Diaminopimelate dehydrogenase mutant and use in d-amino acid synthesis

By molecularly modifying diaminopimelic acid dehydrogenase, a mutant diaminopimelic acid dehydrogenase with high catalytic activity was obtained, which solved the problem of low catalytic performance of D-amino acid dehydrogenases in the existing technology and achieved the effect of efficient synthesis of D-biphenylalanine.

WO2025241319A1PCT designated stage Publication Date: 2025-11-27EAST CHINA UNIV OF SCI & TECH
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/111072
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-05-23
Filing Date
2024-08-09
Publication Date
2025-11-27

AI Technical Summary

Technical Problem

Existing D-amino acid dehydrogenases have low catalytic performance, making it difficult to efficiently catalyze the synthesis of D-biphenylalanine. Furthermore, the reaction conditions are harsh, making it difficult to meet the needs of industrial applications.

Method used

By molecularly modifying diaminopimelic acid dehydrogenase derived from Bacillus thermophilus, and employing directed evolution strategies such as error-prone PCR, site-directed saturation mutagenesis, and combinatorial mutagenesis, a mutant of diaminopimelic acid dehydrogenase with high catalytic activity was obtained for catalyzing the asymmetric reductive amination reaction of biphenylpyruvate.

Benefits of technology

It achieves a conversion rate of over 99% and an optical purity of over 99% for biphenylpyruvic acid, significantly improves catalytic activity, and has mild reaction conditions, making it suitable for industrial applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024111072_27112025_PF_FP_ABST
    Figure CN2024111072_27112025_PF_FP_ABST
Patent Text Reader

Abstract

A diaminopimelate dehydrogenase mutant and a use in D-amino acid synthesis. A diaminopimelate dehydrogenase mutant obtained by performing molecular modification on a Bacillus thermozeamaize diaminopimelate dehydrogenase, a nucleic acid encoding the diaminopimelate dehydrogenase mutant, a recombinant expression vector containing the nucleic acid, a recombinant expression transformant containing the recombinant expression vector, and a use of the diaminopimelate dehydrogenase mutant in the synthesis of a D-amino acid by means of the asymmetric reductive amination of a 2-keto acid. Compared with other D-biphenylalanine synthesis methods, the present invention has a simple route, a high theoretical yield, good atom economy, and a product optical purity of more than 99%. Therefore, the present invention relates to an environmentally-friendly, highly-stereoselective and green biological synthesis method, and has good prospects for application in actual production of D-biphenylalanine and other D-amino acids.
Need to check novelty before this filing date? Find Prior Art

Description

Diaminopimelate dehydrogenase mutants and applications in D-amino acid synthesis TECHNICAL FIELD

[0001] The present application relates to the field of bioengineering, in particular to a diaminopimelate dehydrogenase mutant with D-amino acid dehydrogenase activity obtained by molecular modification of diaminopimelate dehydrogenase from Bacillus thermozemaize, a nucleic acid encoding the diaminopimelate dehydrogenase mutant, a recombinant expression vector containing the nucleic acid, a recombinant expression transformant containing the recombinant expression vector, preparation of the mutant enzyme catalyst, and applications of the mutant enzyme catalyst in catalyzing the asymmetric reductive amination of 2-keto acids to prepare D-amino acids. BACKGROUND

[0002] Most of the biochemical synthesis building blocks in nature are chiral molecules, which cannot coincide with their mirror images like shoes, screws and snail shells. Although chiral molecules have two configurations, nature generally only selects one as a synthesis building block, for example, only L-amino acids are used to synthesize proteins. This selection of nature endows D-amino acids with great potential as key synthesis building blocks in other special applications. For example, D-amino acids have become key chiral building blocks for drugs such as β-lactam antibiotics, fertility drugs, anticoagulants and insecticides. Because most enzymes selectively degrade substances composed of L-amino acids after billions of years of natural evolution, they have no degrading effect on substances composed of D-amino acids. Therefore, drugs synthesized from D-amino acids not only have better efficacy, but also have better stability in the body, and have broad application prospects. For example, D-tryptophan, as a precursor of serotonin, can be used as a supplement to regulate mood and improve sleep quality. D-tryptophan also has antioxidant properties and can be used as a potential drug for antioxidants, anti-inflammatory agents and immunomodulators. D-phenylalanine also has important application value in the pharmaceutical field. It has the effects of inhibiting human exhaustion and relieving fever and pain, and is mainly used to produce raw pharmaceuticals for treating osteoporosis, cardiovascular disease, Parkinson's syndrome and other diseases. It is also a key intermediate for HIV protease (AIDS) inhibitors, and is the raw material for the latest anti-tumor drug (Bosutinib) and diabetes treatment drug (Naglennat), and is also used for the production of brain peptide degradation inhibitors.

[0003] LCZ696 (Novartis, Entresto, Formula A) is a dual angiotensin receptor neprilysin (NEP) inhibitor, developed by Novartis, composed of valsartan (Formula B) and sacubitril (also known as AHU377, Formula C) in a 1:1 molar ratio, approved by FDA on July 7, 2015, and is a new type of anti-heart failure drug, which can improve ventricular remodeling by controlling blood pressure and is used for the treatment of hypertension and heart failure.

[0004] Formula D (D-biphenylalanine) is a key chiral intermediate for the preparation of sacubitril. In the enzymatic preparation process of D-biphenylalanine, patent CN110088079A uses (R)-selective ω-transaminase to catalyze the transamination reaction of biphenylpyruvic acid, and the substrate conversion rate is close to 100% at 40-45°C for 17-18 hours. The post-treatment obtained D-biphenylalanine with ee>99% and the yield reached 90%; in the chemical enzymatic preparation, there are documents (ACS Catal.2015, 5, 5410-5413) introducing a method for synthesizing a series of non-L or D biphenylalanine derivatives, in which D-amino acid dehydrogenase is used to catalyze 4-bromophenylpyruvic acid to obtain 4-bromophenylalanine, and then the target product D-biphenylalanine is obtained by coupling phenylboronic acid by chemical method, and the total conversion rate is 95%, the separation yield is 40%, and the product ee is >99%.

[0005] Although transaminase can be used to catalyze biphenylpyruvic acid to generate D-biphenylalanine, its enzyme activity is low, the reaction time is long, and a large amount of amine donor needs to be added to the reaction system to promote the reaction balance to move to the product generation direction; in the chemical enzymatic preparation process, the late coupling of arylboronic acid needs to be carried out at high temperature, which is harsh and has low separation yield. Compared with the above, the method of directly using amino acid dehydrogenase to catalyze ketonic acid asymmetric reduction and amination to synthesize chiral amino acid not only has good atom economy, but also has high theoretical yield, and has great potential in the application of chiral amino acid synthesis, which has been widely concerned.

[0006] However, the naturally occurring D-amino acid dehydrogenase in nature is very rare, and is in the form of membrane protein, which is not conducive to large-scale preparation and industrial application. At present, the only D-amino acid dehydrogenase that can be efficiently expressed in Escherichia coli is meso-diaminopimelate dehydrogenase (meso-DAPDH) in the L-lysine synthesis pathway in the organism. It can catalyze the asymmetric reduction of meso-diaminopimelate to produce L-lysine with NADPH as the coenzyme, and the catalytic activity is 1.5 U / mg. + / NADPH reversibly catalyzes the oxidation of meso-diaminopimelic acid to generate L-2-amino-6-carbonyl heptanedioic acid. Patent CN 116656639A uses a meso-DAPDH mutant derived from Bacillus thermozeamaize to successfully catalyze the generation of D-phenylglycine from benzoylformic acid, and 100 mM substrate can be completely converted in 12 h with a product ee>99%. Unfortunately, the mutant has very low activity on biphenylalanine, and there is still a big gap from practical application.

[0007] Therefore, it is urgent to develop D-amino acid dehydrogenase with better catalytic performance to meet the technical needs and market demand for the synthesis of D-biphenylalanine and other large steric D-amino acids.

[0008] SUMMARY

[0009] In order to overcome the defects of low activity of D-amino acid dehydrogenase and poor efficiency of catalytic synthesis of D-biphenylalanine, the present application provides a diaminopimelic acid dehydrogenase mutant and its application in D-amino acid synthesis.

[0010] Specifically, the present application provides a diaminopimelic acid dehydrogenase mutant with significantly improved catalytic performance, a nucleic acid encoding the diaminopimelic acid dehydrogenase mutant, a recombinant expression vector containing the nucleic acid, a recombinant expression transformant containing the recombinant expression vector, a diaminopimelic acid dehydrogenase mutant catalyst, and the application of the diaminopimelic acid dehydrogenase mutant catalyst in the asymmetric reduction and amination of the substrate biphenylpyruvic acid to synthesize D-biphenylalanine by using error-prone PCR, site-directed saturation mutation and combination mutation and other directed evolution strategies.

[0011] The diaminopimelic acid dehydrogenase mutant catalyst of the present application has the advantages of mild reaction conditions, environmental friendliness, high yield, etc. in the application of catalyzing the asymmetric reduction and amination of the substrate biphenylpyruvic acid to synthesize D-biphenylalanine.

[0012] The object of the present application can be achieved by the following technical solutions:

[0013] In one of the technical solutions, the present application provides a diaminopimelic acid dehydrogenase mutant with significantly improved catalytic performance.

[0014] The present application takes a mutant BtDAPDH-W129T / P134C / F154V / S177A / H235I with 275-fold improved catalytic efficiency for benzoyl formic acid, which is obtained by molecular modification of diaminopimelic acid dehydrogenase BtDAPDH from Bacillus thermozemaize in the previous stage of the research group (disclosed in patent CN116656639A), as the research object, and the amino acid sequence thereof is shown in SEQ ID No. 2 (hereinafter named BtDAPDH-M0). Further, through error-prone PCR, site-directed saturation mutation and combinatorial mutation and other directed evolution strategies, a diaminopimelic acid dehydrogenase mutant with significantly improved asymmetric reduction and amination activity for diphenylpyruvic acid is obtained.

[0015] wherein the structure of diphenylpyruvic acid is as follows:

[0016] The protein corresponding to the new amino acid sequence formed by replacing one or more of the amino acid residues at positions 78 threonine, 79 arginine, 101 isoleucine, 102 histidine, 129 threonine, 130 aspartic acid, 134 cysteine, 154 valine, 158 methionine, 160 methionine, 161 glycine, 162 histidine, 163 serine, 179 threonine, 189 arginine, 213 tyrosine, 235 isoleucine, 236 glycine and 237 valine in the amino acid sequence shown in SEQ ID No. 2 with other amino acid residues, exhibits significantly improved catalytic activity for a plurality of 2-keto acid substrates including diphenylpyruvic acid.

[0017] Further, the diaminopimelic acid dehydrogenase mutant with high catalytic activity for diphenylpyruvic acid provided by the present application is a protein having the following amino acid sequence:

[0018] (1) replacing the isoleucine at position 101 in the amino acid sequence shown in SEQ ID No. 2 with phenylalanine, named M1 (BtDAPDH-I101F);

[0019] (2) replacing the isoleucine at position 101 in the amino acid sequence shown in SEQ ID No. 2 with leucine, named M2 (BtDAPDH-I101L);

[0020] (3) replacing the isoleucine at position 101 in the amino acid sequence shown in SEQ ID No. 2 with alanine, named M3 (BtDAPDH-I101A);

[0021] (4) the histidine at position 102 of the amino acid sequence shown as SEQ ID No. 2 is replaced by phenylalanine, designated as M4 (BtDAPDH-H102F);

[0022] (5) the histidine at position 102 of the amino acid sequence shown as SEQ ID No. 2 is replaced by alanine, designated as M5 (BtDAPDH-H102A);

[0023] (6) the threonine at position 129 of the amino acid sequence shown as SEQ ID No. 2 is replaced by phenylalanine, designated as M6 (BtDAPDH-T129F);

[0024] (7) the threonine at position 129 of the amino acid sequence shown as SEQ ID No. 2 is replaced by leucine, designated as M7 (BtDAPDH-T129L);

[0025] (8) the aspartic acid at position 130 of the amino acid sequence shown as SEQ ID No. 2 is replaced by phenylalanine, designated as M8 (BtDAPDH-D130F);

[0026] (9) the aspartic acid at position 130 of the amino acid sequence shown as SEQ ID No. 2 is replaced by leucine, designated as M9 (BtDAPDH-D130L);

[0027] (10) the aspartic acid at position 130 of the amino acid sequence shown as SEQ ID No. 2 is replaced by valine, designated as M10 (BtDAPDH-D130V);

[0028] (11) the aspartic acid at position 130 of the amino acid sequence shown as SEQ ID No. 2 is replaced by alanine, designated as M11 (BtDAPDH-D130A);

[0029] (12) the valine at position 154 of the amino acid sequence shown as SEQ ID No. 2 is replaced by phenylalanine, designated as M12 (BtDAPDH-V154F);

[0030] (13) the valine at position 154 of the amino acid sequence shown as SEQ ID No. 2 is replaced by tryptophan, designated as M13 (BtDAPDH-V154W);

[0031] (14) the valine at position 154 of the amino acid sequence shown as SEQ ID No. 2 is replaced by tyrosine, designated as M14 (BtDAPDH-V154Y);

[0032] (15) the histidine at position 162 of the amino acid sequence shown as SEQ ID No. 2 is replaced by leucine, designated as M15 (BtDAPDH-H162L);

[0033] (16) the histidine at position 162 of the amino acid sequence shown as SEQ ID No. 2 is replaced by alanine, designated as M16 (BtDAPDH-H162A);

[0034] (17) the histidine at position 162 of the amino acid sequence shown as SEQ ID No. 2 is replaced by glycine, designated as M17 (BtDAPDH-H162G);

[0035] (18) the isoleucine at position 235 of the amino acid sequence shown as SEQ ID No. 2 is replaced by leucine, designated as M18 (BtDAPDH-I235L);

[0036] (19) the valine at position 237 of the amino acid sequence shown as SEQ ID No. 2 is replaced by phenylalanine, designated as M19 (BtDAPDH-V237F);

[0037] (20) the valine at position 237 of the amino acid sequence shown as SEQ ID No. 2 is replaced by tyrosine, designated as M20 (BtDAPDH-V237Y);

[0038] (21) the aspartic acid at position 130 of the amino acid sequence shown as SEQ ID No. 2 is replaced by leucine, and the histidine at position 162 is replaced by alanine, designated as M21 (BtDAPDH-D130L / H162A);

[0039] (22) the aspartic acid at position 130 of the amino acid sequence shown as SEQ ID No. 2 is replaced by leucine, and the histidine at position 162 is replaced by glycine, designated as M22 (BtDAPDH-D130L / H162G);

[0040] (23) the aspartic acid at position 130 of the amino acid sequence shown as SEQ ID No. 2 is replaced by alanine, and the histidine at position 162 is replaced by alanine, designated as M23 (BtDAPDH-D130A / H162A);

[0041] (24) the aspartic acid at position 130 of the amino acid sequence shown as SEQ ID No. 2 is replaced by alanine, and the histidine at position 162 is replaced by glycine, designated as M24 (BtDAPDH-D130A / H162G);

[0042] (25) the threonine at position 129, the aspartic acid at position 130, and the histidine at position 162 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, and alanine, respectively, and designated as M25 (BtDAPDH-T129L / D130L / H162A);

[0043] (26) the histidine at position 102, the aspartic acid at position 130, and the histidine at position 162 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by alanine, leucine, and alanine, respectively, and designated as M26 (BtDAPDH-H102A / D130L / H162A);

[0044] (27) the threonine at position 129, the aspartic acid at position 130, and the histidine at position 162 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, and cysteine, respectively, and designated as M27 (BtDAPDH-T129L / D130L / H162C);

[0045] (28) the histidine at position 102, the aspartic acid at position 130, and the histidine at position 162 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by alanine, leucine, and cysteine, respectively, and designated as M28 (BtDAPDH-H102A / D130L / H162C);

[0046] (29) the aspartic acid at position 130, the valine at position 154, and the histidine at position 162 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, phenylalanine, and alanine, respectively, and designated as M29 (BtDAPDH-D130L / V154F / H162A);

[0047] (30) the aspartic acid at position 130, the histidine at position 162, and the valine at position 237 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, alanine, and tyrosine, respectively, and designated as M30 (BtDAPDH-D130L / H162A / V237Y);

[0048] (31) the threonine at position 78, the threonine at position 129, the aspartic acid at position 130, and the histidine at position 162 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by glutamine, leucine, leucine, and alanine, respectively, and designated as M31 (BtDAPDH-T78Q / T129L / D130L / H162A);

[0049] (32) the threonine at position 129, the aspartic acid at position 130, the serine at position 159, the histidine at position 162 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, alanine, respectively, designated as M32 (BtDAPDH-T129L / D130L / S159T / H162A);

[0050] (33) the threonine at position 129, the aspartic acid at position 130, the methionine at position 160, the histidine at position 162 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, alanine, respectively, designated as M33 (BtDAPDH-T129L / D130L / M160T / H162A);

[0051] (34) the threonine at position 129, the aspartic acid at position 130, the methionine at position 160, the histidine at position 162 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, serine, alanine, respectively, designated as M34 (BtDAPDH-T129L / D130L / M160S / H162A);

[0052] (35) the threonine at position 129, the aspartic acid at position 130, the glycine at position 161, the histidine at position 162 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, serine, alanine, respectively, designated as M35 (BtDAPDH-T129L / D130L / G161S / H162A);

[0053] (36) the threonine at position 129, the aspartic acid at position 130, the cysteine at position 134, the glycine at position 161, the histidine at position 162 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, alanine, serine, alanine, respectively, designated as M36 (BtDAPDH-T129L / D130L / C134A / G161S / H162A);

[0054] (37) the threonine at position 129, the aspartic acid at position 130, the glycine at position 161, the histidine at position 162, the threonine at position 179 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, serine, alanine, isoleucine, respectively, designated as M37 (BtDAPDH-T129L / D130L / G161S / H162A / T179I);

[0055] (38) the threonine at position 129, the aspartic acid at position 130, the glycine at position 161, the histidine at position 162, the arginine at position 189 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, serine, alanine, alanine, respectively, designated as M38 (BtDAPDH-T129L / D130L / G161S / H162A / R189A);

[0056] (39) the threonine at position 129, the aspartic acid at position 130, the glycine at position 161, the histidine at position 162, the tyrosine at position 213 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, serine, alanine, leucine, respectively, designated as M39 (BtDAPDH-T129L / D130L / G161S / H162A / Y213L);

[0057] (40) the threonine at position 129, the aspartic acid at position 130, the glycine at position 161, the histidine at position 162, the glycine at position 236 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, serine, alanine, alanine, respectively, designated as M40 (BtDAPDH-T129L / D130L / G161S / H162A / G236A);

[0058] (41) the threonine at position 129, the aspartic acid at position 130, the glycine at position 161, the histidine at position 162, the threonine at position 179, the tyrosine at position 213 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, serine, alanine, isoleucine, leucine, respectively, designated as M41 (BtDAPDH-T129L / D130L / G161S / H162A / T179I / Y213L);

[0059] (42) the threonine at position 129, the aspartic acid at position 130, the glycine at position 161, the histidine at position 162, the threonine at position 179, the tyrosine at position 213, the glycine at position 236 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, serine, alanine, isoleucine, leucine, alanine, respectively, designated as M42 (BtDAPDH-T129L / D130L / G161S / H162A / T179I / Y213L / G236A);

[0060] (43) the 79th arginine, the 129th threonine, the 130th aspartic acid, the 161st glycine, the 162nd histidine, the 179th threonine, the 213th tyrosine, and the 236th glycine in the amino acid sequence set forth in SEQ ID No. 2 are replaced by glutamine, leucine, leucine, serine, alanine, isoleucine, leucine, and alanine, respectively, and is designated as M43 (BtDAPDH-R79Q / T129L / D130L / G161S / H162A / T179I / Y213L / G236A);

[0061] (44) the 79th arginine, the 129th threonine, the 130th aspartic acid, the 161st glycine, the 162nd histidine, the 179th threonine, the 213th tyrosine, and the 236th glycine in the amino acid sequence set forth in SEQ ID No. 2 are replaced by tyrosine, leucine, leucine, serine, alanine, isoleucine, leucine, and alanine, respectively, and is designated as M44 (BtDAPDH-R79Y / T129L / D130L / G161S / H162A / T179I / Y213L / G236A);

[0062] (45) the 129th threonine, the 130th aspartic acid, the 161st glycine, the 162nd histidine, the 163rd serine, the 179th threonine, the 213th tyrosine, and the 236th glycine in the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, serine, alanine, threonine, isoleucine, leucine, and alanine, respectively, and is designated as M45 (BtDAPDH-T129L / D130L / G161S / H162A / S163T / T179I / Y213L / G236A);

[0063] (46) the 129th threonine, the 130th aspartic acid, the 158th methionine, the 161st glycine, the 162nd histidine, the 163rd serine, the 179th threonine, the 213th tyrosine, and the 236th glycine in the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, tyrosine, serine, alanine, threonine, isoleucine, leucine, and alanine, respectively, and is designated as M46 (BtDAPDH-T129L / D130L / M158Y / G161S / H162A / S163T / T179I / Y213L / G236A).

[0064] The second aspect of the present application provides a nucleic acid encoding the diaminopimelate dehydrogenase mutant according to the first aspect of the present application.

[0065] The nucleic acid encodes the diaminopimelate dehydrogenase mutant according to the first aspect of the present application, which is obtained by cloning the gene sequence of the diaminopimelate dehydrogenase mutant according to the first aspect of the present application through genetic engineering technology, or by synthesizing the nucleic acid encoding the diaminopimelate dehydrogenase mutant according to the first aspect of the present application through artificial full-sequence synthesis.

[0066] The third aspect of the present application provides a recombinant expression vector comprising the nucleic acid according to the second aspect of the present application.

[0067] The recombinant expression vector can be constructed by linking the nucleic acid encoding the diaminopimelate dehydrogenase mutant according to the present application to various suitable vectors through conventional methods in the art. The vector can be any conventional vector in the art, as long as the recombinant expression vector can normally replicate in the corresponding expression host and express the diaminopimelate dehydrogenase mutant. The diaminopimelate dehydrogenase mutant gene can be operably linked downstream of a suitable regulatory sequence in the vector to achieve constitutive or inducible expression of the diaminopimelate dehydrogenase mutant. For an E. coli host, the plasmid vector is preferably a pET-28a(+) plasmid.

[0068] The fourth aspect of the present application provides a recombinant expression transformant comprising the diaminopimelate dehydrogenase mutant gene or the recombinant expression plasmid according to the present application.

[0069] The recombinant expression transformant can be prepared by transforming the recombinant expression vector that has been constructed into a host cell to prepare the recombinant expression transformant through conventional techniques in the art. The host cell can be any conventional host cell in the art, as long as the recombinant expression vector can stably replicate itself and effectively express the diaminopimelate dehydrogenase mutant protein after induction by an inducer. The present application preferably uses E. coli as the host cell, and more preferably uses E. coli BL21(DE3) for efficient expression of the diaminopimelate dehydrogenase mutant according to the present application.

[0070] The fifth aspect of the present application provides a recombinant diaminopimelate dehydrogenase mutant catalyst.

[0071] The recombinant diaminopimelate dehydrogenase mutant catalyst is in any of the following forms:

[0072] (1) culturing the recombinant expression transformant according to the present application to isolate the transformant cells containing the diaminopimelate dehydrogenase mutant;

[0073] (2) culturing the recombinant expression transformant of the present application, isolating the transformant cells containing the diaminopimelate dehydrogenase mutant, and crushing the transformant cells containing the diaminopimelate dehydrogenase mutant to obtain a cell crushing solution;

[0074] (3) culturing the recombinant expression transformant of the present application, isolating the transformant cells containing the diaminopimelate dehydrogenase mutant, and crushing the transformant cells containing the diaminopimelate dehydrogenase mutant to obtain a cell crushing solution, and freeze-drying the cell crushing solution of the diaminopimelate dehydrogenase mutant to obtain a freeze-dried enzyme powder.

[0075] The culture method and conditions of the recombinant expression transformant are conventional methods and conditions in the art, and different preferred culture methods and conditions are used for recombinant expression transformants constructed using different hosts, as long as the recombinant expression transformant can grow and efficiently produce the diaminopimelate dehydrogenase mutant of the present application.

[0076] For recombinant E. coli, the preferred culture medium is LB medium: 10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl, pH 6.5-7.0. The preferred culture method is as follows: inoculate the recombinant E. coli as described above into LB medium containing kanamycin, and cultivate at 37°C with 180 rpm shaking overnight. Transfer the seed liquid into a 5 L fermenter containing 3 L of LB medium (containing kanamycin), and control the dissolved oxygen (DO) at more than 30% by adjusting the stirring speed, supplementing carbon and nitrogen sources, etc. When the OD 600 8-10, add isopropyl-β-D-thiogalactoside (IPTG) as an inducer at a final concentration of 0.1-0.5 mmol / L, and induce at 16-25°C for 8-24 h. Centrifuge the culture solution, collect the cells, and then wash twice with physiological saline to obtain recombinant expression transformant cells. Freeze-dry the harvested recombinant expression transformant cells to obtain freeze-dried cells containing the diaminopimelate dehydrogenase mutant. Suspend the harvested recombinant expression transformant cells in 5-10 times the volume (w / v) of buffer, crush by ultrasonication, and centrifuge to collect the supernatant to obtain a cell crushing solution of the recombinant diaminopimelate dehydrogenase mutant. Place the collected cell crushing solution at -80°C for freezing, and then use a vacuum freeze-drying machine for low-temperature drying to obtain a freeze-dried enzyme powder of the recombinant diaminopimelate dehydrogenase mutant. Store the obtained freeze-dried enzyme powder in a 4°C refrigerator for convenient use.

[0077] The sixth technical solution of the present application provides a method for determining the activity of the diaminopimelate dehydrogenase mutant. Specifically, 1 mL of the reaction system comprises 400 mM ammonium formate buffer (pH 9.0), 10 mM substrate, 0.5 mg / mL pure enzyme solution, 0.1 mM NADP + , and the reaction is oscillated at 40°C and 1000 rpm for 15 min. The product concentration is detected by HPLC, and the specific activity of different mutants on biphenylpyruvic acid is calculated.

[0078] The seventh technical solution of the present application provides a method for preparing different D-amino acids (amino acids with dextrorotatory configuration) by asymmetric reduction and amination of 2-keto acids using the diaminopimelate dehydrogenase mutant of the first technical solution or the recombinant diaminopimelate dehydrogenase mutant catalyst of the fifth technical solution as the catalyst.

[0079] The 2-keto acid is selected from an aliphatic 2-keto acid or an aromatic 2-keto acid, the structure of the aliphatic 2-keto acid is selected from one of S1-S9, and the structure of the aromatic 2-keto acid is selected from one of S10-S20.

[0080] In an embodiment of the present application, the asymmetric reduction reaction of the 2-keto acid substrate catalyzed by the diaminopimelate dehydrogenase mutant or the recombinant diaminopimelate dehydrogenase mutant catalyst requires the participation of coenzyme NADH or NADPH, and the coenzyme NADH or NADPH is oxidized to NAD + or NADP + during the reaction.

[0081] In an embodiment of the present application, the in-situ regeneration of coenzyme NADH or NADPH is realized by coupling with the formic acid oxidation reaction catalyzed by formate dehydrogenase, and ammonium formate is used as a co-substrate.

[0082] In an embodiment of the present application, the concentration of the 2-keto acid substrate is 10-100 mM, and the amount of NADP + in the reaction solution is 0.1-0.5 mM; the temperature of the asymmetric reduction reaction is 30-40°C.

[0083] In an embodiment of the present application, more specifically, the application of the diaminopimelate dehydrogenase mutant of the first technical solution or the recombinant diaminopimelate dehydrogenase mutant catalyst of the fifth technical solution in the preparation of D-biphenylalanine by asymmetric reduction and amination of biphenylpyruvic acid (see the specific application shown in FIG. 1). D-biphenylalanine is a key chiral intermediate for the synthesis of sacubitril valsartan sodium salt (LCZ696).

[0084] The asymmetric reduction reaction of biphenylpyruvic acid catalyzed by the diaminopimelate dehydrogenase mutant or the recombinant diaminopimelate dehydrogenase mutant catalyst needs the participation of coenzyme NADPH, and the coenzyme NADPH is oxidized to NADP + .

[0085] Further, the in-situ regeneration of coenzyme NADPH can be realized by coupling with the formic acid oxidation reaction catalyzed by formate dehydrogenase, with ammonium formate as a co-substrate.

[0086] In the application, the concentration of the biphenylpyruvic acid substrate can be 10-100 mM. The amount of NADP + in the reaction solution is 0.1-0.5 mM. During the reaction, ammonium formate can be used as a co-substrate to realize the cyclic regeneration of NADPH coenzyme in the reaction system through the oxidation reaction of formate ions catalyzed by formate dehydrogenase. The ammonia / formate buffer (but not limited to ammonia / formate buffer) required in the asymmetric reduction reaction is a conventional buffer in the art, and the concentration thereof is preferably 400 mM. The asymmetric reduction reaction is carried out under oscillation or stirring conditions. The temperature of the asymmetric reduction reaction is 40°C. The reaction time is the time when the substrate is completely converted or the reaction is self-terminated, and the reaction time is preferably less than 24 h.

[0087] After the reaction is completed, the reduced product D-biphenylalanine in the reaction solution is separated and purified by a strong acid cation exchange resin through a conventional method, and the collected ammonia eluate is freeze-dried to obtain the target product.

[0088] Compared with the prior art, the technical effects of the present application mainly embody in the following aspects:

[0089] The present application provides a diaminopimelate dehydrogenase mutant with significantly better catalytic performance, which can efficiently catalyze the asymmetric reduction amination reaction of biphenylpyruvic acid to prepare optically pure D-biphenylalanine.

[0090] The diaminopimelate dehydrogenase mutant of the present application can catalyze the asymmetric reduction amination reaction of 100 mM biphenylpyruvic acid to achieve a conversion rate of more than 99% and a product optical purity of more than 99% ee. Compared with the wild-type diaminopimelate dehydrogenase, the diaminopimelate dehydrogenase mutant obtained by the present application has the advantages of high catalytic activity, high substrate concentration, and high space-time yield, and therefore has good industrial application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0091] FIG. 1 is a schematic diagram of the preparation of D-amino acid by the asymmetric reduction amination reaction of 2-keto acid catalyzed by the diaminopimelate dehydrogenase mutant. DETAILED DESCRIPTION

[0092] The present application will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0093] Each reaction or detection condition described in the summary of the application can be combined or modified according to common knowledge in the art and can be verified by experiments.

[0094] The technical solutions and technical effects of the present application will be described clearly and completely below with reference to specific embodiments, but the protection scope of the present application is not limited to these embodiments, and any changes or equivalent replacements without departing from the concept of the present application are included in the protection scope of the present application.

[0095] The materials in the following examples are from:

[0096] The recombinant plasmid pET28a-BtDAPDH-M0 containing the nucleic acid sequence shown in SEQ ID No. 1 in the sequence listing is constructed by the inventors.

[0097] The empty plasmid vector pET-28a is purchased from Novagen Company.

[0098] mM in the examples is the abbreviation of mmol / L.

[0099] Unless otherwise specified, the specific experiments in the following examples are performed according to the conventional methods and conditions in the art, or according to the commercial instruction of the kit.

[0100] Example 1 Screening of diaminopimelate dehydrogenase mutants with improved activity by site-directed mutagenesis

[0101] Random mutation is performed on the nucleotide sequence encoding diaminopimelate dehydrogenase BtDAPDH-M0 shown in SEQ ID No. 1 in the sequence listing by using error-prone PCR technology.

[0102] The primer used is:

[0103] The sequence of the upstream primer is: AAGCTTGCATGAGCGAAATCAGGACAGAACGA (as shown in SEQ ID No. 3)

[0104] The sequence of the downstream primer is: CTCGAGTTATACCAAACGGCGAATCAGCTC (as shown in SEQ ID No. 4)

[0105] The sequence of AAGCTT in the upstream primer is the enzyme digestion site of Hind III, and the sequence of CTCGAG in the downstream primer is the enzyme digestion site of Xho I.

[0106] With pET28a-BtDAPDH-M0 as template, error-prone PCR was performed with rTaq DNA polymerase to construct a random mutant library. The PCR system (50 μL) was as follows: rTaq DNA polymerase 1 μL, 10×PCR buffer (Mg 2+ Plus) 5.0 μL, dNTP Mixture (2.0 mM each) 4.0 μL, MnCl2 at a final concentration of 150 μmol / L, pET28a-BtDAPDH-M0 plasmid 50 ng, upstream and downstream primers (10 μM) 1 μL each, and sterile distilled water to make up to 50 μL. The PCR reaction program was as follows: (1) 95 °C pre-denaturation for 5 min; (2) 94 °C denaturation for 30 s; (3) 58 °C annealing for 30 s; (4) 72 °C extension for 1 min; steps (2)-(4) were repeated for 30 cycles; finally 72 °C extension for 10 min, and the product was stored at 4 °C. After the PCR product was analyzed by agarose gel electrophoresis, the gel was cut and the purified DNA was recovered. The recovered DNA fragment and the empty plasmid pET-28a were digested with restriction enzymes Hind III and Xho I at 37 °C for 6 h. After the double-digested product was analyzed by agarose gel electrophoresis, the gel was cut and the purified DNA was recovered. The linearized pET-28a plasmid and the purified DNA fragment were ligated with T4 DNA ligase at 16 °C overnight. The ligation product was transformed into E. coli BL21 (DE3) competent cells, and uniformly coated on LB agar plates containing 50 μg / mL kanamycin and placed in a 37 °C incubator for about 12 h.

[0107] The transformants on the transformation plate were picked with sterile toothpicks into a 96-well deep well plate and cultured at 37 °C, 220 rpm in a shaker overnight. 50 μL of bacterial solution was taken from the primary plate and inoculated into a secondary plate, which was cultured at 37 °C, 220 rpm in a shaker for 2-3 h, then IPTG at a final concentration of 0.2 mM was added and the plate was cultured at 16 °C for 24 h. Then the plate was centrifuged at 4 °C, 3500 ×g for 10 min, the supernatant was discarded, 200 μL of lysozyme solution (750 mg lysozyme and 10 mg DNase were dissolved in 1 L deionized water) was added to each well, and the plate was shaken to mix, then treated at 37 °C in a shaker for 1.5 h. Subsequently, the plate was centrifuged at 4 °C, 3500 ×g for 10 min, and the cell broken supernatant was used for preliminary screening of enzyme activity. Mutants with higher activity than the wild type were selected for re-screening, and the corresponding genes were sequenced.

[0108] To detect the specific activity, enantioselectivity and yield of mutant catalyzing the synthesis of D-biphenylalanine from biphenylpyruvic acid, the reaction was carried out with coupling formate dehydrogenase (BstFDH) coenzyme cycle system. Crude enzyme reaction method: 1 mL reaction system contained 400 mM ammonium formate buffer (pH 9.0), 5 mM substrate (biphenylpyruvic acid, structure shown in S20), 1 mg / mL crude enzyme solution, 8 mg / mL BstFDH, 0.1 mM NADP + , and the reaction was carried out at 40°C, 1000 rpm for 20 h. The product concentration was detected by HPLC to determine the dominant mutant; pure enzyme activity detection method: 1 mL reaction system contained 400 mM ammonium formate buffer (pH 9.0), 10 mM substrate (biphenylpyruvic acid), 0.5 mg / mL pure enzyme solution, 0.1 mM NADP + , and the reaction was carried out at 40°C, 1000 rpm for 15 min. The product concentration was detected by HPLC to calculate the specific activity and determine the optimal mutant.

[0109] Through screening, it was found that replacing threonine at position 78 of diaminopimelate dehydrogenase with glutamine, replacing arginine at position 79 with glutamine, replacing arginine at position 79 with tyrosine, replacing histidine at position 102 with alanine, replacing aspartic acid at position 130 with leucine, replacing aspartic acid at position 130 with alanine, replacing cysteine at position 134 with alanine, replacing valine at position 154 with phenylalanine, replacing methionine at position 158 with tyrosine, replacing methionine at position 160 with threonine, replacing methionine at position 160 with serine, replacing glycine at position 161 with serine, replacing histidine at position 162 with leucine, replacing histidine at position 162 with alanine, replacing histidine at position 162 with glycine, replacing histidine at position 162 with cysteine, replacing serine at position 163 with threonine, replacing threonine at position 179 with isoleucine, replacing arginine at position 189 with alanine, replacing tyrosine at position 213 with leucine, replacing glycine at position 236 with alanine, and replacing valine at position 237 with tyrosine. The activity of the obtained preferred mutant on biphenylpyruvic acid was significantly improved.

[0110] Example 2 Purification of recombinant diaminopimelate dehydrogenase mutant

[0111] The recombinant diaminopimelate dehydrogenase-expressing bacterial cells were resuspended at a ratio of 1 g wet cells to 10 mL A solution. After mixing thoroughly, the cells were broken in an ultrasonic disrupter. The total working time was set to 15 min, and the ultrasonic disruption was performed every 6 s for 4 s. The broken solution was light yellow and slightly translucent. The solution was centrifuged at 12,000 rpm for 35 min at 4°C. The supernatant was collected and stored in an ice box, and was ready for subsequent purification. The nickel column was first washed with ultrapure water to remove the residual ethanol. Then, the nickel column was equilibrated with A solution. To ensure that the column was fully equilibrated, at least 4 column volumes of A solution were used. Then, the broken supernatant was added to the equilibrated nickel column. The supernatant slowly flowed out, and the target protein was combined with the Ni 2+ The impurities were eluted with A solution (20 mM Tris, 250 mM NaCl, 10 mM imidazole, 0.0375% (v / v) β-mercaptoethanol), and the target protein was eluted with B solution (20 mM Tris, 250 mM NaCl, 250 mM imidazole, 0.0375% (v / v) β-mercaptoethanol). The collected target protein solution was concentrated to about 1 mL using an ultrafiltration tube with a 10 kDa molecular weight cutoff. Then, the solution was replaced twice with C solution (50 mM Tris, 150 mM NaCl, 1 mM DTT), and was finally concentrated to about 500 μL. The concentration of the obtained purified protein concentrate was determined using a Nanodrop. The purified protein concentrate could be immediately used or stored in a -80°C refrigerator after being quickly frozen in liquid nitrogen.

[0112] Example 3 Activity determination of recombinant diaminopimelate dehydrogenase mutants

[0113] The activity determination reaction system was 1 mL: 400 mM ammonium formate buffer (pH 9.0), 10 mM diphenylpyruvic acid, 0.5 mg / mL purified enzyme solution, 0.1 mM NADP + The reaction was shaken at 40°C and 1000 rpm for 15 min, and the product concentration was determined using HPLC to calculate the specific activity.

[0114] Table 1 Specific activity of diaminopimelate dehydrogenase mutants on diphenylpyruvic acid

[0115] Wherein, mutant numbers M1~M46 correspond to mutant (1)~mutant (46) disclosed in the technical scheme in the summary of the invention of the specification respectively, that is, mutant number M1 in Table 1 is M1 (BtDAPDH-I101F) in the technical scheme, and mutant (46) is M46 (BtDAPDH-T129L / D130L / M158Y / G161S / H162A / S163T / T179I / Y213L / G236A) in the technical scheme.

[0116] Example 4 Fermentation preparation of recombinant diaminopimelate dehydrogenase mutant

[0117] The recombinant expression transformant containing diaminopimelate dehydrogenase mutant M46 obtained in Example 1 was inoculated into LB medium containing 50 μg / mL kanamycin and cultured at 37°C on a shaking table for 12 hours as a seed liquid. The temperature and stirring speed of the fermentation tank were set to 37°C and 400 rpm respectively, and the aeration amount was adjusted to 1vvm (3L / min). After the parameters of the fermentation tank were stabilized, 200 mL of the seed liquid was introduced into the fermentation tank containing 3L of medium (glycerol 5g / L, proteose peptone 5g / L, yeast extract 5g / L, Na2HPO4 3g / L, Na2SO4 0.7g / L, KH2PO4 3.4g / L, MgSO4 0.25g / L, NH4Cl 2.7g / L) under flame protection, and fermentation was started. As the cells grew, the dissolved oxygen (DO) decreased, and when the DO decreased to below 30%, the stirring speed was gradually increased to 500 rpm. During the fermentation, ammonia water was added to control the pH at about 7.0. After 2 hours of fermentation, samples were taken every 1 hour to detect the cell concentration (OD 600 ) in the fermentation broth. After 4 hours of culture, the carbon and nitrogen sources (250g / L glycerol, 60g / L proteose peptone, 60g / L yeast extract) were supplemented at a flow rate of 35 mL / h. At 5 hours of culture, the temperature of the fermentation broth was adjusted to 25°C, and at the same time, the feeding rate was reduced to 27 mL / h. After 5.5 hours of culture, IPTG aqueous solution (1M stock solution, final concentration 0.2mM) was added to induce the expression of the target protein. After induction, samples were taken every 2 hours to measure OD 600 , and after 10 hours of induction, the fermentation was ended. The fermentation broth was centrifuged to obtain a total of 180g of resting cells.

[0118] Example 5 Preparation of recombinant diaminopimelate dehydrogenase mutant cell breakage liquid, freeze-dried cells and freeze-dried enzyme powder

[0119] The 100 g of harvested recombinant cells in Example 4 were freeze-dried to obtain 20 g of freeze-dried cells containing the diaminopimelate dehydrogenase mutant. 50 g of harvested recombinant cells were suspended in 0.5 L of buffer, broken by high-pressure homogenization, and the supernatant was collected by centrifugation to obtain a crude enzyme solution of the recombinant diaminopimelate dehydrogenase mutant. The collected crude enzyme solution was frozen at -80°C, and then dried at low temperature using a vacuum freeze dryer to obtain 9.2 g of freeze-dried enzyme powder of the recombinant diaminopimelate dehydrogenase mutant. The obtained freeze-dried enzyme powder was stored in a 4°C refrigerator and could be conveniently used.

[0120] Example 6 Specific activities of BtDAPDH-M0 and mutant BtDAPDH-M46 on different 2-keto acid substrates

[0121] Reaction system 1 mL: 400 mM ammonium formate buffer (pH 9.0), 10 mM 2-keto acid, 0.5 mg / mL pure enzyme solution, 0.1 mM NADP + , and the product concentration was detected by HPLC to calculate the specific activity.

[0122] Table 2 Specific activities of diaminopimelate dehydrogenase BtDAPDH-M0 and BtDAPDH-M46 on different substrates

[0123] In Table 2, the structures of substrates S1-S19 are as follows:

[0124] Example 7 BtDAPDH-M0 catalyzing the synthesis of D-biphenylalanine from biphenylpyruvic acid

[0125] Referring to FIG. 1, in a 1 mL reaction system containing 5 mM of substrate biphenylpyruvic acid, 0.1 mM of NADP + , 0.5 mg of BtDAPDH-M0 pure enzyme, 10 mg of formate dehydrogenase, 400 mM of ammonium formate buffer (pH 9.0), 40°C, 1000 rpm constant temperature shaker, after 24 h of reaction, acetonitrile was added to quench the reaction, and liquid chromatography showed that the substrate conversion rate was 5% and the product ee value was 99%.

[0126] Example 8 BtDAPDH-M9 catalyzing the synthesis of D-biphenylalanine from biphenylpyruvic acid

[0127] In a 1 mL reaction system containing 5 mM of substrate biphenylpyruvic acid, 0.1 mM of NADP +, BtDAPDH-M9 pure enzyme 0.5 mg, formate dehydrogenase 10 mg, formate ammonium buffer (400 mM, pH 9.0), 40 °C, 1000 rpm constant temperature shaker for 24 h, then acetonitrile was added to quench the reaction, the substrate conversion rate was 52% and the product ee value was 99% by liquid chromatography.

[0128] Example 9 BtDAPDH-M21 catalyzed synthesis of D-biphenylalanine from biphenylpyruvic acid

[0129] A 1 mL reaction system contained substrate biphenylpyruvic acid 10 mM, 0.1 mM NADP + , BtDAPDH-M21 pure enzyme 0.2 mg, formate dehydrogenase 10 mg, formate ammonium buffer (400 mM, pH 9.0), 40 °C, 1000 rpm constant temperature shaker for 24 h, then acetonitrile was added to quench the reaction, the substrate conversion rate was 48% and the product ee value was 99% by liquid chromatography.

[0130] Example 10 BtDAPDH-M27 catalyzed synthesis of D-biphenylalanine from biphenylpyruvic acid

[0131] A 1 mL reaction system contained substrate biphenylpyruvic acid 10 mM, 0.1 mM NADP + , BtDAPDH-M27 pure enzyme 0.2 mg, formate dehydrogenase 10 mg, formate ammonium buffer (400 mM, pH 9.0), 40 °C, 1000 rpm constant temperature shaker for 24 h, then acetonitrile was added to quench the reaction, the substrate conversion rate was 74% and the product ee value was 99% by liquid chromatography.

[0132] Example 11 BtDAPDH-M39 catalyzed synthesis of D-biphenylalanine from biphenylpyruvic acid

[0133] A 1 mL reaction system contained substrate biphenylpyruvic acid 20 mM, 0.1 mM NADP + , BtDAPDH-M39 pure enzyme 0.1 mg, formate dehydrogenase 20 mg, formate ammonium buffer (400 mM, pH 9.0), 40 °C, 1000 rpm constant temperature shaker for 24 h, then acetonitrile was added to quench the reaction, the substrate conversion rate was 82% and the product ee value was 99% by liquid chromatography.

[0134] Example 12 BtDAPDH-M41 catalyzed synthesis of D-biphenylalanine from biphenylpyruvic acid

[0135] In a 1 mL reaction system containing substrate biphenylpyruvic acid 50 mM, 0.2 mM NADP+, BtDAPDH-M41 pure enzyme 0.02 mg, formate dehydrogenase 20 mg, formic acid ammonium buffer (400 mM, pH 9.0), 40 °C, 1000 rpm constant temperature oscillator, after 24 h of reaction, acetonitrile was added to quench the reaction, and the substrate conversion rate was 87% and the product ee value was 99% measured by liquid chromatography.

[0136] Example 13 BtDAPDH-M46 catalyzing biphenylpyruvic acid to synthesize D- biphenylalanine

[0137] In a 1 mL reaction system containing substrate biphenylpyruvic acid 100 mM, 0.2 mM NADP+, BtDAPDH-M46 pure enzyme 0.01 mg, formate dehydrogenase 20 mg, formic acid ammonium buffer (400 mM, pH 9.0), 40 °C, 1000 rpm constant temperature oscillator, after 24 h of reaction, acetonitrile was added to quench the reaction, and the substrate conversion rate was 99% and the product ee value was 99% measured by liquid chromatography.

[0138] Example 14 BtDAPDH-M46 catalyzing phenylpyruvic acid to synthesize D- phenylalanine

[0139] Wherein, the structures of phenylpyruvic acid and D-phenylalanine are as follows:

[0140] In a 20 mL reaction system containing substrate phenylpyruvic acid 50 mM, 0.5 mM NADP+, BtDAPDH-M46 crude enzyme 5 mg, formate dehydrogenase 50 mg, formic acid ammonium buffer (400 mM, pH 9.0), 30 °C, 1000 rpm constant temperature oscillator, after 24 h of reaction, acetonitrile was added to quench the reaction, and the substrate conversion rate was 95% and the product ee value was 99% measured by liquid chromatography.

[0141] Example 15 BtDAPDH-M46 catalyzing indole-3-pyruvic acid to synthesize D- tryptophan

[0142] Wherein, the structures of indole-3-pyruvic acid and D-tryptophan are as follows:

[0143] In a 20 mL reaction system containing substrate indole-3-pyruvic acid 50 mM, 0.5 mM NADP+, BtDAPDH-M46 crude enzyme 10 mg, formate dehydrogenase 100 mg, formic acid ammonium buffer (400 mM, pH 9.0), 30 °C, 1000 rpm constant temperature oscillator, after 24 h of reaction, acetonitrile was added to quench the reaction, and the substrate conversion rate was 88% and the product ee value was 99% measured by liquid chromatography.

[0144] Example 16 BtDAPDH-M46 catalyzed homophenylpyruvic acid to synthesize D-homophenylalanine

[0145] wherein the structures of homophenylpyruvic acid and D-homophenylalanine are shown as follows, respectively:

[0146] In a 20 mL reaction system containing 50 mM substrate homophenylpyruvic acid, 0.5 mM NADP + , BtDAPDH-M46 crude enzyme 10 mg, formate dehydrogenase 100 mg, ammonium formate buffer (400 mM, pH 9.0), 30℃, 1000 rpm constant temperature oscillator, after 24 h reaction, acetonitrile was added to quench the reaction, and the substrate conversion rate was 97% and the product ee value was 99% measured by liquid chromatography.

[0147] The above description of the embodiments is to facilitate the ordinary skilled person in the art to understand and use the invention. Those skilled in the art can easily make various modifications to these embodiments, and apply the general principles described herein to other embodiments without creative labor. Therefore, the present invention is not limited to the above embodiments, and the improvements and modifications made by those skilled in the art according to the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

[0148] The sequence information involved in the present invention is as follows:

[0149] SEQ ID No. 1

[0150] SEQ ID No. 2

[0151] SEQ ID No. 3

[0152] SEQ ID No. 4

Claims

1. A diaminopimelate dehydrogenase mutant, characterized in that, It is a protein consisting of any one of the following amino acid sequences: (1) replacing isoleucine at position 101 of the amino acid sequence shown as SEQ ID No. 2 with phenylalanine; (2) replacing isoleucine at position 101 of the amino acid sequence shown as SEQ ID No. 2 with leucine; (3) replacing isoleucine at position 101 of the amino acid sequence shown as SEQ ID No. 2 with alanine; (4) replacing histidine at position 102 of the amino acid sequence shown as SEQ ID No. 2 with phenylalanine; (5) replacing histidine at position 102 of the amino acid sequence shown as SEQ ID No. 2 with alanine; (6) replacing threonine at position 129 of the amino acid sequence shown as SEQ ID No. 2 with phenylalanine; (7) replacing threonine at position 129 of the amino acid sequence shown as SEQ ID No. 2 with leucine; (8) replacing aspartic acid at position 130 of the amino acid sequence shown as SEQ ID No. 2 with phenylalanine; (9) replacing aspartic acid at position 130 of the amino acid sequence shown as SEQ ID No. 2 with leucine; (10) replacing aspartic acid at position 130 of the amino acid sequence shown as SEQ ID No. 2 with valine; (11) replacing aspartic acid at position 130 of the amino acid sequence shown as SEQ ID No. 2 with alanine; (12) replacing valine at position 154 of the amino acid sequence shown as SEQ ID No. 2 with phenylalanine; (13) replacing valine at position 154 of the amino acid sequence shown as SEQ ID No. 2 with tryptophan; (14) replacing valine at position 154 of the amino acid sequence shown as SEQ ID No. 2 with tyrosine; (15) replacing histidine at position 162 of the amino acid sequence shown as SEQ ID No. 2 with leucine; (16) replacing histidine at position 162 of the amino acid sequence shown as SEQ ID No. 2 with alanine; (17) replacing histidine at position 162 of the amino acid sequence shown as SEQ ID No. 2 with glycine; (18) replacing isoleucine at position 235 of the amino acid sequence shown as SEQ ID No. 2 with leucine; (19) replacing valine at position 237 of the amino acid sequence shown as SEQ ID No. 2 with phenylalanine; (20) replacing valine at position 237 of the amino acid sequence shown as SEQ ID No. 2 with tyrosine; (21) replacing aspartic acid at position 130 of the amino acid sequence shown as SEQ ID No. 2 with leucine, and replacing histidine at position 162 of the amino acid sequence shown as SEQ ID No. 2 with alanine; (22) replacing aspartic acid at position 130 of the amino acid sequence shown as SEQ ID No. 2 with leucine, and replacing histidine at position 162 of the amino acid sequence shown as SEQ ID No. 2 with glycine; (23) replacing aspartic acid at position 130 of the amino acid sequence shown as SEQ ID No. 2 with alanine, and replacing histidine at position 162 of the amino acid sequence shown as SEQ ID No. 2 with alanine; (24) the aspartic acid at position 130 of the amino acid sequence shown in SEQ ID No. 2 is replaced by alanine, and the histidine at position 162 is replaced by glycine; (25) the threonine at position 129 of the amino acid sequence shown in SEQ ID No. 2 is replaced by leucine, the aspartic acid at position 130 is replaced by leucine, and the histidine at position 162 is replaced by alanine; (26) the histidine at position 102 of the amino acid sequence shown in SEQ ID No. 2 is replaced by alanine, the aspartic acid at position 130 is replaced by leucine, and the histidine at position 162 is replaced by alanine; (27) the threonine at position 129 of the amino acid sequence shown in SEQ ID No. 2 is replaced by leucine, the aspartic acid at position 130 is replaced by leucine, and the histidine at position 162 is replaced by cysteine; (28) the histidine at position 102 of the amino acid sequence shown in SEQ ID No. 2 is replaced by alanine, the aspartic acid at position 130 is replaced by leucine, and the histidine at position 162 is replaced by cysteine; (29) the aspartic acid at position 130 of the amino acid sequence shown in SEQ ID No. 2 is replaced by leucine, the valine at position 154 is replaced by phenylalanine, and the histidine at position 162 is replaced by alanine; (30) the aspartic acid at position 130 of the amino acid sequence shown in SEQ ID No. 2 is replaced by leucine, the histidine at position 162 is replaced by alanine, and the valine at position 237 is replaced by tyrosine; (31) the threonine at position 78 of the amino acid sequence shown in SEQ ID No. 2 is replaced by glutamine, the threonine at position 129 is replaced by leucine, the aspartic acid at position 130 is replaced by leucine, and the histidine at position 162 is replaced by alanine; (32) the threonine at position 129 of the amino acid sequence shown in SEQ ID No. 2 is replaced by leucine, the aspartic acid at position 130 is replaced by leucine, the serine at position 159 is replaced by threonine, and the histidine at position 162 is replaced by alanine; (33) the threonine at position 129 of the amino acid sequence shown in SEQ ID No. 2 is replaced by leucine, the aspartic acid at position 130 is replaced by leucine, the methionine at position 160 is replaced by threonine, and the histidine at position 162 is replaced by alanine; (34) the threonine at position 129 of the amino acid sequence shown in SEQ ID No. 2 is replaced by leucine, the aspartic acid at position 130 is replaced by leucine, the methionine at position 160 is replaced by serine, and the histidine at position 162 is replaced by alanine; (35) the threonine at position 129 of the amino acid sequence shown in SEQ ID No. 2 is replaced by leucine, the aspartic acid at position 130 is replaced by leucine, the glycine at position 161 is replaced by serine, and the histidine at position 162 is replaced by alanine; (36) the threonine at position 129, the aspartic acid at position 130, the cysteine at position 134, the glycine at position 161, the histidine at position 162, and the glycine at position 236 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, alanine, serine, alanine, and alanine, respectively; (37) the threonine at position 129, the aspartic acid at position 130, the glycine at position 161, the histidine at position 162, and the threonine at position 179 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, serine, alanine, and isoleucine, respectively; (38) the threonine at position 129, the aspartic acid at position 130, the glycine at position 161, the histidine at position 162, and the arginine at position 189 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, serine, alanine, and alanine, respectively; (39) the threonine at position 129, the aspartic acid at position 130, the glycine at position 161, the histidine at position 162, and the tyrosine at position 213 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, serine, alanine, and leucine, respectively; (40) the threonine at position 129, the aspartic acid at position 130, the glycine at position 161, the histidine at position 162, and the glycine at position 236 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, serine, alanine, and alanine, respectively; (41) the threonine at position 129, the aspartic acid at position 130, the glycine at position 161, the histidine at position 162, the threonine at position 179, and the tyrosine at position 213 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, serine, alanine, isoleucine, and leucine, respectively; (42) the threonine at position 129, the aspartic acid at position 130, the glycine at position 161, the histidine at position 162, the threonine at position 179, the tyrosine at position 213, and the glycine at position 236 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by leucine, leucine, serine, alanine, isoleucine, leucine, and alanine, respectively; (43) the arginine at position 79, the threonine at position 129, the aspartic acid at position 130, the glycine at position 161, the histidine at position 162, the threonine at position 179, the tyrosine at position 213, and the glycine at position 236 of the amino acid sequence set forth in SEQ ID No. 2 are replaced by glutamine, leucine, leucine, serine, alanine, isoleucine, leucine, and alanine, respectively; (44) the 79th arginine of the amino acid sequence shown in SEQ ID No. 2 is replaced by tyrosine, the 129th threonine is replaced by leucine, the 130th aspartic acid is replaced by leucine, the 161st glycine is replaced by serine, the 162nd histidine is replaced by alanine, the 179th threonine is replaced by isoleucine, the 213th tyrosine is replaced by leucine, and the 236th glycine is replaced by alanine; (45) the 129th threonine of the amino acid sequence shown in SEQ ID No. 2 is replaced by leucine, the 130th aspartic acid is replaced by leucine, the 161st glycine is replaced by serine, the 162nd histidine is replaced by alanine, the 163rd serine is replaced by threonine, the 179th threonine is replaced by isoleucine, the 213th tyrosine is replaced by leucine, and the 236th glycine is replaced by alanine; (46) the 129th threonine of the amino acid sequence shown in SEQ ID No. 2 is replaced by leucine, the 130th aspartic acid is replaced by leucine, the 158th methionine is replaced by tyrosine, the 161st glycine is replaced by serine, the 162nd histidine is replaced by alanine, the 163rd serine is replaced by threonine, the 179th threonine is replaced by isoleucine, the 213th tyrosine is replaced by leucine, and the 236th glycine is replaced by alanine.

2. A nucleic acid, characterized in that, The diaminopimelate dehydrogenase mutant as claimed in claim 1.

3. A recombinant expression vector, characterized in that, The nucleic acid as claimed in claim 2.

4. A recombinant expression transformant, characterized by, The recombinant expression vector as claimed in claim 3.

5. A recombinant diaminopimelate dehydrogenase mutant catalyst characterized in that, is any one of the following forms: (1) culturing the recombinant expression transformant as claimed in claim 4, isolating the transformant cells containing the diaminopimelate dehydrogenase mutant; (2) culturing the recombinant expression transformant as claimed in claim 4, isolating the transformant cells containing the diaminopimelate dehydrogenase mutant, crushing the transformant cells containing the diaminopimelate dehydrogenase mutant to obtain a cell crushing solution; (3) culturing the recombinant expression transformant as claimed in claim 4, isolating the transformant cells containing the diaminopimelate dehydrogenase mutant, crushing the transformant cells containing the diaminopimelate dehydrogenase mutant to obtain a cell crushing solution, and freeze-drying the diaminopimelate dehydrogenase mutant cell crushing solution to obtain a freeze-dried enzyme powder.

6. Use of the diaminopimelate dehydrogenase mutant as claimed in claim 1 or the recombinant diaminopimelate dehydrogenase mutant catalyst as claimed in claim 5 in catalyzing asymmetric reduction of different aliphatic 2-keto acids or aromatic 2-keto acids to prepare D-amino acids.

7. The use according to claim 6, characterized in that, The structure of the aliphatic 2-keto acid is selected from one of S1-S9 and the structure of the aromatic 2-keto acid is selected from one of S10-S20:

8. The use according to claim 6, characterized in that, The asymmetric reduction reaction of 2-keto acid substrate catalyzed by the diaminopimelate dehydrogenase mutant of claim 1 or the recombinant diaminopimelate dehydrogenase mutant catalyst of claim 5 requires the participation of coenzyme NADH or NADPH, and the coenzyme NADH or NADPH is oxidized to NAD + or NADP + during the reaction.

9. The use according to claim 8, wherein the compound is ###00010### or a pharmaceutically acceptable salt thereof. The in-situ regeneration of coenzyme NADH or NADPH is realized by coupling with the formic acid oxidation reaction catalyzed by formate dehydrogenase, with ammonium formate as a co-substrate.

10. The use according to claim 9, wherein the compound is ###00010### or a pharmaceutically acceptable salt thereof. In the application, the concentration of 2-keto acid substrate is 10-100 mM, the amount of NADP + in the reaction solution is 0.1-0.5 mM; and the temperature of the asymmetric reduction reaction is 30-40°C.

Citation Information

Patent Citations

  • Amine dehydrogenase mutant and application thereof in preparation of (S)-5-methyl-2-pyrrolidone

    CN114686451A

  • Meso-diaminopimelate dehydrogenase mutant and production method thereof

    CN115786296A

  • Diaminopimelate dehydrogenase mutant and application thereof in synthesis of D-phenylglycine

    CN116656639A

  • Diaminopimelate dehydrogenase mutant and application thereof in D-amino acid synthesis

    CN118360265A

  • NADH-dependent amino acid dehydrogenase and application thereof in increasing lysine yield

    US20220112471A1