Compositions and methods for treating retinal diseases
Antisense oligonucleotides with a phosphorodiamidate morpholino backbone and specific sequences correct aberrant splicing of the NR2E3 gene, addressing retinal diseases caused by the c.932G>A mutation with minimal toxicity, effectively treating or preventing these conditions.
Patent Information
- Application Number
- PCT/IL2025/050410
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-16
- Filing Date
- 2025-05-15
- Publication Date
- 2025-11-20
AI Technical Summary
There is a need for compounds suitable for treating or ameliorating retinal diseases specifically in subjects harboring the c.932G>A mutation in the NR2E3 gene, which causes conditions such as enhanced S-cone syndrome, retinitis pigmentosa, and Goldmann-Favre syndrome, as the mechanism by which this mutation leads to disease phenotype is not fully understood.
The use of antisense oligonucleotides (ASOs) with a phosphorodiamidate morpholino backbone and specific nucleic acid sequences (SEQ ID Nos: 1-6) to modulate splicing of the NR2E3 gene, potentially restoring normal splicing with minimal cytotoxicity, and optionally conjugated to a cell penetrating peptide (CPP) to enhance therapeutic effect.
The ASOs successfully restore or correct aberrant splicing of the NR2E3 gene, reducing or eliminating the disease effect with minimal cellular toxicity, thereby treating or preventing retinal diseases.
Smart Images

Figure IL2025050410_20112025_PF_FP_ABST
Abstract
Description
COMPOSITIONS AND METHODS FOR TREATING RETINAL DISEASESREFERENCE TO AN ELECTRONIC SEQUENCE LISTING
[0001] The contents of the electronic sequence listing (SKIP-P-003-PCT.xml; size: 12,520 bytes; and date of creation: April 21, 2025) is herein incorporated by reference in its entirety.CROSS REFERENCE TO RELATED APPLICATIONS
[0002] This application claims the benefit of priority of U.S . Provisional Patent Application No. 63 / 648,250, entitled “COMPOSITIONS AND METHODS FOR TREATING RETINAL DISEASES”, filed 16 May 2024, the contents of which are incorporated herein by reference in their entirety.FIELD OF INVENTION
[0003] The present invention is in the field of antisense oligonucleotides and therapeutic use of the antisense oligonucleotides.BACKGROUND
[0004] Functional restoration of gene function in genetic disorders has recently been achieved by modulating splicing of the mutated genes using antisense oligonucleotides (ASOs). ASOs are single stranded, chemically modified, nucleic acids that bind pre-mRNA of the target gene and alter splicing in a way that can restore gene functionality. For example, Nusinersen, is an ASO-based drug that changes the splicing pattern of SMN2 and is successfully used for treatment of spinal muscular atrophy (SMA, Parkash 2107; Gene Ther). Another example is Milasen, an “N=l” drug, where an ASO was developed to effectively restore correct splicing for a unique mutation in the MFSD8 gene that lead to batten disease (Kim et al., 2019; N Engl J Med).
[0005] Deficiency in the nuclear receptor subfamily, 2 group, E member 3 (NR2E3) gene causes a range of inherited retinal disorders including enhanced S-cone syndrome (ESCS), retinitis pigmentosa, Goldmann-Favre syndrome (GFS), and clumped pigmentary retinal degeneration (CPRD) (Mollema and Haider 2010; Exp Eye Res). NR2E3 is a member of a superfamily of nuclear receptors that regulate transcription in a ligand-dependent manner.NR2E3 expression is restricted to retinal photoreceptors in human and is likely to function in multiple capacities: 1) as an activator directing post-mitotic cells to differentiate into rods; 2) as a repressor affecting retinal progenitor competency and retinal development; and 3) a regulator of phototransduction in adult rods and cones (Mollema and Haider 2010; Exp Eye Res).
[0006] A relatively frequent disease-causing mutation in NR2E3 is c.932G>A (p.Arg311Gln) (Bandah et al., 2009; Arch Ophthalmol, ClinVarlD: 5532). This mutation is classified as a missense variant, meaning that it causes a change of the arginine residue at position 311 to a glutamine residue. The mechanism by which this change causes the apparent disease phenotype is not fully understood (see Roduit et al., 2009; PLoS One, where it is demonstrated that this residue change does not affect homodimerization, interaction with CRX co-repressor and DNA binding).
[0007] There is still a great need for compounds suitable for treating or ameliorating a retinal disease specifically in a subject harboring the c.932G>A mutation.SUMMARY
[0008] The present invention, in some embodiments, is directed to a method of splicing modulation of the NR2E3 gene such that the effect of a disease-causing mutation is eliminated or lessened. The present invention, in some embodiments, is based, at least in part, of the surprising findings that ASOs comprising a nucleic acid sequence as set forth in SEQ ID Nos: 1-6, and harboring a PMO backbone, were shown to successfully restore or correct aberrant splicing of a mutated NR2E3 gene in either model cells or cells derived from subjects being homozygous for the NR2E3c 932G>Amutation. This therapeutic effect was observed with minimal to no cytotoxic effect to the cells.
[0009] The present invention is further based, at least in part, on the findings that conjugation of the ASOs of the invention to a CPP may even enhance the therapeutic effect disclosed herein, e.g., restoring or correcting aberrant splicing with reduced cellular toxicity / cytotoxicity .
[0010] According to the first aspect, there is provided a method for treating a retinal disease in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of at least one synthetic antisense oligonucleotide (ASO)comprising a phosphorodiamidate morpholino backbone and a nucleic acid sequence set forth in any one of SEQ ID Nos: 1-6, thereby treating the retinal disease in the subject.[Oi l] According to another aspect, there is provided a composition comprising an ASO comprising a therapeutically effective amount of at least one synthetic antisense oligonucleotide (ASO) comprising a phosphorodiamidate morpholino backbone and a nucleic acid sequence set forth in any one of SEQ ID Nos: 1-6.
[0012] In some embodiments, the treating comprises including of nucleotides in positions 748-933 of the nuclear receptor subfamily, 2 group, E member 3 (NR2E3) pre-mRNA in the subject.
[0013] In some embodiments, the at least one ASO is of 25 to 30 bases.
[0014] In some embodiments, the ASO has at least 75% complementarity to an equal-length portion of a nucleic acid sequence derived from the polynucleotide sequence: GTGATCCTGCTGGAAGAGGCGTGGAGTGAACTCTTTCTCCTCGGGGCCATCCA GTGGTCTCTGCCTCTGGACAGCTGTCCTCTGCTGGCACCGCCCGAGGCCTCTGC TGCCGGTGGTGCCCAGGGCCGGCTCACGCTGGCCAGCATGGAGACGCGTGTCC TGCAGGAAACTATCTCTCGGTTCCGGGCATTGGCGGTGGACCCCACGGAGTTT GCCTGCATGAAGGCCTTGGTCCTCTTCAAGCCAG (SEQ ID NO: 7).
[0015] In some embodiments, the subject comprises at least one in-frame and / or missense mutation in exon 6 of NR2E3.
[0016] In some embodiments, the at least one mutation is c.932G>A.
[0017] In some embodiments, the at least one ASO is in a pharmaceutical composition comprising the at least one ASO and a pharmaceutically acceptable carrier.
[0018] In some embodiments, the composition further comprises a cell penetrating peptide (CPP).
[0019] In some embodiments, the at least one ASO is conjugated to the CPP.
[0020] In some embodiments, the composition further comprises a CPP.
[0021] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.
[0022] In some embodiments, the composition is for use in inducing the inclusion of nucleotides in positions 748-933 of the NR2E3 pre-mRNA, in a subject in need thereof.
[0023] In some embodiments, the subject in need thereof comprises a c.932G>A mutation in exon 6 of the NR2E3 pre-mRNA.
[0024] In some embodiments, the subject is afflicted with or at increased risk for developing a retinal disease.
[0025] In some embodiments, the composition is for use in treatment or prevention of a retinal disease in a subject in need thereof.
[0026] In some embodiments, the treatment comprises inclusion of nucleotides in positions 748-933 of the NR2E3 pre-mRNA, in the subject.
[0027] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
[0028] Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.BRIEF DESCRIPTION OF THE FIGURES
[0029] Figs. 1A-1D include photographs and graphs showing that phosphorodiamidate morpholino oligomers (PMOs) restore normal splicing of NR2E3c 932G>A. (1A) Oligo-screen with PMOs 1-6 to correct aberrant splicing in HEK293 cells. Cells were transfected with NR2E3c 932G>Aplasmid (using Promega’s FuGENE® HD Transfection Reagent) and PMOs were administered under nucleofection (200 nM PMO, using Lonza’s SF Cell Line 4D- Nucleofector® X Kit). RT-PCR was performed using primers spanning exons 5 to 7(forward primer targeting exon 5 and reverse primer targeting exon 7). PMO control (PMO- Ctrl) was purchased from Gene Tools. (1C) Densitometric analysis of the PCR in (1A). (IB) Western blot confirms correction of aberrant splicing at the protein level. (ID) Densitometric analysis of the WB in (IB).
[0030] Figs. 2A-2B include photographs comparing splicing correction of aberrant splicing caused by the NR2E3c 932G>Amutation, using PMO-6 (SEQ ID NO: 6) and PMO-6 conjugated to a cell penetrating peptide (P-PMO6) - in HEK293 cells. The cells were transfected with NR2E3C 932G>Aplasmid and treated with ASOs, either under nucleofection (1 pM PMO, using Lonza’s SF Cell Line 4D-Nucleofector® X Kit) or under free uptake (10 pM PMO) conditions. (2A) RT-PCR levels using plasmids spanning exons 5-6 are shown (forward primer targets exon 5 and reverse primer targets exon 6). (2B) Presented is a western blot analysis evaluating aberrant splicing correction at the protein level using an anti-flag antibody (Monoclonal ANTI-FLAG® M2, sigma-aldrich Cat. #F1804). PMO control (PMO-Ctrl) was purchased from Gene Tools. P-PMO control (P-PMO-Ctrl) is a sequence targeting an unrelated mouse gene (SEQ ID NO: 8, purchased from Wuxi).
[0031] Fig. 3 includes a photograph demonstrating splicing correction of an aberrant splicing caused by the NR2E3c 932G>Amutation in patient derived fibroblast cells. RT-PCR was performed on two patient lines (“Patient N2” and “Patient 12”) and one healthy control line (“Healthy”), using PMO6 (SEQ ID NO: 6) and P-PMO6. RT-PCR levels using plasmids spanning exons 5-6 are shown (forward primer targets exon 5 and reverse primer targets exon 6). PMO control (PMO-Ctrl) was purchased from Gene Tools. P-PMO control (P- PMO-Ctrl) is a sequence targeting an unrelated mouse gene (SEQ ID NO: 8).DETAILED DESCRIPTIONMethod of treatment
[0032] According to some embodiments, there is provided a method for treating a retinal disease in a subject in need thereof. In some embodiments, the method comprises administering to the subject a therapeutically effective amount of a splicing modulator, wherein the splicing modulator induces the endogenous splicing of exon 6 of the nuclear receptor subfamily, 2 group, E member 3 (NR2E3) pre-mRNA, thereby treating a retinal disease in the subject.
[0033] According to some embodiments, there is provided a method for inducing full or complete inclusion of exon 6 in the mature mRNA product of NR2E3.
[0034] According to some embodiments, there is provided a method for inducing inclusion of nucleotides in positions 748-933 of exon 6 of the NR2E3 pre-RNA in the mature mRNA product of NR2E3.
[0035] As used herein, the term "full or complete inclusion of exon 6" refers to a spliced or mature mRNA of the NR2E3 product comprising nucleotides 1-186 of exon 6.
[0036] In some embodiments, a full or complete inclusion of exon 6 results in a spliced or mature mRNA of the NR2E3 product comprising nucleotides 1-1,240 of the NR2E3 mRNA.
[0037] In some embodiments, a full or complete inclusion of exon 6 results in a spliced or mature mRNA of the NR2E3 product comprising at least 1,200, at least 1210, at least 1,220 or at least 1,230 nucleotides, or any value and range therebetween. Each possibility represents a separate embodiment of the invention.
[0038] In some embodiments, a protein product encoded from a spliced or mature mRNA of the NR2E3 gene that fully or completely includes exon 6, as obtained by the instant application, comprises 410 amino acids. In some embodiments, the protein product comprises amino acids encoded from positions 1-186 of exon 6 of the NR2E3 mRNA. In some embodiments, the protein product comprises amino acids in positions 250-311. In some embodiments, a mutated NR2E3 gene, as disclosed herein, is transcribed into an mRNA wherein exon 6 is partially excluded, thus giving rise to an NR2E3 protein being devoid of amino acids in positions 250-311 of the wildtype NR2E3 protein.
[0039] In some embodiments, the protein product comprises arginine to glutamine substitution in position 311 of the protein.
[0040] In some embodiments, the spliced or mature mRNA of the NR2E3 gene, obtained according to the instant application comprises at least 1,200, at least 1210, at least 1,220 or at least 1,230 nucleotides, or any value and range therebetween, and a G932A substitution. Each possibility represents a separate embodiment of the invention.
[0041] According to some embodiments, there is provided a method for suppressing or inhibiting exclusion of a portion of exon 6 of the NR2E3 pre-RNA from the mature mRNA product of NR2E3.
[0042] According to some embodiments, there is provided a method for suppressing or inhibiting exclusion of nucleotides in positions 748-933 of NR2E3 pre-RNA from the mature mRNA product of NR2E3.
[0043] In some embodiments, treating comprises including nucleotides in positions 748- 933 of the nuclear receptor subfamily, 2 group, E member 3 (NR2E3) pre-mRNA in at least one cell of the subject. In some embodiments, treating comprises including nucleotides in positions 748-933 of the nuclear receptor subfamily, 2 group, E member 3 (NR2E3) pre- mRNA in the subject.
[0044] In some embodiments, treating is with reduced toxicity or cellular toxicity.
[0045] In some embodiments, endogenous splicing of exon 6 comprises inclusion of exon 6 in the mature mRNA product of NR2E3.
[0046] In some embodiments, the splicing modulator induces full or complete inclusion of exon 6 in the mature mRNA product of NR2E3.
[0047] In some embodiments, the splicing modulator induces inclusion of nucleotides in positions 748-933 of the mature mRNA product of NR2E3.
[0048] In some embodiments, the splicing modulator is capable of binding to a pre-mRNA of the NR2E3 gene, and inducing or promoting full or complete inclusion of exon 6 in the mature NR2E3 mRNA.
[0049] In some embodiments, the splicing modulator is capable of binding to a pre-mRNA of the NR2E3 gene, and inducing or promoting inclusion of nucleotides in positions 748- 933 of the mature NR2E3 mRNA.
[0050] In some embodiments, the splicing modulator is capable of binding to a pre-mRNA of the NR2E3 gene, and suppressing exclusion of nucleotides in positions 748-933 of the mature NR2E3 mRNA.
[0051] In some embodiments, nucleotides in positions 748-933 of the mature NR2E3 mRNA, are located in exon 6 of the NR2E3 pre-mRNA.
[0052] In some embodiments, a retinal disease is or comprises an inherited retina disease.
[0053] In some embodiments, a retinal disease is a genetic retinal disease.
[0054] In some embodiments, a genetic retinal disease is induced by or involves a mutation inducing at least a partial exclusion of exon 6 of the NR2E3 mRNA.
[0055] In some embodiments, a genetic retinal disease is induced by or involves a mutation inducing at least a partial exclusion of nucleotides in positions 748-933 of the NR2E3 mRNA.
[0056] In some embodiments, a genetic retinal disease is induced by or involves a mutation resulting in a short NR2E3 protein compared to the wildtype NR2E3 protein.
[0057] In some embodiments, the short NR2E3 protein comprises 348 amino acids. In some embodiments, the short NR2E3 protein is devoid of or missing 62 amino acids encoded from nucleotides in positions 748-933 of the NR2E3 mRNA.
[0058] In some embodiments, the wildtype NR2E3 protein comprises 410 amino acids.
[0059] In some embodiments, the method comprises administering a splicing modulator which is at least one synthetic antisense oligonucleotide (ASO).
[0060] In some embodiments, the ASO is chemically modified. In some embodiments, the chemical modification is a modification of a backbone of the ASO. In some embodiments, the chemical modification is a modification of a sugar of the ASO. In some embodiments, the chemical modification is a modification of a nucleobase of the ASO. In some embodiments, the chemical modification increases stability of the ASO in a cell. In some embodiments, the chemical modification increases stability of the ASO in vivo. In some embodiments, the chemical modification increases the ASO’s ability to modulate splicing. In some embodiments, the chemical modification increases the ASO’s ability to induce full or complete inclusion of exon 6 of the NR2E3 pre-mRNA. In some embodiments, the chemical modification increases the ASO’s ability to induce inclusion of nucleotides in positions 748-933 of the NR2E3 pre-mRNA. In some embodiments, the chemical modification increases the ASO’s ability to suppress exclusion of nucleotides in positions 748-933 from the mature NR2E3 mRNA. In some embodiments, the chemical modification increases the half-life of the ASO. In some embodiments, the chemical modification inhibits polymerase extension from the 3’ end of the ASO. In some embodiments, the chemical modification inhibits recognition of the ASO by a polymerase. In some embodiments, the chemical modification inhibits double-strand triggered degradation. In some embodiments, the chemically modified ASO does not trigger nucleic acid double- stranded degradationupon binding a NR2E3 pre-mRNA. In some embodiments, the chemical modification inhibits RISC-mediated degradation. In some embodiments, the chemical modification inhibits RISC-mediated degradation or any parallel nucleic acid degradation pathway.
[0061] In some embodiments, the ASO is devoid of a labeling moiety. In some embodiments, the ASO is not labeled. In some embodiments, the ASO does not emit a detectable signal or does not comprise moieties capable of being recognized so as to enable nucleic acid detection (e.g., digoxigenin and fluorescently labeled anti-DIG antibody). In some embodiments, a detectable signal comprises a dye or an emitting energy which provides detection of a compound, e.g., a polynucleotide, in vivo or in vitro. In some embodiments, a detectable signal comprises: a fluorescent signal, a chromatic signal, or a radioactive signal.
[0062] In some embodiments, the ASO is devoid of radioactive nucleobase(s); digoxigenin, streptavidin, biotin, a fluorophore, hapten label, CLICK label, amine label, or thiol label.
[0063] In some embodiments, the ASO comprises a phosphorodiamidate morpholino backbone (MPO).
[0064] In some embodiments, the ASO comprises a backbone selected from: a phosphateribose backbone, a phosphate-deoxyribose backbone, a phosphorothioate-deoxyribose backbone, a 2'-O-methyl-phosphorothioate backbone, a phosphorodiamidate morpholino backbone, a peptide nucleic acid backbone, a 2-methoxyethyl phosphorothioate backbone, an alternating locked nucleic acid backbone, a phosphorothioate backbone, N3'-P5' phosphoroamidates, 2'-deoxy-2'-fluoro-P-d-arabino nucleic acid, cyclohexene nucleic acid backbone nucleic acid, tricyclo-DNA (tcDNA) nucleic acid backbone, and a combination thereof.
[0065] In some embodiments, the ASO comprises 14 to 30 bases, 14 to 28 bases, or 14 to 26 bases. Each possibility represents a separate embodiment of the invention. In some embodiments, the ASO comprises or consists of 25 bases.
[0066] In some embodiments, the ASO is complementary to exon 6 of the NR2E3 pre- mRNA.
[0067] In some embodiments, exon 6 of the NR2E3 pre-mRNA comprises the sequence:GTGATCCTGCTGGAAGAGGCGTGGAGTGAACTCTTTCTCCTCGGGGCCATCCAGTGGTCTCTGCCTCTGGACAGCTGTCCTCTGCTGGCACCGCCCGAGGCCTCTGCTGCCGGTGGTGCCCAGGGCCGGCTCACGCTGGCCAGCATGGAGACGCGTGTCCTGCAGGAAACTATCTCTCGGTTCCGGGCATTGGCGGTGGACCCCACGGAGTTTGCCTGCATGAAGGCCTTGGTCCTCTTCAAGCCAG (SEQ ID NO: 7).
[0068] In some embodiments, the ASO has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% complementarity to an equal-length portion of a nucleic acid sequence derived from SEQ ID NO: 7, any value and range therebetween. Each possibility represents a separate embodiment of the invention. In some embodiments, the ASO has 70-80%, 75-85%, 80-90%, 85-95%, 90-99%, or 95-100% complementarity to an equal-length portion of a nucleic acid sequence derived from SEQ ID NO: 7. Each possibility represents a separate embodiment of the invention.
[0069] The term “complementary” refers to the ability of polynucleotides to form base pairs with one another. Base pairs are typically formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands. Complementary polynucleotide strands can base pair in the Watson-Crick manner (e.g., A to T, A to U, C to G), or in any other manner that allows for the formation of duplexes. As persons skilled in the art are aware, when using RNA as opposed to DNA, uracil rather than thymine is the base that is considered to be complementary to adenosine. However, when a U is denoted in the context of the present invention, the ability to substitute a T is implied, unless otherwise stated.
[0070] In some embodiments, the pre-mRNA is a wildtype pre-mRNA. In some embodiments, the pre-mRNA is a mutated pre-mRNA. In some embodiments, the NR2E3 pre-mRNA comprises SEQ ID NO: 1. In some embodiments, the ASO is complementary to a nucleic acid sequence comprising SEQ ID NO: 7.
[0071] In some embodiments, the ASO comprises a nucleic acid sequence selected from:GAACCGAGAGATAGTTTCCTGCAGG (SEQ ID NO: 1);GGAACCGAGAGATAGTTTCCTGCAG (SEQ ID NO: 2);TGGAACCGAGAGATAGTTTCCTGCA (SEQ ID NO: 3);CTGGAACCGAGAGATAGTTTCCTGC (SEQ ID NO: 4);CCTGGAACCGAGAGATAGTTTCCTG (SEQ ID NO: 5);GCCTGGAACCGAGAGATAGTTTCCT (SEQ ID NO: 6); or any combination thereof.
[0072] In some embodiments, the ASO comprises an active fragment of any one of SEQ ID Nos: 1-6.
[0073] As used herein, the term “active fragment” refers to a fragment that is 100% identical to a contiguous portion of the full nucleotide sequence of the ASO, providing that at least: 30%, 40%, 50%, 60%, 70%, 80% or 90% of the activity of the original ASO nucleotide sequence is retained, or any value and range therebetween. Each possibility represents a separate embodiment of the present invention.
[0074] In some embodiments, the ASO is specific to a NR2E3 pre-mRNA.
[0075] As used herein, the term “specific” refers to both base pair specificity and also gene specificity. In some embodiments, the ASO is specific to the NR2E3 gene. In some embodiments, the ASO is specific to a splice activating motif in NR2E3. In some embodiments, the ASO is specific to a splice activating region of NR2E3. In some embodiments, the splice activating is splice activating of a part or a portion of exon 6 ofNR2E3.
[0076] In some embodiments, the ASO binds the NR2E3 pre-mRNA with perfect complementarity. In some embodiments, the ASO does not bind any gene or pre-mRNA product thereof, other than NR2E3 with perfect complementarity. In some embodiments, the ASO does not bind any gene or pre-mRNA product thereof, other than NR2E3 with a complementarity of greater than 70, 75, 80, 85, 90, 95, 97, 99 or 100%. Each possibility represents a separate embodiment of the invention. In some embodiments, the ASO does not bind any gene or pre-mRNA product thereof, other than NR2E3 with a complementarity of greater than 90%. In some embodiments, the ASO binds SEQ ID NO: 7 with perfect complementarity. In some embodiments, the ASO does not bind any sequence other than SEQ ID NO: 7 with complementarity of greater than 70, 75, 80, 85, 90, 95, 97, 99 or 100%. Each possibility represents a separate embodiment of the invention. In some embodiments, the ASO does not bind any sequence other than SEQ ID NO: 7 with a complementarity of greater than 90%. In some embodiments, the ASO does not bind with perfect complementarity to anywhere in the genome or transcriptome (including pre-transcriptome, e.g., transcriptome comprising or consisting of pre-mRNA) of a cell other than within NR2E3. In some embodiments, the ASO does not bind with complementarity of greater than 70, 75, 80, 85, 90, 95, 97, 99 or 100% to anywhere in the genome or transcriptome (including pre-transcriptome, e.g., transcriptome comprising or consisting of pre-mRNA) of a cell other than within NR2E3. Each possibility represents a separate embodiment of theinvention. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammal is a human.
[0077] In some embodiments, the ASO modulates expression of NR2E3. In some embodiments, the ASO modulates splicing of NR2E3. In some embodiments, the ASO modulates splicing of exon 6 ofNR2E3. In some embodiments, the ASO does not cause an off-target effect. In some embodiments, off-target is a target other than NR2E3. In some embodiments, off-target is a target other than splicing of exon 6 of NR2E3. In some embodiments, the ASO does not substantially or significantly modulate expression of a gene other than NR2E3. In some embodiments, the ASO does not substantially or significantly modulate splicing of a gene other than NR2E3. In some embodiments, the ASO does not substantially or significantly modulate splicing of an exon other than exon 6 of NR2E3. In some embodiments, substantial modulation of expression is a change in expression of at least 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50%. Each possibility represents a separate embodiment of the invention. In some embodiments, substantial modulation of expression is a change in expression of at least 20%.
[0078] In some embodiments, the ASO is complementary to an exon-intron junction. In some embodiments the exon is exon 6 of the NR2E3 pre-mRNA. In some embodiments, the ASO is complementary to an aberrant splice junction residing within exon 6 of the NR2E3 pre-mRNA. In some embodiments, the aberrant splice junction within exon 6 of the NR2E3 comprises a substitution or mutation of G932A of the NR2E3 gene.
[0079] In some embodiments, the ASO is at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% complementary to an aberrant splice junction as disclosed herein, or any value and range therebetween. Each possibility represents a separate embodiment of the invention. In some embodiments, the ASO is 70-85%, 80-90%, 85-95%, 90-99%, or 95-100% complementary to an aberrant splice junction as disclosed herein. Each possibility represents a separate embodiment of the invention.
[0080] In some embodiments, an ASO as disclosed herein targets, complements, induces, or any combination thereof, the full or complete inclusion of exon 6 of NR2E3 pre-mRNA transcribed from a mutated allele of the NR2E3 gene.
[0081] In some embodiments, an ASO as disclosed herein targets, complements, induces, or any combination thereof, the inclusion of nucleotides in positions 748 to 933 of exon 6 of NR2E3 pre-mRNA transcribed from a mutated allele of the NR2E3 gene.
[0082] In some embodiments, the ASO of the invention is characterized by reduced toxicity or cellular toxicity. In some embodiments, the ASO of the invention is characterized by inducing inclusion of exon 6 in a transcript encoded by a mutated NR2E3 gene in at least one cell of a subject and with reduced toxicity to the cell and / or to the subject.
[0083] In some embodiments, the subject comprises or is characterized by having a genome comprising at least one mutation in exon 6 of NR2E3 rendering a partially or fully nonfunctional NR2E3 protein.
[0084] In some embodiments, the subject comprises or is characterized by having a genome comprising at least one mutation in exon 6 of NR2E3 resulting in splicing and exclusion of nucleotides in positions 748 to 933 of exon 6 of NR2E3 pre-mRNA transcribed therefrom.
[0085] In some embodiments, the substitution or mutation as disclosed herein is an in-frame mutation. In some embodiments, the substitution or mutation as disclosed herein is a missense mutation.
[0086] In some embodiments, the at least one mutation is c.932G>A (also referred to herein as "G932A substitution").
[0087] In some embodiments, the ASO is complementary to the mutation. In some embodiments, the ASO comprises a nucleotide being complementary to the mutation. In some embodiments, the ASO is 100% complementary to a sequence of exon 6 of NR2E3 pre-mRNA comprising c.932G>A mutation.
[0088] In some embodiments, the ASO is not 100% complementary to a sequence of exon 6 of NR2E3 pre-mRNA comprising c.932G>A mutation.
[0089] In some embodiments, a mutation as disclosed herein provides an arginine to glutamine substitution.
[0090] In some embodiments, "a mutation" as used herein, refers to a nucleotide substitution or modification which induces or results in a "retinal disease" in a subject harboring or comprising the mutation.
[0091] As used herein, the term "retinal disease" encompasses any symptom or manifestation related to diseases involving the retina. Methods for diagnosing retinal disease and / or symptoms associated therewith are common and would be apparent to one of ordinary skill in the art.
[0092] In some embodiments, the method is directed to improving at least one clinical parameter of a retinal disease in the subject.
[0093] As used herein, the terms “treatment” or “treating” of a disease, disorder, or condition encompasses alleviation of at least one symptom thereof, a reduction in the severity thereof, or inhibition of the progression thereof. Treatment need not mean that the disease, disorder, or condition is totally cured. To be an effective treatment, a useful composition herein needs only to reduce the severity of a disease, disorder, or condition, reduce the severity of symptoms associated therewith, or provide improvement to a patient or subject’s quality of life.
[0094] As used herein, the term "condition" includes anatomic and physiological deviations from the normal that constitute an impairment of the normal state of the living animal or one of its parts, that interrupts or modifies the performance of the bodily functions.
[0095] As used herein, the terms “subject” or “individual” or “animal” or “patient” or “mammal,” refers to any subject, particularly a mammalian subject, for whom therapy is desired, for example, a human.
[0096] In some embodiments, there is provided a method for treating retina disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a synthetic antisense oligonucleotide (ASO), wherein the ASO induces the full or complete inclusion of exon 6 of the NR2E3 pre-mRNA, thereby treating the retinal disease in the subject.
[0097] In some embodiments, the ASO induces inclusion of nucleotides in positions 748- 933 of the NR2E3 pre-mRNA, thereby treating the retinal disease in the subject.
[0098] In some embodiments, there is provided a method for treating retina disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a synthetic antisense oligonucleotide (ASO), wherein the ASO suppresses the exclusion of a portion of exon 6 from the NR2E3 pre-mRNA, thereby treating the retinal disease in the subject.
[0099] In some embodiments, the ASO suppresses the exclusion of nucleotides in positions 748-933 of the NR2E3 pre-mRNA, thereby treating the retinal disease in the subject.
[0100] In some embodiments, the at least one ASO is in a pharmaceutical composition comprising the at least one ASO, and a pharmaceutically acceptable carrier.
[0101] In some embodiments, the composition further comprises a cell penetrating peptide (CPP). In some embodiments, the at least one ASO is conjugated to the CPP In some embodiments, there is provided a pharmaceutical composition comprising an effective amount of a conjugate comprising a CPP and at least one ASO of the invention.
[0102] In some embodiments, there is provided a conjugate comprising the ASO of the invention bound to a CPP. In some embodiments, bound is directly or indirectly bound. In some embodiments, directly bound is via a covalent bond. In some embodiments, indirectly bound is via a linker. In some embodiments, a linker is a flexible linker. In some embodiments, a linker is a rigid linker. In some embodiments, a linker comprises or is an amino acid-based linker, e.g., at least one amino acid.
[0103] Types and sequences of CPPs are available online and would be apparent to one of ordinary skill in the art, such as review by Bottens and Yamada (Cancers, 2022 Nov; 14(22): 5546; or in WO2021119756A1).
[0104] In some embodiments, the CPP comprises or consists of the amino acid sequence: RRSRTARAGRPGRNSSRPSAPR (SEQ ID NO: 9). In some embodiments, the CPP comprises the amino acid sequence set forth in SEQ ID NO: 9, or an analog thereof having at least 60%, 70%, 80%, 90%, or 99% homology or identity thereto. Each possibility represents a separate embodiment of the invention.
[0105] In some embodiments, an analog is a functional analog. In some embodiments, a functional analog is not identical to SEQ ID NO: 9, but retains the activity or has at least 90% the activity of SEQ ID NO: 9, e.g., cell penetrating / penetration activity.
[0106] In some embodiments, the conjugate of the invention, comprising the ASO of the invention directly conjugated or bound to a CPP, is characterized by reduced toxicity or cellular toxicity. In some embodiments, the conjugate of the invention, comprising the ASO of the invention conjugated or bound to a CPP, is characterized by inducing inclusion or retention of exon 6 in a transcript encoded by a mutated NR2E3 gene in at least one cell of a subject with reduced toxicity to the cell and / or to the subject.
[0107] In some embodiments, the ASO is conjugated to a CPP comprising an amino acid sequence set forth in SEQ ID NO: 9. In some embodiments, the conjugate comprises anASO of the invention and SEQ ID NO: 9, or an analog thereof. In some embodiments, the conjugate of the invention consists of an ASO of the invention covalently bound to SEQ ID NO: 9, or an analog thereof. In some embodiments, the conjugate comprises an ASO of the invention and a CPP comprising an amino acid set forth in SEQ ID NO: 9, or an analog thereof. In some embodiments, the conjugate of the invention consists of an ASO of the invention covalently bound to a CPP comprising an amino acid set forth in SEQ ID NO: 9, or an analog thereof.
[0108] As used herein, the terms “inclusion” and “retention” in the context of exon 6 of a mutated NR2E3 gene or a transcript encoded therefrom, are interchangeable.Composition
[0109] According to some embodiments, there is provided a composition comprising a therapeutically effective amount of at least one ASO comprising phosphorodiamidate morpholino backbone and a nucleic acid sequence set forth in any one of SEQ ID Nos: 1-6.
[0110] In some embodiments, the at least one ASO comprises 14 to 30 bases having at least 80% complementarity to a NR2E3 pre-mRNA. In some embodiments, the at least one ASO is characterized by inducing inclusion of nucleotides in positions 748-933 of the NR2E3 pre-mRNA.
[0111] In some embodiments, the composition further comprises a CPP. In some embodiments, the at least one ASO is conjugated to a CPP.
[0112] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.
[0113] The term “pharmaceutically acceptable carrier” as used herein refers to any of the standard pharmaceutical carriers known in the field such as sterile solutions, tablets, coated tablets, and capsules. Typically, such carriers contain excipients such as starch, milk, sugar, certain types of clay, gelatin, stearic acids, or salts thereof, magnesium or calcium stearate, talc, vegetable fats or oils, gums, glycols, or other known excipients. Such carriers may also include flavor and color additives or other ingredients. Examples of pharmaceutically acceptable carriers include, but are not limited to, the following: water, saline, buffers, inert, nontoxic solids (e.g., mannitol, talc). Compositions comprising such carriers are formulated by well-known conventional methods. Depending on the intended mode of administration and the intended use, the compositions may be in the form of solid, semi-solid, or liquiddosage forms, such, for example, as powders, granules, crystals, liquids, suspensions, liposomes, nano-particles, nano-emulsions, pastes, creams, salves, etc., and may be in unitdosage forms suitable for administration of relatively precise dosages.
[0114] In some embodiments, the pharmaceutical composition is formulated for systemic administration. In some embodiments, the pharmaceutical composition is formulated for administration to a subject. In some embodiments, the subject is a human subject. It will be understood by a skilled artisan that a pharmaceutical composition intended to administration to a subj ect should not have off-target effects, e.g., effects other than the intended therapeutic ones. In some embodiments, the pharmaceutical composition is devoid of a substantial effect on a gene other than NR2E3. In some embodiments, the pharmaceutical composition is devoid of a substantial effect on splicing of an exon other than exon 3 of NR2E3. In some embodiments, a substantial effect is one with a phenotypic result. In some embodiments, a substantial effect is a deleterious effect. In some embodiments, deleterious is with respect to the health and / or wellbeing of the subject.
[0115] In some embodiments, the composition is administered via a route selected from: topical administration, local administration, ocular administration, retinal administration, ophthalmic administration, systemic administration, intravitreal administration, or any combination thereof. In some embodiments, the composition is formulated for: topical administration, local administration, ocular administration, retinal administration, ophthalmic administration, systemic administration, intravitreal administration, or any combination thereof inhalation composition. In some embodiments, an ASO as disclosed and as described hereinabove, or a pharmaceutical composition comprising thereof, is used in the modulation of splicing of a NR2E3 pre-mRNA transcribed from aNR2E3 gene having a mutated exon 6.
[0116] The phrase “modulation of splicing” as used herein refers to affecting a change in the level of any RNA or mRNA variant produced by the NR2E3 native, mutated, or both, pre-mRNA.
[0117] In certain embodiments, the use is for increasing the level of an mRNA molecule comprising nucleotides in positions 748-933 of a mutated exon 6.
[0118] In some embodiments, the method (or use) comprises increasing the amount and / or abundance of an mRNA molecule encoded by a mutated NR2E3 gene, wherein the mRNA comprises nucleotides in positions 748-933 of a mutated exon 6 of the NR2E3 gene. In someembodiments, the method (or use) comprises reducing the amount and / or abundance of an mRNA molecule encoded by a mutated NR2E3 gene, wherein the mRNA is devoid or at least partially devoid of nucleotides in positions 748-933 of a mutated exon 6 of the NR2E3 gene.
[0119] Increasing and / or reducing is compared to a control, as defined herein.
[0120] In some embodiments, increasing is by at least 5%, 10%, 20%, 50%, 70%, 100%, 250%, 400%, 550%, 680%, 750%, 900%, or at least 1,000% compared to a control, or any value and range therebetween. Each possibility represents a separate embodiment of the invention. In some embodiments, increasing is by 5-100%, 10-150%, 20-200%, 50-350%, 70-450%, 100-800%, 250-1,000%, 40-390%, 55-190%, 6-80%, or 70-1,200% compared to a control. Each possibility represents a separate embodiment of the invention.
[0121] In some embodiments, reducing is by at least 5%, 10%, 20%, 50%, 70%, or 100% compared to a control, or any value and range therebetween. Each possibility represents a separate embodiment of the invention. In some embodiments, reducing is by 5-100%, 10- 100%, 20-100%, 50-100%, 70-100%, or 90-100% compared to a control. Each possibility represents a separate embodiment of the invention.
[0122] In some embodiments, an ASO as disclosed and as described hereinabove, or a pharmaceutical composition comprising thereof, is used in method for improving at least one clinical parameter of a retinal disease. In some embodiments, an ASO as disclosed and as described hereinabove, or a pharmaceutical composition comprising thereof, is used in treating of a retinal disease.
[0123] In some embodiments, the composition of the invention is characterized by reduced toxicity. In some embodiments, toxicity is or comprises cellular toxicity (e.g., cytotoxicity). In some embodiments, the composition of the invention is characterized by inducing inclusion of exon 6 in a transcript encoded by a mutated NR2E3 gene in at least one cell of a subject and with reduced toxicity to the cell and / or to the subject. In some embodiments, inducing inclusion of exon 6 of a mutated NR2E3 gene comprises restoring or correcting aberrant splicing of a transcript encoded by the mutated NR2E3 gene.
[0124] In some embodiments, recued is compared to a control. In some embodiments, control comprises or is a control AOS. In some embodiments, a control comprises or is a control composition. In some embodiments, a control composition comprises a controlASO. In some embodiments, a control ASO does not comprise a nucleic acid sequence as set forth in SEQ ID Nos: 1-6. In some embodiments, a control ASO does not comprise a phosphorodiamidate morpholino backbone (PMO backbone). In some embodiments, a control ASO does not comprise a nucleic acid sequence as set forth in SEQ ID Nos: 1-6 and a phosphorodiamidate morpholino backbone (PMO backbone). In some embodiments, a control ASO comprises a nucleic acid sequence as set forth in SEQ ID Nos: 1-6 and does not comprise phosphorodiamidate morpholino backbone (PMO backbone). In some embodiments, a control ASO does not comprise a nucleic acid sequence as set forth in SEQ ID Nos: 1-6 and comprises phosphorodiamidate morpholino backbone (PMO backbone). In some embodiments, a control ASO is not an ASO of the invention.General
[0125] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.
[0126] As used herein, the term "about" when combined with a value refers to plus and minus 10% of the reference value (±10%). For example, a length of about 1,000 nanometers (nm) refers to a length of 1,000 nm ± 100 nm.
[0127] It is noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a polynucleotide" includes a plurality of such polynucleotides and reference to "the polypeptide" includes reference to one or more polypeptides and equivalents thereof known to those skilled in the art, and so forth. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements or use of a "negative" limitation.
[0128] In those instances where a convention analogous to "at least one of A, B, and C, etc." is used, in general such a construction is intended in the sense one having skill in the artwould understand the convention (e.g., "a system having at least one of A, B, and C" would include but not be limited to systems that have A alone, B alone, C alone, A and B together, A and C together, B and C together, and / or A, B, and C together, etc.). It will be further understood by those within the art that virtually any disjunctive word and / or phrase presenting two or more alternative terms, whether in the description, claims, or drawings, should be understood to contemplate the possibilities of including one of the terms, either of the terms, or both terms. For example, the phrase "A or B" will be understood to include the possibilities of "A" or "B" or "A and B".
[0129] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the invention are specifically embraced by the present invention and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all subcombinations of the various embodiments and elements thereof are also specifically embraced by the present invention and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.
[0130] Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.
[0131] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
[0132] All scientific and technical terms used herein have meanings commonly used in the art unless otherwise specified. The definitions provided herein are to facilitate understanding of certain terms used frequently herein and are not meant to limit the scope of the present disclosure.
[0133] Before specific aspects and embodiments of the invention are described in detail, it is to be understood that this invention is not limited to particular methods, and experimentalconditions described, as such methods and conditions may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.
[0134] In the discussion unless otherwise stated, adjectives such as “substantially” and “about” modifying a condition or relationship characteristic of a feature or features of an embodiment of the invention, are understood to mean that the condition or characteristic is defined to within tolerances that are acceptable for operation of the embodiment for an application for which it is intended. Unless otherwise indicated, the word “or” in the specification and claims is considered to be the inclusive “or” rather than the exclusive or, and indicates at least one of, or any combination of items it conjoins.
[0135] It should be understood that the terms “a” and “an” as used above and elsewhere herein refer to “one or more” of the enumerated components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless specifically stated otherwise. Therefore, the terms “a”, “an” and “at least one” are used interchangeably in this application.
[0136] For purposes of better understanding the present teachings and in no way limiting the scope of the teachings, unless otherwise indicated, all numbers expressing quantities, percentages or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
[0137] In the description and claims of the present application, each of the verbs, “comprise”, “include” and “have” and conjugates thereof, are used to indicate that the object or objects of the verb are not necessarily a complete listing of components, elements or parts of the subject or subjects of the verb.
[0138] Other terms as used herein are meant to be defined by their well-known meanings in the art.
[0139] Unless specifically stated or obvious from context, as used herein, the term "or" is understood to be inclusive.
[0140] Throughout this specification and claims, the word “comprise”, or variations such as “comprises” or “comprising,” indicate the inclusion of any recited integer or group of integers but not the exclusion of any other integer or group of integers.
[0141] As used herein, the term “consists essentially of’, or variations such as “consist essentially of’ or “consisting essentially of’ as used throughout the specification and claims, indicate the inclusion of any recited integer or group of integers, and the optional inclusion of any recited integer or group of integers that do not materially change the basic or novel properties of the specified method, structure or composition.
[0142] As used herein, the terms "comprises", "comprising", "containing", "having" and the like can mean "includes", "including", and the like; "consisting essentially of or "consists essentially" likewise has the meaning ascribed in U.S. patent law and the term is open- ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments. In one embodiment, the terms "comprises", "comprising", "having" are / is interchangeable with "consisting".
[0143] While the present invention has been particularly described, persons skilled in the art will appreciate that many variations and modifications can be made. Therefore, the invention is not to be construed as restricted to the particularly described embodiments, and the scope and concept of the invention will be more readily understood by reference to the claims, which follow.EXAMPLES
[0144] Generally, the nomenclature used herein, and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birrenet al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes LIII Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes LIII Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); "Monoclonal Antibodies: Methods and Protocols". Vincent Ossipow, Nicolas Fischer. Humana Press (2014); "Monoclonal Antibodies: Methods and Protocols". Maher Albitar. Springer Science & Business Media (2007), all of which are incorporated by reference. Other general references are provided throughout this document.EXAMPLE 1
[0145] Fig. 1 shows that pho sphorodiamidate morpholino oligomers (PMOs) restore normal splicing for the mutated, NR2E3C 932G>Agene. As previously described, the inventors created plasmids coding for the wild type (NR2E3WT) and mutated (NR2E3c 932G>A) NR2E3 in HEK293 cells (see international patent application no. PCT / IL2023 / 051187). Plasmids were purchased from VectorBuilder encoding the sequence of transcript NM_014249.4, including all the exons and introns of the gene (with and without the c.932G>A mutation), and flag-tagged in the C-terminus. The inventors performed an ASOs mini-screen using semi-quantitative PCR and identified ASOs 1-6 (SEQ ID Nos: 1-6, respectively) that corrected the aberrant splicing and restored the expression of the full transcript (Figs. 1A and 1C). Further, the inventors confirmed correction of the aberrant splicing at the protein level by ASOs 1-6 (SEQ ID Nos: 1-6, respectively) using western blot analysis (Figs. IB and ID). In view of the above, the inventors concluded that ASOs harboring a nucleic acid sequence as set forth in SEQ ID Nos: 1-6, and comprising a morpholino backbone (e.g., pho sphorodiamidate morpholino oligomers (PMOs)), are sufficient to induce exon 6 retention in NR2E3 mRNA transcribed from a mutated gene comprising the c.932G>A mutation.EXAMPLE 2
[0146] To further enhance potential delivery of the PMOs, e.g., PMO-6 (SEQ ID NO: 6), an ASO comprising a PMO backbone and SEQ ID NO: 6 nucleic acid sequence, was conjugated to a short amino acid sequence (e.g., a peptide), also known to function as a “cell penetrating sequence (CPP)” (SEQ ID NO: 9; as disclosed in WO2021119756). The PMO- CPP conjugate is referred to hereinafter as the “peptide-PMO6 or “P-PMO6”. In Fig. 2 a comparative assay on the restoration of normal splicing in the NR2E3c 932G>Aconstruct, using PMO6 and P-PMO6 under nucleofection and free uptake conditions in HEK293 cells expressing the construct, is presented. Under nucleofection, both PMO-6 and P-PMO6 successfully restored normal splicing spicing at both the RNA (Fig. 2A) and protein (Fig. 2B) levels. Under both nucleofection and free uptake conditions, the correction using P- PM06 was highly pronounced. PM06 was found to effectively restore normal splicing primarily under nucleofection conditions.
[0147] In view of the above, the inventors further validated the results of Example 1. Further, the inventors concluded that an ASO of the invention, e.g., SEQ ID NO: 6, being conjugated to a CPP has further improved restoration of normal NR2E3 splicing (in a NR2E3C 932G>Acontext), regardless of whether provided to cells by a “free-uptake” route, or by means of nucleofection.EXAMPLES
[0148] Thus far, the results provided herein (e.g., under Examples 1-2) were demonstrated by using ASO and PMO correction on a plasmid construct in HEK293 cells (see international patent application no. PCT / IL2023 / 051187). Next, the inventors sought to demonstrate the splicing correction capabilities of ASOs of the invention on endogenous NR2E3C 932G>Atranscripts from patient (e.g., carrying the mutation) derived cells. The results show splicing correction of aberrant splicing resulting from the NR2E3C 932G>Amutation in patient derived fibroblast (Fig. 3). Briefly, cells of two patients homozygous for the NR2E3C 932G>Amutation were obtained from skin biopsies excised from the patients in the Hadassah medical center. Fibroblast lines were established from samples of the two patients and compared to a healthy control fibroblast line (purchased from HCC). Although NR2E3 is expressed predominantly in photoreceptor cells, its expression can still be detected in the patient fibroblasts, although at lower level. Nonetheless, it is important to note that the predicted aberrant splicing was indeed detected in the patients’ derived cells but not in thehealthy control (indicated by the lower band in Fig. 3). Both PMO-6 (SEQ ID NO: 6) and the CPP-conjugated ASO (P-PM06) induced correction of aberrant splicing compared to the corresponding controls. Of notion, the splicing correcting effect of P-PM06 was highly pronounced. To the best of the inventors’ knowledge, this result is the first evidence of successful splicing correction on patient cells.
[0149] In view of the above, the inventors conclude that an ASO of the invention, e.g., comprising a nucleic acid sequence as set forth in SEQ ID Nos: 1-6, and harboring a PMO backbone, can be used in a method for inducing inclusion of exon 6 of a mutated NR2E3 gene (e.g., NR2E3c 932G>A) in a subject in need thereof (and / or in a cell thereof), as well as in a method for treating a retinal disease in a subject in need thereof (e.g., characterized by at least one in-frame and / or missense mutation in exon 6 of NR2E3, such as c.932G>A).
[0150] While the present invention has been particularly described, a person of skill in the art will appreciate that many variations and modifications can be made. Therefore, the invention is not to be construed as restricted to the particularly described embodiments, and the scope and concept of the invention will be more readily understood by reference to the claims which follow.
Claims
CLAIMSWhat is claimed is:
1. A method for treating a retinal disease in a subject in need thereof, the method comprising administering to said subject a therapeutically effective amount of at least one synthetic antisense oligonucleotide (ASO) comprising a phosphorodiamidate morpholino backbone and a nucleic acid sequence set forth in any one of SEQ ID Nos: 1-6, thereby treating the retinal disease in the subject.
2. The method of claim 1, wherein said treating comprises including of nucleotides in positions 748-933 of the nuclear receptor subfamily, 2 group, E member 3 (NR2E3) pre-mRNA in said subject.
3. The method of claim 1 or 2, wherein said at least one ASO is of 25 to 30 bases.
4. The method of any one of claims 1 to 3, wherein said ASO has at least 75% complementarity to an equal-length portion of a nucleic acid sequence derived from the polynucleotide sequence:GTGATCCTGCTGGAAGAGGCGTGGAGTGAACTCTTTCTCCTCGGGGCCATCCAGT GGTCTCTGCCTCTGGACAGCTGTCCTCTGCTGGCACCGCCCGAGGCCTCTGCTGC CGGTGGTGCCCAGGGCCGGCTCACGCTGGCCAGCATGGAGACGCGTGTCCTGCA GGAAACTATCTCTCGGTTCCGGGCATTGGCGGTGGACCCCACGGAGTTTGCCTGC ATGAAGGCCTTGGTCCTCTTCAAGCCAG (SEQ ID NO: 7).
5. The method of any one of claims 1 to 4, wherein said subject comprises at least one inframe and / or missense mutation in exon 6 of NR2E3.
6. The method of claim 5, wherein said at least one mutation is c.932G>A.
7. The method of any one of claims 1 to 6, wherein said at least one ASO is in a pharmaceutical composition comprising said at least one ASO and a pharmaceutically acceptable carrier.
8. The method of claim 7, wherein said composition further comprises a cell penetrating peptide (CPP).
9. The method of claim 8, wherein said at least one ASO being conjugated to said CPP.
10. A composition comprising an ASO comprising a therapeutically effective amount of at least one synthetic antisense oligonucleotide (ASO) comprising a phosphorodiamidate morpholino backbone and a nucleic acid sequence set forth in any one of SEQ ID Nos: 1-6.
11. The composition of claim 10, further comprising a CPP.
12. The composition of claim 11, wherein said at least one ASO being conjugated to said CPP.
13. The composition of any one of claims 10 to 12, further comprising a pharmaceutically acceptable carrier.
14. The composition of any one of claims 10 to 13, for use in inducing the inclusion of nucleotides in positions 748-933 of the NR2E3 pre-mRNA, in a subject in need thereof.
15. The composition of use according to claim 14, wherein said subject in need thereof comprises a c.932G>A mutation in exon 6 of the NR2E3 pre-mRNA.
16. The composition for use according to claim 14 or 15, wherein said subject is afflicted with or at increased risk for developing a retinal disease.
17. The composition of any one of claims 10 to 13, for use in treatment or prevention of a retinal disease in a subject in need thereof.
18. The composition for use according to claim 17, wherein said treatment comprises inclusion of nucleotides in positions 748-933 of the NR2E3 pre-mRNA, in said subject.
Citation Information
Patent Citations
Antisense oligomers and uses thereof
US20190070213A1
Compositions and methods for treatment of eye diseases
WO2017106370A1
Novel cellular delivery methods
WO2021119756A1
Compositions and methods for treating retinal diseases
WO2024105673A1