Use of scavenger receptor class a member 3 or reagent increasing expression of scavenger receptor class a member 3 in preparing hypoglycemic product

Abstract

Provided is use of scavenger receptor class A member 3 or a reagent increasing the expression of scavenger receptor class A member 3 in preparing a hypoglycemic product. By means of overexpressing a human-derived SR-A3 gene in hamsters, it was found that the overexpression of the human-derived SR-A3 gene can reduce the plasma glucose concentration, decrease the plasma insulin concentration, improve glucose tolerance, enhance insulin sensitivity, reduce insulin resistance, lower the expression of gluconeogenesis-related genes, and inhibit the activation of the AKT signaling pathway. The present application provides a new target and a new strategy for the precise treatment of patients with hyperglycemia.

Description

Application of scavenger receptor class A member 3 or reagent for improving expression of scavenger receptor class A member 3 in preparation of product for reducing blood sugar TECHNICAL FIELD

[0001] The present application relates to the field of pharmaceutical technology of gene therapy, and particularly relates to application of scavenger receptor class A member 3 or reagent for improving expression of scavenger receptor class A member 3 in preparation of product for reducing blood sugar. BACKGROUND

[0002] The scavenger receptor (SR) superfamily plays an important role in the development of atherosclerosis, but only some members have been identified in the fields of lipid metabolism, energy homeostasis and immune response related to atherosclerosis, and some members have unknown functions in atherosclerosis. Among them, SR family A (SR-A) protein is a type II transmembrane glycoprotein that forms a homotrimer on the cell surface, including an N-terminal cytoplasmic region, a helical transmembrane region and a C-terminal extracellular part. SR-A can recognize a variety of ligands such as lipids, reactive oxygen species (ROS), metal ions, pathogenic microorganisms, etc., and is involved in various cell biological processes.

[0003] At present, there are five known members of the SR-A family, SR-A1 and SR-A2 are highly expressed in macrophages and dendritic cells; SR-A4 is mainly expressed in endothelial cells and neutrophils; SR-A5 is mainly limited to epithelial cell expression; and SR-A3 is widely expressed in different cells. Studies have shown that SR-A family members 1, 2, 4 and 5 can bind to natural or modified LDL, while SR-A3 lacks the extracellular C-terminal globular domain and cannot bind to lipoproteins like other SR-A members to participate in endocytosis and transport of lipoproteins.

[0004] At present, the research on the biological function of SR-A3 mainly focuses on two aspects: on the one hand, SR-A3 binds to ROS through the C-terminal collagen-like domain, transports ROS and its byproducts to lysosomes for degradation, and plays an antioxidant role; on the other hand, SR-A3 is involved in the process of endocytosis of ligands from the extracellular to the intracellular, and plays a receptor role. However, there is no relevant report on the relationship between SR-A3 and hyperglycemia. SUMMARY

[0005] In order to solve the above problems, the application provides the application of a class scavenger receptor 3 (SR-A3) or a reagent for increasing the expression amount of the class scavenger receptor 3 in the preparation of a blood glucose-lowering product. The application finds that overexpression of SR-A3 can effectively reduce the blood glucose of a model animal, enhance glucose tolerance and insulin sensitivity, and provide a new target and a new strategy for the precise treatment of patients with high blood glucose in the clinic.

[0006] In order to achieve the above purpose, the application provides the following technical scheme:

[0007] The application provides the application of a class scavenger receptor 3 or a reagent for increasing the expression amount of the class scavenger receptor 3 in the preparation of a blood glucose-lowering product.

[0008] Preferably, the blood glucose-lowering product is a blood glucose-lowering drug.

[0009] Preferably, the blood glucose-lowering product is a drug for improving glucose tolerance.

[0010] Preferably, the blood glucose-lowering product is a drug for enhancing insulin sensitivity and / or reducing insulin resistance.

[0011] Preferably, the blood glucose-lowering product is a product for reducing the expression amount of gluconeogenesis-related genes.

[0012] Preferably, the gluconeogenesis-related genes include Gck genes and / or Pklr genes.

[0013] Preferably, the blood glucose-lowering product is a product for inhibiting the activation of an AKT signaling pathway.

[0014] Preferably, the reagent for increasing the expression amount of the class scavenger receptor 3 includes a recombinant vector for overexpressing the class scavenger receptor 3 in the liver.

[0015] Preferably, the recombinant vector includes a recombinant AAV viral vector containing a class scavenger receptor 3 coding sequence.

[0016] Preferably, a wild type vector for preparing the recombinant AAV viral vector includes a pAAV-MCS vector.

[0017] Beneficial effects:

[0018] The application provides application of a scavenger receptor class A 3 or a reagent for increasing expression of the scavenger receptor class A 3 in preparation of a blood sugar reducing product. The application finds that overexpression of the SR-A3 gene can reduce the glucose content in blood plasma, reduce the insulin content in blood plasma, improve glucose tolerance, enhance insulin sensitivity, reduce insulin resistance, reduce the expression amount of gluconeogenesis related genes and inhibit the activation of the AKT signal pathway by overexpressing the SR-A3 gene in hamsters. The application provides a new target and new strategy for precise treatment of hyperglycemic patients in clinic. BRIEF DESCRIPTION OF DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below.

[0020] Figure 1 is a schematic diagram of construction of SR-A3 knockout hamsters;

[0021] Figure 2 is the relative expression amount of SR-A3 mRNA in the liver of WT and SR-A3 knockout hamsters;

[0022] Figure 3 is the glucose content in blood plasma of WT and SR-A3 knockout hamsters after being fed with high-fat high-cholesterol diet for 8 weeks;

[0023] Figure 4 is the insulin content in blood plasma of WT and SR-A3 knockout hamsters after being fed with high-fat high-cholesterol diet for 8 weeks;

[0024] Figure 5 is the glucose tolerance test result of WT and SR-A3 knockout hamsters after being fed with high-fat high-cholesterol diet for 6 weeks;

[0025] Figure 6 is the insulin tolerance test result of WT and SR-A3 knockout hamsters after being fed with high-fat high-cholesterol diet for 7 weeks;

[0026] Figure 7 is the experimental process of injecting Null AAV8 and hSR-A3 AAV8 viruses into the jugular vein of WT hamsters;

[0027] Figure 8 is the relative expression amount of SR-A3 mRNA in the liver of WT hamsters injected with Null AAV8 and hSR-A3 AAV8 viruses into the jugular vein;

[0028] Figure 9 is the glucose content in blood plasma of WT hamsters injected with Null AAV8 and hSR-A3 AAV8 viruses into the jugular vein after being fed with high-fat high-cholesterol diet for 4 weeks;

[0029] Figure 10 is the insulin content in blood plasma of WT hamsters injected with Null AAV8 and hSR-A3 AAV8 viruses into the jugular vein after being fed with high-fat high-cholesterol diet for 4 weeks;

[0030] Figure 11 is a relative mRNA content of liver gluconeogenesis-related indicators of WT hamsters injected with Null AAV8 and hSR-A3 AAV8 viruses in the jugular vein;

[0031] Figure 12 is a result of glucose tolerance test of WT hamsters injected with Null AAV8 and hSR-A3 AAV8 viruses in the jugular vein after being fed with high-fat high-cholesterol diet for 3 weeks;

[0032] Figure 13 is a result of insulin tolerance test of WT hamsters injected with Null AAV8 and hSR-A3 AAV8 viruses in the jugular vein after being fed with high-fat high-cholesterol diet for 3 weeks;

[0033] Figure 14 is a result of AKT expression and phosphorylation of liver tissue of WT hamsters injected with Null AAV8 and hSR-A3 AAV8 viruses in the jugular vein after being fed with high-fat high-cholesterol diet for 4 weeks;

[0034] Figure 15 is a schematic diagram of a shuttle plasmid containing a SR-A3 target gene. DETAILED DESCRIPTION

[0035] The application provides application of a class A scavenger receptor 3 or a reagent for increasing expression of the class A scavenger receptor 3 in preparation of a blood glucose-lowering product.

[0036] In the application, the blood glucose-lowering product preferably comprises one or more of a blood glucose-lowering drug, a glucose tolerance-enhancing drug, an insulin sensitivity-enhancing and / or insulin resistance-reducing drug, a product for reducing expression of a gluconeogenesis-related gene, and a product for inhibiting activation of an AKT signaling pathway; the gluconeogenesis-related gene preferably comprises a Gck gene and / or a Pklr gene.

[0037] In the application, the reagent for increasing expression of the class A scavenger receptor 3 preferably comprises a recombinant vector for overexpressing the class A scavenger receptor 3 in the liver; the recombinant vector preferably comprises a recombinant AAV viral vector containing a class A scavenger receptor 3 coding sequence; the class A scavenger receptor 3 coding sequence is preferably a human class A scavenger receptor 3 coding sequence; a wild-type vector for preparing the recombinant AAV viral vector preferably comprises a pAAV-MCS vector; the class A scavenger receptor 3 coding sequence is preferably as shown in SEQ ID NO. 1, and specifically as follows:

[0038] .

[0039] The present application finds that by targeting to increase the expression of SR-A3 in the liver, the glucose metabolism of the liver can be regulated, the glucose tolerance and insulin sensitivity can be increased, and the blood glucose can be reduced, thereby providing a new target and a new strategy for the precise treatment of patients with high blood glucose in the clinic.

[0040] In order to further illustrate the present application, the application of the class A scavenger receptor 3 or the reagent for increasing the expression amount of the class A scavenger receptor 3 in the preparation of the blood glucose-lowering product is described in detail below in combination with examples, but they cannot be understood as limiting the protection scope of the present application.

[0041] Example 1

[0042] According to the method described in Chinese patent CN202210545169.X, SR-A3 knockout (SR-A3 - / - ) hamsters were constructed. Due to the randomness of targeting, the schematic diagram of the construction of the SR-A3 knockout hamsters of the present application is shown in Figure 1.

[0043] The relative expression amount of SR-A3 mRNA in the liver of wild-type hamsters (denoted as WT, purchased from Beijing Vantoll Life Animal Technology Co., Ltd., 8 weeks old) and the constructed SR-A3 - / - hamsters was determined by using liver mRNA extraction reagent Trizol (Quazolyn, ET111-01-V2), reverse transcription kit (Quazolyn, AT301-03) and QPCR kit (Quazolyn, AQ132-24). The internal reference gene was GAPDH; the primers used are as follows:

[0044] SR-A3-F: 5'-TCCACTCCATCCAAGGCTACTC-3', SEQ ID NO. 2;

[0045] SR-A3-R: 5'-TCCTCTTCAGTGACGCACAGTA-3', SEQ ID NO. 3;

[0046] GAPDH-F: 5'-GCCGTATTGGACGCCTGGTTAC-3', SEQ ID NO. 4;

[0047] GAPDH-R: 5'-CGCTCCTGGAAGATGGTGATGG-3', SEQ ID NO. 5.

[0048] The relative expression amount of SR-A3 mRNA is shown in Figure 2, wherein, p<0.001.

[0049] As can be seen from Figure 2, compared with the WT hamsters, the SR-A3- / - SR-A3 mRNA was hardly detected in hamster liver.

[0050] Example 2

[0051] SR-A3 - / - The hamsters and the purchased wild-type hamsters were fed with normal feed for 2 weeks, and then were fed with high-fat and high-cholesterol feed (purchased from Beijing Botaihongda Biotechnology Co., Ltd., item number HD012b). After 6 weeks of high-fat and high-cholesterol diet, the glucose tolerance test was performed, and the results are shown in Fig. 5; after 7 weeks of high-fat and high-cholesterol diet, the insulin tolerance test was performed, and the results are shown in Fig. 6; after 8 weeks of high-fat and high-cholesterol diet, the plasma glucose content and the plasma insulin content were measured, and the reagent kits used were: glucose reagent kit (North China Biotech Co., Ltd., item number: 100000240) and insulin reagent kit (Mercodia, item number: 10-1251-01), and the results are shown in Figs. 3 and 4, respectively, wherein p < 0.05, p < 0.01, p < 0.001. The experimental methods are as follows:

[0052] Glucose tolerance test: the hamsters were fasted overnight for 12 hours, and the 0-point blood was collected from the orbital medial vein, and 20% glucose (Sigma-Aldrich, item number G8270) was injected intraperitoneally at 2 g / kg body weight; 15, 30, 60 and 120 minutes after intraperitoneal injection of glucose, the orbital medial vein was collected at 4000 rpm and centrifuged at 4°C for 10 minutes, and the plasma was taken, and the blood glucose was measured by enzyme labeling method.

[0053] Insulin resistance test: the hamsters were fasted for 6 hours, and the 0-point blood was collected from the orbital medial vein, and insulin (Lilly, France, item number HI0219) was injected intraperitoneally at 0.75 U / kg body weight; 15, 30, 60 and 120 minutes after intraperitoneal injection of insulin, the orbital medial vein was collected at 4000 rpm and centrifuged at 4°C for 10 minutes, and the plasma was taken, and the blood glucose was measured by enzyme labeling method.

[0054] As shown in Fig. 3, compared with the WT hamsters, the SR-A3 - / - The blood glucose content of the hamsters was significantly increased.

[0055] As shown in Fig. 4, compared with the WT hamsters, the SR-A3 - / - The plasma insulin content of the hamsters was significantly increased.

[0056] As shown in Fig. 5, compared with the WT hamsters, the SR-A3 - / - The glucose sensitivity of the hamsters was reduced.

[0057] As shown in FIG. 6, compared with WT hamsters, SR-A3 - / - Hamster insulin resistance was aggravated.

[0058] Example 3

[0059] Construction of hSR-A3 AAV8: commissioned Suzhou Nojicai Biotechnology Co., Ltd. to construct, the production of AAV vector adopts three plasmid system, that is, using a shuttle plasmid containing SR-A3 target gene, pRepCap plasmid (Addgene, item number: #110770) containing AAV vector repcap gene and helper plasmid pHelper, polyethyleneimine (PEI) as transfection reagent, co-transfect HEK293 cells, and recombine AAV virus vector. Harvested 48-72 hours after transfection, and obtained a certain purity (1 x 10 14 vg / ml) of recombinant AAV virus vector after purification. The construction process of the shuttle plasmid containing SR-A3 target gene is as follows:

[0060] 1) Gene synthesis Alb promoter and bGH terminator (KpnI and BglII enzyme cutting sites are introduced between the two elements during synthesis), insert the synthesized Alb promoter and bGH terminator into the shuttle vector pAAV-MCS treated with NotI enzyme, to obtain the first shuttle vector; the nucleotide sequence of the Alb promoter and bGH terminator is as follows:

[0061] A1b promoter: 5'-AAGTATTTAGTTTGGTTAGTAATTACTAAACACTGAGAACGCCAATGAAATACAAAGATGAGTCTAGTTAATAATCTACAATTATTGGTTAAAGAAGTATATTAGTGCTAATTTCCCTCCGTTTGTCCTAGCTTTTCTCTTCTGTCAACCCCACACGCCTTTGGCA-3', SEQ ID NO. 6;

[0062] bGH terminator: 5'-CTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGG-3', SEQ ID NO. 7;

[0063] 2) SR-A3 target gene was obtained by PCR amplification using human genomic DNA as template; the reaction system of the PCR amplification was as follows: cDNA template 2 μL, forward primer 1 μL, reverse primer 1 μL, 2 x FastPfu Fly Reaction Mix 25 μL, FastPfu Fly DNA Polymerase 1 μL and ddH2O 20 μL; the reaction program of the PCR amplification was as follows: 95 °C pre-denaturation for 2 min; 95 °C denaturation for 20 s, 60 °C annealing for 20 s, 72 °C extension for 20 s, 35 cycles, 72 °C final extension for 5 min; the primer sequences of the PCR amplification were as follows:

[0064] Forward primer: 5'-CCGGTACCGATGGAGATGCCTTGTG-3', SEQ ID NO. 8;

[0065] Reverse primer: 5'-TCCTATGGCACAGTCACTATCTAGCC-3', SEQ ID NO. 9;

[0066] 3) The SR-A3 target gene obtained in step 2) was inserted into the first shuttle vector (KpnI and BglII enzyme treatment) constructed in step 1) by Gibson assembly (Thermo Fisher Scientific, A46628), and finally a shuttle plasmid containing the SR-A3 target gene was obtained (see Figure 15).

[0067] Example 4

[0068] The experimental process of WT hamsters injected with Null AAV8 and hSR-A3 AAV8 virus in the jugular vein is shown in FIG. 7, and is as follows: 8-week-old hamsters (WT) purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. were injected with hSR-A3-AAV8 and AAV8-Null (empty vector control group, similar to the construction method of hSR-A3-AAV8, the difference is that the shuttle plasmid is not connected with the SR-A3 target gene) constructed in Example 3 in the jugular vein, respectively, and the injection amount was 1×10 13 After 2 weeks of normal feeding, the hamsters were fed with high-fat and high-cholesterol feed (purchased from Beijing Botaihongda Biotechnology Co., Ltd., product number HD012b) and continued to be fed for 3 weeks. The glucose tolerance and insulin resistance experiments were performed at 3 weeks and 4 weeks, respectively. The experimental process is described in Example 2. After 4 weeks, the mice were euthanized, and plasma and liver samples were collected to detect blood glucose and analyze the expression of liver glucose metabolism-related indicators. The relative expression amount of SR-A3 mRNA in the hamster liver was determined by the method described in Example 1. The plasma glucose content and plasma insulin content were detected by the method described in Example 2. The reference gene used for the relative content of glucose kinase (Gck) and pyruvate kinase isozyme (Pklr) mRNA in the liver gluconeogenesis-related indicators was GAPDH. The nucleotide sequences of the primers are as follows:

[0069] Gck-F: 5'-ACCTTGCCTGGGGAAATAGC-3', SEQ ID NO. 10;

[0070] Gck-R: 5'-CATGTGGCTGGACAGTCAGT-3', SEQ ID NO. 11;

[0071] Pklr-F: 5'-GGGAGCCGCATCTACATTGA-3', SEQ ID NO. 12;

[0072] Pklr-R: 5'-AGCGTTGGGCAAATTCACAC-3', SEQ ID NO. 13;

[0073] GAPDH-F: 5'-GCCGTATTGGACGCCTGGTTAC-3', SEQ ID NO. 4;

[0074] GAPDH-R: 5'-CGCTCCTGGAAGATGGTGATGG-3', SEQ ID NO. 5;

[0075] The antibodies used in Western Blot (WB) are as follows: AKT antibody (Cell Signaling Technology, 4685S), p-AKT antibody (Cell Signaling Technology, 4060S), β-ACTIN (Abmart, T40104), and the steps are as follows: WT hamsters are injected with Null AAV8 and hSR-A3 AAV8 viruses in the jugular vein, and are fed with high-fat and high-cholesterol diet for 4 weeks. The liver tissue protein is extracted using RIPA added with protease and phosphatase inhibitors; the protein concentration is detected by BCA method; 5x SDS-PAGE loading buffer is mixed with the protein lysate and denatured at 100°C for 10 minutes; the protein is separated by SDS-PAGE gel electrophoresis, and is transferred to a nitrocellulose membrane; milk is blocked; pAKT / AKT primary antibody is incubated at 4°C overnight; the membrane is washed with TBST solution for 30 minutes; the corresponding species secondary antibody is incubated at room temperature for one hour; the membrane is washed with TBST solution for 15 minutes; ECL light-emitting liquid is prepared; and the membrane is placed in a digital imager and light-emitting liquid is added.

[0076] The relative expression amount of SR-A3 mRNA in the liver of WT hamsters injected with Null AAV8 and hSR-A3 AAV8 viruses is shown in FIG. 8, wherein, p<0.001. As can be seen from FIG. 8, the expression of hSR-A3 mRNA in the liver of hamsters injected with hSR-A3 AAV8 is significantly higher than that of hamsters injected with Null AAV8.

[0077] The plasma glucose content of WT hamsters injected with Null AAV8 and hSR-A3 AAV8 viruses and fed with high-fat and high-cholesterol diet for 4 weeks is shown in FIG. 9, wherein, p<0.05. As can be seen from FIG. 9, the plasma glucose content of hamsters injected with hSR-A3 AAV8 is significantly lower than that of hamsters injected with Null AAV8.

[0078] The plasma insulin content of WT hamsters injected with Null AAV8 and hSR-A3 AAV8 viruses and fed with high-fat and high-cholesterol diet for 4 weeks is shown in FIG. 10. As can be seen from FIG. 10, the plasma insulin content of hamsters injected with hSR-A3 AAV8 is significantly lower than that of hamsters injected with Null AAV8.

[0079] The relative mRNA content of indicators related to hepatic gluconeogenesis of WT hamsters injected with Null AAV8 and hSR-A3 AAV8 viruses is shown in FIG. 11, wherein, For p<0.05. As shown in Fig. 11, compared with the hSR-A3 AAV8-injected hamsters, the mRNA of glucoseogenesis-related factors Gck and Pklr in the liver of the hamsters injected with the Null AAV8 was significantly reduced.

[0080] The results of the glucose tolerance test of the WT hamsters injected with the Null AAV8 and hSR-A3 AAV8 virus via the jugular vein after being fed with a high-fat high-cholesterol diet for 3 weeks are shown in Fig. 12, wherein, For p<0.05. As shown in Fig. 12, compared with the hSR-A3 AAV8-injected hamsters, the glucose sensitivity of the hamsters injected with the Null AAV8 was increased.

[0081] The results of the insulin tolerance test of the WT hamsters injected with the Null AAV8 and hSR-A3 AAV8 virus via the jugular vein after being fed with a high-fat high-cholesterol diet for 3 weeks are shown in Fig. 13, wherein, For p<0.05. As shown in Fig. 13, compared with the hSR-A3 AAV8-injected hamsters, the insulin resistance of the hamsters injected with the Null AAV8 was reduced.

[0082] The expression and phosphorylation of AKT in the liver tissue of the WT hamsters injected with the Null AAV8 and hSR-A3 AAV8 virus via the jugular vein after being fed with a high-fat high-cholesterol diet for 4 weeks are shown in Fig. 14, wherein 0.6~0.1 refers to the gray scale ratio of the p-AKT and AKT protein bands; For p<0.05. As shown in Fig. 14, compared with the hSR-A3 AAV8-injected hamsters, the key enzyme AKT pathway of liver glucose metabolism of the hamsters injected with the Null AAV8 was inhibited.

[0083] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, but not all the embodiments, and people can also obtain other embodiments according to the present embodiment without creativity, which all belong to the protection scope of the present application.

Claims

1. Use of a reagent for increasing expression of scavenger receptor class A 3 in preparation of a drug for lowering blood glucose; the reagent for increasing expression of scavenger receptor class A 3 is a recombinant vector for overexpressing scavenger receptor class A 3 in the liver; the coding sequence of the scavenger receptor class A 3 is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, the recombinant vector is a recombinant AAV viral vector containing the coding sequence of the scavenger receptor class A 3.

3. Use according to claim 2, characterized in that, the wild-type vector for preparing the recombinant AAV viral vector is a pAAV-MCS vector.

Images