubicin-tetrahedral framework nucleic acid, which can be enriched in the ablation point area after radiofrequency ablation of the heart, and can induce the death of cells in the area, effectively avoiding the survival of cells at the ablation point, and further avoiding the occurrence of electrical conduction recurrence induced by the survival of cells at the ablation point.

[0093] Although the content of the application has been described in detail by the above preferred embodiments, it should be recognized that the above description should not be considered as a limitation of the application. After reading the above content, various modifications and alternatives of the application will be obvious to those skilled in the art. Therefore, the protection scope of the application should be defined by the appended claims.

Claims

1. Use of a doxorubicin-tetrahedron framework nucleic acid for the preparation of a medicament for reducing electrical conduction recurrence after radiofrequency ablation, characterized in that, The doxorubicin-tetrahedron framework nucleic acid is made of doxorubicin and tetrahedron framework nucleic acid, and the molar ratio of the doxorubicin and the tetrahedron framework nucleic acid is (80-120):

1.

2. Use of the doxorubicin-tetrahedral framework nucleic acid according to claim 1 for the preparation of a medicament for reducing electrical conduction recurrence after radiofrequency ablation, characterized in that, The tetrahedron framework nucleic acid is made of eight DNA single strands, and the eight DNA single strands are complementary to each other in pairs; the sequences of the eight DNA single strands are shown in SEQ ID NO. 1-8.

3. Use of the doxorubicin-tetrahedral framework nucleic acid according to claim 1 for the preparation of a medicament for reducing electrical conduction recurrence after radiofrequency ablation, characterized in that, The molar ratio of the doxorubicin and the tetrahedron framework nucleic acid is 100:

1.

4. Use of the doxorubicin-tetrahedral framework nucleic acid according to claim 1 for the preparation of a medicament for reducing electrical conduction recurrence after radiofrequency ablation, characterized in that, The drug is used after radiofrequency ablation.

5. Use of the doxorubicin-tetrahedral framework nucleic acid according to claim 1 for the preparation of a medicament for reducing electrical conduction recurrence after radiofrequency ablation, characterized in that, The drug is an injection preparation.

6. A method of preparing the doxorubicin-tetrahedron framework nucleic acid of claim 1, wherein, The method comprises the following steps: Step S1, preparing a tetrahedron framework nucleic acid: The eight DNA single strands complementary to each other in pairs are added into a buffer solution, maintained at 85-105℃ for 5-15 min, and then maintained at 2-8℃ for 10-30 min to obtain the tetrahedron framework nucleic acid; Step S2, preparing a doxorubicin-tetrahedron framework nucleic acid: The doxorubicin is taken, mixed with the tetrahedron framework nucleic acid, and incubated to obtain the doxorubicin-tetrahedron framework nucleic acid.

7. The method for preparing doxorubicin-tetrahedral framework nucleic acid as described in claim 6, characterized in that, In step S1, the concentrations of the eight DNA single strands in the buffer solution are the same.

8. The method for preparing doxorubicin-tetrahedral framework nucleic acid as described in claim 7, characterized in that, In step S1, the final concentration of the eight DNA single strands is 80-120 μM.

9. The method for preparing doxorubicin-tetrahedral framework nucleic acid as described in claim 6, characterized in that, In step S1, after the eight DNA single strands are added into the buffer solution, they are maintained at 95℃ for 10 min, and then maintained at 4℃ for 20 min to obtain the tetrahedron framework nucleic acid.

10. A doxorubicin-tetrahedral framework nucleic acid, characterized in that, The method comprises the following steps: Doxorubicin and a tetrahedron framework nucleic acid; the doxorubicin is loaded in the tetrahedron framework nucleic acid, and the tetrahedron framework nucleic acid is made of eight DNA single strands shown in SEQ ID NO. 1-8.

Images