Improved cell penetrating peptides and related compositions and methods

Abstract

Described herein are improved cell penetrating peptides and related compositions and methods.

Description

[0001] Improved Cell Penetrating Peptides and Related Compositions and Methods

[0002] Technical Field

[0003] The present disclosure generally is directed to cell penetrating peptides (CPPs) and related compositions and methods.

[0004] Background

[0005] Efficient intracellular delivery of therapeutic molecules, particularly polynucleotides, proteins and peptides as therapeutic agents (“biopolymeric therapeutic agents”) is an ongoing challenge. Further, many existing cell penetrating peptides (CPPs) and any associated cargo typically may become entrapped in the endosomal and lysosomal compartment. Thus, in order to fully exploit the advantages of biopolymeric therapeutic agents there is an ongoing need to develop ever-more efficient CPPs and related compositions and methods for intracellular of associated payloads.

[0006] Summary

[0007] The present disclosure provides cell penetrating peptides (CPPs) and related compositions and methods. Such compositions are particularly useful for ocular intracellular delivery of a CPP -linked cargo, e.g., a polynucleotide such as an oligonucleotide, an mRNA, a guide RNA, a peptide, or a protein linked.

[0008] Accordingly, in one aspect the present disclosure provides a cell penetrating peptide (CPP) comprising the amino acid sequence:

[0009] Wni(Xn2Yn3Zn4)n5 (SEQ ID NO:2); wherein:

[0010] W, X, or Z is an amino acid selected from Arg, Lys, or His; nl is 0 to 1 residues, n2 is 1 to 2 residues; n4 is 0 to 1 residue and n5 is 3 to 6 repeats;

[0011] Y is an amino acid selected from Ala, Ser, Gly, Asn, Pro, Thr, Phe, or Trp; and n3 is 1 to 5 residues; and wherein at each position, the amino acid is a D-amino acid or an L-amino acid. In another aspect the present disclosure provides a cell-penetrating peptide (CPP) comprising the amino acid sequence: (RXniR)n2RSGGR (SEQ ID NO:1); wherein Xniis an amino acid sequence 1-4 amino acids in length and n2 = 2 to 10 repeats, wherein 0 to n2 of the repeat (RXniR) sequences are identical, and wherein, at each position, the amino acid is a D-amino acid or an L-amino acid.

[0012] In some examples Xniis three amino acids in length.

[0013] In some examples at least one of the three amino acids in Xnihas a net positive charge.

[0014] In some examples the at least one amino acid has a side chain conferring a net charge of at least +1.

[0015] In some examples at least one Xnisequence comprises an arginine.

[0016] In some examples at least one Xnicomprises an amino acid sequence selected from the group consisting of: ASA, ANA, AFA, and AWA. In some examples at least one Xni comprises an amino acid sequence of ASA or ANA. In some examples at least one Xni comprises an amino acid sequence of ASA and ANA. In some examples at least one Xni comprises an amino acid sequence of AFA or AWA. In some examples at least one Xni comprises an amino acid sequence of AFA and ANA. In some examples at least one Xni comprises an amino acid sequence of ASA. In some examples at least one Xnicomprises an amino acid sequence of ANA. In some examples at least one Xnicomprises an amino acid sequence of AFA. In some examples at least one Xnicomprises an amino acid sequence of AWA.

[0017] In some examples n2 = 3 to 6 repeats. In some examples n2 = 3 repeats. In some examples n2 = 4 repeats. In some examples n2 = 5 repeats. In some examples n2 = 6 repeats.

[0018] In a related aspect the present disclosure also provides a cell-penetrating peptide (CPP) comprising the amino acid sequence corresponding to:

[0019] (i) any one of SEQ ID NOs:3, 7, or 11 with up to two amino acid substitutions;

[0020] (ii) any one of SEQ ID NOs: 4, 8, 9, 12-18with up to three amino acid substitutions; or

[0021] (iii) any one of SEQ ID NOs:5, 6, 10, or 19 with up to four amino acid substitutions. In some examples at least one of the amino acids substitutions is a net positively charged amino acid. In some examples at least one of the amino acids substitutions is substituted with an amino acid that is not a net positively charged amino acid. In some examples the amino acid that is not net positively charged is selected from the group consisting of: alanine, tryptophan, serine, asparagine, proline, and threonine. In some examples the amino acid that is not positively charged is alanine. In some examples the amino acid that is not positively charged is tryptophan. In some examples the amino acid that is not positively charged is serine. In some examples the amino acid that is not positively charged is asparagine. In some examples the amino acid that is not positively charged is proline. In some examples the amino acid that is not positively charged is threonine.

[0022] In some examples the CPP comprises an amino acid sequence selected from the above set of sequences mentioned in (i).

[0023] In some examples the CPP comprises an amino acid sequence selected from the above set of sequences mentioned in (ii).

[0024] In some examples the CPP comprises an amino acid sequence selected from the above set of sequences mentioned in (iii).

[0025] In some examples the CPP comprises multiple copies of an amino acid sequence corresponding to any one of SEQ ID NOs:3-19.

[0026] In some examples the length of the amino acid sequence of the CPP consists of 10 to 100 residues. In some examples the amino acid sequence of the CPP consists of 15 to 70 residues. In some examples the amino acid sequence of the CPP consists of 20 to 60 residues. In some examples the amino acid sequence of the CPP consists of 25 to 50 residues.

[0027] In some examples the CPP comprises multiple copies of an amino acid sequence selected from (i)-(iii).

[0028] In some examples the amino acid sequence of the CPP is the retro-inverso sequence of the amino acid sequence of any of the above-mentioned CPPs.

[0029] In some examples the CPP is a modified CPP comprising a moiety other than a canonical amino acid. In some examples the amino acid sequence of the CPP comprises at least one D-amino acid. In some examples the amino acid sequence of the CPP comprises only D- amino acids.

[0030] In some examples the amino acid sequence of the CPP comprises at least one L- amino acid. In some examples the amino acid sequence of the CPP comprises only L- amino acids.

[0031] In some examples the CPP is a modified CPP comprising a moiety other than a canonical amino acid. In some examples the moiety is selected from the group consisting of a detectable label, a non-canonical amino acid, a reactive group, a fatty acid, cholesterol, and a bioactive carbohydrate, and a lipid. In some examples the moiety is a detectable label. In some examples the moiety is a non-canonical amino acid. In some examples the moiety is a reactive group. In some examples the moiety is a fatty acid. In some examples the moiety is cholesterol. In some examples the moiety is a bioactive carbohydrate. In some examples the moiety is a lipid.

[0032] In some examples the CPP comprises the amino acid sequence corresponding to any one of SEQ ID NOs:2-9 or 11-19 In some examples the amino acid sequence of the CPP consists of the amino acid sequence corresponding to any one of SEQ ID NOs:2-9 or 11-19

[0033] In some examples the CPP comprises the amino acid sequence corresponding to SEQ ID NO: 10 with up to four amino acid substitutions. In some examples the CPP comprises the amino acid sequence corresponding to SEQ ID NO: 10. In some examples the CPP comprises the amino acid sequence corresponding to SEQ ID NO: 10 with one substitution. In some examples the CPP comprises the amino acid sequence corresponding to SEQ ID NO: 10 with two substitutions. In some examples the CPP comprises the amino acid sequence corresponding to SEQ ID NO: 10 with three substitutions. In some examples the amino acid sequence of the CPP consists of the amino acid sequence corresponding to SEQ ID NO: 10. In some examples, where the amino acid sequence corresponds to SEQ ID NO: 10, the amino acids in the sequence of the CPP, other than glycine, are all in D-form. In other examples, where the amino acid sequence corresponds to SEQ ID NO: 10, the amino acids in the sequence of the CPP, other than glycine, are all in L-form. The present disclosure also provides a CPP conjugate comprising a CPP linked to a polynucleotide or a protein. In some examples the CPP conjugate comprises a CPP linked to a polynucleotide. In some examples the CPP conjugate comprises a CPP linked to a protein. In some examples the polynucleotide is an oligonucleotide.

[0034] In some examples the oligonucleotide is a double-stranded oligonucleotide. In some examples the oligonucleotide is about 18 to about 40 nucleotides in length.

[0035] In some examples the polynucleotide in the CPP conjugate is selected from the group consisting of: siRNA, antisense oligonucleotide, gapmer, steric blocking oligonucleotide, peptide nucleic acid (PNA), and phosphorodiamidate morpholino oligomer (PMO).

[0036] In some examples the polynucleotide comprises an RNA. In some examples the RNA is a mRNA encoding at least one protein. In some examples the at least one protein comprises the amino acid sequence of a gene editor protein. In some examples the RNA comprises a guide RNA or a hybrid guide RNA. In some examples the RNA comprises a guide RNA. In some examples the RNA comprises a hybrid guide RNA.

[0037] In some examples the CPP is linked to a protein. In some examples the protein comprises a gene editor protein. In some examples the protein comprises a Cas9 nickase. In some examples the protein comprising a Cas9 nickase further comprises a reverse transcriptase.

[0038] In some examples the polynucleotide or the protein is covalently linked to the CPP. In some examples the covalently linked polynucleotide or protein is covalently linked at the N-terminal of the CPP. In some examples the covalently linked polynucleotide or protein is covalently linked at the C-terminal of the CPP.

[0039] The present disclosure also provides a modified cell comprising any of the above- mentioned CPPs or CPP conjugate intracellularly. In some examples the modified cell comprises a CPP intracellularly. In some examples the modified cell comprises a CPP conjugate intracellularly.

[0040] The present disclosure also provides any of the above-mentioned CPPs, CPP conjugates, or modified cells for use in the manufacture of a medicament or diagnostic agent. The present disclosure also provides a pharmaceutical composition comprising any of the above-mentioned CPPs, CPP conjugates, or modified cells, and a pharmaceutically acceptable excipient.

[0041] Also provided by the present disclosure is a method for delivering a CPP or a CPP conjugate to a cell by contacting the cell with any of the CPPs or CPP conjugate provided herein. In some examples the contacting is performed ex vivo. In other examples the contacting is performed in vivo.

[0042] Key to Sequence Listing

[0043] SEQ ID NO:1 Formula I

[0044] SEQ ID NO:2 Formula II

[0045] SEQ ID NO:3 CPP 1

[0046] SEQ ID NO:4 CPP 2

[0047] SEQ ID NO:5 CPP 3

[0048] SEQ ID NO:6 CPP 4

[0049] SEQ ID NO: 7 CPP 5

[0050] SEQ ID NO:8 CPP 6

[0051] SEQ ID NO:9 CPP 7

[0052] SEQ ID NO: 10 CPP 8

[0053] SEQ ID NO: 11 CPP 9

[0054] SEQ ID NO: 12 CPP 10

[0055] SEQ ID NO: 13 CPP 11

[0056] SEQ ID NO: 14 CPP 12

[0057] SEQ ID NO: 15 CPP 13

[0058] SEQ ID NO: 16 CPP 14

[0059] SEQ ID NO: 17 CPP 15

[0060] SEQ ID NO: 18 CPP 16

[0061] SEQ ID NO: 19 CPP 17

[0062] SEQ ID NO:20 Linker 1

[0063] SEQ ID NO:21 Linker 2

[0064] SEQ ID NO:22 Linker 3

[0065] SEQ ID NO:23 ASO targeting exon 7 of mouse Smn gene

[0066] SEQ ID NO:24 ASO targeting exon 8 of rabbit Smn gene SEQ ID NO:25 ASO targeting 5' UTR of human Opal gene

[0067] Brief Description of Drawings

[0068] Figure 1 shows a plot of the in vitro evaluation of the efficacy of peptide-PMO conjugates as assessed through exon skipping. The proportion of SmnA7 was measured through RT-PCR using a Lab Chip GX nucleic acid analyser. Cell viability is also shown on this plot and was measured using a CellTiter-Glo® luminescent assay.

[0069] Figure 2 shows a plot of the in vivo evaluation of the efficacy of peptide-PMO conjugates in mouse neural retina as assessed through exon skipping. The proportion of SmnA7 was measured through RT-PCR using a Lab Chip GX nucleic acid analyser. D7 = samples harvested 7 days post-injection and D28 = samples harvested 28 days postinjection.

[0070] Detailed Description

[0071] General

[0072] Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or groups of compositions of matter. Thus, as used herein, the singular forms “a”, “an” and “the” include plural aspects unless the context clearly dictates otherwise. For example, reference to “a” includes a single as well as two or more; reference to "an" includes a single as well as two or more; reference to “the” includes a single as well as two or more and so forth.

[0073] Each example of the present disclosure described herein is to be applied mutatis mutandis to each and every other example unless specifically stated otherwise.

[0074] Those skilled in the art will appreciate that the disclosure herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the disclosure includes all such variations and modifications. The disclosure also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.

[0075] The present disclosure is not to be limited in scope by the specific examples described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the disclosure, as described herein.

[0076] The present disclosure is performed without undue experimentation using, unless otherwise indicated, conventional techniques of molecular biology, microbiology, virology, recombinant DNA technology, peptide synthesis in solution, solid phase peptide synthesis, organic chemistry and immunology. Such techniques are described and explained throughout the literature in sources such as Perbal 1984, Sambrook et al., 2001, Brown (editor) 1991, Glover and Hames (editors) 1995 and 1996, Ausubel et al. including all updates until present, Coligan et al. (editors) (including all updates until present), Maniatis et al. 1982, Gait (editor) 1984, Hames and Higgins (editors) 1984, Freshney (editor) 1986.

[0077] The term “and / or”, e.g, “X and / or Y” shall be understood to mean either "X and Y" or "X or Y" and shall be taken to provide explicit support for both meanings or for either meaning.

[0078] The term “about”, unless stated to the contrary, refers to + / - 20%, more preferably + / - 10%, of the designated value. For the avoidance of doubt, the term “about” followed by a designated value is to be interpreted as also encompassing the exact designated value itself (for example, “about 10” also encompasses 10 exactly).

[0079] Throughout this specification the word “comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

[0080] The term “peptide” is intended to include compounds composed of amino acid residues linked by amide bonds. A peptide may be natural or unnatural, ribosome encoded or synthetically derived. Typically, a peptide will consist of between 2 and 200 amino acids. For example, the peptide may have a length in the range of 10 to 20 amino acids or 10 to 30 amino acids or 10 to 40 amino acids or 10 to 50 amino acids or 10 to 60 amino acids or 10 to 70 amino acids or 10 to 80 amino acids or 10 to 90 amino acids or 10 to 100 amino acids, including any length within said range(s). The peptide may comprise or consist of fewer than about 150 amino acids or fewer than about 125 amino acids or fewer than about 100 amino acids or fewer than about 90 amino acids or fewer than about 80 amino acids or fewer than about 70 amino acids or fewer than about 60 amino acids or fewer than about 50 amino acids.

[0081] Peptides, as referred to herein, include "inverso" peptides in which all L-amino acids are substituted with the corresponding D-amino acids, "retro-inverso" peptides in which the sequence of amino acids is reversed and all L-amino acids are replaced with D-amino acids.

[0082] Peptides may comprise amino acids in both L- and / or D-form. For example, both L- and D-forms may be used for different amino acids within the same peptide sequence. In some examples the amino acids within the peptide sequence are in L-form, such as natural amino acids. In some examples the amino acids within the peptide sequence are a combination of L- and D-form.

[0083] The term "amino acid" relates to any amino acid, including natural and nonnatural amino acids. Included within this definition are Arginine, Lysine, Homoarginine (Har), and Histidine as well as derivatives thereof. Suitable non-natural amino acids are described in US 6,858,396.

[0084] The term “canonical amino acid” refers to an amino acid encoded directly by the codons of the universal genetic code. The canonical amino acids are: Alanine, Arginine, Asparagine, Aspartic acid, Cysteine, Glutamic acid, Glutamine, Glycine, Histidine, Isoleucine, Leucine, Lysine, Methionine, Phenylalanine, Proline, Serine, Threonine, Tryptophan, Tyrosine, and Valine.

[0085] A "conservative" amino acid substitution is one in which an amino acid residue is replaced with another amino acid residue having a side chain with similar physicochemical properties. Amino acid residues having side chains with similar physiochemical properties are known in the art, and include amino acids with basic side chains (e.g, lysine, arginine, histidine), acidic side chains (e.g, aspartic acid, glutamic acid), uncharged polar side chains (e.g, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g, threonine, valine, isoleucine) and aromatic side chains e.g, tyrosine, phenylalanine, tryptophan, histidine). Conservative amino acid substitutions include those with amino acids, which have been substituted with non-naturally occurring amino acids and non-proteogenic amino acids, which are therefore not among the regular amino acids encoded by the genetic code. Examples of non-proteogenic amino acids include, but are not limited to, ornithine, citrulline (Cit), diaminobutyric acid (Dab), diaminopropionic acid (Dap), 2- Aminoisobutyric acid, a-Amino-n-butyric acid, Norvaline, Norleucine, Alloisoleucine, t-leucine, Ornithine, Allothreonine, P-Alanine, P-Amino-n-butyric acid, N-isopropyl glycine, Isoserine, and Sarcosine and pyroglutamic acid. Conservative amino acid substitutions further include D-amino acids. In some examples the amino acid sequence of a CPP is a retro-inverso amino acid sequence.

[0086] Cell-Penetrating Peptides

[0087] The term “cell penetrating peptide” (CPP) refers to a peptide that is capable of crossing a cellular membrane. In one example, a CPP is capable of translocating across a mammalian cell membrane and entering into a cell. In another example, a CPP may direct a conjugate to a desired subcellular compartment. Thus, a CPP may direct or facilitate penetration of a molecule of interest across a phospholipid, mitochondrial, endosomal, lysosomal, vesicular, or nuclear membrane.

[0088] A CPP may direct a molecule of interest from outside a cell through the plasma membrane, and into the cytoplasm or a desired subcellular compartment. Alternatively, or in addition, a CPP may direct a molecule of interest across the blood-brain, trans- mucosal, hematoretinal, skin, gastrointestinal and / or pulmonary barriers.

[0089] Accordingly, in some examples provided herein is a cell-penetrating peptide (CPP) comprising the amino acid sequence: cell penetrating peptide (CPP) comprising the amino acid sequence:

[0090] Wni(Xn2Yn3Zn4)n5 (SEQ ID NO:2) corresponding to Formula I; where:

[0091] W, X, or Z is an amino acid selected from Arg, Lys, or His; nl is 0 to 1 residues, n2 is 1 to 2 residues; n4 is 0 to 1 residue and n5 is 4 to 6 repeats;

[0092] Y is an amino acid selected from Ala, Ser, Gly, Asn, Pro, Thr, Phe, or Trp; and n3 is 1 to 5 residues; and wherein at each position, the amino acid is a D-amino acid or an L-amino acid.

[0093] In some examples a CPP according to above-mentioned Formula I comprises an amino acid sequence comprising or consisting of the amino acid sequence, wherein the amino acid sequence of the CPP comprises: (i) eight or fewer arginines, seven or fewer alanines; (iii) two or fewer serines; (iii) one or fewer asparagines; or (iv) one or fewer glycines. In some examples, a CPP according to Formula I comprises at least one amino acid in L-form. In other examples a CPP according to Formula I does not comprise a CPP in which the amino acid sequence corresponds to SEQ ID NO: 10 with each residue, other than glycine, in D-form. In some examples a CPP according to Formula I does not comprise a CPP in which the amino acid sequence corresponds to SEQ ID NO:10.

[0094] In some examples a CPP according to above-mentioned Formula I comprises an amino acid sequence comprising or consisting of the amino acid sequence corresponding to SEQ ID NO: 10 with 1 to 3 amino acid substitutions.

[0095] In other examples provided herein is a CPP comprising the amino acid sequence: (RXniR)n2RSGGR (SEQ ID NO:1) corresponding to Formula II; wherein Xniis an amino acid sequence 1-4 amino acids in length and n2 = 2 to 10 repeats, wherein 0 to m of the repeat (RXniR) sequences are identical, and wherein at each position the amino acid is a D-amino acid or an L-amino acid.

[0096] In some examples the “Xni” subsequence is three amino acids in length. In other examples, the Xnisubsequence is 1, 2, 4, 6, 7, 8, 9, or 10 amino acids in length. In some preferred examples at least one of the amino acids in the Xnisubsequence has a net positive charge. In some examples that at least one net positively charged amino acid has a net charge of +1. In some examples at least one Xnisubsequence includes an arginine. In some examples at least one Xnisubsequence includes an amino acid sequence selected from the group consisting of: ASA, ANA, AFA, and AWA. In some examples the Xnisubsequence includes ASA and / or ANA. In other examples the Xnisubsequence includes AFA and / or AWA. In some examples of the above-mentioned CPPs the number of repeats “n?” in (RXniR)n2RSGGR (SEQ ID NO:1) is 3 to 9 repeats, e.g., 3, 4, 5, 6, 7, 8, or 9 repeats. In other examples the number of repeats (n?) is 3 to 6 repeats, e.g, 3, 4, 5, or 6 repeats.

[0097] In other examples a CPP comprises the amino acid sequence corresponding to:

[0098] (i) any one of SEQ ID NOs:3, 7, or 11 with up to two amino acid substitutions;

[0099] (ii) any one of SEQ ID NOs : 4, 7-9, or 12-18 with up to three amino acid substitutions; or

[0100] (iii) any one of SEQ ID NOs:5, 6, 10, or 19 with up to four amino acid substitutions. In some embodiments at least one of the above amino acid substitutions is a net positively charged amino acid. In other examples, where a substitution is to be introduced, the original amino acid is substituted with an amino acid that is not a net positively charged amino acid, e.g, alanine, tryptophan, serine, asparagine, proline, or threonine.

[0101] In some examples the length of the amino acid sequence of any of the foregoing CPPs consists of 10 to 100 residues, e.g., 11, 12, 15, 18, 20, 25, 26, 30, 35, 40, 45, 48, 50, 52, 60, 65, 70, 75, 80, 85, 90, 95, or another number of amino acid residues from 10 to 100. In other examples the length of amino acid sequence of any of the foregoing CPPs consists of 15 to 70 residues, e.g., 17, 18, 20, 25, 30, 35, 40, 45, 48, 50, 52, 60, 65, or another number of residues from 15 to 70 residues. In other examples the length of the amino acid sequence of any of the foregoing CPPs consists of 20 to 60 residues, e.g., 22, 24, 25, 27, 28, 30, 35, 40, 42, 43, 45, 48, 50, 52, 54, 57, 58, or another number of residues from 20 to 60 residues. In some examples, the length of the amino acid sequence of any of the foregoing CPPs consists of 25 to 50 residues, e.g., 26, 29, 30, 32, 35, 36, 38, 40, 42, 43, 45, 57, 58, or another number of residues from 35 to 50 residues.

[0102] In some examples the amino acid sequence of a CPP provided herein includes at least one D-amino acid. In some examples the amino acid sequence of a CPP includes only D-amino acids. In other examples, a CPP includes at least one L-amino acid. In some example the CPP includes only L-amino acids. In some examples the amino acid sequence of a CPP provided herein is the retro-inverso sequence of any of the CPP amino acid sequence enumerated herein. In some examples, a CPP provided herein is a modified CPP by virtue of comprising a moiety other than a canonical amino acid. Such modifications include, but are not limited to, non-peptide linkers, and detectable labels, as described in further detail herein.

[0103] In some preferred examples a CPP comprises the amino acid sequence corresponding to SEQ ID NO: 10 with up to four amino acid substitutions. In other preferred examples the CPP comprises the amino acid sequence corresponding to SEQ ID NO: 10. In yet other preferred examples the amino acid sequence of a CPP provided herein consists of the amino acid sequence corresponding to SEQ ID NO: 10. In some examples each of the amino acids in SEQ ID NO: 10 other than glycine is in the D-form. In other examples each of the amino acids in SEQ ID NO: 10 other than glycine is in the L-form.

[0104] Modified CPPs

[0105] In some examples a CPP is a modified CPP comprising a moiety other than a canonical amino acid. Such modified CPPs may confer additional functionalities to a CPP, such as facilitating detection of CPP entry, localisation within cells, enhanced cell entry, and / or reduced CPP degradation in vitro or in vivo. Suitable moieties for a modified CPP include, but are not limited to any moiety selected from the group consisting of a detectable label, a non-canonical amino acid, a reactive group, a fatty acid, cholesterol, a bioactive carbohydrate, a lipid, a nanoparticle, a small molecule drug, and a polynucleotide. In some examples the moiety in a modified CPP is a D-amino acid. In some examples the moiety in a modified CPP is a detectable label.

[0106] Detectable Labels

[0107] The term “detectable label” refers to any type of molecule which can be detected by optical, fluorescent, isotopic imaging or by mass spectroscopic techniques, or by performing simple enzymatic assays. Any detectable label known in the art may be used. In some examples the detectable label is selected from among a fluorophore, a fluorogenic substrate, a luminogenic substrate, and a biotin. A fluorescent tag may be a fluorophore. For example, a fluorophore may be fluorescein isothiocyanate, fluorescein thiosemicarbazide, rhodamine, Texas Red, a CyDye such as Cy3, Cy5 and Cy5.5, a Alexa Fluor such as Alexa488, Alexa555, Alexa594 and Alexa647) or a near infrared fluorescent dye. A fluorophore may be a pH-sensitive fluorescent probe. For example, a pH-sensitive fluorescent probe may be naphthofluorescein, A fluorescent tag may be a fluorescent protein. For example, a fluorescent protein may be green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), AcGFP or TurboGFP, Emerald, Azami Green, ZsGreen, EBFP, Sapphire, T-Sapphire, ECFP, mCFP, Cerulean, CyPet, AmCyanl, Midori -Ishi Cyan, mTFPl (Teal), enhanced yellow fluorescent protein (EYFP), Topaz, Venus, mCitrine, YPet, PhiYFP, ZsYellowl, mBanana, Kusabira,ange, mOrange, dTomato, dTomato- Tandem, AsRed2, mRFPl, Jred, mCherry, HcRedl, mRaspberry, HcRedl, HcRed- Tandem, mPlum, AQ 143. A fluorescent tag may be a quantum dot. In some examples, where the detectable label is a fluorophore, the fluorophore is a pH-sensitive fluorescent probe. Suitable pH-sensitive fluorescent probes include, but are not limited to, naphthofluorescein, pHrodo™ Green (ThermoFisher), and pHrodo™ Red (ThermoFisher). Fluorescent tags may be detected using fluorescent microscopes such as epifluorescence or confocal microscopes, fluorescence scanners such as microarray readers, spectrofluorometers, microplate readers and / or flow cytometers.

[0108] In some examples the detectable label is a fluorogenic substrate. Suitable fluorogenic substrates include fluorogenic substrates of P-lactamase (e.g, CCF-2-AM, CCF4-AM, and any of those described in U.S. Patent No. 7,427,680) and P-gal (e.g, HMRef-PGal described in Asanuma et al 2015, Nature Comm., 6:6463).

[0109] In some examples the detectable label is a luminogenic substrate. Suitable luminogenic substrates include, but are not limited to, D-Luciferin, L-Luciferin, Coelenterazine,

[0110] An epitope tag may be a poly-histidine tag such as a hexahistidine tag or a dodecahistidine, a FLAG tag, a Myc tag, a HA tag, a GST tag or a V5 tag. Epitope tags are routinely detected with commercially available antibodies. A person skilled in the art will be aware that an epitope tag may facilitate purification and / or detection. For example, a conjugate containing a hexahistidine tag may be purified using methods known in the art, such as, by contacting a sample comprising the protein with nickelnitrilotriacetic acid (Ni-NTA) that specifically binds a hexahistidine tag immobilized on a solid or semi-solid support, washing the sample to remove unbound protein, and subsequently eluting the bound protein. Alternatively, or in addition a ligand or antibody that binds to an epitope tag may be used in an affinity purification method.

[0111] An isobaric tag may be a mass tag or an isobaric tag for relative absolute quantification (iTRAQ). A mass tag is a chemical label used for mass spectrometry based quantification of proteins and peptides. In such methods mass spectrometers recognise the mass difference between the labeled and unlabeled forms of a protein or peptide, and quantification is achieved by comparing their respective signal intensities as described, for example, in Bantscheff et al. 2007. Examples of mass tags include TMTzero, TMTduplex, TMTsixplex and TMT 10-plex. An isobaric tag for relative absolute quantification (iTRAQ) is a chemical tag used in quantitative proteomics by tandem mass spectrometry to determine the amount of proteins from different sources in a single experiment as described, for example, in Wiese et al. 2007.

[0112] In some examples the moiety is a non-canonical amino acid. Suitable non- canonical amino acids include, but are not limited to, ornithine, citrulline (Cit), diaminobutyric acid (Dab), diaminopropionic acid (Dap), 2-Aminoisobutyric acid a-Amino-n-butyric acid, Norvaline, Norleucine, Alloisoleucine, t-leucine, Ornithine, Allothreonine, P-Alanine, P -Amino-n-butyric acid, N-isopropyl glycine, Isoserine, and Sarcosine.

[0113] In other examples a moiety in a modified CPP is a reactive group. Suitable reactive groups include, but are not limited to, azide groups, amine-reactive groups, thiolreactive groups, and carbonyl -reactive groups. In some examples the reactive groups are part of a chemical tag. Suitable chemical tags include, but are not limited to, a SNAP tag, a CLIP tag, a HaloTag or a TMP-tag. In one example, the chemical tag is a SNAP- tag or a CLIP -tag. SNAP and CLIP fusion proteins enable the specific, covalent attachment of virtually any molecule to a protein or peptide of interest as described, for example, in Correa 2015 (Methods Mol Biol, 1266:55-79). In another example, the chemical tag is a HaloTag. HaloTag involves a modular protein tagging system that allows different molecules to be covalently linked, either in solution, in living cells, or in chemically fixed cells. In another example, the chemical tag is a TMP-tag. TMP-tags are able to label intracellular, as opposed to cell-surface, proteins with high selectivity.

[0114] In some examples the moiety in a modified CPP is a fatty acid. Suitable fatty acids for modified peptides include, but are not limited to, palmitic acid, myristic acid, caprylic acid, lauric acid, n-octanoic acid, and n-decanoic acid.

[0115] CPP Conjugates

[0116] The term “CPP conjugate,” as used herein, refers to a CPP that is linked (covalently or non-covalently) to a polynucleotide, another peptide, or a protein.

[0117] In some examples, a CPP conjugate protein comprises a flexible linker linking the CPP and a heterologous amino acid sequence such a peptide or protein. Examples of flexible linkers include, but are not limited to, GASGGASG (SEQ ID NO:20), GASG (SEQ ID NO:21), G, GAS, GGG, GSG, GTG, and GGTAGSTGG (SEQ ID NO:22). Other examples of such flexible linkers are known in the art as described in, e.g., Chen et al (2013), Adv Drug Deliv Rev., 65(10): 1357-1369.

[0118] In some examples the enzyme is a gene editor protein (e.g., a CRISPR-associated protein 9 / Cas9 nickase as discussed in further detail herein.

[0119] Polynucleotides

[0120] The present invention refers to various polynucleotides. As used herein, a "polynucleotide" or "nucleic acid" or "nucleic acid molecule" means a polymer of nucleotides, which may be DNA or RNA or a combination thereof.

[0121] In some examples, where a CPP conjugate comprises a polynucleotide, the polynucleotide is an oligonucleotide. In some examples the oligonucleotide is about 18 to about 40 nucleotides in length.

[0122] In other examples, where a CPP conjugate comprises a polynucleotide, the polynucleotide is an RNA. In some examples the RNA is a mRNA that codes for at least one protein. In some examples the mRNA is a modified mRNA comprising pseudouridine groups. In some examples a mRNA is a polycistronic mRNA encoding two or more proteins. In some cases the polycistronic mRNA comprises an internal ribosomal entry site (IRES) and / or encodes a 2A-self cleaving peptide, which, post- translationally, enables encoding and separation of the encoded proteins post- translationally. In some examples, the amino acid sequence of the at least one encoded protein comprises the amino acid sequence of a gene editor protein such as a Cas9 nickase, a deaminase, and / or a polymerase.

[0123] In some examples the RNA is a guide RNA (“gRNA”), which is used in combination with a gene editor protein to effect genome editing as well known in the art.

[0124] In some preferred examples a linked polynucleotide in the CPP conjugate is an oligonucleotide. In some examples the oligonucleotide is an antisense oligonucleotide. In some examples an ASO has a sequence that is completely complementary across its length to the target sequence or a sequence near complementarity (e.g., sufficient complementarity to bind the target sequence to promote exon splicing or RNASe-H- mediated degradation depending on the antisense targeting modality being exploited). ASOs are designed so that they bind (hybridize) to a target RNA sequence (e.g., a targeted portion of a pre-mRNA transcript) and remain hybridized under physiological conditions. Selection of suitable sequences for ASOs generally avoids, where possible, similar nucleic acid sequences in other (i.e., off-target) locations in the genome or in cellular mRNAs or miRNAs, such that the likelihood the ASO will hybridize at such sites is limited.

[0125] In some examples, ASOs “specifically hybridize” to or are “specific” to a target nucleic acid or a targeted portion of a mRNA 5' UTR, a splice junction or proximal sequence, or a 3' UTR sequence. In some examples, ASOs “specifically hybridize” to or are “specific” to a target nucleic acid or a targeted portion of a pre-mRNA of interest. At a given ionic strength and pH, the Tm is the temperature at which 50% of a target sequence hybridizes to a complementary oligonucleotide.

[0126] ASO sequences are “complementary” to their target sequences when hybridization occurs in an antiparallel configuration between two single-stranded polynucleotides. Complementarity is quantifiable in terms of the proportion (e.g., the percentage) of bases in opposing strands that are expected to form hydrogen bonds with each other, according to generally accepted base-pairing rules. The nucleotide sequence of an ASO need not be 100% complementary to that of its target nucleic acid to hybridize. In certain examples, the nucleotide sequences of ASOs in the compositions disclosed herein can be at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleotide sequence of the targeted portion of an RNA (pre-mRNA or mRNA) transcript over the length of the ASO nucleotide sequence. For example, an ASO in which 18 of 20 nucleotides of ASO sequence are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In such an example, the remaining non-compl ementary nucleotides of the ASO could be clustered together or interspersed with complementary nucleotides and need not be contiguous. Complementarity of an ASO sequence to a target nucleotide sequence (expressed as “percent complementarity” to its target sequence; or “percent identity” to its reverse complement sequence) can be determined routinely using algorithms known in the art, as exemplified in the BLAST programs (basic local alignment search tools) and PowerBLAST programs (Altschul, et al., 1990, J. Mol. Biol., 215:403-410; Zhang et al., 1997, Genome Res., 7:649-656).

[0127] In some examples, an ASO does not hybridize to all nucleotides in a target sequence and the nucleotide positions at which it does hybridize may be contiguous or noncontiguous. ASOs may hybridize over one or more segments of a 5' UTR region of a mRNA or over one or more segments of an intron or exon of a targeted pre-mRNA, such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure may be formed).

[0128] In some examples, a linked ASO is complementary to a targeted portion within sufficient proximity to an acceptor site of a targeted exon to promote exclusion of the targeted during splicing.

[0129] In other examples the nucleotide sequences of a linked ASO is complementary to a targeted portion the 3' UTR of a pre-mRNA or mRNA of interest.

[0130] In some examples, an ASO does not hybridize to all nucleotides in a target sequence and the nucleotide positions at which it does hybridize may be contiguous or non-contiguous. ASOs may hybridize over one or more segments of a targeted sequence, such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure may be formed). An ASO may be of any length suitable for specific hybridization to a target sequence. In some examples, the nucleotide sequence of an ASO consists of 8 to 50 nucleotides. For example, an ASO sequence can be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 40, 45, or 50 nucleotides in length. In some examples, the ASOs consist of more than 50 nucleotides, but no more than 100 nucleotides in length. In some examples, where the CPP conjugate is a CPP- polynucleotide conjugate, the CPP-polynucleotide conjugate comprises a peptide linker other than a peptide linker comprising or consisting of an amino acid sequence corresponding to SEQ ID NO:20. In other examples, the CPP-polynucleotide, comprises a polynucleotide comprising or consisting of a sequence other than SEQ ID NO:25. In some examples a CPP conjugate does not include a polynucleotide comprising or consisting of a sequence other than SEQ ID NO:25. In some examples, a CPP conjugate does not include a peptide linker comprising or consisting of the amino acid sequence corresponding to SEQ ID NO:20.

[0131] In some examples a polynucleotide in a CPP-polynucleotide conjugate is conjugated via its 3' end to the carboxy terminal of the CPP or of a peptide linker. In other examples a polynucleotide in a CPP-polynucleotide conjugate is conjugated via its 3' end to the amino terminal of the CPP or of a peptide linker. In other examples a CPP- polynucleotide conjugate is conjugated via its 5' end to the carboxy terminal of the CPP or of a peptide linker. In other examples a polynucleotide in a CPP-polynucleotide conjugate is conjugated via its 5' end to the amino terminal of the CPP or of a peptide linker.

[0132] In some examples, the ASO nucleotide sequence is from 8 to 50 nucleotides, 8 to 40 nucleotides, 8 to 35 nucleotides, 8 to 30 nucleotides, 8 to 25 nucleotides, 8 to 20 nucleotides, 8 to 15 nucleotides, 9 to 50 nucleotides, 9 to 40 nucleotides, 9 to 35 nucleotides, 9 to 30 nucleotides, 9 to 25 nucleotides, 9 to 20 nucleotides, 9 to 15 nucleotides, 10 to 50 nucleotides, 10 to 40 nucleotides, 10 to 35 nucleotides, 10 to 30 nucleotides, 10 to 25 nucleotides, 10 to 20 nucleotides, 10 to 15 nucleotides, 11 to 50 nucleotides, 11 to 40 nucleotides, 11 to 35 nucleotides, 11 to 30 nucleotides, 11 to 25 nucleotides, 11 to 20 nucleotides, 11 to 15 nucleotides, 12 to 50 nucleotides, 12 to 40 nucleotides, 12 to 35 nucleotides, 12 to 30 nucleotides, 12 to 25 nucleotides, 12 to 20 nucleotides, 12 to 15 nucleotides, 13 to 50 nucleotides, 13 to 40 nucleotides, 13 to 35 nucleotides, 13 to 30 nucleotides, 13 to 25 nucleotides, 13 to 20 nucleotides, 14 to 50 nucleotides, 14 to 40 nucleotides, 14 to 35 nucleotides, 14 to 30 nucleotides, 14 to 25 nucleotides, 14 to 20 nucleotides, 15 to 50 nucleotides, 15 to 40 nucleotides, 15 to 35 nucleotides, 15 to 30 nucleotides, 15 to 25 nucleotides, 15 to 20 nucleotides, 20 to 50 nucleotides, 20 to 40 nucleotides, 20 to 35 nucleotides, 20 to 30 nucleotides, 20 to 25 nucleotides, 25 to 50 nucleotides, 25 to 40 nucleotides, 25 to 35 nucleotides, or 25 to 30 nucleotides in length. In some examples, the ASOs are 17 nucleotides in length. In some preferred examples, the nucleotide sequence of the ASO nucleotide is 25 nucleotides in length.

[0133] In some examples a ASO comprises the nucleotide sequence corresponding to SEQ ID NO:23 In some examples the ASO comprises the nucleotide sequence corresponding to SEQ ID NO:24.

[0134] In some examples an ASO is a “gapmer,” which refers to an ASO comprising a central DNA segment flanked by nucleotides of modified chemistry, which facilitates recruitment of an endogenous endonuclease known as RNase H to cleave the RNA strand of a DNA-RNA duplex.

[0135] In some examples the polynucleotide is a phosphorodiamidate morpholino oligomer (PMO).

[0136] In other examples the polynucleotide is an siRNA. In some examples the polynucleotide is a steric blocking oligonucleotide (SBO), short (15-30 nucleotide), single-stranded nucleic acids designed to modulate gene expression by binding to RNA transcripts and blocking access from cellular machinery such as splicing factors or blocking hybridization of regulatory nucleic acids such as miRNAs to the relevant transcript. In some examples the polynucleotide is a peptide nucleic acid (PNA).

[0137] Proteins

[0138] The term “protein” shall be taken to include a single polypeptide chain, z.e., a series of contiguous amino acids linked by peptide bonds or a series of polypeptide chains covalently or non-covalently linked to one another (z.e., a polypeptide complex). For example, the series of polypeptide chains can be covalently linked using a suitable chemical bond or a disulfide bond. Examples of non-covalent bonds include hydrogen bonds, ionic bonds, Van der Waals forces, and hydrophobic interactions.

[0139] Any protein or peptide of the present disclosure may be synthesized using a chemical method known to the skilled artisan. For example, synthetic proteins and peptides are prepared using known techniques of solid phase, liquid phase, or peptide condensation, or any combination thereof, and can include natural and / or unnatural amino acids.

[0140] Also described herein are CPP fusion proteins comprising the amino acid sequence of any CPP described herein, including a modified CPP and a heterologous amino acid sequence, i.e, an amino acid sequence that is not naturally found as a sequence that is contiguous with the amino acid sequence of a CPP. In some examples, the heterologous amino acid sequence comprises the amino acid sequence of a protein.

[0141] In some examples the CPP is linked as a fusion protein to a gene editor protein.

[0142] Gene Editor Proteins

[0143] In some examples a gene editor protein conjugated to a CPP disclosed herein is a Cas nuclease, with reduced or abolished nuclease activity. For example, a Cas9 protein may be nuclease inactive or may be a Cas9 nickase. Methods for generating a Cas9 protein (or a fragment thereof) having an inactive DNA cleavage domain are known. For example, the DNA cleavage domain of Cas9 is known to include two subdomains, the HNH nuclease subdomain and the RuvC 1 subdomain. The HNH subdomain cleaves the strand complementary to the gRNA, whereas the RuvC 1 subdomain cleaves the non- complementary strand. Mutations within these subdomains can silence the nuclease activity of Cas9. For example, the mutations D10A and H840A have been shown to completely inactivate the nuclease activity of S. pyogenes Cas9.

[0144] In some preferred examples a suitable Cas9 nickase for inclusion in a CPP conjugate disclosed herein has an active HNH domain and an inactive RuvC domain and is able to cleave only the strand of the target DNA that is bound by a gRNA (which is the opposite strand of the strand that is being edited). In some examples a Cas9 nickase comprises mutations that inactivate the RuvC domain, e.g., a D10A mutation. 1

[0145] In various examples, any mutation that inactivates the RuvC domain is included in a Cas9 nickase, e.g. , insertion, deletion, or single or multiple amino acid substitution in the RuvC domain.

[0146] Other exemplary suitable nuclease-inactive Cas9 domains include, but are not limited to, those comprising mutations: D839A, N863 A, or K603R

[0147] Modified Cells

[0148] Also described herein is a modified cell comprising any of the CPPs, modified CPPs, or CPP conjugates described herein. In some examples a modified cell is a prokaryotic cell. In other examples the modified cell is a eukaryotic cell. Suitable eukaryotic cells include yeast cells, and mammalian cells including, but not limited to human cells. In some examples modified mammalian cells are from a cell line. Suitable cell lines include, but are not limited to, human induced pluripotent stem cell (hiPSC) lines ARPE-19, SH SY5Y, CHO-K1, HEK-293, COS7, HeLa, N2a, and NIH 3T3. In some examples the human cells are human stem cells. Such human stem cells include, but are not limited to, embryonic stem cells, induced pluripotent stem cells, and mesenchymal stem cells. In other examples a modified cells are primary human cells or cells differentiated from a hiPSC line, e.g., retinal ganglion cells, rods, cones, bipolar cells, cortical neurons, astrocytes, cardiomyocytes, hepatocytes, podocytes, tubule epithelial cells, glomerular endothelial cells, mesangial cells, parietal epithelial cells, pancreatic islet cells, or myocytes.

[0149] In some examples a modified cell expresses one or more genetically encoded CPPs or CPP fusion proteins. In other examples a modified cell is a primary mammalian cell.

[0150] In other examples a modified cell does not comprise exogenous nucleic acids encoding a CPP or CPP conjugate, but is modified by protein transduction of a CPP or CPP conjugate.

[0151] Pharmaceutical Compositions

[0152] Pharmaceutical compositions containing any of the CPP compositions described herein, for use in the methods disclosed herein, can be prepared according to conventional techniques well known in the pharmaceutical industry and described in the published literature. The skilled person appreciates that pharmaceutical compositions comprising a CPP conjugate will be prepared in part based on the nature of the agent conjugated to the CPP, e.g., a protein or polynucleotide.

[0153] Pharmaceutically acceptable salts are suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, etc., and are commensurate with a reasonable benefit / risk ratio. Examples of pharmaceutically acceptable, nontoxic acid addition salts are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemi sulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3- phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Further pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate and aryl sulfonate.

[0154] Exemplary salts useful in a composition of the present disclosure include calcium chloride, magnesium chloride or sodium chloride.

[0155] In one example, a composition comprises a buffer. Exemplary buffers useful in a composition of the present disclosure include sodium phosphate.

[0156] In some examples, pharmaceutical compositions are formulated into any of a number of possible dosage forms including, but not limited to, ocular emulsions, topical ointments, solutions for intravitreal injection, intravenous administration, intrathecal administration, intracisterna magna administration, tablets, capsules, gel capsules, liquid syrups, and soft gels. In some examples, the compositions are formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension may also contain stabilizers. In some examples, a pharmaceutical formulation disclosed herein is provided in a form including, but not limited to, a solution, emulsion, microemulsion, foam or liposome-containing formulation (e.g., cationic or noncationic liposomes).

[0157] In some preferred examples, a pharmaceutical composition comprises a CPP- ASO conjugate, where the amount of ASO in the pharmaceutical composition is sufficient to provide a dose when administered from about 0.01 mg / kg to 20 mg / kg, e.g., 0.05 mg / kg, 0.1 mg / kg, 0.2 mg / kg, 0.5 mg / kg, 1 mg / kg, 3 mg / kg, 5 mg / kg, 8 mg / kg, 10 mg / kg, 15 mg / kg, or another dose ranging from about 0.01 mg / kg to 20 mg / kg.

[0158] Methods

[0159] The present disclosure also provides any one of the CPPs, modified CPPs, CPP conjugates, or modified cells for use as a medicament or diagnostic agent. The present disclosure also provides any one of these for use in the manufacture of a medicament or diagnostic agent.

[0160] The present disclosure also provides a method for delivering one of the CPPs, modified CPPs, CPP conjugates disclosed herein to a cell by contacting the cell with any of these. In some examples the contacting is performed ex vivo, e.g., in cultured eukaryotic cells. In other examples the contacting is performed in vivo, e.g., in a human subject.

[0161] The invention will now be further described with reference to the following, nonlimiting examples.

[0162] EXAMPLES

[0163] Example 1: Synthesis of peptide-oligonucleotide conjugate

[0164] Peptides comprising SEQ ID NOs: 3-19 were synthesised using standard Fmoc solid phase peptide synthesis techniques. Upon cleavage from the supporting resin, peptides were purified using reverse phase HPLC chromatography, and lyophilized to yield a fluffy white solid.

[0165] Conjugation to phosphorodiamidate morpholino oligomer (PMO) targeting either mouse Smn exon 7 (SEQ ID NO:23) or rabbit Smn exon 8 (SEQ ID NO:24) was achieved through standard amide conjugation conditions using HATU and DIEA. The carboxylic acid C-terminus of the peptide was conjugated to the secondary amine located at the PMO 3’ end. The PPMO conjugate was then purified through strong cation exchange chromatography and desalting to yield the PPMO conjugates used for subsequent in vitro and in vivo experiments.

[0166] Example 2: In vitro evaluation of the peptide-PMO conjugate

[0167] In vitro evaluation of the peptide-PMO conjugate was performed in ARPE-19 cells (efficacy) or SHSY-5Y cells (cytotoxicity) using the D-form of the peptide comprising SEQ ID NO: 10 conjugated to the PMO SEQ ID NO:23. For determination of efficacy as assessed through SMN exon skipping, cells were harvested 48 hours posttreatment. RNA was extracted using Aurum™ Total RNA Mini Kit as per manufacturer's instructions, with quantification of RNA undertaken using a Quant-IT RNA BR Kit. Following RNA extraction and quantitation, cDNA was synthesised and proportion of SmnA7 measured through RT-PCR using a Lab Chip GX nucleic acid analyser.

[0168] Measurement of cell viability was performed using a CellTiter-Glo® luminescent assay. Briefly, cells were treated with PPMO and 48 hours post-treatment, CellTiter- Glo® reagent was added and luminescent signal read using an EnSpire plate reader. Data were normalized against untreated cells and a positive control cytotoxic peptide. Results are shown in Figure 1.

[0169] Example 3: In vivo evaluation of peptide-PMO conjugate in the mouse neural retina

[0170] All procedures performed were approved by the appropriate Institutional Animal Care and Use Committee, in accordance with the relevant Research Ethics Office.

[0171] Female C57B1 / 6 mice of 6-7 weeks age were injected intravitreally with 0.2 pg, 0.4 pg, or 0.8 pg of the D-form of the peptide comprising SEQ ID NO: 10 conjugated to the PMO SEQ ID NO:23, formulated in PBS (1 pg / pl of the peptide-PMO conjugate). At harvest (7 or 28 days post-injection), eyes were enucleated and stored in PBS on ice, before being dissected into neural retina, RPE and optic nerve. After homogenization of the appropriate tissue layer in trizol, RNA was extracted using Aurum™ Total RNA Mini Kit as per manufacturer's instructions, with quantification of RNA undertaken using a Quant-IT RNA BR Kit. Following RNA extraction and quantitation, cDNA was synthesised and proportion of SmnA7 measured through RT- PCR using a Lab Chip GX nucleic acid analyser. Results are shown in Figure 2.

[0172] Example 4: In vivo evaluation of peptide-PMO conjugate in the rabbit neural retina

[0173] All procedures performed were approved by the appropriate Institutional Animal Care and Use Committee, in accordance with the relevant Research Ethics Office.

[0174] In one experiment, male and female New Zealand White rabbits of 4-6 weeks age were injected intravitreally with: 3 pg, 10 pg, or 30 pg of the D-form of the peptide comprising SEQ ID NO: 10 conjugated to the PMO SEQ ID NO:24, formulated in PBS.

[0175] In another experiment, 1.2 pg, 4 pg, or 12 pg of the D-form of the peptide comprising SEQ ID NO: 19 conjugated to the PMO SEQ ID NO:24, formulated in PBS.

[0176] At harvest (7 days post-injection), eyes were enucleated, the aqueous humour removed and the remainder of the eye snap frozen in liquid nitrogen. Frozen eyes were dissected, placed in pre-chilled RNAlater™-ICE Frozen Tissue Transition Solution, stored at -20 °C, before being frozen at -80 °C.

[0177] After homogenization of the appropriate tissue layer in trizol, RNA was isolated using TRIzol® / chloroform and purified using QIAGEN RNeasy mini columns. On column DNA-digestion was performed, followed by elution of RNA and quantitation through a Quant-IT RNA BR Kit. After cDNA synthesis, the proportion of SmnA8 was measured through RT-PCR using a Lab Chip GX nucleic acid analyser.

[0178] For the peptide comprising SEQ ID NO: 10 conjugated to the PMO-SEQ ID NO:24, at 3 pg dose, approximately 20% of SmnA8 was measured through RT-PCR, increasing to 60% at 10 pg and 30 pg.

[0179] For the peptide comprising SEQ ID NO: 19 conjugated to the PMO-SEQ ID NO:24, at a 1.2 pg dose, approximately 15% of SmnA8 was measured through RT-PCR, increasing to 25% at 4 pg and 28% at 12 pg. Appendix: Sequences and SEQ ID NOs:

[0180] (Note: amino acids in the following sequences can be L-form or D-form amino acids)

[0181] SEQ ID NO: 1 (RXniR)n2RSGGR (Formula I) where Xniis an amino acid sequence 1 to 4 amino acids in length and n2 = 2 to 10 repeats, wherein 0 to n2 of the repeat (RXniR) sequences are identical, and wherein at each position the amino acid is a D-amino acid or an L-amino acid.

[0182] SEQ ID NO:2 Wni(Xn2Yn3Zn4)n5 (Formula II) where W or X or Z = R, K, or H; nl = 0-1; n2 = 1-2; n4=0-l; n5 = 4-6; and

[0183] Y = A, S, G, N, P, T, F, or W; and n3=l-5.

[0184] SEQ ID NO:3 RARRARRARRARRSR

[0185] SEQ ID NO:4 RASRRASRRANRRANRRSGR

[0186] SEQ ID NO:5 RASASRRASASRRANANRRANANRRSGGSR

[0187] SEQ ID NO:6 RASASARRASASARRANANARRANANARRSGGSSR

[0188] SEQ ID NO:7 RASARRANARRSGGR

[0189] SEQ ID NO:8 RASARRASARRANARRSGGR

[0190] SEQ ID NO:9 RAFARRAFARRAWARRAWARRFGGR

[0191] SEQ ID NO: 10 RASARRASARRANARRANARRSGGR, where

[0192] SEQ ID NO: 10 can be in all D-form amino acids or all L-form amino acids except for glycine.

[0193] SEQ ID NO:11 RRSRTARAGRPGRNSS

[0194] SEQ ID NO:12 RRSRTARAGRPGRNSSHPSAPH

[0195] SEQ ID NO:13 RSRTARAGRPGRNSSRPSAP

[0196] SEQ ID NO:14 RSRTARAGRPGRNSSRPSAPR

[0197] SEQ ID NO:15 RRSRTARAGRPGRNSSKPSAPK SEQ ID NO: 16 RRSRTARAGKPGKNSSKPSAPK

[0198] SEQ ID NO: 17 RRSRTARAGRPGRNSSKKPSAPKK

[0199] SEQ ID NO: 18 RRSRTARAGKKPGKKNSSKKPSAPKK

[0200] SEQ ID NO: 19

[0201] RGSGRARASRLPTGRGDYRGRRSRRPRASGGASGGGARSSHRSVPR

[0202] SEQ ID NO:20

[0203] GASGGASG (Linker 1)

[0204] SEQ ID NO:21

[0205] GGGGSGGGGS (Linker 2)

[0206] SEQ ID NO:22

[0207] GASG (Linker 3)

[0208] SEQ ID NO:23

[0209] Sequence of ASO targeting exon 7 skipping of mouse Survival Motor Neuron (Smri) gene

[0210] ACTTTCCTTCTTTTTTATTTTGTCT

[0211] SEQ ID NO:24

[0212] Sequence of ASO targeting exon 8 skipping of rabbit Survival Motor Neuron (Sinn) gene ATCTTCCTTCTTTCTGACTTTGCTT

[0213] SEQ ID NO:25

[0214] Sequence of ASO targeting 5' UTR of human OP Al gene CAACCACTTTACCCTTTCTAGGC

[0215] It will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the above-described examples, without departing from the broad general scope of the present disclosure. The present examples are, therefore, to be considered in all respects as illustrative and not restrictive. All references cited herein, including patents, patent applications, papers, text books, and the like, and the references cited therein, to the extent that they are not already, are hereby incorporated herein by reference in their entirety.

[0216] Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application. This application claims priority from Australian Provisional Application No.

[0217] 2024901551 entitled “Improved Cell-Penetrating Peptides” filed on 24 May 2024, the entire contents of which are hereby incorporated by reference.

Claims

1. CLAIMS:

1. A cell penetrating peptide (CPP) comprising the amino acid sequence:Wni(Xn2Yn3Zn4)n5 (SEQ ID NO:2); wherein:W, X, or Z is an amino acid selected from Arg, Lys, or His; nl is 0 to 1 residues, n2 is 1 to 2 residues; n4 is 0 to 1 residue and n5 is 4 to 6 repeats;Y is an amino acid selected from Ala, Ser, Gly, Asn, Pro, Thr, Phe, or Trp; and n3 is 1 to 5 residues; and wherein at each position, the amino acid is a D-amino acid or an L-amino acid.

2. A cell penetrating peptide (CPP) comprising the amino acid sequence: (RXniR)n2RSGGR (SEQ ID NO:1); wherein Xniis an amino acid sequence 1-4 amino acids in length and n2= 2 to 10 repeats, wherein 0 to n2of the repeat (RXniR) sequences are identical, and wherein, at each position, the amino acid is a D-amino acid or an L-amino acid.

3. The CPP according to claim 2, wherein Xniis three amino acids in length.

4. The CPP according to claim 3, wherein at least one of the three amino acids in Xni has a net positive charge.

5. The CPP according to claim 4, wherein the at least one amino acid has a side chain conferring a net charge of at least +1.

6. The CPP according to any one of claims 2 to 5, wherein at least one Xnisequence comprises an arginine.

7. The CPP according to claim 2 or claim 3, wherein at least one Xnicomprises an amino acid sequence selected from the group consisting of: ASA, ANA, AFA, and AWA.

8. The CPP according to claim 7, wherein at least one Xnicomprises the amino acid sequence ASA or ANA.

9. The CPP according to claim 8, wherein at least one Xnicomprises the amino acid sequence ASA and ANA.

10. The CPP according to any one of claims 4 to 9, wherein at least one Xnicomprises the amino acid sequence AFA or AWA.

11. The CPP according to claim 10, wherein at least one Xnicomprises the amino acid sequence AFA and ANA.

12. The CPP according to any one of claims 2 to 11, wherein n2 = 3 to 6 repeats.

13. A cell-penetrating peptide (CPP) comprising the amino acid sequence corresponding to:(i) any one of SEQ ID NOs:3, 7, or 11 with up to two amino acid substitutions;(ii) any one of SEQ ID NOs : 4, 7-9, or 12-18 with up to three amino acid substitutions; or(iii) any one of SEQ ID NOs:5, 6, 10, or 19 with up to four amino acid substitutions.

14. The CPP according to claim 13, wherein at least one of the amino acid substitutions is a net positively charged amino acid.

15. The CPP according to claim 13, wherein at least one of the amino acid substitutions is substituted with an amino acid that is not a net positively charged amino acid.

16. The CPP according to claim 15, wherein the amino acid that is not net positively charged is selected from the group consisting of: alanine, tryptophan, serine, asparagine, proline, and threonine.

17. The CPP according to any one of claims 13 to 16 comprising an amino acid sequence selected from (i).

18. The CPP according to any one of claims 13 to 16 comprising an amino acid sequence selected from (ii).

19. The CPP according to any one of claims 13 to 16 comprising an amino acid sequence selected from (iii).

20. The CPP according to any one of claims 1 to 19, wherein the CPP comprises multiple copies of an amino acid sequence corresponding to any one of SEQ ID NOs:3-1921. The CPP according to any one of claims 1 to 20, wherein the length of the amino acid sequence of the CPP consists of 10 to 100 residues.

22. The CPP according to claim 21, wherein the amino acid sequence of the CPP consists of 15 to 70 residues.

23. The CPP according to claim 21, wherein the amino acid sequence of the CPP consists of 20 to 60 residues.

24. The CPP according to claim 21, wherein the amino acid sequence of the CPP consists of 25 to 50 residues.

25. The CPP according to any one of claims 1 to 24, wherein the amino acid sequence of the CPP is the retro-inverso sequence of the amino acid sequence of the CPP of any one of claims 1 to 24.

26. The CPP according to any one of claims 1 to 24, wherein the CPP is a modified CPP comprising a moiety other than a canonical amino acid.

27. The CPP according to any one of claims 1 to 24, wherein the amino acid sequence of the CPP comprises at least one D-amino acid.

28. The CPP according to claim 27, wherein the amino acid sequence of the CPP comprises only D-amino acids.

29. The CPP according to any one of claims 1 to 24, wherein the amino acid sequence of the CPP comprises at least one L-amino acid.

30. The CPP according to claim 29, wherein the amino acid sequence of the CPP comprises only L-amino acids.

31. The CPP according to any one of claims 1 to 30, wherein the CPP is a modified CPP comprising a moiety other than a canonical amino acid.

32. The modified CPP according to claim 31 wherein the moiety is selected from the group consisting of a detectable label, a non-canonical amino acid, a reactive group, a fatty acid, cholesterol, and a bioactive carbohydrate, and a lipid.

33. The modified CPP according to claim 31 or claim 32, wherein the moiety comprises a detectable label.

34. The CPP according to any one of claims 1 to 33, wherein the CPP comprises the amino acid sequence corresponding to any one of SEQ ID NOs:2-9 or 11-19.

35. The CPP according to any one of claims 1 to 33, wherein the amino acid sequence of the CPP consists of the amino acid sequence corresponding to any one of SEQ ID NOs:2-9 or 11-1936. The CPP according to any one of claims 1 to 33, wherein the CPP comprises the amino acid sequence corresponding to SEQ ID NO: 10 with up to four amino acid substitutions.

37. The CPP according to claim according to claim 34, wherein the CPP comprises the amino acid sequence corresponding to SEQ ID NO: 10.

38. The CPP according to claim 37, wherein the amino acid sequence of the CPP consists of the amino acid sequence corresponding to SEQ ID NO: 10.

39. The CPP according to any one of claims 36 to 38, wherein the amino acids in the sequence of the CPP, other than glycine, are all in D-form.

40. The CPP according to any one of claims 36 to 38, wherein the amino acids in the sequence of the CPP, other than glycine, are all in L-form.

41. A CPP conjugate comprising the CPP according to any one of claims 1 to 40 linked to a polynucleotide or a protein.

42. The CPP conjugate according to claim 41, wherein the polynucleotide is an oligonucleotide.

43. The CPP conjugate according to claim 42, wherein the oligonucleotide is a double-stranded oligonucleotide.

44. The CPP conjugate according to claim 42 or claim 43, wherein the oligonucleotide is about 18 to about 40 nucleotides in length.

45. The CPP conjugate according to claim 41, wherein the polynucleotide is selected from the group consisting of: siRNA, antisense oligonucleotide, gapmer, steric blocking oligonucleotide, peptide nucleic acid (PNA), and phosphorodiamidate morpholino oligomer (PMO).

46. The CPP conjugate according to claim 41, wherein the polynucleotide comprises an RNA.

47. The CPP conjugate according to claim 46, wherein the RNA is a mRNA encoding at least one protein.

48. The CPP according to claim 47, wherein the at least one protein comprises the amino acid sequence of a gene editor protein.

49. The CPP conjugate according to claim 46, wherein the RNA comprises a guide RNA or a hybrid guide RNA.

50. The CPP conjugate according to claim 41, wherein the CPP is linked to a protein.

51. The CPP conjugate according to claim 50, wherein the protein comprises a gene editor protein.

52. The CPP according to claim 48 or claim 51, wherein the protein comprises a Cas9 nickase.

53. The CPP according to claim 52, wherein the protein further comprises a reverse transcriptase.

54. The CPP conjugate according to any one of claims 41 to 53, wherein the polynucleotide or the protein is covalently linked to the CPP.

55. The CPP conjugate according to claim 54, wherein the covalently linked polynucleotide or protein is covalently linked at the N-terminal of the CPP.

56. The CPP conjugate according to claim 54, wherein the covalently linked polynucleotide or protein is covalently linked at the C-terminal of the CPP.

57. A modified cell comprising the CPP of any one of claims 1 to 38, or the CPP conjugate according to any one of claims 41 to 56 intracellularly.

58. The CPP according to any one of claims 1 to 38, the CPP conjugate according to any one of claims 41 to 56, or the modified cell according to claim 57 for use in the manufacture of a medicament or diagnostic agent.

59. A pharmaceutical composition comprising the CPP according to any one of claims 1 to 38, the CPP conjugate according to any one of claims 41 to 56, or the modified cell according to claim 57, and a pharmaceutically acceptable excipient.

60. A method for delivering a CPP or a CPP conjugate to a cell, the method comprising contacting the cell with the CPP of any one of claims 1 to 38 or the CPP conjugate according to any one of claims 41 to 56.

61. The method of claim 60, wherein the contacting is performed ex vivo.

62. The method of claim 60, wherein the contacting is performed in vivo.

Images