Treatment and prevention of alpha-synuclein-mediated disease
By increasing the activity of mitochondrial proteases to degrade alpha-synuclein, the pathological effects of alpha-synuclein in neurodegenerative diseases are mitigated, addressing the underlying toxicity and reducing mitochondrial dysfunction.
Patent Information
- Application Number
- PCT/EP2025/062632
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-09
- Filing Date
- 2025-05-08
- Publication Date
- 2025-11-13
AI Technical Summary
The mechanism underlying alpha-synuclein toxicity in neurodegenerative diseases such as Parkinson's disease remains enigmatic, and existing technologies do not effectively address the pathological aggregation of alpha-synuclein, leading to neuronal damage and mitochondrial dysfunction.
Administering agents that increase the expression or activity of mitochondrial proteases like neurolysin, PITRM1, IMMP1L, IMMP2L, YME1L1, PARL, or METAP1 to degrade alpha-synuclein, thereby reducing its accumulation and mitigating mitochondrial dysfunction.
Enhancing mitochondrial proteolysis through these agents reduces alpha-synuclein levels, decreases mitochondrial damage, and alleviates symptoms associated with alpha-synucleinopathies.
Smart Images

Figure EP2025062632_13112025_PF_FP_ABST
Abstract
Description
[0001] Treatment and prevention of alpha-Synuclein-mediated disease
[0002] This application claims priority from US63 / 644906 filed 9 May 2024, the contents and elements of which are herein incorporated by reference for all purposes.
[0003] Technical Field
[0004] The present disclosure relates to methods of medical treatment and prophylaxis, in particular of diseases and conditions in which a-synuclein is pathologically-implicated.
[0005] Background
[0006] Alpha-Synuclein (a-Syn) is a presynaptic protein that is implicated in the pathology of Parkinson's disease (PD). PD is the second most common neurodegenerative disorder, and is characterized by symptoms of motor dysfunction that result from progressive loss of dopaminergic (DA) neurons in the substantia nigra1. A hallmark of PD is the formation of a-Syn-containing neuronal aggregates known as Lewy bodies and Lewy neurites, in an age-dependent manner2-4.
[0007] Pathological aggregation of a-Syn in the form of Lewy bodies and Lewy neurites is a common feature of PD and other synucleinopathies, or synuclein-mediated neurodegenerative diseases, such as dementia with Lewy bodies (DLB) and multiple system atrophy (MSA) (Goedert et al., The Synucleinopathies: Twenty Years On. J Parkinsons Dis. 2017;7(s1 ):S51 -S69). a-Syn is encoded by the SNCA gene. Mutations in or elevated expression of the SNCA gene causes familial PD7. Most patients with familial PD only develop a pathology and symptoms later in life (after decades). In animal and cell models, overexpression of a-Syn is sufficient to cause cellular toxicity and PD-like pathology and symptoms8. However, the mechanism underlying a-Syn toxicity remains enigmatic. In addition, it is not known how a-Syn proteostasis is maintained at an early age but is impaired with aging.
[0008] Summary
[0009] In a first aspect, the present disclosure provides a method of treating or preventing a disease in which a- synuclein is pathologically-implicated in a subject, comprising administering to a subject an agent that increases the expression or activity of a mitochondrial protease that degrades a-synuclein.
[0010] The present disclosure also provides the use of an agent that increases the expression or activity of a mitochondrial protease that degrades a-synuclein in the manufacture of a medicament for use in treating or preventing a disease in which a-synuclein is pathologically-implicated.
[0011] The present disclosure also provides an agent that increases the expression or activity of a mitochondrial protease that degrades a-synuclein for use in treating or preventing a disease in which a-synuclein is pathologically-implicated. In some embodiments, in accordance with the various aspects of the present disclosure, the mitochondrial protease that degrades a-synuclein is selected from neurolysin, PITRM1 , IMMP1 L, IMMP2L, YME1 L1 , PARL, ATP23 and METAP1 . In some embodiments, the mitochondrial protease that degrades a-synuclein is neurolysin or PITRM1 .
[0012] In some embodiments, the disease in which a-synuclein is pathologically-implicated is a disease characterised by the presence of Lewy bodies. In some embodiments, the disease in which a-synuclein is pathologically-implicated is a disease characterised by the presence of Lewy neurites.
[0013] In some embodiments, the disease in which a-synuclein is pathologically-implicated is a synucleinopathy.
[0014] In some embodiments, the disease in which a-synuclein is pathologically-implicated is selected from Parkinson’s disease (PD), dementia with Lewy bodies (DLB), multiple system atrophy (MSA), pure autonomic failure (PAF) and REM behaviour disorder (RBD).
[0015] In some embodiments, in accordance with the various aspects of the present disclosure, the agent is a small molecule that allosterically increases the activity of the mitochondrial protease that degrades a- synuclein.
[0016] In some embodiments, the agent is a compound selected from: enantiomer or pharmaceutically-acceptable salt thereof.
[0017] In some embodiments, the agent that increases the expression or activity of a mitochondrial protease is a nucleic acid encoding a polypeptide that comprises or consists of an amino acid sequence corresponding to the mitochondrial protease.
[0018] Description
[0019] The present disclosure is based on the inventors’ unexpected finding that a-Syn is constitutively imported into mitochondria and causes mitochondrial dysfunction and loss of cellular fitness in vivo.
[0020] Using a transgenic mouse model, the inventors demonstrate herein that the level of endogenous a-Syn accumulation in mitochondria of dopaminergic neurons and microglia increases with age. The inventors further confirm that the imported a-Syn is degraded by conserved mitochondrial proteases, including neurolysin (NLN) and PITRM1 (Prd1 and Cym1 in yeast, respectively). a-Syn which is present in the mitochondrial matrix and which is not degraded by the proteases, interacts with respiratory chain complexes, leading to loss of mitochondrial DNA (mtDNA), mitochondrial membrane potential and cellular fitness decline. The inventors also demonstrate that enhancing mitochondrial proteolysis by increasing the expression of specific mitochondrial proteases alleviates these defects in yeast, human cells, and a Parkinson’s Disease model of mouse primary neurons. Together, the experimental data described herein provide a direct link between a-synuclein-mediated cellular toxicity and a-synuclein import into mitochondria, and also provide a therapeutic approach for the treatment of disease in which a-synuclein is pathologically-implicated (e.g. a a-synucleinopathy).
[0021] Alpha-Synuclein
[0022] The present disclosure relates to attenuating the pathological effects of a-synuclein (a-Syn).
[0023] The structure and function of a-Syn is described in e.g. Kim W. S. et al. Alzheimers Res Ther. 2014; 6(5) :73, which is hereby incorporated by reference in its entirety. a-synuclein is encoded by the SNCA gene. a-Syn is a 140 amino acid (aa)-long polypeptide that contains three domains5: the N-terminal lipid-binding a-helix (residues 1 -60, SEQ ID NO:2), amyloid-binding central domain (NAC, residues 61 -95, SEQ ID NO:3)6, and C-terminal acidic tail (residues 96-140, SEQ ID NO:4). The amino acid sequence of human a-Syn is set forth in SEQ ID NOU (UniProtKB: P37840), and the amino acid sequence of mouse a-Syn is set forth in SEQ ID NO:5 (UniProtKB: 055042). Apart from the predominant 140 amino acid protein, there are two other alternatively spliced variants of a- Syn; the 126 amino acid and 112 amino acid variants that lack exon 3 and exon 5, respectively (Beyer K. Alpha-synuclein structure, posttranslational modification and alternative splicing as aggregation enhancers. Acta Neuropathol. 2006;112:237-251 ).
[0024] A pathologically-implicated post-translational modification of a-synuclein is phosphorylation, in particular phosphorylation at position 129 of human a-synuclein (phosphorylation of serine 129). Herein, ‘a- synuclein’ may refer to post-translationally modified a-synuclein, e.g. phosphorylated a-synuclein. In some embodiments, phosphorylated a-synuclein is phosphorylated a-synuclein at serine 129 {e.g. of SEQ ID NO:1 ).
[0025] Mitochondrial proteases that degrade a-synuclein
[0026] As used herein, ‘mitochondrial protease’ or ‘mitochondrial peptidase’ refers to a proteolytic enzyme that is localised to the mitochondria. A mitochondrial protease may be located in any one of the four mitochondrial subcompartments, namely at the outer membrane (OM), in the intermembrane space (IMS), at the inner membrane (IM), or in the matrix. A protease that localises to the mitochondria is a protease that, when expressed by a cell {e.g. a eukaryotic / mammalian cell), is detectable at the outer membrane (OM), in the intermembrane space (IMS), at the inner membrane (IM), or in the mitochondrial matrix {e.g. by analysis by immunohisto / cytochemistry, e.g. using an antibody to the protease). A mitochondrial protease may be localised to the mitochondria under normal physiological conditions. A mitochondrial protease may be expressed from genomic DNA {i.e., nuclear DNA) in the cytosol of the cell and imported into the mitochondria.
[0027] Mitochondrial proteases form a complex system that performs limited and terminal proteolysis to build the mitochondrial proteome, maintain and control its functions, or degrade mitochondrial proteins and peptides. During protein biogenesis, presequence proteases cleave and degrade mitochondrial targeting signals to obtain mature functional proteins. Mitochondrial proteases are emerging as regulators of mitochondrial proteostasis and mitochondrial function. The role of mitochondrial proteases is described in e.g. Gomez-Fabra Gala M. et al. FEBS Letters. 2021 ;595: 1205-1222, which is hereby incorporated by reference in its entirety.
[0028] Aspects of the disclosure relate to mitochondrial proteases that degrade a-synuclein. That is, a-synuclein is a substrate of certain mitochondrial proteases, such as the mitochondrial proteases disclosed herein. As used herein, ‘degrade’, for example ‘degrade a-synuclein’, refers to the activity of a protease to hydrolyse a substrate, such as a-synuclein.
[0029] Mitochondrial proteases that degrade a-synuclein may be identified using assays to evaluate the proteolytic activity against a-synuclein, e.g. assays comprising detecting the level of a-synuclein in the presence of the mitochondrial protease {e.g. by antibody-based methods including western blot, immunohisto / cytochemistry, or by reporter-based methods). Such assays may comprise contacting a- synuclein with the mitochondrial protease, and subsequently detecting the level of degradation products of a-synuclein and / or the level of a-synuclein {i.e. intact a-synuclein). Such assays may further comprise comparing the level of a-synuclein and / or degradation products thereof in the presence of the mitochondrial protease, to the level of a-synuclein and / or degradation products thereof of an appropriate control condition (e.g. a-synuclein in the absence of the mitochondrial protease). Herein, ‘contacting’ a- synuclein with a given mitochondrial protease may comprise applying the mitochondrial protease to, and / or mixing the mitochondrial protease with, a-synuclein.
[0030] The inventors have identified mitochondrial proteases that degrade a-synuclein (see Example 5 and Figure 4e). These include: neurolysin, PITRM1 , IMMP2L, YME1 L1 , PARL, METAP1 , AFG3L2 and ATP23.
[0031] Neurolysin
[0032] Neurolysin (NLN) is a mitochondrial peptidase encoded by NLN. The yeast homologue of NLN is Prd1 . Human neurolysin (UniProtKB: Q9BYT8, SEQ ID NO:6) has a 704 amino acid long sequence.
[0033] Modulation of the activity of neurolysin is described in WO 2020 / 047185 A1 , and US 2021 / 0198647 A1 . These documents provide speculative statements that enhancement of the activity of neurolysin may be useful for the treatment of a wide range of peripheral inflammatory disorders (for example, ischemic stroke, autism, dementia, AD, PD and others, see claim 8 of WO 2020 / 047185 A1 ). However, WO 2020 / 047185 A1 and US 2021 / 0198647 A1 do not provide any suggestion that neurolysin is able to degrade a-Syn, let alone any data supporting the use of an agent that induces expression of or enhances the activity of neurolysin to treat or prevent a disease in which a-Syn is pathologically-implicated.
[0034] PITRM1
[0035] The protein encoded by PITRM1 is pitrilysin metallopeptidase 1 (PITRM1 ), which is also known as presequence protease (PreP). PITRM1 is an ATP-dependent metalloprotease that degrades peptides, including mitochondrial presequences and amyloid-p (Ap). Human PITRM1 has a 1037 amino acid long sequence (UniProtKB: Q5JRX3, SEQ ID NO: 7). The yeast homologue of PITRM1 is Cym1 , which is encoded by CYM1.
[0036] Inner Membrane Peptidase subunit 2
[0037] The mitochondrial inner membrane peptidase (IMP) cleaves hydrophobic sorting signals of incoming precursor proteins, often after initial processing by mitochondrial processing peptidase (MPP). The substrates are subsequently mostly released into the IMS. IMP has been studied in yeast (model organism Saccharomyces cerevisiae) , which revealed a composition of two catalytic subunits, Imp1 and Imp2 (Gomez-Fabra Gala M. et al., 2021 ). The human homologues are Inner Membrane Peptidase subunit 1 and 2 (IMMP1 L and IMMP2L), respectively. Human IMMP1 L has a 166 amino acid long sequence (UniProtKB: Q96LU5, SEQ ID NO: 8). Human IMMP2L has a 175 amino acid long sequence (UniProtKB: Q96T52, SEQ ID NO: 9).
[0038] Further mitochondrial proteases
[0039] Further mitochondrial proteases that degrade a-Syn include:
[0040] Yeast Mitochondrial Escape (YME1 ). The human homologue is YME1 like 1 ATPase (YME1 L1 ) Processing of Cytochrome c Peroxidase (PCP1 ). The human homologue is presenilin associated rhomboid like (PARL).
[0041] Methionine Aminopeptidase (MAPI ). The human homologue is methionyl aminopeptidase 1 (METAP1 ).
[0042] Yeast Tat-binding Analog (YTA12). The human homologue is AFG3-like protein 2 (AFG3L2). ATP23 which is a metalloprotease of the mitochondrial inner membrane in yeast and human.
[0043] In some embodiments, the mitochondrial protease that degrades a-synuclein is selected from Prd1 , Cym1 , Imp2, Yme1 , Pcp1 , Map1 , Yta12 and Atp23. In some embodiments, the mitochondrial protease that degrades a-synuclein is a human homologue of Prd1 , Cym1 , Imp2, Yme1 , Pcp1 , Map1 , Yta12 or Atp23.
[0044] In some embodiments, the mitochondrial protease that degrades a-synuclein is selected from neurolysin, PITRM1 , IMMP1 L, IMMP2L, YME1 L1 , PARL, ATP23 and METAP1 . In some embodiments, the mitochondrial protease that degrades a-synuclein is selected from neurolysin, PITRM1 , IMMP1 L, IMMP2L, YME1 L1 , PARL and METAP1 . In some embodiments, the mitochondrial protease that degrades a-synuclein is selected from neurolysin, PITRM1 , IMMP2L, YME1 L1 , PARL, and METAP1 . In some embodiments, the mitochondrial protease is selected from neurolysin, PITRM1 , and IMMP2L. In some embodiments, the mitochondrial protease is selected from YME1 L1 , PARL, and METAP1 .
[0045] In some embodiments, the mitochondrial protease that degrades a-synuclein is neurolysin or PITRM1 . In some embodiments, the mitochondrial protease that degrades a-synuclein is neurolysin. In some embodiments, the mitochondrial protease that degrades a-synuclein is PITRM1 .
[0046] In this specification, reference to a ‘mitochondrial protease’ (e.g. neurolysin) encompasses: the human homologue (e.g. human neurolysin), an animal homologue, a yeast homologue and variants thereof. That is, reference to e.g. ‘CymT encompasses the human homologue, PITRM1.
[0047] A homologue of neurolysin (NLN) may be from any animal. In some embodiments, a homologue of NLN may be from a mammal. A homologue of PITRM1 may be from any animal. In some embodiments, a homologue of PITRM1 may be from a mammal.
[0048] In some embodiments, the mammal may be a non-human mammal, e.g. a primate (e.g. a non-human primate, e.g. an animal of the genus Macaca (e.g. Macaca fascicularis, Macaca mulatta), e.g. a non- human hominid (e.g. Pan troglodytes)). In some embodiments, the mammal may be a rabbit, guinea pig, rat, mouse or animal of the order Rodentia, cat, dog, pig, sheep, goat, an animal of the order Bos (e.g. cattle), an animal of the family Equidae (e.g. horse) or donkey. In some embodiments, the mammal may be human.
[0049] As used herein, a ‘fragment’, ‘variant’ or ‘homologue’ of a protein may optionally be characterised as having at least 60%, preferably one of 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to the amino acid sequence of the reference protein (e.g. a reference isoform of the reference protein). In some embodiments fragments / variants / isoforms / homologues may be characterised by their ability to perform a function performed by the reference protein.
[0050] A ‘fragment’ generally refers to a fraction of the reference protein. A ‘variant’ generally refers to a protein having an amino acid sequence comprising one or more amino acid substitutions, insertions, deletions or other modifications relative to the amino acid sequence of the reference protein, but retaining a considerable degree of sequence identity (e.g. at least 60%) to the amino acid sequence of the reference protein. An ‘isoform’ generally refers to a variant of the reference protein expressed by the same species as the species of the reference protein. A ‘homologue’ generally refers to a variant of the reference protein produced by a different species as compared to the species of the reference protein. Homologues include orthologues.
[0051] A ‘fragment’ may be of any length (by number of amino acids), although may optionally be at least 20% of the length of the reference protein (that is, the protein from which the fragment is derived) and may have a maximum length of one of 50%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the length of the reference protein.
[0052] Isoforms, fragments, variants or homologues may optionally be functional isoforms, fragments, variants or homologues, e.g. having a functional property / activity of the reference protein, as determined by analysis by a suitable assay for the functional property / activity.
[0053] In some embodiments, a mitochondrial protease according to the present disclosure comprises, or consists of, an amino acid sequence having at least 60%, preferably one of >70%, >75%, >80%, >85%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99% or 100% amino acid sequence identity to the amino acid sequence of a mitochondrial protease described herein.
[0054] In some embodiments, a mitochondrial protease according to the present disclosure comprises, or consists of, an amino acid sequence having at least 60%, preferably one of >70%, >75%, >80%, >85%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99% or 100% amino acid sequence identity to any one of SEQ ID NOs:6, 7, 8 or 9.
[0055] In some embodiments, a mitochondrial protease according to the present disclosure is human neurolysin (i.e. SEQ ID NO:6). In some embodiments, the mitochondrial protease comprises, or consists of, an amino acid sequence having at least 60%, preferably one of >70%, >75%, >80%, >85%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99% or 100% amino acid sequence identity to SEQ ID NO:6.
[0056] In some embodiments, a mitochondrial protease according to the present disclosure is human PITRM1 (i.e. SEQ ID NO:7). In some embodiments, the mitochondrial protease comprises, or consists of, an amino acid sequence having at least 60%, preferably one of >70%, >75%, >80%, >85%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99% or 100% amino acid sequence identity to SEQ ID NOT.
[0057] In some embodiments, a mitochondrial protease according to the present disclosure is human IMMP1 L (i.e. SEQ ID NO:8). In some embodiments, the mitochondrial protease comprises, or consists of, an amino acid sequence having at least 60%, preferably one of >70%, >75%, >80%, >85%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99% or 100% amino acid sequence identity to SEQ ID NO:8.
[0058] In some embodiments, a mitochondrial protease according to the present disclosure is human IMMP2L (i.e. SEQ ID NO:9). In some embodiments, the mitochondrial protease comprises, or consists of, an amino acid sequence having at least 60%, preferably one of >70%, >75%, >80%, >85%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99% or 100% amino acid sequence identity to SEQ ID NO:9.
[0059] Agents that increase the activity or expression of a mitochondrial protease
[0060] The present disclosure is concerned with increasing the expression or activity of a mitochondrial protease that degrades a-synuclein.
[0061] As used in the specification and the appended claims, the singular forms ‘a’, ‘an’, and ‘the’ include plural referents, namely ‘a mitochondrial protease’ includes ‘one or more mitochondrial proteases’.
[0062] An agent that increases the expression or activity of a mitochondrial protease encompasses an agent that increases the level of gene and / or protein expression of the mitochondrial protease that degrades a- synuclein, and an agent that increases the activity of the mitochondrial protease that degrades a- synuclein. It will be appreciated that the word ‘increase’ in the preceding sentence refers to the level of expression / activity observed in the absence of such an agent. Such agents may be used as therapeutic agents to treat or prevent a disease in which a-synuclein is pathologically-implicated.
[0063] In the present disclosure, agents that increase the activity of a mitochondrial protease may also be referred to as ‘activators’, ‘enhancers’ or ‘potentiators’ of the mitochondrial protease, and similarly increase of the activity of a mitochondrial protease may be referred to as ‘enhancement’ or ‘potentiation’ of the activity of the mitochondrial protease.
[0064] As used herein, an ‘activity’ or ‘function’ of a mitochondrial protease that degrades a-synuclein refers to the proteolytic activity of the mitochondrial protease, and may refer to cleavage (i.e. hydrolysis) of a- synuclein and / or of another substrate of the mitochondrial protease.
[0065] In some embodiments, an agent that increases the activity or expression of a mitochondrial protease that degrades a-synuclein, according to the present disclosure, displays one or more of the following properties:
[0066] Increases the gene expression of a gene encoding the mitochondrial protease; Increases the protein expression of the mitochondrial protease;
[0067] Allosterically increases the activity of the mitochondrial protease;
[0068] Increases the level of RNA encoding the mitochondrial protease;
[0069] Increases the transcription of nucleic acid encoding the mitochondrial protease;
[0070] Reduces degradation of RNA encoding the mitochondrial protease;
[0071] Increases the protein level of the mitochondrial protease;
[0072] Increases normal post-transcriptional processing (e.g. splicing, translation, post-translational processing) of RNA encoding the mitochondrial protease;
[0073] Reduces degradation of the mitochondrial protease;
[0074] Reduces the level of a-synuclein (e.g. in neurons);
[0075] Reduces the level of a-synuclein in the mitochondria (e.g. in neurons);
[0076] Reduces accumulation of a-synuclein in the mitochondria (e.g. in neurons);
[0077] Reduces the level of mitochondrial fragmentation (e.g. in neurons);
[0078] Increases the level of mitochondrial volume (e.g. in neurons);
[0079] Reduces the level of aggregation of a-synuclein (e.g. in neurons);
[0080] Reduces the formation or presence of Lewy bodies and / or Lewy neurites; and Reduces mitochondrial dysfunction (e.g. in neurons).
[0081] It will be appreciated that a given agent that increases the activity or expression of a mitochondrial protease that degrades a-synuclein may display more than one of the properties recited in the preceding paragraph. A given agent that increases the activity or expression of a mitochondrial protease may be evaluated for the properties recited in the preceding paragraph using suitable assays. For example, the assays may be e.g. in vitro assays, optionally cell-based assays or cell-free assays. In some embodiments, the assays may be e.g. in vivo assays, i.e. performed in non-human animals. In some embodiments, the assays may be e.g. ex vivo assays, i.e. performed using cells / tissue / an organ obtained from a subject.
[0082] Gene expression can be determined by means well known to the skilled person. The level of RNA encoding a mitochondrial protease as described herein can be determined e.g. by techniques such as RT-qPCR, northern blot, etc. An increase in the level of RNA encoding a mitochondrial protease as described herein may e.g. be the result of increased transcription of nucleic acid encoding the mitochondrial protease, or decreased degradation of RNA encoding the mitochondrial protease.
[0083] Agents capable of increasing gene expression of a mitochondrial protease (e.g. increasing the level of RNA encoding the mitochondrial protease, increasing transcription of nucleic acid encoding the mitochondrial protease and / or reducing degradation of RNA encoding the mitochondrial protease) may be identified using assays comprising detecting the level of RNA encoding the relevant protein, e.g. by RT- qPCR. Such assays may comprise treating cells / tissue with the agent, and subsequently comparing the level of RNA encoding the relevant protein in such cells / tissue to the level of RNA encoding the relevant protein in cells / tissue of an appropriate control condition (e.g. untreated / vehicle-treated cells / tissue).
[0084] Assays for detecting reduced / altered splicing of pre-mRNA of a given protein may comprise detecting and / or quantifying one or more isoforms of the relevant protein, or RNA encoding one or more of the isoforms.
[0085] Increased transcription of nucleic acid encoding a mitochondrial protease as described herein may be a consequence of transduction with a nucleic acid encoding the mitochondrial protease. An exemplary method is transduction using a lentivirus vector, as described herein (Examples 1 .7 and 6). Reduced degradation of RNA encoding a mitochondrial protease as described herein may be a consequence of decreased enzymatic degradation of RNA encoding the mitochondrial protease, e.g. as a consequence of increased stability of RNA encoding the mitochondrial protease.
[0086] Protein expression can be determined by means well known to the skilled person. The protein levels of a mitochondrial protease can be determined e.g. by antibody-based methods including western blot, immunohisto / cytochemistry, flow cytometry, ELISA, or by reporter-based methods. Suitable methods include immunostaining and immunoblotting, as described e.g. in Example 6.2.
[0087] Protein degradation can be evaluated e.g. by detection of, or analysis of the level / proportion of, ubiquitinated protein, association with ubiquitin ligase and / or proteosomal localisation.
[0088] Agents capable of increasing protein expression of mitochondrial protease as described herein {e.g. increasing the level of the mitochondrial protease) may be identified using assays comprising detecting the level of the relevant protein, e.g. using antibody / reporter-based methods (western blot, ELISA, immunohisto / cytochemistry, etc.). Such assays may comprise treating cells / tissue with the agent, and subsequently comparing the level of the relevant protein in such cells / tissue to the level of the relevant protein in cells / tissue of an appropriate control condition {e.g. untreated / vehicle-treated cells / tissue). Assays of protein degradation may comprise evaluating e.g. ubiquitination or proteosomal localisation of the relevant protein, and / or the proportion of the relevant protein that is ubiquitinated or localised to the proteasome.
[0089] The activity of a mitochondrial protease as described herein may refer to the proteolytic activity of the mitochondrial protease against a-synuclein, i.e. the activity to degrade a-synuclein. The activity of a mitochondrial protease that degrades a-synuclein may be evaluated using assays that measure the proteolytic activity against a-synuclein, e.g. assays comprising detecting the level of a-synuclein in the presence of the mitochondrial protease {e.g. by antibody-based methods including western blot, immunohisto / cytochemistry, or by reporter-based methods). Accordingly, an agent capable of increasing the activity of a mitochondrial protease that degrades a-synuclein may be identified using assays that may comprise contacting a mitochondrial protease that degrades a-synuclein with a putative agent capable of increasing the activity / expression of a mitochondrial protease, and subsequently {e.g. after an appropriate period of time, i.e. a period of time sufficient for a change in the level of a-synuclein to be observed) detecting the level of degradation products of a-synuclein and / or the level of a-synuclein {i.e. intact a-synuclein). Such assays may further comprise comparing the level of a-synuclein and / or degradation products thereof in the presence of the putative agent, to the level of a-synuclein and / or degradation products thereof of an appropriate control condition {e.g. in the absence of the putative agent). Such assays may comprise varying the concentration of the putative agent and detecting the level of a-synuclein and / or degradation products thereof at each different concentration of the putative agent.
[0090] The present disclosure is concerned with upregulating / increasing degradation of a-synuclein by a mitochondrial protease using an agent according to the present disclosure.
[0091] The experimental examples of the present disclosure demonstrate that increasing the activity of a mitochondrial protease that degrades a-synuclein (e.g. in neurons), as described herein, may be used to: reduce the level of a-synuclein (e.g. in mitochondria), reduce accumulation of a-synuclein in the mitochondria, reduce the level of mitochondrial fragmentation, increase the level of mitochondrial volume, reduce the level of aggregation of a-synuclein, reduce the formation or presence of Lewy bodies and / or Lewy neurites (which often comprise phosphorylated a-synuclein), and / or reduce mitochondrial dysfunction.
[0092] Accordingly, an agent capable of increasing the activity / expression of a mitochondrial protease as described herein may be evaluated for its ability to: reduce the level of a-synuclein or a specific post- translationally modified version thereof (e.g. phosphorylated a-synuclein as described herein) (e.g. in mitochondria), reduce accumulation of a-synuclein in the mitochondria, reduce the level of mitochondrial fragmentation, increase the level of mitochondrial volume, reduce the level of aggregation of a-synuclein, reduce the formation or presence of Lewy bodies and / or Lewy neurites (which often comprise phosphorylated a-synuclein), and / or reduce mitochondrial dysfunction.
[0093] The ability of an agent according to the present disclosure to reduce the level of a-synuclein or a specific post-translationally modified version thereof (e.g. phosphorylated a-synuclein as described herein) may be evaluated using assays comprising detecting and / or quantifying the level of the relevant protein / post- translationally modified version thereof, e.g. using techniques well known to the skilled person, such as antibody / reporter-based methods (western blot, ELISA, immunohisto / cytochemistry, etc.). The methods may employ antibodies specific for the relevant protein or post-translationally modified version thereof. Such assays may comprise contacting cells that express a-synuclein (e.g. neuronal cells) in in vitro culture with an agent that increases the activity or expression of a mitochondrial protease that degrades a-synuclein, and subsequently (e.g. after an appropriate period of time, i.e. a period of time sufficient for a change in the level of the relevant protein / post-translationally modified version thereof to be observed) measuring the level of the relevant protein / post-translationally modified version thereof. Such assays may further comprise comparing the level of the relevant protein / post-translationally modified version thereof in cells treated with the agent to the level detected in a control condition in which cells of the same type are subjected to the same conditions, except that instead of being treated with the agent, they are untreated, or otherwise treated with a negative control agent known not to affect the level of the relevant protein / post-translationally modified version thereof. A suitable method for analysing the level of a- synuclein, e.g. in mitochondria, is described in e.g. Example 5.
[0094] The subcellular localisation of a-synuclein within cells can be analysed using techniques known to the person skilled in the art. Such techniques include e.g. analysis by immunocytochemistry and reporter- based methods. For example, Cabantous S, et al. Protein tagging and detection with engineered selfassembling fragments of green fluorescent protein. Nature biotechnology. 2005;23:102-107 describes a reporter system (“split GFP” or “sp-GFP”) permitting imaging of proteins imported into the mitochondria. Such methods can be employed to analyse the levels of a-synuclein in the mitochondria {i.e. a-synuclein accumulation), including at the outer membrane (OM), in the intermembrane space (IMS), at the inner membrane (IM), and in the matrix. The sp-GFP system may be coupled with mitochondrial purification, and a protease protection assay (described e.g. in Ruan L. et al. Nature 543, 443-446 (2017), which is incorporated herein by reference in its entirety), as described in e.g. Example 1 .5.
[0095] Aggregation of a-synuclein {e.g. in neurons), and / or the formation or presence of Lewy bodies and / or Lewy neurites can be analysed in vitro by adding a-synuclein preformed fibrils to primary neuronal cultures to seed recruitment of endogenous a-synuclein to Lewy body and Lewy neurite-like aggregates, e.g. as described in Volpicelli-Daley, L. A., et al. Nat. Protoc. 9, 2135-2146 (2014), and Luk, K. C. et al. Proc. Natl. Acad. Sci. U.S.A. 106, 20051 -20056 (2009), the disclosures of which are incorporated herein by reference in their entirety.
[0096] Reduction of aggregation of a-synuclein {e.g. in neurons), and / or the formation or presence of Lewy bodies and / or Lewy neurites can be determined using assays comprising detecting the level of a- synuclein in the mitochondria. The methods may employ a reporter molecule specific for phosphorylated a-synuclein {e.g. S129-phosphorylated a-synuclein), as described herein. The assay may comprise contacting the cells {e.g. primary neuronal cells) with an agent described herein, and subsequently, {e.g. after an appropriate period of time, i.e. a period of time sufficient for a change in the level of aggregation of a-synuclein to occur) detecting the level of a-synuclein aggregation, level of S129-phosphorylated a- synuclein or level of Lewy body / neurite formation in the cells. The assay may further comprise comparing the level of a-synuclein aggregation, level of S129-phosphorylated a-synuclein or level of Lewy body / neurite formation in cells treated with the agent to the level detected in a control condition in which cells of the same type are subjected to the same conditions, except that instead of being treated with the agent, they are untreated, or otherwise treated with a negative control agent known not to affect the level of the level of a-synuclein aggregation or level of Lewy body / neurite formation.
[0097] Mitochondrial dysfunction is characterised by loss of mitochondrial DNA (mtDNA), increased oxidative stress caused by reactive oxygen species (ROS), deterioration of metabolic activities and reduced calcium homeostasis, as reviewed in e.g. Chen C. et al. Biology (Basel). (2019) 8(2):38.
[0098] Reduction of mitochondrial dysfunction may be determined using assays comprising detecting and / or quantifying the level of mitochondrial DNA (mtDNA), e.g. using techniques well known to the skilled person, such as reporter-based methods. The methods may employ a reporter molecule specific for mtDNA. Such assays may comprise contacting cells that express a-synuclein {e.g. neuronal cells) in in vitro culture with an agent that increases the activity or expression of a mitochondrial protease that degrades a-synuclein, and subsequently {e.g. after an appropriate period of time, i.e. a period of time sufficient for a change in the level of mtDNA to be observed) measuring the level of mtDNA. Such assays may further comprise comparing the level mtDNA in cells treated with the agent to the level detected in a control condition in which cells of the same type are subjected to the same conditions, except that instead of being treated with the agent, they are untreated, or otherwise treated with a negative control agent known not to affect the level of mtDNA. A suitable method for analysing loss of mtDNA in mitochondria, is TTC staining, as described in e.g. Example 1 .16.
[0099] Mitochondrial fragmentation can be analysed using techniques well known to the person skilled in the art, including immunocytochemistry and reporter-based methods. An exemplary method involves contacting cells with MitoTracker Green to label the mitochondria and determining the fluorescence signal of cells treated with the agent as compared to cells that have not been treated with the agent, e.g. as described in Horn A. et al. J Cell Biol. 2020 May 4; 219(5): e201909154. An alternative method is described in Example 6.2.
[0100] Reduction of mitochondrial fragmentation may be determined using assays comprising quantifying the mitochondrial volume. Such techniques include e.g. analysis by immunocytochemistry and reporter-based methods. Such assays may comprise contacting cells that express a-synuclein {e.g. neuronal cells) in in vitro culture with an agent that increases the activity or expression of a mitochondrial protease that degrades a-synuclein, and subsequently {e.g. after an appropriate period of time, i.e. a period of time sufficient for a change in the mitochondrial volume to be observed) measuring the mitochondrial volume. Such assays may further comprise comparing the mitochondrial volume in cells treated with the agent to the mitochondrial volume detected in a control condition in which cells of the same type are subjected to the same conditions, except that instead of being treated with the agent, they are untreated, or otherwise treated with a negative control agent known not to affect mitochondrial fragmentation. A suitable method for analysing mitochondrial fragmentation by measuring the mitochondrial volume, is TTC staining, as described in e.g. Example 1 .4.
[0101] Herein, ‘contacting’ or ‘treating’ cells with a given agent may comprise applying the agent to, and / or mixing the agent with, the cells.
[0102] Agents that allosterically increase the activity of a mitochondrial protease that degrades a-synuclein Some embodiments of various aspects of the present disclosure relate to enhancing the activity of a mitochondrial protease that degrades a-synuclein using an agent that allosterically increases the activity of the mitochondrial protease.
[0103] An ‘agent that allosterically increases the activity of a mitochondrial protease’ or an ‘allosteric enhancer’ refers to any agent capable of binding to and enhancing the catalytic efficiency of the mitochondrial protease that degrades a-synuclein. Such agent may bind to an ‘allosteric’ binding site on or ‘bind allosterically’ to the mitochondrial protease, i.e. binds to a binding site that is not / does not overlap with the substrate binding site on the mitochondrial protease. That is, such agent does not bind at a substrate binding site and / or does not hinder the binding of the substrate of the mitochondrial protease {i.e. a-Syn). A competition assay may be used to determine whether the binding site overlaps with the substrate binding site, as described e.g. in WO 2020 / 047185 A1 , which is herein incorporated by reference in its entirety. Another exemplary method for determining the binding site is X-ray crystallography of a complex comprising the agent bound to the mitochondrial protease.
[0104] The activity / catalytic efficiency of a protease may be measured using assays known to the skilled person. An exemplary assay involves detecting the increase in fluorescence occurring upon cleavage of a quenched fluorescent substrate (QFS), as described in e.g. Lew R. A. et al. Methods Mol Biol. 2005:298:143-50, which is herein incorporated by reference in its entirety.
[0105] In some embodiments, the agent is a small molecule that allosterically increases the activity of the mitochondrial protease that degrades a-synuclein. In some embodiments, the mitochondrial protease that degrades a-synuclein is neurolysin.
[0106] As used herein, a ‘small molecule’ refers to a low molecular weight (< 1000 Daltons, typically between -300-700 Daltons) organic compound.
[0107] Allosteric enhancers of neurolysin activity are described e.g. in WO 2020 / 047185 A1 and in US 2021 / 0198647 A1 , which describe dipeptides, including peptidomimetics, comprising histidine that allosterically increase the activity of neurolysin. In some embodiments, the agent that allosterically increases the activity of neurolysin is His-Tyr or His-His. In some embodiments, the agent that allosterically increases the activity of neurolysin according to the present disclosure is a compound described in WO 2020 / 047185 A1 , which is hereby incorporated by reference in its entirety. In some embodiments, the agent that allosterically increases the activity of neurolysin according to the present disclosure is a compound described in US 2021 / 0198647 A1 , which is hereby incorporated by reference in its entirety.
[0108] Accordingly, in some embodiments, the agent is or comprises a compound selected from:
[0109] entantiomer or pharmaceutically-acceptable salt thereof.
[0110] Accordingly, in some embodiments, the agent is or comprises a compound selected from the table below:
[0111] ; an enantiomer or a pharmaceutically-acceptable salt thereof.
[0112] In some embodiments, the agent is or comprises: enantiomer or a pharmaceutically-acceptable salt thereof.
[0113] In some embodiments, the agent is or comprises: enantiomer or a pharmaceutically-acceptable salt thereof.
[0114] In some embodiments, the agent is or comprises:
[0115] In some embodiments, the agent is L-histidyl-L-tyrosine, D, L-histidyl-D, L-histidine or L-histidyl-L- tryptophan.
[0116] In some embodiments, the agent is or comprises: enantiomer or a pharmaceutically-acceptable salt thereof.
[0117] In some embodiments, the agent is or comprises:
[0118] enantiomer or a pharmaceutically-acceptable salt thereof.
[0119] Preferably, the allosteric binding site of the allosteric enhancer is conserved between the mitochondrial protease of human origin and that of e.g. rodent origin.
[0120] Preferably, the allosteric enhancer is specific to the mitochondrial protease that degrades a-synuclein {e.g. neurolysin). That is, the allosteric enhancer may be inert to other homologous mitochondrial proteases that do not degrade a-synuclein.
[0121] Nucleic acids
[0122] In some embodiments, according to the various aspects of the present disclose, the agent is a nucleic acid encoding a mitochondrial protease that degrades a-synuclein. Such nucleic acids comprise or consist of DNA and / or RNA.
[0123] Provided herein is a nucleic acid that encodes a polypeptide which comprises or consists of a mitochondrial protease that degrades a-synuclein {e.g. neurolysin). Any polypeptide, or portion of a polypeptide, described herein may be encoded by, or partly encoded by, a nucleic acid as described herein. Thus, reference to ‘a polypeptide’ or ‘polypeptides’ herein may be taken to apply to a polypeptide encoded by a nucleic acid or nucleotide sequence, such as those disclosed herein. Equally, reference to a ‘nucleic acid’ or ‘nucleotide sequence’ herein may be taken to apply to a nucleic acid or nucleotide sequence that encodes a polypeptide(s) such as those disclosed herein.
[0124] The nucleotide sequence of the human NLN gene is located on chromosome 5, at positions 65,018,023- 65,167,553 (forward strand, see e.g. Ensembl ID ENSG00000123213, Release: 1 1 1 ). The canonical transcript mRNA is provided at NCBI NM 020726.5.
[0125] The nucleotide sequence of the human PITRM1 gene is located on chromosome 10, at positions 3,137,728-3,172,841 (reverse strand, see e.g. Ensembl ID ENSG00000107959, Release: 1 1 1 ). The canonical transcript mRNA is provided at NCBI NM_014889.4. In some embodiments of various aspects of the present disclosure, the agent that increases the expression or activity of a mitochondrial protease that degrades a-synuclein is a nucleic acid encoding a mitochondrial protease as described hereinabove.
[0126] In some embodiments, the agent is a nucleic acid encoding a polypeptide that comprises or consists of an amino acid sequence corresponding to human neurolysin (i.e. SEQ ID NO:6), human PITRM1 (i.e. SEQ ID NO:7), human IMMP1 L ( / .e. SEQ ID NO:8), or human IMMP2L ( / .e. SEQ ID NO:9). Provided herein is a nucleic acid encoding a polypeptide, wherein the polypeptide comprises, or consists of, an amino acid sequence having at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:6. Provided herein is a nucleic acid encoding a polypeptide, wherein the polypeptide comprises, or consists of, an amino acid sequence having at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:7. Also provided herein is a nucleic acid encoding a polypeptide, wherein the polypeptide comprises, or consists of, an amino acid sequence having at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:8. Also provided herein is a nucleic acid encoding a polypeptide, wherein the polypeptide comprises, or consists of, an amino acid sequence having at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO:9.
[0127] In some embodiments, an agent that increases the expression or activity of a mitochondrial protease that degrades a-synuclein is administered in the form of a nucleic acid encoding the factors required for production of the mitochondrial protease (e.g. a nucleic acid encoding a precursor of the mitochondrial protease).
[0128] In some embodiments the nucleic acid / nucleotide sequence is codon optimised, i.e. comprises synonymous codons based on an organism’s or cell’s codon bias without altering the amino acid sequence of the translated protein. Codon optimisation can improve translational efficiency and protein expression.
[0129] Thus, provided herein is a nucleotide sequence based on the wild-type nucleic acid encoding a mitochondrial protease described herein in which codons have been optimised for protein expression in mammalian cells, e.g. human cells. The cells may be any cells that are affected by a a-synuclein-related disorder, e.g. as described herein. The cells may be in a tissue or organ affected by a a-synuclein-related disorder. The nucleic acid sequence may be codon-optimised for expression in human cells, e.g. of the central nervous system, or brain.
[0130] The cells may be retinal pigment epithelial, photoreceptor, retinal or ganglion cells. The cells may be neuronal cells, for example dopaminergic (DA) neurons. The cells may be cells of the CNS, e.g. astrocytes, oligodendrocytes, ependymal cells, or microglia. The nucleic acid may comprise a polypeptide-encoding nucleotide sequence, as described herein, and may additionally comprise one or more non-polypeptide-encoding nucleotide sequence(s). Non- polypeptide-encoding nucleotide sequence(s) may be e.g. 5’ cap, 5’ untranslated region (5’ UTR), 3’ UTR and / or polyadenylation (PolyA) tail sequences.
[0131] The present invention provides expression cassettes comprising nucleic acid / nucleotide sequences encoding the polypeptides described herein.
[0132] Thus, in one aspect, there is provided a nucleic acid / polynucleotide comprising, in 5’ to 3’ or 3’ to 5’ order:
[0133] (i) a first nucleotide sequence comprising a promoter;
[0134] (ii) a second nucleotide sequence {e.g. encoding a polypeptide as described herein) comprising a transgene, wherein the transgene encodes a polypeptide that comprises or consists of an amino acid sequence corresponding to a mitochondrial protease that degrades a-synuclein {i.e. as described above); and
[0135] (iii) a polyadenylation (polyA) signal sequence.
[0136] In some embodiments the polynucleotide is isolated and / or substantially purified. In some embodiments, the polynucleotide is a polydeoxyribonucleotide.
[0137] In some embodiments the second nucleotide sequence, i.e. containing a transgene to be expressed, is operably linked to the first nucleotide sequence. The term “operably linked” may include the situation where the first and second nucleotide sequences are covalently linked in such a way as to place the expression of the second nucleotide sequence under the influence or control of the first nucleotide sequence, such that first nucleotide sequence is thus capable of effecting transcription of the second nucleotide sequence. The resulting transcript(s) may then be translated into a desired peptide(s) / polypeptide(s), e.g. a polypeptide which comprises or consists of a mitochondrial protease that degrades a-synuclein as described herein.
[0138] In some embodiments the second nucleotide sequence comprises a stop codon or termination codon that can signal the termination of protein synthesis. In some embodiments the stop codon is positioned at the distal end of the second nucleotide sequence compared to the position of the first nucleotide sequence. In some embodiments the polynucleotide comprises a stop codon at the distal end of the polyA signal sequence compared to the position of the second nucleotide sequence. The stop codon may be TAA, TAG or TGA. In some embodiments the stop codon is TAA.
[0139] The first nucleotide sequence may comprise any suitable promoter for driving expression of the second nucleotide sequence, e.g. in mammalian cells. The promoter may be a mammalian promoter, i.e. is able to drive transcription of the second nucleotide sequence or transgene in a mammalian cell. The promoter may be a human promoter i.e. is able to drive transcription of the second nucleotide sequence or transgene in a human cell. Suitable promoters will be known to a skilled person, including constitutive promoters such as the simian virus 40 early promoter (SV40), cytomegalovirus immediate-early promoter (CMV), human Ubiquitin C promoter (UBC), human elongation factor 1 a promoter (EF1A), mouse phosphoglycerate kinase 1 promoter (PGK), chicken p-Actin promoter (CBA), and chicken p-Actin promoter (CBA) coupled with CMV early enhancer (CAG or CAGG), see e.g. Qin et al., PLoS One. 2010; 5(5): e10611 , which is hereby incorporated by reference in its entirety. A further suitable promoter known to a skilled person is the spleen focus-forming virus (SFFV) promoter.
[0140] The chimeric introns used in the CAG and CBA promoters are ~1 kb making the promoters relatively large (~1 ,6kb) and so smaller introns may be used, for example to fit within the ~4.8kb packaging capacity of AAV vectors. Smaller introns may include the SV40 intron (~97bp) or a chimeric intron that is a chimera between introns from human p-globin and immunoglobulin heavy chain genes (~133bp).
[0141] Sequences for the promoters above are publicly available. For example, the CMV enhancer with the chicken p-actin core promoter (pCAGGS plasmid; GenBank: LT727518.1 ), the SV40 intron (pTR-CBA- EGFP; GenBank: MK225672.1 ), the chimeric human p-globin and immunoglobulin heavy chain intron (pCI plasmid; GenBank: U47119.2), and the CAG promoter (pCAGGS vector; GenBank: LT727518.1 )
[0142] In some embodiments the first nucleotide sequence comprises a promoter that drives expression in a specific neuronal cell type, e.g. in astrocytes, oligodendrocytes etc. In some embodiments, the first nucleotide sequence comprises a promoter selected from: CaMK2a, neuron-specific enolase promoter, human synapsin-1 promoter, MeCP2 promoter, herpes simplex virus 1 latency associated transcript promoter, GFAP promoter and myelin basic protein (MBP) promoter, as described for example in Castle M. et al. Methods Mol Biol. 2016 ; 1382: 133-149, which is hereby incorporated by reference in its entirety. For example, the 1 .3 kb CaMK2a promoter can drive transgene expression in glutamatergic excitatory neurons with high specificity. Further, the 1 .8 kb neuron-specific enolase promoter, the 470 bp human synapsin-1 promoter, the 229 bp MeCP2 promoter, and the 2 kb herpes simplex virus 1 latency associated transcript promoter can all drive neuron-specific gene expression. The GFAP promoter can drive astrocyte-specific expression, and the myelin basic protein (MBP) promoter can drive oligodendrocyte-specific expression.
[0143] In some embodiments the first nucleotide sequence comprises an inducible promoter, i.e. gene expression is activated by the promoter only in the presence or absence of a particular molecule. Suitable inducible promoters will be known to the skilled person, such as the TRE promoter which can be activated by the rtTA transcriptional activator in a doxycycline-inducible manner (Qin et al., PLoS One. 2010; 5(5): e10611 ). Further examples of inducible promoters are described in e.g. Le at al. Invest Ophthalmol Vis Sci. 2008, 49(3): 1248-1253, and McGee Sanftner et al. Mol Ther. 2001. 3(5): 688-696, both of which are hereby incorporated by reference in their entirety. Inducible expression systems are well known in the art and are reviewed e.g. in Ryding et al. Journal of Endocrinology (2001) 171 , 1 -14, which is hereby incorporated by reference in its entirety.
[0144] Polyadenylation of mRNA transcripts is required for efficient nuclear export and to provide mRNA stability. The polyadenylation (polyA) signal sequence may be any suitable sequence, such as the bovine growth hormone (bGH), human growth hormone (hGH) and SV40 late polyA sequences, all of which are readily available to the skilled person, see e.g. Azzoni et al., J Gene Med. 2007 May;9(5):392-402, which is hereby incorporated by reference in its entirety. The bGH sequence has been used for ocular indications and in therapeutic agents such as voretigene neparvovec (Spark Therapeutics), timrepigene emparvovec (Biogen) and cotoretigene toliparvovec (Biogen).
[0145] A nucleic acid described herein may be, or may be comprised in, a vector or plasmid, e.g. for introduction into a cell, such as a human cell. Thus, the present invention provides a vector or plasmid comprising a nucleic acid / polynucleotide / expression cassette as described herein.
[0146] A ‘vector’ as used herein refers to a nucleic acid used as a vehicle to transfer exogenous nucleic acid into a cell. The vector may be a vector for expression of the nucleic acid in the cell (i.e. the vector may be an expression vector). Such vectors may include a promoter sequence operably linked to the nucleotide sequence encoding the sequence to be expressed. A vector may also include a termination codon and expression enhancers. Any suitable vectors, promoters, enhancers and termination codons known in the art may be used to express a peptide or polypeptide from a vector according to the present disclosure. The vector may be suitable for gene therapy.
[0147] Suitable vectors include plasmids, binary vectors, DNA vectors, mRNA vectors, viral vectors (e.g. gammaretroviral vectors (e.g. murine Leukemia virus (MLV)-derived vectors), lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, vaccinia virus vectors and herpesvirus vectors), transposon-based vectors, and artificial chromosomes (e.g. yeast artificial chromosomes), e.g. as described in Maus et al., Annu Rev Immunol (2014) 32:189-225 or Morgan and Boyerinas, Biomedicines 2016 4, 9, which are both hereby incorporated by reference in their entirety. In preferred embodiments, the vector is an adeno-associated virus vector or a lentiviral vector.
[0148] The vector may be a viral vector, such as a gammaretroviral vector (e.g. murine Leukemia virus (MLV)- derived vector), a lentiviral vector, a retroviral vector, an adenovirus vector, an adeno-associated virus (AAV) vector, a vaccinia virus vector or a herpesvirus vector, e.g. Herpes Simplex Virus vector. In some embodiments, the vector is a lentiviral vector.
[0149] In some embodiments, a vector is selected based on tropism for a cell type / tissue / organ to which it is desired to deliver a nucleic acid encoding a mitochondrial protease that degrades a-synuclein. In some embodiments, a vector is selected based on tropism for a cell type / tissue / organ in which it is desired to express the mitochondrial protease. For example, it may be desired to deliver the nucleic acid / express the mitochondrial protease in a cell type / tissue / organ affected by a disease to be treated / prevented in accordance with the present disclosure (e.g. a cell type / tissue / organ in which the symptoms of the disease manifest).
[0150] In some embodiments it is desired to deliver a nucleic acid to neurons (e.g. brain cells), and vectors having a tropism for such cells / tissue may be employed in such embodiments. In preferred embodiments, the vector is an adeno-associated virus (AAV) vector. Thus, in some embodiments a polynucleotide or expression cassette provided herein comprises inverted terminal repeat (ITR) sequences for use in an AAV vector.
[0151] Adeno-associated virus vectors and their use in vector gene therapy is reviewed e.g. in Wang et al., Nat. Rev. Drug Discov. (2019) 18: 358-378 and Li and Samulski, Nat. Rev. Genet. (2020) 12: 255-272, both of which are hereby incorporated by reference in their entirety. In some embodiments, a vector may be an adeno-associated virus vector described in Wang et al., Nat. Rev. Drug Discov. (2019) 18: 358-378. In some embodiments, a vector may be an adeno-associated virus vector described in Li and Samulski, Nat. Rev. Genet. (2020) 12: 255-272.
[0152] ITRs are 145 nucleotide, palindromic sequences located at the termini of an adenovirus or AAV genome, see e.g. Earley et al., Hum Gene Ther. February 2020; 31 (3-4): 151-162, which is hereby incorporated by reference in its entirety. In wild type AAV, ITRs are important for the regulation and priming of viral DNA replication and contain secondary structures including the Rep binding element (RBE) and a terminal resolution site (TRS), which together constitute the AAV origin of replication. They also facilitate recombination of the viral genome with the cellular genome of the host and are required for packaging / genome encapsidation and vector persistence, see e.g. Maurer and Weitzman, Hum Gene Ther. 2020 May;31 (9-10):499-511 , which is hereby incorporated by reference in its entirety.
[0153] In recombinant AAV (rAAV) vectors, the internal wildtype AAV genes are removed and replaced by an expression cassette of interest, leaving only the ITR sequences.
[0154] In some embodiments, e.g. wherein the polynucleotide comprises ITR sequences, the vector is an adenovirus or adeno-associated virus (AAV) vector. Production of recombinant AAV (rAAV) vectors requires the AAV construct containing the transgene expression cassette to be flanked by two ITRs, e.g. a polynucleotide as described herein, along with a source of the AAV Rep and Cap genes (which express proteins required for replication / packaging of the capsid proteins, respectively). The AAV capsid is composed of three viral proteins (VPs): VP1 , VP2, and VP3. Each capsid serotype exhibits a unique tissue tropism and transduction efficiency. AAV ITRs are also serotype-specific.
[0155] In some embodiments, the AAV vector is selected from AAV serotype 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, AAV-DJ, AAV-DJ / 8, AAV-rh10, AAVrh.39, AAV-retro, AAV-PHP.B, AAV8-PHP.eB, AAV-PHP.S, and AAV-Anc80, or variants, hybrids and / or mutants thereof. Suitable variants / hybrids / mutants are available to the skilled person, such as AAV2.5, AAV Spark100, R100, AAV2.7m8, AAV-LK05 and AAVtYF. Such vectors may be single stranded or self-complementary AAV vectors.
[0156] In some embodiments, the AAV vector exhibits tropism to the central nervous system (CNS) / brain. In some embodiments, the AAV vector is selected from serotype AAV1 , AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV-rh10, e.g. as described in Castle M. et al., Methods Mol Biol. 2016; 1382: 133-149, which is hereby incorporated by reference in its entirety. In some embodiments, the AAV vector is an AAV serotype 2 (AAV2) vector, or a hybrid and / or mutant thereof. In some embodiments, the AAV vector is an AAV serotype 8 (AAV8) vector, or a hybrid and / or mutant thereof.
[0157] AAV vectors can be pseudotyped such that they contain the genome of one AAV variant packaged in the capsid of another. In some embodiments, the AAV vector is AAV2 / 2, AAV2 / 8, AAV2 / 1 , AAV2 / 6, AAV2 / 5, AAV2 / 7, AAV2 / 9 (in which the ITRs of the first serotype are packaged in the capsid of the second), see e.g. Lebherz et al., J Gene Med. 2008 Apr; 10(4): 375-382, which is hereby incorporated by reference in its entirety.
[0158] Recently the development of tyrosine mutant serotypes has greatly enhanced transduction efficiencies of rAAV vectors. In some embodiments, the rAAV vector is rAAV2 / 8 Y733F, rAAV2 / 2 Y444F or sextuple mutant rAAV2 / 2 Y252F, Y272F, Y444F, Y500F, Y704F, Y730F.
[0159] Thus, the present invention provides an AAV vector, e.g. a rAAV, comprising:
[0160] (i) a polynucleotide as described herein, e.g. comprising at least one ITR; and
[0161] (ii) at least one capsid protein.
[0162] In some embodiments the at least one capsid protein is selected from AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAB7, AAV8, AAV9, AAV10, AAV11 , AAV12, AAV-DJ, AAV-DJ / 8, AAV-rh10, AAVrh.39, AAV- retro, AAV-PHP.B, AAV8-PHP.eB, AAV-PHP.S, AAV-Anc80, AAV2.5, AAV Spark100, R100, AAV2.7m8, AAV-LK05 and AAVtYF, or a variant / hybrid / mutant thereof.
[0163] In some embodiments the AAV vector is a pseudotyped AAV vector. In some embodiments the AAV vector is AAV2 / 2, AAV2 / 8, AAV2 / 1 , AAV2 / 6, AAV2 / 5, AAV2 / 7 or AAV2 / 9.
[0164] In some embodiments the AAV vector comprises AAV2 ITRs and at least one AAV2 capsid protein (AAV2 / 2). In some embodiments the AAV vector comprises AAV2 ITRs and at least one AAV8 capsid protein (AAV2 / 8).
[0165] In some embodiments, the vector is a self-complementary adeno-associated virus (scAAV) vector. Self- complementary adeno-associated virus vectors are described e.g. in McCarty, Mol Ther. (2008)
[0166] 16(10):1648-56, which is hereby incorporated by reference in its entirety. Conventional AAV vectors have a single-stranded DNA genome, and depend on the DNA replication machinery of a transduced cell to synthesise the complementary strand, delaying transgene expression. By contrast, scAAV vectors contain complementary sequences that spontaneously anneal upon infection, eliminating the requirement for DNA synthesis in the transduced host cell. Compared to classical, single-stranded AAV vectors, scAAV vectors have been shown to provide accelerated onset of transgene expression, and an increased level of transgene expression. In some embodiments, a vector may be an adeno-associated viral vector of one of the following serotypes: AAV1 , AAV2, AAV2i8, AAV5, AAV6, AAV8, AAV9, AAV9.45, AAV10 or AAVrh74. In some embodiments, the vector is an AAV9 vector.
[0167] In some embodiments, a vector may be a cardiotropic adeno-associated viral vector. In some embodiments, a vector may be an adeno-associated viral vector of one of the following serotypes: AAV1 , AAV8, AAV9, AAV9.45.
[0168] In some embodiments, a vector may be a skeletal muscle tropic adeno-associated viral vector. In some embodiments, a vector may be an adeno-associated viral vector of one of the following serotypes: AAV1 , AAV6, AAV7, AAV8, AAV9, AAV9.45.
[0169] In some embodiments a vector comprises modification to increase binding to and / or transduction of a cell-type of interest (i.e. as compared to the level of binding / transduction by the unmodified vector). In some embodiments modification is to a capsid protein.
[0170] In some embodiments a vector comprises a capsid protein comprising a cell-targeting peptide. In some embodiments the cell-targeting peptide is a cell-targeting peptide described in Buning and Srivastava, Molecular Therapy: Methods & Clinical Development (2019) 12: 248-265, which is hereby incorporated by reference in its entirety, e.g. a cell-targeting peptide shown in Table 1 , 2, 3 or 4 thereof.
[0171] In some embodiments a vector comprises a capsid protein comprising a substitution to one or more tyrosine residues, e.g. one or more surface-exposed tyrosine residues. In some embodiments, one or more tyrosine residues of the capsid protein are substituted with phenylalanine. In some embodiments a vector comprises a capsid protein in which one or more tyrosine residues are substituted with another amino acid as described in lida et al., Biomed Res Int. (2013) 2013: 974819, which is hereby incorporated by reference in its entirety.
[0172] In some embodiments, a vector may be an adeno-associated virus vector described in Buning and Srivastava, supra. In some embodiments, a vector may be an adeno-associated virus vector described in lida et al., supra.
[0173] In some embodiments the nucleic acid / vector comprises one or more sequences for controlling expression of the nucleic acid. Accordingly, in some embodiments the nucleic acid / vector comprises a control element for inducible expression of the nucleic acid. A sequence for controlling expression of the nucleic acid may provide for expression of the nucleic acid by cells of a particular type or tissue. For example, expression may be under the control of a cell type- or tissue-specific promoter.
[0174] In preferred embodiments, the vector is a lentiviral vector. Thus, in some embodiments a polynucleotide / nucleic acid provided herein comprises a lentiviral long terminal repeat (LTR) sequence. Lentiviruses are unique among the retroviruses in being able to infect non-dividing cells; they can deliver a significant amount of genetic information into the DNA of the host cell, so provide one of the most efficient methods of gene delivery. HIV, SIV, and FIV are all examples of lentiviruses. Vectors derived from lentiviruses offer the means to achieve significant levels of gene transfer in vivo, ex vivo or in vitro. Lentiviral vectors have been successfully used to transduce most cell types within the central nervous system (CNS) in vivo, including neurons, astrocytes, adult neuronal stem cells, oligodendrocytes, and astrocytes. A general method for constructing a lentiviral vector for transduction of neuronal cells is described e.g. in Wollebo H. et al. Methods Mol Biol. 2013 ; 1078: 141-146, which is hereby incorporated by reference in its entirety.
[0175] In preferred embodiments, the nucleic acid has a size permitting its delivery as a gene therapy, i.e. in a suitable vector.
[0176] In some embodiments, the nucleic acid encoding a mitochondrial protease that degrades a-synuclein consists of a nucleotide sequence having a size within the packaging limit of a vector for delivering the nucleic acid. In some embodiments, the nucleic acid consists of a nucleotide sequence having a size within the packaging limit of a vector described herein. In some embodiments, the nucleic acid consists of a nucleotide sequence having a size within the packaging limit of an adeno-associated virus (AAV) vector, e.g. an AAV vector described herein. In some embodiments, the nucleic acid consists of a nucleotide sequence having a size within the packaging limit of a scAAV vector. In some embodiments, the nucleotide sequence of the nucleic acid consists of fewer than 6,000 nucleotides, e.g. one of <5,000, <4,500, <4,000, <3,500, <3,000, <2,500, <2,400 or <2,300 nucleotides.
[0177] Diseases / conditions in which a-synuclein is pathologically-implicated
[0178] Aspects and embodiments of the present disclosure relate to the treatment and prevention of diseases and conditions in which a-synuclein is pathologically-implicated. The experimental examples of the present disclosure demonstrate a key role for certain mitochondrial proteases in degrading a-synuclein in the mitochondria, and that increasing proteolysis of a-synuclein by a mitochondrial protease ameliorates pathology in a mouse neuronal model of disease characterised by accumulation of a-synuclein.
[0179] Treatment is achieved through increasing the activity or expression of a mitochondrial protease that degrades a-synuclein, e.g. using the agents described herein.
[0180] In some embodiments, the disease / condition to be treated / prevented in accordance with the present disclosure is a disease / condition in which accumulation of a-synuclein (e.g. in the mitochondria or the cytosol) is pathologically-implicated, e.g. a disease / condition in which accumulation of a-synuclein (e.g. in the mitochondria or cytosol) is positively-associated with the onset, development or progression of the disease / condition, and / or severity of one or more symptoms of the disease / condition. In some embodiments, accumulation of a-synuclein (e.g. in the mitochondria) may be a risk factor for the onset, development or progression of the disease / condition. In some embodiments, the disease / condition to be treated / prevented in accordance with the present disclosure is a disease / condition characterised by an increase in the level of a-synuclein, e.g. in the mitochondria, e.g. as compared to the level observed in the absence of the disease / condition {e.g. in a healthy subject, or in equivalent non-diseased tissue).
[0181] It will be appreciated that the methods and articles of the present disclosure may be used for the treatment / prevention of any disease / condition that would derive therapeutic or prophylactic benefit from a reduction in the level of a-synuclein {e.g. in the mitochondria).
[0182] In some embodiments, the disease / condition to be treated / prevented in accordance with the present disclosure is a disease / condition characterised by the presence of Lewy bodies and / or Lewy neurites. Lewy bodies (LB) are protein aggregates that contain a-synuclein. Lewy neurites are abnormal neurites in diseased neurons, containing granular material and abnormal a-synuclein filaments similar to those found in Lewy bodies.
[0183] In some embodiments, the disease / condition to be treated / prevented in accordance with the present disclosure is a disease / condition characterised by mitochondrial dysfunction. Mitochondrial dysfunction is characterised by loss of mitochondrial DNA (mtDNA), increased oxidative stress caused by reactive oxygen species (ROS), deterioration of metabolic activities and reduced calcium homeostasis, as reviewed in e.g. Chen C. et al. Biology (Basel). (2019) 8(2):38.
[0184] In some embodiments, the disease / condition to be treated / prevented in accordance with the present disclosure is a disease / condition characterised by mitochondrial dysfunction.
[0185] In some embodiments, the disease / condition to be treated / prevented in accordance with the present disclosure is a disease / condition characterised by the presence of Lewy bodies and / or Lewy neurites, and mitochondrial dysfunction. a-synuclein is subjected to a variety of post-translational modifications in various disorders. Among them, phosphorylation at serine 129 is most relevant to the pathogenic process and is commonly used to indicate pathogenic a-synuclein species14. In some embodiments, the disease / condition to be treated / prevented in accordance with the present disclosure is a disease / condition in which phosphorylated a-synuclein at position 129 {i.e. S129-phosphorylated a-synuclein) is pathologically- implicated. In some embodiments, the disease / condition is characterised by an increase in the level of a- S129-phosphorylated a-synuclein, e.g. in the mitochondria, e.g. as compared to the level observed in the absence of the disease / condition {e.g. in a healthy subject, or in equivalent non-diseased tissue).
[0186] Diseases / conditions in which a-synuclein is pathologically-implicated include diseases / conditions associated with mutations to genes encoding a-synuclein. In some embodiments, the disease / condition to be treated / prevented in accordance with the present disclosure is a disease / condition associated with mutation to a gene encoding a-synuclein. In some embodiments, the disease / condition is associated with mutation to SNCA. Mutations to SNCA that are associated with diseases / disorders are known to a skilled person and are described e.g. in Polymeropoulos M. et al. Science. 276, 2045-2047 (1997), and Oliviera M. A. et al. npj Parkinson's Disease, volume 7, Article number: 65 (2021 ), which are hereby incorporated herein by reference in their entirety.
[0187] In some embodiments, the disease / condition to be treated / prevented in accordance with the present disclosure is a neurodegenerative disease / disorder.
[0188] The most common version of the nucleotide sequence of a given gene may be referred to as the wildtype allele of the gene. A version of the nucleotide sequence of a given gene comprising a ‘genetic variant’ or ‘mutation’ relative to the wildtype allele may be referred to as a ‘variant’ or ‘mutant’ allele of the gene. As used herein, a ‘genetic variant’ of, or ‘mutation’ to, a given gene refers to an insertion, deletion, substitution to, or larger-scale translocation / rearrangement of, the nucleotide sequence of the gene, relative to the nucleotide sequence of a reference allele not comprising the genetic variant / mutation {e.g. the ‘non-mutated’ or ‘wildtype’ allele). It will be appreciated that the nucleotide sequence of a variant / mutant allele of a given gene has a nucleotide sequence which is non-identical to the nucleotide sequence of the wildtype allele.
[0189] Where a given disease / condition is described herein as being ‘associated with’ a given genetic variant / mutation or disease / condition, the genetic variant / mutation / disease / condition may be positively- associated with the onset, development or progression of the given disease / condition, and / or severity of one or more symptoms of the given disease / condition. The genetic variant / mutation or disease / condition may be a risk factor for the development or progression of the given disease / condition. In some embodiments, a disease / condition that is associated with a given genetic variant / mutation or disease / condition may be caused or exacerbated by the genetic variant / mutation / disease / condition. Where a given disease / condition is described herein as being ‘caused by’ a given genetic variant / mutation or disease / condition, the genetic variant / mutation / disease / condition may be directly or indirectly implicated in the pathology of the given disease / condition.
[0190] The genetic variant / mutation may result in a change in the level of (gene and / or protein) expression of, and / or a change in the activity of, a gene product {e.g. RNA and / or a polypeptide) encoded by the wildtype allele of the relevant gene. The genetic variant / mutation may result in a reduction in the level of a gene product encoded by the wildtype allele of the relevant gene. The genetic variant / mutation may result in an increase in the level of a polypeptide encoded by a disease-associated allele of the relevant gene. The genetic variant / mutation may result in the production of a truncated version of a polypeptide encoded by the wildtype allele of the relevant gene. The genetic variant / mutation may result in the production of a version of a polypeptide encoded by the wildtype allele of the relevant gene which is misfolded and / or degraded. The genetic variant / mutation may result in the production of a polypeptide having altered activity relative to a polypeptide encoded by the wildtype allele of the relevant gene, e.g. a reduced or increased level of an activity possessed by a polypeptide encoded by the wildtype allele, and / or an acquired activity which is not possessed by a polypeptide encoded by the wildtype allele. Synucleinopathies
[0191] Aspects and embodiments of the present disclosure relate to the treatment and / or prevention of a synucleinopathy. The experimental examples of the present disclosure demonstrate that increase in expression of a mitochondrial protease that degrades a-synuclein ameliorates pathology in a neuronal model of synucleinopathy.
[0192] Herein, ‘synucleinopathy’ or ‘a-synucleinopathy’ refers to pathology affecting the central and / or peripheral nervous system, and is characterised by the cytoplasmic accumulation of a-synuclein primarily in neurons and, in some cases, glial cells. Synucleinopathies are reviewed in Goedert M. et al. J Parkinsons Dis. 2017;7(s1 ):S51 -S69 and Lamotte G. and Singer W. Handbook of Clinical Neurology. Volume 196, 2023, Pages 175-202, the disclosures of which are incorporated herein by reference in their entirety. When these protein deposits occur exclusively in the peripheral autonomic nerves, the disease is termed pure autonomic failure (PAF). Parkinson’s disease (PD), multiple system atrophy (MSA), and dementia with Lewy bodies (DLB) are diseases of both central and peripheral a-synuclein deposition.
[0193] Parkinson’s disease and DLB are characterized by deposition of a-synuclein in Lewy bodies in neurons, whereas MSA features a-synuclein deposition in glial cytoplasmic inclusions (GCIs). The current clinical definition of PAF is based on chronic neurogenic orthostatic hypotension (OH) regardless of biomarkers suggesting a Lewy body or non-Lewy body synucleinopathy (Kaufmann, 1996); however, a few autopsy studies of PAF cases have reported Lewy bodies in sympathetic ganglia and Lewy neurites in distal sympathetic nerves and central structures (Lamotte G. and Singer W. Handbook of Clinical Neurology. Volume 196, 2023, Pages 175-202).
[0194] In some embodiments, the disease in which a-synuclein is pathologically-implicated is a synucleinopathy characterised by the presence of Lewy bodies and / or Lewy neurites. The a-synucleinopathy may be further characterised by mitochondrial dysfunction. a-synucleinopathies broadly include the following disorders: Parkinson’s disease (PD), dementia with Lewy bodies (DLB), the Lewy body variant of Alzheimer’s Disease (LBV), multiple system atrophy (MSA), pure autonomic failure (PAF), REM behavior disorder (RBD), and neurodegeneration with brain iron accumulation (NBIA).
[0195] In some embodiments, the disease in which a-synuclein is pathologically-implicated is selected from Parkinson’s disease (PD), dementia with Lewy bodies (DLB), the Lewy body variant of Alzheimer’s Disease (LBV), multiple system atrophy (MSA), pure autonomic failure (PAF), REM behaviour disorder (RBD), and neurodegeneration with brain iron accumulation (NBIA).
[0196] In some embodiments, the disease in which a-synuclein is pathologically-implicated is dementia with Lewy bodies (DLB). In some embodiments, the disease in which a-synuclein is pathologically-implicated is the Lewy body variant of Alzheimer’s Disease (LBV). In some embodiments, the disease in which a- synuclein is pathologically-implicated is multiple system atrophy (MSA). In some embodiments, the disease in which a-synuclein is pathologically-implicated is pure autonomic failure (PAF). In some embodiments, the disease in which a-synuclein is pathologically-implicated is REM behaviour disorder (RBD). In some embodiments, the disease in which a-synuclein is pathologically-implicated is neurodegeneration with brain iron accumulation (NBIA).
[0197] Parkinson’s Disease
[0198] In some embodiments, the disease in which a-synuclein is pathologically-implicated is Parkinson’s disease (PD).
[0199] A hallmark of PD is the formation of a-Syn-containing neuronal aggregates known as Lewy bodies and Lewy neurites, in an age-dependent manner2. Mitochondrial dysfunction is another hallmark of PD characterized by loss of mitochondrial DNA (mtDNA), increased oxidative stress caused by reactive oxygen species (ROS), deterioration of metabolic activities and reduced calcium homeostasis9. Disruption of the electron transport chain complexes with 1 -63 methyl-4-phenyl-1 ,2,3,6-tetrahydropyridine (MPTP) is sufficient to cause Parkinsonian-like symptoms in mice10. Furthermore, mutations in genes encoding mitochondrial proteins such as Parkin and PINK1 , also cause familial PD11.
[0200] Recent studies suggest that a-Syn interacts with mitochondrial outer membrane import channel proteins TOM20 and TOM4012 13. Another study reported that in an a-Syn preformed fibril (PFF)-treated mouse model of PD, the majority of a pathogenic form of a-Syn (serine 129 phosphorylated a-Syn) binds to mitochondria and alters cellular respiration14. a-Syn has also been reported to interact with the Voltage- Dependent Anion Channel (VDAC) of the mitochondrial outer membrane in HeLa cells15. Another study suggests that the conversion of monomeric a-Syn into toxic oligomeric states preferentially occurs on mitochondrial membranes via interactions with mitochondrial lipid cardiolipin16. Moreover, a-Syn has been detected in the mitochondrial inter membrane space17and been reported to interact with complex I, causing reduced complex I activity and increased production of ROS18 19. Artificial targeting of a-Syn to mitochondria via linkage with a mitochondrial targeting sequencing impaired mitochondrial respiration in human dopaminergic (DA) neurons20.
[0201] However, it has been unclear whether the import of a-Syn into mitochondria is a spontaneous process or occurs only under pathogenic conditions.
[0202] In the present Examples, the inventors study a-synuclein in mitochondria using a split-GFP system (spGFP)27, which allows a-Syn to be specifically visualised once it enters the mitochondrial matrix in vivo. This is in contrast to using lengthy biochemical fractionation during which the non-native mitochondrial protein could be degraded. This system was implemented in yeast and cultured mammalian cells, as well as in mice by tagging the endogenous SNCA gene with a part of the spGFP. The experimental data described herein demonstrate that a-Syn can be constitutively imported into mitochondria in these diverse models. The mitochondrial pool of a-Syn forms puncta, which can be efficiently degraded by specific mitochondrial proteases. Mitochondria-associated / localised a-Syn interacts with proteins comprising diverse pathways and leads to mitochondrial defects similar to those reported for PD neurons. The Examples demonstrate that enhancing mitochondrial degradation of a-Syn rescues the observed cellular defects and represents a novel therapeutic approach to alleviating mitochondrial and cellular toxicity caused by a-Syn.
[0203] In accordance with various aspects of the present disclosure, a method of treating or preventing a disease in which a-synuclein is pathologically-implicated comprises one or more of the following: Reducing the level of a-synuclein (e.g. in neurons, e.g. dopaminergic neurons);
[0204] Reducing the level of a-synuclein in the mitochondria (e.g. in neurons, e.g. dopaminergic neurons); Reducing accumulation of a-synuclein in the mitochondria (e.g. in neurons, e.g. dopaminergic neurons); Reducing the level of mitochondrial fragmentation (e.g. in neurons, e.g. dopaminergic neurons);
[0205] Increasing the level of mitochondrial volume (e.g. in neurons, e.g. dopaminergic neurons);
[0206] Reducing the level of aggregation of a-synuclein (e.g. in neurons, e.g. dopaminergic neurons); Reducing the formation or presence of Lewy bodies and / or Lewy neurites (e.g. in neurons, e.g. dopaminergic neurons); and
[0207] Reducing mitochondrial dysfunction (e.g. in neurons, e.g. dopaminergic neurons).
[0208] The present disclosure further provides methods for reducing the level of a-synuclein (e.g. in neurons, e.g. dopaminergic neurons), reducing the level of a-synuclein in the mitochondria (e.g. in neurons, e.g. dopaminergic neurons), reducing accumulation of a-synuclein in the mitochondria (e.g. in neurons, e.g. dopaminergic neurons), reducing the level of mitochondrial fragmentation (e.g. in neurons, e.g. dopaminergic neurons), increasing the level of mitochondrial volume (e.g. in neurons, e.g. dopaminergic neurons), reducing the level of aggregation of a-synuclein (e.g. in neurons, e.g. dopaminergic neurons), reducing the formation or presence of Lewy bodies and / or Lewy neurites (e.g. in neurons, e.g. dopaminergic neurons), or reducing mitochondrial dysfunction (e.g. in neurons, e.g. dopaminergic neurons), the methods comprising administering to a subject an agent that that increases the expression or activity of a mitochondrial protease that degrades a-synuclein.
[0209] Compositions
[0210] An agent that increases the expression or activity of a mitochondrial protease that degrades a-synuclein according to the present disclosure may be provided in the form of a composition comprising the agent. Such compositions may comprise the relevant article (i.e. the agent, e.g. compound, nucleic acid etc.) in a formulation suitable for clinical use.
[0211] The compositions may comprise one or more pharmaceutically-acceptable carriers (e.g. liposomes, micelles, microspheres, nanoparticles), diluents / excipients (e.g. starch, cellulose, a cellulose derivative, a polyol, dextrose, maltodextrin, magnesium stearate), adjuvants, fillers, buffers, preservatives (e.g. vitamin A, vitamin E, vitamin C, retinyl palmitate, selenium, cysteine, methionine, citric acid, sodium citrate, methyl paraben, propyl paraben), anti-oxidants (e.g. vitamin A, vitamin E, vitamin C, retinyl palmitate, selenium), lubricants (e.g. magnesium stearate, talc, silica, stearic acid, vegetable stearin), binders (e.g. sucrose, lactose, starch, cellulose, gelatin, polyethylene glycol (PEG), polyvinylpyrrolidone (PVP), xylitol, sorbitol, mannitol), stabilisers, solubilisers, surfactants (e.g., wetting agents), masking agents or colouring agents (e.g. titanium oxide). The term ‘pharmaceutical ly-acceptable’ as used herein pertains to compounds, ingredients, materials, compositions, dosage forms, salts, etc., which are within the scope of sound medical judgment, suitable for use in contact with the tissues of the subject in question {e.g. a human subject) without excessive toxicity, irritation, allergic response, or other problem or complication, and commensurate with a reasonable benef it / risk ratio. Each carrier, diluent, excipient, adjuvant, filler, buffer, preservative, antioxidant, lubricant, binder, stabiliser, solubiliser, surfactant, masking agent, colouring agent, flavouring agent or sweetening agent of a composition according to the present disclosure must also be ‘acceptable’ in the sense of being compatible with the other ingredients of the formulation. Suitable carriers, diluents, excipients, adjuvants, fillers, buffers, preservatives, anti-oxidants, lubricants, binders, stabilisers, solubilisers, surfactants, masking agents, colouring agents, flavouring agents or sweetening agents can be found in standard pharmaceutical texts, for example, Remington’s ‘The Science and Practice of Pharmacy’ (Ed. A. Adejare), 23rd Edition (2020), Academic Press.
[0212] The articles of the present disclosure may be formulated for administration to a subject, e.g. via a route of administration as appropriate for the nature of the therapeutic agent and the disease to be treated / prevented. Administration of the articles of the present disclosure may be parenteral, systemic, topical, intracavitary, intravascular, intravenous, intra-arterial, intramuscular, intrathecal, intraocular, intraconjunctival, intratumoral, subcutaneous, intradermal, oral or transdermal. In some embodiments, administration may be by injection or infusion, or by ingestion.
[0213] In some aspects and embodiments, articles of the present disclosure may be administered to a tissue / organ of interest {e.g. a tissue / organ affected by the disease / condition {e.g. a tissue / organ in which symptoms of the disease / condition manifest)). In some aspects and embodiments, articles of the present disclosure may be administered to the blood {i.e. intravenous / intra-arterial administration) by injection or infusion {e.g. via cannula), or may be administered subcutaneously or orally. The particular mode and / or site of administration may be selected in accordance with the location at which the therapeutic / prophylactic effect is required, e.g. cardiac muscle cells / tissue.
[0214] The pharmaceutical compositions / medicaments may comprise the agent / nucleic acid / vector according to the disclosure in a sterile or isotonic medium. The pharmaceutical compositions / medicaments may be provided in fluid, including gel, form. Fluid formulations may be formulated for administration by injection or infusion {e.g. via cannula) to a blood vessel, or a selected region of the human or animal body. The pharmaceutical compositions / medicaments may be provided in solid form, e.g. in lyophilised form.
[0215] Agents {e.g. compounds, nucleic acids, vectors etc.) and compositions according to the present disclosure may be modified and / or formulated to facilitate delivery to, and / or uptake by, a cell / tissue of interest {e.g. cardiac muscle cells / tissue). Strategies for targeted delivery of such species are reviewed e.g. in Li et al., Int. J. Mol. Sci. (2015) 16: 19518-19536 and Fu et al., Bioconjug Chem. (2014) 25(9): 1602-1608, which are hereby incorporated by reference in their entirety.
[0216] In some embodiments, articles of the present disclosure may be encapsulated in a nanoparticle or a liposome. In some embodiments, articles of the present disclosure may be (covalently or non-covalently) associated with a cell-penetrating peptide {e.g. a protein transduction domain, trojan peptide, arginine-rich peptide, vectocell peptide), a cationic polymer, a cationic lipid or a viral carrier.
[0217] Nanoparticles may be organic, e.g. micelles, liposomes, proteins, solid-lipid particles, solid polymer particles, dendrimers, and polymer therapeutics. Nanoparticles may be inorganic, e.g. such as nanotubes or metal particles, optionally with organic molecules added. In some embodiments, a nanoparticle is a nanoparticle described in Chen et al., Mol Ther Methods Clin Dev. (2016) 3:16023, which is hereby incorporated by reference in its entirety. In some embodiments, a nanoparticle is a PLGA, polypeptide, poly(p-amino ester), DOPE, p-cyclodextrin-containing polycation, linear PEI, PAMAM dendrimer, branched PEI, chitosan or polyphosphoester nanoparticle.
[0218] In some embodiments, agents {e.g. compounds, nucleic acids, vectors etc.) according to the present disclosure comprise modification to incorporate one or more moieties facilitating delivery to, and / or uptake by, a cell type or tissue of interest {e.g. cardiac and / or skeletal muscle cells / tissue). In some embodiments, agents {e.g. compounds, nucleic acids, vectors etc.) according to the present disclosure are linked {e.g. chemically conjugated to) one or more moieties facilitating delivery to, and / or uptake by, a cell type or tissue of interest.
[0219] Moieties facilitating delivery to, and / or uptake by, cell types or tissues of interest are described e.g. in Benizri et al., Bioconjug Chem. (2019) 30(2): 366-383, which is hereby incorporated by reference in its entirety. Such moieties include e.g. N-acetylgalactosamine (GalNAc), a-tocopherol, cell-penetrating peptides, nucleic acid aptamers, antibodies and antigen-binding fragments / derivatives thereof, cholesterol, squalene, polyethylene glycol (PEG), fatty acids {e.g. palmitic acid) and nucleolipid moieties.
[0220] Articles of the present disclosure may be formulated in a sustained release delivery system, in order to release the agent, nucleic acid, vector, or composition of the present disclosure at a predetermined rate. Sustained release delivery systems may maintain a constant drug / therapeutic / prophylactic concentration for a specified period of time. In some embodiments, articles of the present disclosure are formulated in a liposome, gel, implant, device, or drug-polymer conjugate e.g. hydrogel.
[0221] Administration of an agent described herein to a subject in accordance with the present disclosure is preferably in a ‘therapeutically-effective’ or ‘prophylactically-effective’ amount, this being sufficient to show therapeutic / prophylactic benefit to the subject.
[0222] The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of the disease to be treated / prevented, and the nature of the therapeutic agent {i.e. an agent described herein). Prescription of treatment, e.g. decisions on dosage etc., is within the responsibility of general practitioners and other medical doctors, and typically takes account of the disease / condition to be treated, the condition of the individual subject, the site of delivery, the method of administration and other factors known to practitioners. Examples of the techniques and protocols mentioned above can be found in Remington’s ‘The Science and Practice of Pharmacy’ (Ed. A. Adejare), 23rd Edition (2020), Academic Press. In preferred embodiments, administration is of a nucleic acid / vector, or of a composition comprising a nucleic acid / vector according to the present disclosure. In preferred embodiments, administration results in modification of a cell or cells to comprise / express a nucleic acid / vector, and / or to comprise / express a polypeptide according to the present disclosure. That is, the nucleic acid / vector / composition is employed as a gene therapy.
[0223] In some embodiments, therapeutic or prophylactic intervention according to the present disclosure may further comprise administering another agent for the treatment / prevention of the relevant disease / condition. Administration of agents / nucleic acids / vectors / compositions described herein may be alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated. Simultaneous administration refers to administration with another therapeutic agent together, for example as a pharmaceutical composition containing both agents (combined preparation), or immediately after each other and optionally via the same route of administration {e.g. to the same tissue, artery, vein or other blood vessel). Sequential administration refers to administration of one agent followed by separate administration of another agent after a given time interval. It is not required that the two agents are administered by the same route, although this is the case in some embodiments. The time interval may be any time interval.
[0224] Multiple doses of the agent / nucleic acid / vector / composition may be provided. One or more, or each, of the doses may be accompanied by simultaneous or sequential administration of another therapeutic / prophylactic agent. Multiple doses may be separated by a predetermined time interval, which may be selected to be one of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, or 31 days, or 1 , 2, 3, 4, 5, or 6 months. By way of example, doses may be given once every 7, 14, 21 or 28 days (plus or minus 3, 2, or 1 days).
[0225] Subjects
[0226] A subject in accordance with the various aspects of the present disclosure may be any animal or human. Therapeutic and prophylactic applications may be in humans or animals (veterinary use).
[0227] The subject to be administered with an article of the present disclosure {e.g. in accordance with therapeutic or prophylactic intervention) may be a subject in need of such intervention. The subject is preferably mammalian, more preferably human. The subject may be a non-human mammal, but is more preferably human. The subject may be male or female. The subject may be a patient.
[0228] A subject may have {e.g. may have been diagnosed with) a disease or condition described herein {e.g. a synucleinopathy, a disease / condition characterised by the presence of Lewy bodies and / or Lewy neurites etc.), may be suspected of having such a disease / condition, or may be at risk of developing / contracting such a disease / condition. In embodiments according to the present disclosure, a subject may be selected for treatment according to the methods based on characterisation of one or more markers of such a disease / condition, e.g. as described hereinabove. A subject may be suspected of having or suffering from a disease / condition described herein based on the presence of other symptoms indicative of the disease / condition in the subject or in a cell / tissue / organ of the subject. A subject may be considered at risk of developing the disease / condition because of genetic predisposition or other risk factors for the disease.
[0229] In some embodiments, a subject comprises a mutation according to any embodiment described herein. In some embodiments, the subject comprises a mutation giving rise to a disease / condition described herein.
[0230] In some embodiments, methods according to the present disclosure may comprise determining whether a subject has a disease / condition described herein. In some embodiments the methods comprise diagnosing a disease / condition described herein. Determining whether a subject has a disease / condition described herein may comprise analysing a subject for one or more symptoms / correlates of the disease / condition. Genetic factors may be assayed by methods known to those of ordinary skill in the art, including PCR based and sequencing assays. By determining the presence of genetic factors, e.g. in a sample obtained from a subject, a diagnosis may be confirmed, and / or a subject may be classified as being at risk of developing a disease / condition described herein, and / or a subject may be identified as being suitable for treatment with an agent / nucleic acid / vector / composition described herein.
[0231] Assays may be performed in vitro on a sample obtained from a subject, or following processing of a sample obtained from a subject. The sample obtained from a subject may be of any kind. A biological sample may be taken from any tissue or bodily fluid, e.g. a blood sample, blood-derived sample, serum sample, lymph sample, semen sample, saliva sample, synovial fluid sample. A blood-derived sample may be a selected fraction of a patient’s blood, e.g. a selected cell-containing fraction or a plasma or serum fraction. A sample may comprise a tissue sample or biopsy; or cells isolated from a subject.
[0232] Sequence identity
[0233] As used herein, ‘sequence identity’ refers to the percent of nucleotides / amino acid residues in a subject sequence that are identical to nucleotides / amino acid residues in a reference sequence, after aligning the sequences and, if necessary, introducing gaps, to achieve the maximum percent sequence identity between the sequences. Pairwise and multiple sequence alignment for the purposes of determining percent identity between two or more amino acid or nucleic acid sequences can be achieved in various ways known to a person of skill in the art, for instance, using publicly available computer software such as ClustalOmega (Sbding, J. 2005, Bioinformatics 21 , 951 -960), T-coffee (Notredame et al. 2000, J. Mol. Biol. (2000) 302, 205-217), Kalign (Lassmann and Sonnhammer 2005, BMC Bioinformatics, 6(298)) and MAFFT (Katoh and Standley 2013, Molecular Biology and Evolution, 30(4) 772-780) software. When using such software, the default parameters, e.g. for gap penalty and extension penalty, are preferably used.
[0234] Sequences ***
[0235] The present disclosure includes the combination of the aspects and preferred features described except where such a combination is clearly impermissible or expressly avoided.
[0236] The section headings used herein are for organisational purposes only and are not to be construed as limiting the subject matter described.
[0237] Aspects and embodiments of the present disclosure will now be illustrated, by way of example, with reference to the accompanying figures. Further aspects and embodiments will be apparent to those skilled in the art. All documents mentioned in this text are incorporated herein by reference.
[0238] Throughout this specification, including the claims which follow, unless the context requires otherwise, the word ‘comprise,’ and variations such as ‘comprises’ and ‘comprising’, will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
[0239] It must be noted that, as used in the specification and the appended claims, the singular forms ‘a’, ‘an’, and ‘the’ include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from ‘about’ one particular value, and / or to ‘about’ another particular value. When such a range is expressed, the embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent ‘about,’ it will be understood that the particular value forms another embodiment.
[0240] Methods described herein may preferably be performed in vitro. The term ‘in vitro’ is intended to encompass procedures performed with cells in culture whereas the term ‘in vivo’ is intended to encompass procedures with / on intact multi-cellular organisms.
[0241] Brief Description of the Figures
[0242] Embodiments and experiments illustrating the principles of the present disclosure will now be discussed with reference to the accompanying figures.
[0243] Figures 1a to 11. a-Syn is imported into mitochondria in yeast and human cells. (1a) Schematic illustration of a-Syn spGFP system in yeast. The mitochondrial outer membrane was labeled with mCherry-tagged Fis1 transmembrane domain; the GFPi-iowas targeted to the mitochondrial matrix by tagging endogenous Grx5; and the eleventh p-strand of GFP (GFPn) was introduced to the COOH terminus of a-Syn. (1b) Representative confocal images of log-phase live yeast cells labeled with the mCherry-FisITM and Grx5-GFPi-io. Endogenous Mdh1 (top), Gpm1 (middle) and a GAP promoter driven human a-Syn (bottom) were tagged with GFPn. Cell outlines were circled with dashed lines. Scale bars, 5pm. (1c) Airyscan super resolution imaging of a-Syn spGFP cells as described in (1 b). Arrowheads point to a-Syn spGFP puncta inside mitochondria. Scale bars, 1 pm. The right panel shows the 3D- reconstructed image. (1d) Representative images of the protease protection assay using mitochondria purified from a-Syn spGFP cells as described in (1 b) and (1c). Purified mitochondria were treated with protease K and indicated detergents for 35 min. Arrowheads point to a-Syn spGFP puncta inside mitochondria. Scale bars, 5 pm. (1e) Immunoblots of purified mitochondria treated with or without detergents and proteases, as indicated. Pro. K, protease K. TX-100, triton X-100. (1f) Schematic illustration of a-Syn spGFP system in Human retinal pigment epithelial-1 (RPE-1 ) cells. The mitochondrial targeting sequence (ATP synthase Subunit 9, Su9) targeted mCherry linked with GFP1-10 (MTS-mCherry- GFP1-10) to the mitochondrial matrix and human a-Syn was tagged with GFP11 (a-Syn-GFPn). (1g) Representative confocal images of RPE1 cells transfected with a-Syn spGFP systems. Scale bars, 5pm. (1 h) Schematic illustration of three structural domains of a-Syn. (1 i) Quantification of the mean intensity of spGFP signal in a-Syn truncations spGFP strains. Shown are Means ± SEM of each cell from 3 biological repeats. Unpaired two-tailed t-test between a-Syn full-length (Fl) and truncations. (1j) Confocal live cell imaging of cells expressing Cherry-FisI TM, Grx5-GFPi-io, and truncated forms of a-Syn as indicated linking with GFP11. Cell outlines were circled with dashed line. Scale bars, 5pm. (1k) Confocal imaging of live RPE1 cells expressing the a-Syn spGFP system with indicated a-Syn truncations. Scale bars, 5pm. (11) Quantification of the percentage of a-Syn spGFP positive cells by flow cytometry. Shown are Means ± SEM from 3 biological repeats. Unpaired two-tailed t-test between a-Syn full-length (Fl) and truncations as indicated in the figure.
[0244] Figures 2a to 21. a-Syn import into mitochondria is age-dependent in transgenic a-Syn spGFP mouse. (2a) Schematic illustration of a-Syn spGFP transgenic mouse and comparison of relative ages between mice and humans. The 3' terminus of the endogenous SNCA ORF was tagged with GFP11 and the mitochondrial matrix-targeted mCherry-GFPi-10 (MTS-mCherry-GFPi-10) under CAG promoter was inserted into the Rosa26 locus, both via CRISPR-Cas9 genome editing. (2b) Airyscan super resolution confocal images of mid-brain sections of 5-month-old a-Syn spGFP transgenic mouse stained with TH marker. Arrowheads point to a-Syn spGFP signal inside mitochondria. (2c) Representative confocal images of mid-brain sections of 2-, 5-, 1 1 - and 21 -month-old a-Syn spGFP mice. Arrowheads point to a- Syn spGFP inside mitochondria in TH-positive cells. (2d) Quantification of the mean intensity of a-Syn spGFP signal in TH-positive cells. ****p <0.0001 ; one-way ANOVA followed by Tukey's multiple comparison test. Unpaired two-tailed t-test between each age from 3 biological repeats. (2e) Representative confocal images of brain sections of 1 1 - and 21 -month-old a-Syn spGFP transgenic mice stained with I BA1 . Arrowheads point to a-Syn spGFP puncta inside mitochondria in IBA1 -positive cells. (2f) Quantification of the mean intensity of a-Syn spGFP signal in IBA1 -positive microglia. Shown are Means ± SEM of spGFP intensity from 3 biological repeats. **P = 0.0029; NS, non-significant; one-way ANOVA followed by Tukey's multiple comparison test. Unpaired two-tailed t-test between ages. (2g) Representative confocal images of brain sections of 5-, 1 1 - and 28-month-old a-Syn spGFP transgenic mice stained with IBA1 and P62. Arrowheads point to zoomed in regions where a-Syn spGFP puncta containing mitochondria colocalized with P62 in microglia. Scale bars, 10 pm. (2h) Representative confocal images of mouse brain slices containing TH-negative cells of 2-, 5-, 1 1 - and 21 -months old, comparing with Fig. 2b and 2c. Scale bars, 10 pm. (2i) Quantification of the mean intensity of a-Syn spGFP signal in TH-negative cells. ****p < 0.0001 ; NS, non-significant; one-way ANOVA followed by Tukey's multiple comparison test, (n = 3-4 brain sections). (2j) Representative confocal images of 1 1 - month-old mouse brain containing GFAP-positive astrocytes and TH-positive neurons. Scale bars, 10 pm. (2k) Representative confocal images of 1 1 -month-old mouse brain slice stained with TQM20 antibody and DAPI. Scale bars, 10 pm. (21) Representative confocal images of 1 1 -month-old mouse brain containing MAP2-positive neurons. Scale bars, 10 pm.
[0245] Figures 3a to 31. a-Syn causes mitochondrial dysfunction. (3a) Confocal images of live yeast cells expressing a-Syn spGFP and mScarlet Il-tagged Ndi 1 or Atp5. Cell outlines are circled with a dashed line. (3b) Confocal images of cell lysates in a buffer containing 1 % Triton X-100 showing that a-Syn is stably associated with Ndi1 and Atp5 in aggregates (arrowheads). (3c) Confocal images of mitochondrial membrane potential staining using TMRM. a-Syn was linked with GFPn and the mitochondrial matrix protein Grx5 was tagged with GFP1-10. Arrowhead points to an a-Syn spGFP punctum inside mitochondria without TMRM signal. Cell outlines are circled with a dashed line. (3d) Mitochondrial membrane potential was detected with TMRM and measured by FACS. Each data point represents the mean TMRM intensity from a biological repeat. Shown are Means ± SEM from 3-4 biological repeats with unpaired two-tailed t- test. (3e) Confocal images of Mito View 405 dye staining in live RPE1 cells expressing the a-Syn spGFP system. Arrowheads point to a-Syn spGFP puncta inside mitochondria with diminished MitoView 405 signal, which is a blue-fluorescent mitochondrial membrane potential dye in live cells. (3f) The percentage of respiratory-deficient cells (petites) in a-Syn spGFP cells normalized to cells expressing MTS-mCherry only, measured by the TTC staining in yeast. Shown are Means ± SEM from 3 biological repeats with unpaired two-tailed t-test. (3g) DAPI staining for white or pink colonies picked from TTC staining. DAPI stains both nuclear and mitochondrial DNA. Arrowheads point to mtDNA. Cell outlines were circled with white line. (3h) Time-lapse images showing that acute induction of a-Syn caused mitochondrial fragmentation in yeast. Total mitochondria were labeled with mCherry-FisI TM; a-Syn was tagged with GFP11 and mitochondrial matrix protein Grx5 was tagged with GFP1-10. Cell outlines were circled with a white line. (3i) Quantification of total mitochondrial volume per cell change over time of images of (3h). Shown are Means ± SEM of mitochondrial volume (n = 28). (3j) Growth curves of cells expressing a-Syn under GAP promoter (pGap-Syn), Gal promoter with the GEM system (pGal-Syn) or both (pGal-pGap- Syn). p-estradiol was used to induce expression of a-Syn in the GEM system. ODeoo was recorded every 30 minutes at 30°C. Shown are Means ± SEM from 3 biological repeats. Scale bars, 5pm. (3k) Confocal images of brain sections of 1 1 -month-old a-Syn spGFP transgenic mice stained with ATP5O antibody. Scale bars, 10 pm. (31) Quantification of the mean MitoView 405 dye intensities in RPE1 cells expressed MTS-mCherry-GFPi-10 without (left) or with a-Syn GFPn (right). Shown are Means ± SEM from 3-4 biological repeats with unpaired two-tailed t-test. Each data point represents mean dye intensity per biological repeat.
[0246] Figures 4a to 4j. a-Syn imported into mitochondria is degraded by specific proteases. (4a) Time lapse images of log-phase a-Syn spGFP system expressing cells with or without CCCP added at TO. The interval time is 5 min. Arrowheads point to a-Syn spGFP puncta inside mitochondria. Scale bars, 5 pm. (4b) Quantification of the mean a-Syn spGFP intensity in (4a). Shown are Means ± SEM of a-Syn spGFP intensity in mitochondria from 3 biological repeats. ***P < 0.001 ; two-way ANOVA test. (4c) Quantification of the mean Grx5 spGFP intensity in time lapse images of log-phase Grx5 spGFP expressing cells with CCCP added at TO. The interval time is 5 min. Shown are Means ± SEM of Grx5 spGFP intensity in mitochondria from 3 biological repeats. (4d) Representative confocal images of cells expressing the a- Syn spGFP system that were introduced with additional copies of genes encoding individual mitochondrial proteases (CYM1, IMP2, ATP23, PRD1 and LAP3) via the MoBY plasmid. Scale bars, 5pm. (4e) Representative confocal images of cells expressing the a-Syn spGFP system that were introduced with additional copies of individual mitochondrial proteases (as indicated in the figure) via the MoBY plasmid. Scale bars, 5pm. (4f) Representative confocal images of cells expressing the Grx5 spGFP system that were introduced additional copies of individual mitochondrial proteases (as indicated in the figure) via the MoBY plasmid. Scale bars, 5pm. (4g) Representative confocal images of cells expressing the a-Syn spGFP with deletion of ATP23, CYM1 or PRD1. Scale bar, 5pm. (4h) Quantification of the a-Syn spGFP intensities in (4d). Shown are Means ± SEM from 3 biological repeats. ****p <0.0001 ; one-way ANOVA followed by Tukey's multiple comparison test. (4i) Quantification of a-Syn levels in cells expressing the indicated mitochondrial proteases via the MoBY plasmid by immunoblots. Pgk1 was used as the loading control. (4j) Representative immunoblots of a-Syn spGFP after introduction of additional copies of individual mitochondrial proteases via the MoBY plasmid.
[0247] Figures 5a to 5i. Enhancing a-Syn degradation in mitochondria reduces a-Syn toxicity in yeast and human cells. (5a) Representative confocal images of yeast cells expressing the GEM inducible a-Syn spGFP system that were introduced additional gene copies of individual mitochondrial proteases via MoBY plasmids. (5b) Ratio of growth rates (with estradiol / no estradiol) for cells expressing a-Syn under both the GAP promoter and the estradiol-GEM inducing promoter (pGAP-a-Syn; pGal-a-Syn) having extra gene copies of the indicated protease. Shown are Means ± SEM from 3 biological repeats. Unpaired two-tailed t-test between control and MoBY strains. (5c) Representative confocal images of mitochondrial membrane potential measured by TMRM staining for cells as in (5b). (5d) Quantification of mean TMRM intensity in strains with extra gene copies of the indicated protease. Shown are Means ± SEM (n > 20 cells) with unpaired two-tailed t-test. (5e) Representative confocal images of stable RPE1 cells expressing a-Syn spGFP with or without NLN overexpression (“OE NLN”). (5f) Quantification of mitochondrial volume in a-Syn spGFP stable cells with or without overexpression of NLN. Shown are Means ± SEM (n > 20 cells) with unpaired two-tailed t-test from 3 biological repeats. (5g) Quantification of the mean a-Syn spGFP intensity in stable RPE1 cell lines expressing dox-inducible a-Syn-GFPn with or without NLN overexpression. Shown are Means ± SEM with unpaired two-tailed t-test from 3 biological repeats (n > 20 cells). (5h) Schematic illustration of the stable RPE1 cell line expressing a-Syn-GFPi-10 under TRE promotor and MTS-mCherry-GFPi-10 under EF-1 a promotor, with or without expression of NLN by lentivirus transduction. (5i) Immunoblots of WT and overexpression of NLN (“OE Nln”) in a-Syn spGFP system in RPE1 cells.
[0248] Figures 6a and 6b. Enhancing a-Syn degradation by neurolysin in mitochondria reduces a-Syn toxicity in a model of synucleinopathy. (6a) Representative confocal images of primary neurons from a-Syn spGFP mouse with or without NLN overexpression for 7 days post a-Syn PFF treatment. Arrowheads point to a- Syn spGFP puncta inside mitochondria under PFF treatment (in the first row) or zoomed in regions with overexpression of NLN (in the second row). Scale bars, 5 pm. (6b) Quantification of the mean intensity of a-Syn spGFP signal in (6a). Shown are Means ± SEM of spGFP intensity from 3-5 biological repeats with unpaired two-tailed t-test. Figure 7a and 7b. (7a) Quantification of NLN expression during aging in different brain regions from GTEx RNA-seq database. Shown are expression levels of NLN across GTEx brain tissues for each individual at the time of sample donation (represented as age in x-axis). Expression levels are normalized after regressing out known and hidden covariates described in a previous paper48. (7b) Comparison of transcriptional differences of mitochondrial proteases in DA neurons derived from healthy control and PD patients. T value is derived from generalized linear model estimated using BPSC58.
[0249] Figure 8. Representative confocal images of yeast cells expressing the a-Syn spGFP system (mCherry- FisITM; Grx5-GFPi-io; a-Syn-GFPn ; Apdr5) that were treated with DMSO (control) or the neurolysin enhancer molecule AB-2-5-4, which is described in WO 2020 / 047185 A1 . The compound AB-2-5-4 was dissolved in DMSO and used to treat cells at a final concentration of 225 pM for 22 hours. Scale bars, 5 pm.
[0250] Examples
[0251] Example 1 : Materials and Methods
[0252] 1 .1 Yeast strains, plasmids, and culture media
[0253] Yeast strains of the BY4741 background (MATa his3A1 leu2A0 met15A0 ura3A0) were used in this study. Gene deletion and tagging (HA, mcherry, GFPn and GFP) in this study were performed with PCR- mediated homologous recombination50or picked from the Yeast KO Collection51, and verified by PCR genotyping. Both GFPn and MTS-mCherry-GFPi-10 plasmids of yeast and mammalian systems were from our previous study28. GFPi-iowas in frame with the mitochondria targeting sequence (MTS) and mCherry in MTS-mCherry-GFPi-ioconstruct or used for tagging of the endogenous Grx5. The MoBY library36was purchased from Dharmacon Reagents (Catalog ID: YSC5432). The mSC-ll library was a gift from Michael Knop lab32. Cells were grown in YPD for biochemistry and growth assays, in synthetic complete (SC) medium for imaging. The respective media contained either 2% glucose (YPD, SC complete) or 2% galactose (YPGal, SC-Glucose + Gal). ODeoo was used to estimate the amount of yeast cells used in various experiments.
[0254] 1.2 Animals
[0255] Parental mice C57BL / 6J for making the a-Syn spGFP transgenic mice were obtained from the Jackson Laboratories (strain #000664). All mice housing, breeding, and experiment procedures were performed according to the guidelines of Laboratory Animal Manual of the National Institute of Health Guide to the Care and use of Experimental Animals and were approved by Johns Hopkins University Animal Care and Use Committee. Mice were housed in a 12h I ig ht / dark cycle with free access to food and water. Randomized mixed-gender groups were used for animal experiments.
[0256] The a-Syn spGFP transgenic mice were generated and characterized in this study, using homology- directed repair based, CRISPR-Cas9-induced precise gene editing as described below. CAG promoter driven MTS (Su9)-mCherry-GFPi-iosequence was inserted into the safe harbor Rosa26 locus using plasmids containing the construct flanked by ROSA26 homologous sequence (1083 bp upstream / 4341 bp downstream overlap). They were microinjected together with CRISPR Cas9 protein and crRNA (CGCCCATCTTCTAGAAAGAC) into one-cell embryos of C57BL / 6J mice (strain #000664 from the Jackson Laboratory) by the Transgenic Core Laboratory in Johns Hopkins University, resulting in the MTS-mCherry-GFPi-io mice. PCR genotyping was performed with primer pairs forward TTCCCTCGTGATCTGCAACTC and reverse CTTTAAGCCTGCCCAGAAGACT for WT Rosa26 forward GTGGGAGCGGGTAATGAACTTT and reverse TCCTGCAATGATGAATCTTGAGTGA for MTS-mCherry- GFP1-10 knock in. The correct insertion generated a band size of 69 bp. GFPn targeted COOH terminus of the endogenous SNCA gene was created by using crRNA (CCGGCAGATCTTAGGAGATT), Cas9 and DNA template (GAAGGCTACCAAGACTATGAGCCTGAAGCCGGGGGATCCGGTCGACCCGGAGGCGGTTCTAGAGA TCATATGGTTTTGCATGAATATGTTAATGCTGCTGGTATTACT), resulting the a-Syn GFPn mice. PCR genotyping was performed with primer pairs forward CCTGATATTAGGAAGGCTACCAAGACT and reverse CGCCTCCGGGTCGA for GFPn knock-in; forward CCTGATATTAGGAAGGCTACCAAGACT and reverse GCACTTGTACGCCATGGAAGA for WT SNCA. Injections were performed by the Transgenic Core Laboratory in Johns Hopkins University. Crossing a-Syn GFPn and MTS-mCherry- GFPi-io mice resulted in the a-Syn spGFP mice. Homozygous a-Syn spGFP mice were PCR genotyped and used in this study.
[0257] 1 .3 Antibodies
[0258] HA-tag (C29F4): mAb #3724, Cell Signaling Technology. Anti-Tom70 antibody, anti-Dld1 antibody and anti-Abf2 antibody were kindly provided by S. Claypool's laboratory (Johns Hopkins University). Antimouse IgG, HRP-linked Antibody, Cell Signaling Technology, Cat# 7076. mCherry antibody: PA5-34974, Invitrogen. GAPDH (D16H11 ) XP® Rabbit antibody: CS#51745, Cell Signaling. PGK1 Monoclonal Antibody (22C5D8): #459250, Invitrogen. Ms mAb to NLN, ab119802, abeam. Map2 Alexa Fluor 647 conjugated anti-MAP2, #801806, BioLegend. Iba1 / AIF-1 (E4O4W) XP Rabbit mAb, #17198S, Cell Signaling Technology. Rabbit anti-Tyrosine Hydroxylase pAb, NB300-109, NOVUS. Rb mAb to Alpha- Synuclein phosphor S129, ab51253, abeam. Purified Mouse Anti-alpha Synuclein, #610787, BD Biosciences. Purified anti-GFAP, #801103, BioLegend. Purified anti-p62(SQSTM1 ), #814802, BioLegend. Goat pAb to Ms IgG (Alexa Fluor 405), ab175660, abeam. Goat pAb to Rb IgG (Alexa Fluor 647), ab150079, abeam. Goat pAb to Rb IgG (Alexa Fluor 405), ab175652, abeam. ATP5O Polyclonal antibody, 10994-1 -AP, Proteintech. GFP11 -tag antibody, #48545, Signalway Antibody.
[0259] 1 .4 Confocal microscopy and quantification
[0260] Live-cell images were acquired using a Yokagawa CSU-10 spinning disc on the side port of a Carl Zeiss 200M inverted microscope. Laser 488 / 561 nm excitation was applied to excite GFP / mCherry, respectively, and the emission was collected through the appropriate filters onto a Hamamatsu C9100-13 EMCCD on the spinning disc confocal system. For multi-track acquisition, the configuration of alternating excitation was applied to avoid the bleed-through of GFP. The spinning disc was equipped with a 100x1 .45 NA Plan-Apochromat objective and a 63x1 .4 oil Plan-Apochromat objective, respectively. For 3D imaging, 0.5 pm step size for 5-6 pm in total in Z for yeast cells; 1 pm step size was applied for human cells. Images were acquired using MetaMorph (version 7.0; MDS Analytical Technologies) on CSU-10 spinning disc system. Zeiss LSM880-Airyscan FAST Super-Resolution microscopy equipped with 63x / 1 .4 PlanApo oil was used for yeast, human cells, and mouse brain sections. The super-resolution images were generated by Airyscan processing.
[0261] Live yeast cells imaging: yeast cells were cultured in SC medium overnight at 30 °C. Then they were refreshed in SC medium for at least 3 hours at 30 °C to an ODeoo around 0.1 -0.25. For 3D time-lapse imaging, cells were laid on a SC-complete agarose gel pad or cultured in a MatTek (P35G-0-14-C) glass bottom dish that were treated with Concanavalin A (MP Biomedicals, Cat# IC150710.2). Each z series was acquired with a 0.5 pm step size. For GEM inducible systems, 1 M of p-estradiol (E2758-1 G, Sigma) was added to SC-complete medium upon induction. The image processing was performed using the Image J software (NIH) or the Imaris software. For visualization purposes, some of the images in the figures were scaled with bilinear interpolation and shown as max projection on Z for fluorescent channels.
[0262] Quantification of spGFP fluorescence was done using a custom python code that was published in a previous study28. In brief, after reading the mCherry and GFP channel z stacks, the intensities were summed along the z-axis. The resulting 2D image in the GFP channel was then subject to random walk segmentation to segment out the yeast cells from background and watershed segmentation to separate adjacent cells. The segmentation algorithms were taken from the scikit image library. After segmentation, the median GFP and mCherry intensities in each cell were calculated. For each cell, the mCherry channel was thresholded at 5% of maximal value in order to detect mitochondria, and median GFP intensity within mitochondria was calculated. This median GFP intensity and the mCherry intensity were used in the following analyses. Characterization of mitochondrial volume per piece was derived from voxel volume of segmented mitochondria.
[0263] 1 .5 Mitochondrial isolation and protease protection assay
[0264] Mitochondrial purification was based on a known protocol52. In brief, yeast cells expressing a-Syn-HA spGFP were cultured in YPD to an ODeoo of about 0.3-0.4. Cells were collected by centrifugation and treated with Tris-DTT buffer (0.1 M Tris, 10 mM DTT, adjusted pH to 9.4). After washing with SP buffer (1 .2 M sorbital, 20 mM KPi, pH 7.4), cells were treated with 0.5 mg / ml zymolasel 00T (US Biological) at 30 °C for 40 min. Spheroplasts were then washed with SEH buffer (0.6 M sorbital, 20 mM HEPES-KOH pH 7.4, 2 mM MgClz, 1 mM EGTA pH 8.0, protease cocktail (P2714, Sigma), 10 gM benzamidine-HCI (B6506), 1 pg / ml 1 ,10-phenanthroline (P9375), PMSF 1 mM was added before use) and broken with a Dounce homogenizer. The homogenate was centrifuged at 1 ,500g (low speed) for 5 min at 4 °C. Supernatant was collected and centrifuged at 12,000g (high speed) for 10 min at 4 °C. The pellet containing mitochondria was used for protease protection assays.
[0265] Purified mitochondria were washed three times with import buffer without ATP (3% w / v fatty acid-free BSA, 250 mM sucrose, 80 mM KCI, 5 mM MgClz, 2 mM KH2PO4, 10 mM MOPS-KOH, pH7.2) to remove the protease inhibitor. Then the mitochondria were spun down at 4 °C, 13,000 rpm for 10 min.
[0266] Mitochondria were resuspended and the same amount was added to four different 1 .5-ml tubes. Group 1 was used as untreated total mitochondria. Group 2 was treated with protease K for 35 min at room temperature to assess protection by the mitochondrial outer membrane. Group 3 was treated with digitonin to permeabilize the outer membrane and Group 4 was treated with both digitonin and Triton- X100 to permeabilize the inner membrane. Then, Groups 3 and 4 underwent the same protease treatment as Group 2. The volume difference was equalized with SEH buffer. Immediately after the treatment, all the samples were either taken for imaging or treated with PMSF and boiled for 15 min in SDS sample buffer for immunoblotting analysis.
[0267] 1 .6 Mammalian cell culture, transfection, and imaging
[0268] Human RPE1 (ATCC CRL4000, authenticated by ATCC based on Ep-16 antigen as determined by flow cytometry using the Ep-16 monoclonal antibody and cytokeratins as determined by immunocytochemistry using a pan-cytokeratin antibody) cells were cultured in Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM / F12) (GIBCO), supplemented with 10% (v / v) fetal bovine serum (FBS), 100 lU / ml penicillin and maintained at 37°C with 5% CO2 in a humidified incubator. Transient transfections were performed with Lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions. RPE1 cells were double transfected with MTS-mCherry-GFPi-io and a-Syn tagged with GFP11. After 24 h or 48h of transfection, samples were collected for flow cytometry analysis or confocal imaging.
[0269] 1 .7 Lentiviral vector construction, production and transduction
[0270] The a-Syn spGFP expression lentiviral vectors were generated by cloning the a-Syn-GFPn into pTRE- Bsd vector and MTS-mCherry-GFPi-10 into the pEF1 a-Neo vector, respectively. The pSFFV-NLN-Puro plasmid was synthesized by Twist Bioscience. The lentiviral vectors were transfected into HEK293FT cells together with packaging vectors psPAX2 and pMD2.G (1 :1 .5:1 .5) to generate the lentiviruses. The viral supernatants were collected at 48 and 72 hours after transfection and concentrated by ultracentrifugation for 2 hours at 50,000g. Viral particles were resuspended into serum free medium and stored at -80 °C. RPE1 cells were infected with inducible a-Syn spGFP expression lentiviral vectors with or without NLN overexpression and mouse primary neurons were infected by lentivirus carrying NLN at DIV 6.
[0271] 1 .8 Mouse primary neuronal culture and a-Syn PFF transduction
[0272] Primary cortical and midbrain neurons were prepared from E18 pups of a-Syn spGFP transgenic mice and cultured in Neurobasal media supplemented with B-27, 0.5 mM L-glutamine, penicillin and streptomycin (Invitrogen, Grand Island, NY, USA) on cell culture plates or coverslips coated with poly-L- lysine (50 pg / ml, Sigma, #P1024-100MG). The neurons were maintained by changing the medium every 3-4 days. Mouse a-Syn PFF (final concentration 5 pg / mL) and PBS control were added at 7 days in vitro (DIV) and incubated for 10-21 days, followed by imaging or biochemical experiments for toxicity assays. Overexpression of NLN by lentivirus transduction was performed one day prior to a-Syn PFF and PBS treatment.
[0273] 1.9 Immunofluorescence analysis
[0274] RPE1 cells were cultured on fibronectin (5 pg / cm2, Sigma F2006)-coated glass bottom dishes (MatTek). Mouse primary neurons were cultured on poly-L-lysine (50 pg / ml) coated glass bottom dishes or coverslips. Fixation was performed using 4% paraformaldehyde (PFA) at 30°C for 15 min, followed by 3 times phosphate-buffered saline (PBS) washing. Cells were blocked with goat serum 10% in blocking buffer (1x PBS buffer, 0.3% Triton X-100 and 10% goat serum) at room temperature for 1 hour. Primary antibody incubation was performed at 4°C overnight. After washing with 3 times with PBS, cells were incubated with fluorescent secondary antibodies for 1 hour at room temperature in the dark. After 3 times washing with PBS, cells were mounted with Prolong glass antifade mountant (P36980, Invitrogen) for imaging.
[0275] 1.10 Immunohistochemistry and quantitative analysis
[0276] Mice were transcardiac perfused with ice-cold PBS followed by fixation with 4% paraformaldehyde / PBS (pH 7.4) as described previously with some modifications53. Brains and Gl tract (duodenum, jejunum, ileum, appendix, colon and rectum) were collected and postfixed for 24 h in 4% paraformaldehyde and cryoprotected in 30% sucrose / PBS (pH 7.4) solution for 1 -2 weeks in 4°C. All samples were frozen in OCT buffer and 20 mm serial coronal sections were cut with a microtome (MICROM HM550). The cryosections were mounted on Superfrost Plus slides. For immunohistochemistry, the cryosections were surrounded by ImmEdge pen circle and blocked with 10% goat serum / PBS plus 0.3% Triton X-100. They were then incubated with primary antibodies, followed by incubation with goat anti-rabbit IgG Alexa fluor 647 / 405 antibody or goat anti-mouse IgG Alexa fluor 405 antibodies (abeam). Sections were mounted with Prolong glass antifade mountant (P36980, Invitrogen) and cover slide sealed with nail polish for imaging. The images were taken by Zeiss LSM880 microscope and analysed with Imaged and Imaris software.
[0277] 1.11 Tissue lysate preparation
[0278] Tissue lysates were prepared as described previously54. Sequential lysis buffers were prepared for detergent-soluble and detergent-insoluble fractions. Different regions of brain tissues (cortex / middle brain / cerebellum) were homogenized in the lysis buffer [150 mM NaCI, 10 mM Tris-HCI, pH 7.4, 5 mM EDTA, phosphatase inhibitor cocktail II and III (Sigma-Aldrich), 1% Triton X-100, and complete protease inhibitor mixture (Sigma-Aldrich)], then they were centrifuged, and soluble supernatant was collected. The insoluble pellet was washed once in brain lysis buffer containing 0.1% Triton X-100 detergent, and the resulting pellet was lysed with lysis buffer containing 0.5% sodium deoxycholate and 2% SDS. The resulting supernatant (Triton X-100 detergent-insoluble) was collected after centrifuge. Then total lysates were prepared by homogenization of different tissue in RIPA buffer [150 mM NaCI, 50 mM Tris, pH 8.0, 1% Nonidet P-40, 0.5% sodium-deoxycholate, 1% SDS, phosphatase inhibitor cocktail II and III (Sigma- Aldrich), and complete protease inhibitor mixture (Sigma-Aldrich)]. After homogenization, samples were rotated at 4°C for 30 min for complete lysis. Then the homogenate was centrifuged at 22,000 x g for 20 min and the supernatants collected. Protein levels were quantified using the Pierce BCA protein assay Kit (Thermo 23225) with BSA standards and analysed by immunoblot.
[0279] 1.12 Cell lysate preparation
[0280] For RPE1 cells: Cells were washed with PBS and scraped and collected for centrifuge at 2000 rpm for 5 min at RT. The cell pellet was resuspended in lysis buffer which includes PIPA buffer supplemented with 0.1% SDS and Protease- Phosphatase inhibitor cocktail. Then the lysate was incubated on ice for 15 min, followed by sonication using a QSONICA digital sonicator set as 70 amplitudes, pulse on / off 30 seconds each cycle for 5 min in total at 4°C. Then the lysate was incubated on ice for an additional 15 minutes. The lysate was centrifuged at 13000 x g for 5 min at 4° and the supernatant was collected. Protein levels were quantified using the Pierce BCA protein assay Kit (Thermo 23225) with BSA standards and analysed by immunoblot.
[0281] For mouse primary neurons: Cells were washed with PBS to remove debris. Cells were scraped in PBS and collected for centrifuge at 2000 rpm for 5 min at RT. The cell pellet was resuspended in lysis buffer (1% Triton X-100 and Protease / Phosphatase inhibitor in PBS) and vortexed briefly. Then it was freeze- thawed on chilled water and dry ice three times with 15 seconds vortex after each thaw. The samples were centrifuged at 14000 rpm for 30 min at 4°C. The supernatants were collected for Triton X-100- soluble fraction. The cell pellet was resuspended in SDS cell lysis buffer (2%SDS, 1% Triton X-100 and Protease-Phosphatase inhibitor in PBS) and pipetted several times to dissolve the pellet. Then it was freeze-thawed on chilled water and dry ice three times with 15 seconds vortex after each thaw. The samples were centrifuged at 14000 rpm for 30 min at 4°C. The supernatants were collected for SDS- soluble fraction. Protein levels were quantified using the Pierce BCA protein assay Kit (Thermo 23225) with BSA standards and analysed by immunoblot.
[0282] For yeast cells: cells were centrifuged at 21000 g for 2 min at 4°C and the supernatants were removed. Cells were washed with 1 ml ddH2O and centrifuged again at 21000g for 2min at 4°C. Then the supernatant was removed and 100 pl 1 x LDS sample buffer with 40 mM DTT was added to resuspend the cells. The cells were incubated at 100°C for 10 min and vortexed with 100 pl glass beads for 1 min, followed by another 5 min incubation at 100°C. The cells were centrifuged at 21000 g for 2 min at room temperature and the supernatant was collected for immunoblot.
[0283] 1.13 Immunoblot analysis
[0284] Electrophoresis on 4%-12% or 4%-20% gradient SDS-PAGE gel was performed with proteins from mouse brain tissues, primary neurons, RPE1 cells and yeast cells, as described above. The proteins were then transferred to PVDF membranes using iBlot2 (Thermo Fisher Scientific). The membranes were blocked with blocking solution (Odyssey blocking TBS buffer was used for fluorescent-dye conjugated secondary antibodies and Tris-buffered saline with 5% BSA and 0.1% Tween-20 was used for HRP- conjugated secondary antibodies) for 1 h and incubated with primary antibody at 4°C overnight. The bands were visualized using Clarity Western ECL substrate (Bio-Rad) or fluorescent-dye conjugated secondary antibodies. Data were acquired using LI-COR imaging systems (LI-COR Biosciences) and analysed with Image Studio (LI-COR Biosciences).
[0285] 1.14 Drug treatment
[0286] Cycloheximide (C4859, Sigma) was added to a final concentration of 100 pg / ml. CCCP (C2759, Sigma) was dissolved in DMSO or ethanol to make a 20 mM stock solution, and 25 pM of the stock solution was used to treat cells. MG132 (c2211 , Sigma) was dissolved in DMSO and 80 pM was used to treat yeast cells.
[0287] 1.15 Membrane potential measurements
[0288] Tetramethylrhodamine methyl ester (TMRM) (Sigma-Aldrich, Cat# T5428-25MG) staining was performed for cells without mCherry labels. Cells were incubated with 2.5 pM TMRM at 30°C for 10 min and washed three times before recording. Mammalian cells were incubated with 100 nM MitoViewTM 405 dye (Biotium, Cat# 70070-T) at 37°C for 15 min and directly for imaging without washing.
[0289] 1.16 TTC staining assay
[0290] TTC staining assays were performed using the agar medium overlay method34. Yeast strains were growing on normal selected plates and cultured at 30°C for 48 h, then the melted soft agar (1 .5%) containing 1 mg / ml TTC was gently poured onto the colonies and incubated at room temperature for 2 h. The TTC staining activity was judged by the color of the colonies, as white compound can be enzymatically changed to red in normal respiratory-competent cells but not in respiratory-deficient cells. The plates were documented by a document scanner and analysed by Imaged software.
[0291] 1.17 Yeast cells fixation and DAPI staining
[0292] Yeast cells were cultured in SC medium overnight at 30 °C. Then they were refreshed in SC medium for at least 3 hours at 30°C to an ODeoo around 0.1 -0.25. The cells were spun down before the medium was removed and 4% paraformaldehyde was added, and then incubated at room temperature for 15 min. The cells were then washed once with KPO sorbitol and resuspend in KPO sorbitol containing 0.2 pg / ml DAPI until imaging by a Nikon Ti-E inverted fluorescence microscope.
[0293] 1.18 Detergent resistance assay
[0294] Log phase yeast cells cultured in YPD were collected by centrifugation (5000 g, 6 min) and then washed once with ddH2O, followed by 10 mM DTT treatment for 5 min (pH 9.3) at 30°C. The cells were then washed with sorbitol buffer (pH 7.5, 1 .2 M sorbitol) followed by 8 min digestion with 1 mg / ml Zymolyase 100T in Zymolyase buffer. The cells then were washed twice with SEH buffer (0.6 M sorbitol, 20 mM HEPES-KOH pH 7.4, 2 mM MgCL, protease cocktail (sigma), PMSF 1 mM was added before use) to remove the Zymolyase and were lysed with a dounce homogenizer. The homogenate was centrifuged at 1 ,500 g for 5 min at 4 °C, and then the supernatant was collected and centrifuged at 12,000 g for 10 min at 4 °C. The pellet was resuspended and imaged to ensure the mitochondria were intact. Then 1 % T riton X-100 was added and incubated on ice for 10 min before confocal imaging. The mitochondrial membranes were removed by detergent extraction, which was confirmed by imaging.
[0295] 1.19 Yeast g rowth assays
[0296] For recording yeast growth, cells of the indicated genotypes were cultured in corresponding media. Overnight cultures were refreshed for 4 hours at 30°C and the OD600 of the cells was measured and adjusted to 0.04 in 200 pL and added to a 96-well plate. The wells along the plate's perimeter were filled with 200 pL medium without sample to avoid evaporation and the plate was sealed with parafilm. The optical density (OD) at 600 nm was continuously monitored at 30°C using a Tecan Infinite M200 Pro every 30 min. The data were extracted and analysed using Magellan 7 software and the R package GroFit55.
[0297] 1 .20 Flow cytometry
[0298] Cells (yeast or mammalian) were analysed on the Attune NxT flow cytometer (Thermo Fisher Scientific) equipped with appropriate filter sets. Appropriate gating was applied for single cell populations. Gating for fluorescent report was based on negative controls. Statistical analysis was performed with Graphpad Prism software.
[0299] 1 .21 RNA-seg analysis
[0300] Single-cell RNA-seq data from iPSC derived DA neurons were obtained from EMBL-EBI Biostudies (Accession # E-MTAB-7303). Raw counts were log normalized with top variable genes according to published protocols56. To remove potential technical confounders, we applied f-scLVM and regressed out hidden factors57. Beta-Poisson model was used to estimate differential expression between PD and normal cells58. Bulk RNA-seq from GTEx V8 brain analysis tissues were obtained from the GTEx portal (https: / / gtexportal.org / home / datasets). After log normalization, we regressed out covariates similar to the GTEx consortium pipeline including PEER factors, genotype principal components, donor sex, and sequencing batch to obtain normalized expression levels.
[0301] 1 .22 Quantification and statistical analysis
[0302] Statistical analysis was performed with Prism 5 (GraphPad Software, La Jolla, USA) and p values < 0.05 were considered significant.
[0303] Example 2: a-Syn is imported into mitochondria in yeast and cultured human cells
[0304] The budding yeast Saccharomyces cerevisiae has been a useful model for understanding how a-Syn may perturb basic cellular functions that could be extended to human cells21-24. These studies demonstrated that a-Syn interferes with a broad range of membrane-based processes to exert its toxicity, such as lipid metabolism, vesicular trafficking, Ca2+ and Mn2+ transport, protein quality control and mitochondrial functions25’26.
[0305] In the present Examples, the inventors study a-Syn in mitochondria using a split-GFP system (spGFP)27, which allows a-Syn to be specifically visualized once it is enters the mitochondrial matrix in vivo. This is in contrast to lengthy biochemical fractionation during which the non-native mitochondrial protein could be degraded. This system was implemented in yeast and cultured mammalian cells, as well as in mice by tagging the endogenous SNCA gene with a part of the spGFP.
[0306] 2.1 Confocal imaging of accumulation of a-Syn in mitochondria in yeast cells
[0307] To visualize the entry of a-Syn into the mitochondrial matrix, the spGFP system27’28was employed, in which the eleventh p-strand of GFP (GFPn) was introduced to the COOH terminus of human a-Syn (a- Syn-GFPn). In yeast, the other part of GFP containing the first 10 p-strands (GFP1-10) was targeted to the mitochondrial matrix by linking to the COOH terminus of a mitochondrial matrix protein Grx528. The mitochondrial outer membrane was labeled with Fis1 transmembrane domain tagged with mCherry29. a- Syn-GFPn was expressed in yeast using the constitutive GAP promoter, which allows cells to grow in the normal glucose-containing medium. The entry of a-Syn into the mitochondrial matrix enables reconstitution of GFP fluorescence thus allowing the visualisation of imported a-Syn (Figure 1 a).
[0308] Confocal live cell imaging showed that a-Syn spGFP fluorescence colocalized with mitochondria (Figure 1 b). As positive and negative controls in the Grx5-GFPi-io background, the GFPn-tagged mitochondrial matrix protein Mdh1 or cytosolic protein Gpm1 showed strong or no GFP signal, respectively, in mitochondria (Figure 1 b). The expression levels of a-Syn and Gpm1 were comparable. Super resolution microscopy further showed that a-Syn formed puncta within mitochondria (Figure 1 c), and these puncta colocalized with the mitochondrial matrix disagregase Hsp78, suggesting that a-Syn aggregates in mitochondria.
[0309] 2.2 Protease protection assay further confirms accumulation of a-Syn in mitochondria in yeast cells To biochemically confirm the presence of a-Syn in the mitochondrial matrix, the inventors purified mitochondria from the yeast strain above and performed a protease protection assay (Figures 1 d and 1 e). Digitonin and Triton X-100 were used to permeabilize the mitochondrial outer membrane and inner membrane, respectively, and protease K treatment was used to degrade a-Syn that was not protected by membranes. Immunoblot analysis showed the presence of a-Syn in both the mitochondrial intermembrane space and the mitochondrial matrix (Figures 1 d and 1 e).
[0310] 2.3 Accumulation of a-Syn in mitochondria in human RPE1 cells
[0311] The inventors also applied the a-Syn spGFP system to human RPE1 cells by expressing a-Syn tagged with GFP11 and mitochondrial matrix-targeted mCherry-GFPi-io (MTS-mCherry-GFPi-io)30and found that a-Syn was present in the mitochondria of RPE1 cells by imaging. Localization in the mitochondria occurred in 26.8% of transfected cells, as determined by flow cytometry analysis (Figures 1 f, 1 g and 1 1).
[0312] 2.4 Localisation of a-Syn fragments in mitochondria
[0313] To determine which domain of a-Syn was essential for accumulation inside mitochondria, each of the three a-Syn structural domains (N-terminal lipid binding, NAC domain and C-terminal unstructured domain) were tagged with GFPn and co-expressed with Grx5-GFPi-io in yeast (Figures 1 h, 1 i and 1j).
[0314] Both the N-terminal and C-terminal domains on their own, but not the central NAC domain, were imported into mitochondria constitutively (Figures 1 i and 1j). Fragments containing the N-terminal domain plus the NAC domain, or the NAC domain plus the C-terminal domain, were also imported into mitochondria (Figure 1 i), suggesting that either N-terminal or C-terminal is sufficient for the protein to be imported into mitochondria.
[0315] The inventors further tested if the above mechanisms found in yeast were conserved in humans. The N- terminal domain, but not the NAC or C-terminal domain, was imported into mitochondria in RPE1 cells, although the N-terminal domain was imported less efficiently than full-length a-Syn (Figures 1 k and 1 1). However, because the protein expression level of the C-terminal domain was exceedingly low compared with full-length a-Syn, which could be caused by instability of the C-terminal domain, the inventors believe that the lack of spGFP signal in mitochondria may not reflect an import defect (Figures 1 k and 11).
[0316] Example 3: a-Syn accumulates in mitochondria of dopaminergic neurons and microglia in mouse brains in an age-dependent manner
[0317] The inventors further examined whether the endogenous a-Syn is imported into mitochondria of mammals in vivo. A transgenic mouse model was generated in which the COOH terminus of the endogenous SNCA gene was tagged with GFPn , and MTS-mCherry-GFPi-10 under a CAG promoter, and was ubiquitously expressed by inserting it into the Rosa26 locus, both via CRISPR-Cas9-mediated genome editing (Figure 2a). This mouse model allows visualization of mitochondrial import of a-Syn in different tissues and cell types during mouse aging (Figure 2a). MTS-mCherry-GFPi-iofluorescence emitted by mCherry also colocalized with a mitochondrial protein TOM20 by immunofluorescence in mouse brain slices (Figure 2k).
[0318] The inventors detected a-Syn accumulation in the mitochondria of mouse brain in 5-month-old mice by confocal imaging of spGFP fluorescence in tissue slices (Figure 2b). The mitochondria-associated a-Syn spGFP signal was enriched in the midbrain and was present in cells that stained positive for tyrosine hydrolase (Th), a marker specific for dopaminergic neurons (Figure 2b).
[0319] Interestingly, the accumulation of a-Syn in mitochondria in Th+ neurons correlated with age: the spGFP signal was low in 2- and 5-month-old animals, but increased dramatically in 1 1 - and 21 -month-old mouse brains (Figures 2c and 2d). Furthermore, in brains of older animals, a-Syn spGFP was frequently observed in Th- cells (Figures 2c, 2h and 2i). Using different cell type markers, the inventors observed that a-Syn accumulated in mitochondria of microglia marked by I BA1 (Ionized calcium binding adaptor molecule 1 ), but not in cells stained with astrocyte maker GFAP (Figures 2e, 2f, 2j and 2I). In microglia, some of the large puncta containing a-Syn spGFP and MTS-mCherry co-localized with p62, an autophagosome marker, in 1 1 - and 28-, but not 5-month-old brains (Figure 2g), indicating that mitophagy of the a-Syn-containing mitochondria was increased in aged cells.
[0320] Example 4: a-Syn interacts with functional complexes in mitochondria and causes mitochondrial dysfunction a-Syn has been reported to impair mitochondrial functions through its interactions with components of the electron transport chain18. The interaction of a-Syn with complex I has been reported to reduce complex I activity and increase ROS production.
[0321] To verify the interaction of a-Syn with the oxidative phosphorylation machineries, the inventors expressed the a-Syn spGFP system in strains that express mScarlet-l labeled NDI1 , a NADH-ubiquinone oxidoreductase31, or ATP532, a component of Complex V, separately (Figure 3a).
[0322] After disrupting the outer and inner membranes of purified mitochondria with 1 % Triton-X100-containing lysis buffer, Atp5 and Ndi 1 remained associated with a-Syn puncta (Figure 3b). Consistently, the mouse orthologue of ATP5, Atp5o, also co-localized with a-Syn puncta in 1 1 -month-old mouse brains (Figure 3k).
[0323] Since the electron transport chain is important for producing the proton gradient across the mitochondrial inner membrane, the inventors measured mitochondrial membrane potential (A1) with Tetramethylrhodamine (TMRM) staining33. Mitochondria with a-Syn accumulation showed a marked decline in T (Figures 3c and 3d).
[0324] Similarly, a-Syn overexpression also reduced mitochondrial membrane potential in RPE1 cells by staining with MitoView405, which is used for monitoring changes in mitochondrial membrane potential in live cells (Figures 3e and 3I).
[0325] The inventors also measured the frequencies of respiratory-deficient cells (petites), which indicate the loss of mtDNA using 2,3,5-triphenyltetrazolium chloride (TTC) staining34in yeast expressing a-Syn. DAPI staining confirmed the loss of mtDNA in TTC negative cells. The data demonstrate that a-Syn accumulation in the mitochondria of yeast cells resulted in an increased loss of mtDNA (Figures 3f and 3g).
[0326] Furthermore, inducible expression of a-Syn and its subsequent accumulation in mitochondria caused mitochondrial fragmentation in both yeast cells and RPE1 cells (Figures 3h, 3i and 5f). Although a-Syn under the constitutive GAP promoter in yeast cells did not significantly affect cell growth, acute high-level expression from a second copy of a-Syn with a P-estradiol-inducible GEM system35significantly impaired cell growth (Figure 3j , pGal-pGap-Syn).
[0327] These data together show that high levels of a-Syn accumulated in mitochondria cause mitochondrial dysfunction and cellular fitness decline.
[0328] Example 5: Imported a-Syn is degraded by specific proteases in mitochondria
[0329] The inventors next used time lapse imaging to track the fate of a-Syn spGFP in mitochondria over time. When a-Syn was under constitutive expression, the spGFP signal in mitochondria was maintained at a steady level throughout the course of the observation (Figures 4a and 4b).
[0330] When treating these cells with CCCP, which blocks import of a-Syn by eliminating the mitochondrial membrane potential, the a-Syn spGFP signal in mitochondria decreased with a half-life of 6.9 min (Figures 4a and 4b). The spGFP signal of the matrix protein Grx5 did not change with treatment of CCCP (Figure 4c), suggesting that a-Syn which had already been imported in mitochondria was rapidly degraded in mitochondria upon CCCP inhibition.
[0331] The inventors proceeded to identify mitochondrial proteases responsible for the degradation of a-Syn.
[0332] The copy number of mitochondrial proteases was moderately increased using centromeric plasmids from the molecular barcoded yeast (MoBY) library, in which each gene is controlled by its native promoter and terminator36. Increased copy number of several mitochondrial proteases significantly reduced the steadystate level of a-Syn-spGFP, but not Grx5-spGFP, in mitochondria (Figures 4d, 4e, 4f , 4h, 4i and 4j).
[0333] Plasmids expressing Cym1 and Prd1 had the strongest effect on reducing a-Syn spGFP accumulation in mitochondria, whereas deletion of CYM1 or PRD1 significantly increased the accumulation of a-Syn in mitochondria (Figures 4i and 4g, respectively). On the other hand, overexpression of Pim1 , a Lon protease involved in aggregate dissolution after heat shock28, or Nma1 1 1 / Ynm3, a serine protease whose human orthologue HtrA2 has genetic association with Parkinson’s Disease37, did not affect a-Syn accumulation in mitochondria (Figures 4i and 4e). An earlier study, however, describes that inhibition of mitochondrial proteases, such as HtrA2 and Lon protease, significantly aggravates a-Syn seeding, as well as amyloid-p 1 -42 (Ap 42) aggregation in human neuroblastoma cells (SH-SY5Y)47.
[0334] The data collectively demonstrate that a-Syn imported in mitochondria is degraded by certain mitochondrial proteases, including PRD1 , CYM1 , IMP2, YME1 , PCP1 , MAPI , YTA12 and ATP23.
[0335] Example 6: Enhancement of specific mitochondrial proteolytic activity reduces a-Syn toxicity
[0336] To determine whether elevating the level of mitochondrial proteases that can degrade a-Syn would reduce the cellular toxicity and mitochondrial defects caused by a-Syn expression, the inventors moderately increased the gene copy number using the MoBY system.
[0337] 6.1 In yeast cells
[0338] Cym1 , Prd1 , Imp2 or Atp23 mitochondrial proteases showed the highest inhibitory effects on a-Syn accumulation in mitochondria (Figures 4d and 4h) and rescued growth defects caused by the induced high-level expression of a-Syn (Figures 5a and 5b). Moreover, increasing copy numbers of Cym1 , Prd1 , Imp2 or Atp23 proteases also restored mitochondrial membrane potential in a-Syn-expressing cells (Figures 5c and 5d).
[0339] 6.2 In human cells
[0340] The inventors next examined whether increasing the levels of neurolysin (NLN), which is a Prd1 orthologue, could rescue mitochondrial defects in human cells. RPE1 cell lines expressing dox-inducible a-Syn spGFP system with or without stable ectopic expression of NLN (Prd1 orthologue) under the SFFV promoter were generated (Figure 5h). Overexpression of NLN in RPE1 cells was confirmed by immunostaining and immunoblotting of NLN (Figures 5e and 5i). Overexpression of NLN significantly reduced a-Syn accumulation in mitochondria and mitochondrial fragmentation caused by the induced high-level expression of a-Syn (Figures 5e, 5f and 5g).
[0341] 6.3 In a neuronal model of synucleinopathy
[0342] To further test whether overexpression of NLN could rescue Parkinson’s Disease pathologies in a neuronal model of synucleinopathy, the inventors applied preformed fibrils of mouse a-Syn (a-Syn PFF)38to primary neurons from the a-Syn spGFP transgenic mouse. PFF seeds the recruitment of endogenous a-Syn into pSer129-a-Syn-positive aggregates that recapitulate features of the Lewy bodies and Lewy neurites in PD39. Phosphorylated Serine 129 (pSer129)-a-Syn is the pathogenic form of a-Syn.
[0343] Primary cortical neurons from a-Syn spGFP mice were isolated and treated with a-Syn PFF for 14 days starting at 7 days in vitro (DIV7). Overexpression of NLN decreases a-Syn accumulation in mitochondria and decreases pSerl 29-a-Syn aggregates in PFF-treated primary neurons, compared to the control (Figures 6a and 6b).
[0344] Collectively, these results demonstrate that enhancing the expression levels of NLN rescues defects caused by synucleinopathy in yeast, human cells, and mouse primary neurons.
[0345] Example 7: RNA-seq analysis of expression of NLN and other proteases during aging in DA neurons derived from healthy control and PD patients.
[0346] By analysing the GTEx RNA-seq database48and a published single cell RNA-seq dataset49, the inventors found that the transcript level of Neurolysin is increased in the substantia nigra, where DA neurons are enriched during normal human aging (Figure 7a). The transcript level of Neurolysin is markedly reduced in DA neurons derived from induced pluripotent stem cell (iPSC) carrying the GBA-N370S risk variant for Parkinson’s Disease49compared to the healthy control (Figure 7b). In fact, Neurolysin is the most affected protease, as evidenced by the lowest T value in Figure 7b. Therefore, the reduced expression of Neurolysin in DA neurons may explain the DA neuron-specific toxicity of a-synucleinopathies and mitochondrial dysfunction in PD.
[0347] Example 8: Allosteric enhancer of neurolysin activity increases degradation of c-Syn in vitro The inventors further investigated the effect of an allosteric enhancer of neurolysin activity (compound AB-2-5-4 described in WO 2020 / 047185 A1 ) on degradation of a-Syn.
[0348] AB-2-5-4
[0349] Treatment of yeast cells expressing the a-Syn spGFP system with AB-2-5-4 enhances degradation of mitochondrial a-Syn, and significantly reduces the level of a-Syn as compared to the DMSO control (Figure 8).
[0350] This data demonstrates that a small molecule enhancer of mitochondrial proteolysis efficiently increases the degradation of mitochondrial a-Syn in yeast cells.
[0351] Example 9: Conclusions
[0352] The data presented above identify a direct link between a-synucleinopathy and mitochondrial dysfunction, which are hallmarks of Parkinson’s Disease (PD). The data demonstrate that the a-Syn import into mitochondria is conserved in yeast, mouse, and human cells (Example 2). During mouse aging, a-Syn accumulation in mitochondria of DA neurons and microglia gradually increases (Example 3). This observation helps to explain why age is a risk factor for Parkinson’s Disease (as reviewed in Reeve et al.40). The decline of proteostasis during aging may lead to increased import of a-Syn and other misfolded proteins into mitochondria. This increased import could overwhelm the proteolytic apparatus, leading to accumulation of misfolded proteins in mitochondria, which further compromises mitochondrial functions20. Dysfunctional mitochondria have a reduced contribution to maintaining cytosolic proteostasis, thus causing metabolic stress. This leads to further accumulation of a-Syn and other misfolded proteins in the cytosol, forming protein aggregates such as Lewy bodies. This vicious cycle may lead to neuronal death.
[0353] A recent study targeted a-Syn directly to mitochondria with a MTS and reported that import of a-Syn severely damaged mitochondrial functions in DA neurons20, confirming the detrimental effects of (artificial) accumulation of a-Syn in mitochondria. The same study20describes that a specific caspase-1 inhibitor significantly prevented a-Syn-induced cell death.
[0354] The spGFP reporter used in the Examples only detects the mitochondrial pool of a-Syn and cannot assess the relative portion of a-Syn in mitochondria comparing to cytosol, however, the inventors’ data show that even a small amount of accumulation of a-Syn in mitochondria significantly damages mitochondrial functions (Figures 3a to 3j).
[0355] The inventors’ data also suggest that enhancing certain mitochondrial proteases rescues both a-Syn toxicity and mitochondrial dysfunction (Example 6). Other studies have shown that enhancing mitochondrial proteostasis reduces Ap proteotoxicity4445and extends the lifespan of worms46. These findings suggest that rescuing mitochondrial proteostasis can antagonize age-associated defects.
[0356] The present data demonstrate that increasing the levels of specific mitochondrial proteases such as Neurolysin significantly reduces the accumulation of a-Syn in mitochondria and rescues the mitochondrial dysfunction brought about by a-Syn overexpression (Example 6). The variable expression of different mitochondrial proteases that are responsible for the degradation of imported a-Syn may help to explain the cell-type specific vulnerability of a-synucleinopathies and mitochondrial dysfunction in PD.
[0357] The present data identity a key role for certain mitochondrial proteases in degrading a-Syn in the mitochondria. A new therapeutic approach to treating a-synucleinopathies, such as PD, is proposed, namely by increasing the levels of a mitochondrial protease that degrades a-Syn (e.g. neurolysin) or stimulating the proteolytic activity of a mitochondrial protease that degrades a-Syn (see Example 8), to reduce the levels of a-Syn in mitochondria and thus alleviate mitochondrial dysfunction and neuronal death.
[0358] References
[0359] A number of publications are cited above in order to more fully describe and disclose the invention and the state of the art to which the invention pertains. Full citations for these references are provided below. The entirety of each of these references is incorporated herein. 1 . Damier, P., Hirsch, E. C., Ag id, Y. & Graybiel, A. M. The substantia nigra of the human brain. II. Patterns of loss of dopamine-containing neurons in Parkinson's disease. Brain 122 (Pt 8, 1437-1448 (1999).
[0360] 2. Spillantini, M. G. et al. Alpha-Synuclein in Lewy bodies. Nature vol. 388 839-840 (1997).
[0361] 3. Engelhardt, E. & Gomes, M. da M. Lewy and his inclusion bodies: Discovery and rejection. Dement. Neuropsychol. 11 , 198-201 (2017).
[0362] 4. Holdorff, B. Friedrich Heinrich Lewy (1885-1950) and his work. J. Hist. Neurosci. 11 , 19-28 (2002).
[0363] 5. Maroteaux, L., Campanelli, J. T. & Scheller, R. H. Synuclein: a neuron-specific protein localized to the nucleus and presynaptic nerve terminal. J. Neurosci. Off J. Soc. Neurosci. 8, 2804-2815 (1988).
[0364] 6. Ueda, K. et al. Molecular cloning of cDNA encoding an unrecognized component of amyloid in Alzheimer disease. Proc. Natl. Acad. Sci. U. S. A. 90, 11282-11286 (1993).
[0365] 7. Polymeropoulos, M. H. et al. Mutation in the alpha-Synuclein Gene Identified in Families with Parkinson' s Disease. Science. 276, 2045-2047 (1997).
[0366] 8. Bridi, J. C. & Hirth, F. Mechanisms of a-Synuclein Induced Synaptopathy in Parkinson's Disease. Front. Neurosci. 12, 80 (2018).
[0367] 9. Chen, C., Turnbull, D. M. & Reeve, A. K. Mitochondrial Dysfunction in Parkinson's Disease-Cause or Consequence? Biology (Basel). 8(2):38, (2019).
[0368] 10. Heikkila, R. E., Hess, A. & Duvoisin, R. C. Dopaminergic neurotoxicity of 1 -methyl-4-phenyl-1 ,2,5,6- tetrahydropyridine in mice. Science 224, 1451 -1453 (1984).
[0369] 11 . Lili, C. M. Genetics of Parkinson's disease. Mol. Cell. Probes 30, 386-396 (2016).
[0370] 12. Di Maio, R. et al. a-Synuclein binds to TOM20 and inhibits mitochondrial protein import in Parkinson's disease. Sci. Transl. Med. 8, 342ra78 (2016).
[0371] 13. Bender, A. et al. TOM40 mediates mitochondrial dysfunction induced by a-Synuclein accumulation in Parkinson's disease. PLoS One 8, e62277 (2013).
[0372] 14. Wang, X. et al. Pathogenic alpha-Synuclein aggregates preferentially bind to mitochondria and affect cellular respiration. Acta Neuropathol. Commun. 7, 41 (2019). 15. Rajendran, M. et al. Restricting a-Synuclein transport into mitochondria by inhibition of a-Synuclein- VDAC complexation as a potential therapeutic target for Parkinson's disease treatment. Cell. Mol. Life Sci. 79, 368 (2022).
[0373] 16. Choi, M. L. et al. Pathological structural conversion of a-Synuclein at the mitochondria induces neuronal toxicity. Nat. Neurosci. 25, 1134-1148 (2022).
[0374] 17. Vicario, M. et al. A split-GFP tool reveals differences in the sub-mitochondrial distribution of wt and mutant alpha-Synuclein. Cell Death Dis. 10, 857 (2019).
[0375] 18. Devi, L., Raghavendran, V., Prabhu, B. M., Avadhani, N. G. & Anandatheerthavarada, H. K. Mitochondrial import and accumulation of a-Synuclein impair complex I in human dopaminergic neuronal cultures and Parkinson disease brain. J. Biol. Chem. 283, 9089-9100 (2008).
[0376] 19. Martinez, J. H. et al. Alpha-Synuclein mitochondrial interaction leads to irreversible translocation and complex I impairment. Arch. Biochem. Biophys. 651 , 1 -12 (2018).
[0377] 20. Ganjam, G. K. et al. Mitochondrial damage by a-Synuclein causes cell death in human dopaminergic neurons. Cell Death Dis. 10, 865 (2019).
[0378] 21 . Outeiro, T. F. & Lindquist, S. Yeast cells provide insight into alpha-Synuclein biology and pathobiology. Science 302, 1772-1775 (2003).
[0379] 22. Tardiff, D. F. et al. Yeast reveal a 'druggable' Rsp5 / Nedd4 network that ameliorates a-Synuclein toxicity in neurons. Science 342, 979-983 (2013).
[0380] 23. Chung, C. Y. et al. Identification and rescue of a-Synuclein toxicity in Parkinson patient-derived neurons. Science 342, 983-987 (2013).
[0381] 24. Tardiff, D. F., Khurana, V., Chung, C. Y. & Lindquist, S. From yeast to patient neurons and back again: powerful new discovery platform. Mov. Disord. 29, 1231 -1240 (2014).
[0382] 25. Franssens, V. et al. The benefits of humanized yeast models to study Parkinson's disease. Oxid. Med. Cell. Longev. 2013, 760629 (2013).
[0383] 26. Su, L. J. et al. Compounds from an unbiased chemical screen reverse both ER-to-Golgi trafficking defects and mitochondrial dysfunction in Parkinson's disease models. Dis. Model. Meeh. 3, 194-208 (2010).
[0384] 27. Cabantous, S., Terwilliger, T. C. & Waldo, G. S. Protein tagging and detection with engineered selfassembling fragments of green fluorescent protein. Nat. Biotechnol. 23, 102-107 (2005). 28. Ruan, L. et al. Cytosolic proteostasis through importing of misfolded proteins into mitochondria. Nature 543, 443-446 (2017).
[0385] 29. Zhou, C. et al. Organelle-based aggregation and retention of damaged proteins in asymmetrically dividing cells. Cell 159, 530-542 (2014).
[0386] 30. Fehrenbacher, K. L., Yang, H.-C., Gay, A. C., Huckaba, T. M. & Pon, L. A. Live cell imaging of mitochondrial movement along actin cables in budding yeast. Curr. Biol. 14, 1996-2004 (2004).
[0387] 31 . Li, W. et al. Yeast AMID homologue Ndilp displays respiration-restricted apoptotic activity and is involved in chronological aging. Mol. Biol. Cell 17, 1802-1811 (2006).
[0388] 32. Meurer, M. et al. Genome-wide C-SWAT library for high-throughput yeast genome tagging. Nat. Methods 15, 598-600 (2018).
[0389] 33. Hughes, A. L. & Gottschling, D. E. An early age increase in vacuolar pH limits mitochondrial function and lifespan in yeast. Nature 492, 261 -265 (2012).
[0390] 34. NAGAI, S., YANAGISHIMA, N. & NAGAI, H. Advances in the study of respiration-deficient (RD) mutation in yeast and other microorganisms. Bacteriol. Rev. 25, 404-426 (1961 ).
[0391] 35. Costa, E. A., Subramanian, K., Nunnari, J. & Weissman, J. S. Defining the physiological role of SRP in protein-targeting efficiency and specificity. Science 359, 689-692 (2018).
[0392] 36. Ho, C. H. et al. A molecular barcoded yeast ORF library enables mode-of-action analysis of bioactive compounds. Nat. Biotechnol. 27, 369-377 (2009).
[0393] 37. Ross, O. A. et al. Genetic variation of Omi / HtrA2 and Parkinson's disease. Parkinsonism Relat. Disord. 14, 539-543 (2008).
[0394] 38. Volpicelli-Daley, L. A., Luk, K. C. & Lee, V. M.-Y. Addition of exogenous a-Synuclein preformed fibrils to primary neuronal cultures to seed recruitment of endogenous a-Synuclein to Lewy body and Lewy neurite-like aggregates. Nat. Protoc. 9, 2135-2146 (2014).
[0395] 39. Luk, K. C. et al. Exogenous alpha-Synuclein fibrils seed the formation of Lewy body-like intracellular inclusions in cultured cells. Proc. Natl. Acad. Sci. U. S. A. 106, 20051 -20056 (2009).
[0396] 40. Reeve, A., Simcox, E. & Turnbull, D. Ageing and Parkinson's disease: why is advancing age the biggest risk factor? Ageing Res. Rev. 14, 19-30 (2014).
[0397] 41. Melentijevic, I. et al. C. elegans neurons jettison protein aggregates and mitochondria under neurotoxic stress. Nature 542, 367-371 (2017). 42. Choi, I. et al. Microglia clear neuron-released a-Synuclein via selective autophagy and prevent neurodegeneration. Nat. Commun. 11 , 1386 (2020).
[0398] 43. Scheiblich, H. et al. Microglia jointly degrade fibrillar alpha-Synuclein cargo by distribution through tunneling nanotubes. Cell 184, 5089-5106. e21 (2021 ).
[0399] 44. Sorrentino, V. et al. Enhancing mitochondrial proteostasis reduces amyloid-p proteotoxicity. Nature 552, 187-193 (2017).
[0400] 45. Fang, D. et al. Increased neuronal PreP activity reduces AP accumulation, attenuates neuroinflammation and improves mitochondrial and synaptic function in Alzheimer disease's mouse model. Hum. Mol. Genet. 24, 5198-5210 (2015).
[0401] 46. Durieux, J., Wolff, S. & Dillin, A. The Cell Non-Autonomous Nature of Electron Transport Chain-Mediated Longevity. Cell 144, 79-91 (2011 ).
[0402] 47. Lautenschlager, J. et al. Intramitochondrial proteostasis is directly coupled to a-Synuclein and amyloid (31 -42 pathologies. J. Biol. Chem. 295, 10138-10152 (2020).
[0403] 48. The GTEx Consortium atlas of genetic regulatory effects across human tissues. Science 369, 1318-1330 (2020).
[0404] 49. Lang, C. et al. Single-Cell Sequencing of iPSC-Dopamine Neurons Reconstructs Disease Progression and Identifies HDAC4 as a Regulator of Parkinson Cell Phenotypes. Cell
[0405] Stem Cell 24, 93-106.e6 (2019).
[0406] 50. Longtine, M. S. et al. Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae. Yeast 14, 953-961 (1998).
[0407] 51 . Giaever, G. et al. Functional profiling of the Saccharomyces cerevisiae genome. Nature 418, 387-391 (2002).
[0408] 52. Boldogh, I. R. & Pon, L. A. Purification and subfractionation of mitochondria from the yeast Saccharomyces cerevisiae. Methods Cell Biol. 80, 45-64 (2007).
[0409] 53. Gage, G. J., Kipke, D. R. & Shain, W. Whole animal perfusion fixation for rodents. J. Vis. Exp. (2012) doi:10.3791 / 3564.
[0410] 54. Kim, S. et al. Transneuronal Propagation of Pathologic a-Synuclein from the Gut to the Brain Models Parkinson's Disease. Neuron 103, 627-641 .e7 (2019). 55. Kahm, M., Hasenbrink, G., Lichtenberg-Frate, H., Ludwig, J. & Kschischo, M. grofit: Fitting Biological Growth Curves with R. J. Stat. Softly. 33, 1 -21 (2010).
[0411] 56. Lun, A. T. L., McCarthy, D. J. & Marioni, J. C. A step-by-step workflow for low-level analysis of single-cell RNA-seq data with Bioconductor. F1 OOOResearch 5, 2122 (2016).
[0412] 57. Buettner, F., Pratanwanich, N., McCarthy, D. J., Marioni, J. C. & Stegle, O. f-scLVM: scalable and versatile factor analysis for single-cell RNA-seq. Genome Biol. 18, 212 (2017).
[0413] 58. Vu, T. N. et al. Beta-Poisson model for single-cell RNA-seq data analyses. Bioinformatics 32, 2128-2135 (2016).
Claims
Claims:1 . A method of treating or preventing a disease in which a-synuclein is pathologically-implicated in a subject, comprising administering to a subject an agent that increases the expression or activity of a mitochondrial protease that degrades a-synuclein.
2. An agent that increases the expression or activity of a mitochondrial protease that degrades a- synuclein for use in treating or preventing a disease in which a-synuclein is pathologically-implicated.
3. Use of an agent that increases the expression or activity of a mitochondrial protease that degrades a- synuclein in the manufacture of a medicament for treating or preventing a disease in which a-synuclein is pathologically-implicated.
4. The method according to claim 1 , the agent for use according to claim 2, or the use according to claim 3, wherein the mitochondrial protease that degrades a-synuclein is selected from neurolysin, PITRM1 , IMMP1 L, IMMP2L, YME1 L1 , PARL, ATP23 and METAP1 .
5. The method according to claim 1 or claim 4, the agent for use according to claim 2 or claim 4, or the use according to claim 3 or claim 4, wherein the mitochondrial protease that degrades a-synuclein is neurolysin or PITRM1 .
6. The method according to any one of claims 1 , 4 or 5, the agent for use according to any one of claims 2, 4 or 5, or the use according to any one of claims 3 to 5, wherein the disease in which a-synuclein is pathologically-implicated is a disease characterised by the presence of Lewy bodies and / or Lewy neurites.
7. The method according to any one of claims 1 , or 4 to 6, the agent for use according to any one of claims 2, or 4 to 6, or the use according to any one of claims 3 to 6, wherein the disease in which a- synuclein is pathologically-implicated is a synucleinopathy.
8. The method according to any one of claims 1 , or 4 to 7, the agent for use according to any one of claims 2, or 4 to 7, or the use according to any one of claims 3 to 7, wherein the disease in which a- synuclein is pathologically-implicated is selected from Parkinson’s disease (PD), dementia with Lewy bodies (DLB), multiple system atrophy (MSA), pure autonomic failure (PAF) and REM behaviour disorder (RBD).
9. The method according to any one of claims 1 , or 4 to 8, the agent for use according to any one of claims 2, or 4 to 8, or the use according to any one of claims 3 to 8, wherein the agent is a small molecule that allosterically increases the activity of the mitochondrial protease that degrades a-synuclein.
10. The method according to any one of claims 1 , or 4 to 9, the agent for use according to any one of claims 2, or 4 to 9, or the use according to any one of claims 3 to 9, wherein the agent is a compound selected from:enantiomer or a pharmaceutically-acceptable salt thereof.
Citation Information
Patent Citations
Enhancers of Neurolysin Activity
US20210198647A1
Apparatus and method for connecting a conduit to a hollow vessel
US60636449P0
Peptidase neurolysin enhancer as well as preparation method and application thereof
CN117603141A
Enhancers of neurolysin activity
WO2020047185A1