Compounds for use in the treatment and / or diagnosis of a pathology characterised by the expression of the na / i symporter (NIS) in the affected cells

Abstract

The invention refers to the compound of formula (I), or enantiomers thereof, or pharmaceutically acceptable salts thereof: (I) or a pharmaceutical composition comprising the same, for use in the treatment of a pathology characterised by the expression of the Na / I symporter (NIS) in the affected cells. The invention also relates to the same compounds of formula (I), or enantiomers thereof, or pharmaceutically acceptable salts thereof, or pharmaceutical composition comprising the same for use in an in vivo diagnostic method of a pathology characterised by the expression of the Na / I symporter (NIS) in the affected cells.

Description

[0001]COMPOUNDS FOR USE IN THE TREATMENT AND / OR DIAGNOSIS OFA PATHOLOGY CHARACTERISED BY THE EXPRESSION OF THE NA / I SYMPORTER (NIS) IN THE AFFECTED CELLS ------ Field of application The present invention refers to the pharmaceuticalfield, and it refers in particular to sitagliptin, orenantiomers thereof, or pharmaceutically acceptablesalts thereof, for use in the treatment and / or in thediagnosis of a pathology characterised by the expressionof the Na / I symporter (NIS) in the affected cells, suchas thyroid cancer, benign hyperthyroid disease andbreast cancer. Prior art Thyroid Cancer (TC) is the 9th most common type of cancerin the world with an estimated 600,000 new cases annuallyworldwide. TC is expected to be the 4th most frequently diagnosed cancer in the USA by the year 2030. The main strategies for treatment of TC include thyroidectomy and, in selected cases, radioactive iodine therapy (ortreatment) (RAI) and TSH suppressive therapy (Haugen,2017). Even though these approaches are successful inmost patients, nearly 10% of differentiated TC will become radioiodine (RAI)-refractory, showing highaggressiveness and poor therapeutic response, causingreduced survival rates in the patient (Crocetti et al.,2021).The development of RAI resistance (also referred to asRAI refractoriness) is caused by the reduction or lossof the ability of iodine up-take by thyroid cells, due to the impairment of Na / I symporter (NIS) expression and function, a step that occurs during the progressive de- differentiation of thyroid cancer cells (Choudhury and Gupta, 2018). NIS is the plasma membrane protein involved in the uptake and active transportation of iodine from the blood into the thyroid follicular cells and is the sole known transporter of iodide into human cells (Dai et al., 1996). Thus, an impaired intracellular retention and / or a reduced expression of NIS on the plasma membrane results in reduction or loss of its activity ultimately leadingto RAI resistance (or refractoriness) (Durante et al.,2006). The reduction / loss of iodide uptake capacity inpoorly differentiated thyroid carcinomas is mainly due to the reduced / lost functional expression of the NIS, with a defect occurring mainly at gene expression level (Ravera et al., 2017).Radioactive iodine-131 (RAI) therapy is an existinganti-tumor therapy, classified as radioactive nuclearmedicine. The molecule was first synthesized in 1941,and approved by FDA for its therapeutic use (Amit et al., 2017). Iodine is a natural precursor for thyroid hormones triiodothyronine (T3) and thyroxine (T4) and is uptaken from the blood into the thyroid follicular cell by the sodium and iodide transporter (NIS) (Amit et al., 2017). Since normal thyroid cells and thyroid cancer cells, at least at early stages, express NIS, RAI therapy is currently employed in patients with hyperthyroidism and at least in some patients with thyroid cancer. Indeed, following RAI uptake by thyroid follicular cells expressing NIS, RAI exerts its destructive effects, by emitting beta rays that further cause definitive localdamage to the thyroid tissue (Ravera et al., 2017). Thistreatment can be used to ablate any residual thyroid tissue not removed by surgery or to treat patients with lymph nodes involvement as well as in benign hyperthyroiddiseases (i.e. Graves’ disease and toxic adenoma)(Kahalyet al., 2018).In some thyroid cancer patients, as mentioned above, theexpression of NIS by thyroid cancer cells is lost or very low, consequently not allowing the use of RAI asdiagnostic and therapeutic tool for both tumor remnantsor distant metastases. At present, the available therapeutic strategies inpatients with RAI-refractory TC are scanty, includingonly local therapy (surgery, external radiotherapy, interventional radiology approach) or, in case of distant metastatic disease, systemic therapy withThyrosine-kinase inhibitors (Amit et al., 2017).However, Thyrosine-kinase therapies show several sideeffects including anemia, thrombopenia and neutropenia,and the most common extra-heamatologic adverse effectsare edema, nausea, hypothyroidism, vomiting anddiarrhea. (Hartmann et al., 2009).The levels of NIS expression in patients with benignhyperthyroid disease also affects the success of RAI therapy in such patients.It has been shown that extra-thyroidal tissue cells,including salivary ductal, gastric mucosa, and lactating mammary cells, express NIS at mRNA and / or protein levels (Ravera et al., 2017). More interestingly, breast cancer cells are also known to express NIS.Moreover, Chatterjee, et al., determined that NISexpression was detected in 70% of breast-cancer patients, and NIS activity varied amongst breast-cancer subtypes (Chatterjee et al., 2015). NIS is also expressed by triple-negative (estrogen receptor-, progesterone receptor-, and Her2-negative) breast cancers (65% of cases), for which the therapeutic choices are limited to chemotherapeutic agents (Renier et al., 2009). Breast cancer is the most common cancer diagnosed in women. Prevalence data indicate that there are more than2,000,000 new cases and more than 600,000 mortalitiesper year. For non-metastatic invasive breast cancer, the average 10-year survival rate is 84%. However, when breast cancer is limited to the breast, the 5-year survival rate rises to 99% (Łukasiewicz et al., 2021). Treatment strategies for breast cancer include surgery, chemotherapy, radiations, hormones, and targeted therapies. Despite advances in breast-cancer treatment,chemotherapy remains the gold standard (Łukasiewicz etal., 2021). The disadvantages of chemotherapy are well known and include toxicity to normal tissues and systemic side effects.Thus, the need is felt in the field for alternativetreatments of a pathology characterised by theexpression of the Na / I symporter (NIS) in the affectedcells, such as for example thyroid cancer, benign hyperthyroid disease and breast cancer, more in particular in the case where the affected cells havelost part or all of their NIS expression or show low NISexpression, possibly making them refractory to RAItherapy; and for a way of diagnosing such pathology. US 9,907,813 describes a method for treating human cancer(including thyroid cancer) in a patient comprisingadministering a histone deacetylase (HDAC) inhibitor to the patient and administering an inhibitor of a MAPkinase pathway protein or its expression to the patientwherein the inhibitors are administered in sufficient amounts to induce expression of one or more iodide- handling genes in the human cancer. WO 2015 / 166355 refers to a method for treating a patient with papillary thyroid carcinoma comprising administering a therapeutically effective amount of at least one PDGFRA inhibitor, or a pharmaceutically acceptable salt thereof, to a patient with papillary thyroid carcinoma.WO 2011 / 133216 refers to a method for treating cancer,the method comprising administering a therapeutically effective amount of transfection vector for a NIS mutant protein or a pharmaceutical composition thereof to a subject, and administering a therapeutically effective amount of a radioisotope, wherein the transfection vector for the NIS mutant protein comprises a heterologous nucleic acid comprising a promoter and encoding a NIS mutant protein wherein glycine residue 93 is replaced with aspartic acid or glutamic acid and wherein the radioisotope is188ReO4- and / or186ReO4-, under conditions permitting cells of the cancer to express the NIS mutant protein and transport the radioisotope thereby treating the cancer.However, these approaches have various side effects, aswell as drawbacks in their means of administration, which affect compliance. The technical problem underlying the present inventionis thus that of making available a new treatment for apathology characterised by the expression of the Na / Isymporter (NIS) in the affected cells, such as forexample thyroid cancer, benign hyperthyroid disease andbreast cancer.A further technical problem is that of making availablesuch new treatment in particular in the case in whichthe affected cells have lost part or all of their NISexpression or show low NIS expression, that overcomesthe drawbacks of the prior art. A further technical problem is that of making availablesuch a treatment for a pathology characterised by theexpression of the Na / I symporter (NIS) in the affectedcells, in the case in which the affected cells have lostpart or all of their NIS expression or show low NISexpression, making them refractory to RAI therapy.A further technical problem is that of making available a method of diagnosis of the above pathology. Summary of the invention The above technical problem has been solved by thecompound of formula (I), or enantiomers thereof, orpharmaceutically acceptable salts thereof: for use in the treatment of a pathology characterised bythe expression of the Na / I symporter (NIS) in theaffected cells. In another aspect, the present invention refers toa pharmaceutical composition comprising the compound offormula (I), or enantiomers thereof, or pharmaceuticallyacceptable salts thereof: and at least one pharmaceutically acceptable excipient, for use in the treatment of a pathology characterised bythe expression of the Na / I symporter (NIS) in theaffected cells. According to an embodiment of the invention, said pharmaceutical composition can further comprise radiolabelled iodine, preferably iodine-131. The expression “a pathology characterised by theexpression of the Na / I symporter (NIS) in the affectedcells” is used herein to refer to a pathology in whichthe affected cells typically express NIS.Preferably, the pathology characterised by theexpression of the Na / I symporter (NIS) in the affectedcells is chosen from thyroid cancer, benign hyperthyroid disease and breast cancer. The pathology characterised by the expression of the Na / I symporter (NIS) in the affected cells cancomprise in fact tumours, preferably malignant tumours,and non-cancerous disorders, such as hyperthyroidism. Preferably, the thyroid cancer is a malignant thyroid cancer. Preferably, the breast cancer is a malignant breast cancer. By “affected cell” is meant herein a cell that expresses the disease. In the case of cancer, theaffected cells are cancer cells; in the case of benignhyperthyroid disease, the affected cells are thyroidcells. Preferably, the compound of formula (I) is in theenantiomer R configuration.Preferably, the pharmaceutically acceptable salt isa phosphate salt or a hydrate thereof.Preferably, the hydrate is a monohydrate or a dihydrate, more preferably a monohydrate. In the following, “the compound of formula (I), orenantiomers thereof, or pharmaceutically acceptablesalts thereof” will also be referred to as “the compoundof the invention”. Preferably the compound of the invention is a saltof the compound of formula (I) or a hydrate thereof,more preferably a phosphate salt of the compound offormula (I) or a hydrate thereof, even more preferably a phosphate monohydrate thereof. Preferably, the compound of the invention is a monohydrate phosphate salt of the compound of formula (I) in the R enantiomeric configuration, having formula (II): (II) Sitagliptin phosphate monohydrate (compound offormula (II)) has formula C16H15F6N5O. H3PO4.H2O, molecular mass 523.32, CAS number 654671-77-9, andIUPAC NAME (R)-3-amino-1-(3-(trifluoromethyl)-5,6- dihydro-[1,2,4]triazolo[4,3-a]pyrazin-7(8h)-yl)-4- (2,4,5-trifluorophenyl)butan-1-one phosphate hydrate.It can be purchased for example from Merck (Merck KGaA,Italy) with product number Y0001812.Sitagliptin (the compound of formula (I)) hasformula C H F N O and mole -116 15 6 5 cular mass 407.31 g mol , CASnumber 486460-32-6 and IUPAC NAME (3R)-3-amino-1-[3-(trifluoromethyl)-6,8-dihydro-5H-[1,2,4]triazolo[4,3- a]pyrazin-7-yl]-4-(2,4,5-trifluorophenyl)butan-1-one. Sitagliptin phosphate monohydrate is an oraldipeptidyl peptidase-4 (DPP-4) inhibitor used in conjunction with diet and exercise to improve glycemic control in patients with type 2 diabetes mellitus. The compound leads to glucose dependent increases in insulin and decreases in glucagon, ultimately leading to an improvement of the control of blood sugar. Sitagliptin is effective and well tolerated and was granted FDAapproval on October 16, 2006 (Herman et al., 2005).Advantageously, the compound of the inventionincreases the expression of NIS in cells that areaffected by said pathology characterised by the expression of NIS in the affected cells, such as in thyroid cancer cells, affected cells in benignhyperthyroid disease (thyroid cells) and breast cancercells, when administered to a subject affected by suchpathology, thus increasing the sensitivity of the cellsto radioiodine (RAI) treatment. The compound of the invention is in fact an up- regulator of NIS. Preferably, the compound of the invention is for use as a radiosensitizer. In particular, in subjects in which the affectedcells have lost part or all of their NIS expression, toan extent that the expression of NIS is too low to enabletreatment with RAI therapy, such as for example in thecase of thyroid cancer patients that have becomerefractory to RAI therapy the compound of the inventionincreases / restores NIS expression in the affected cellsthus making the affected cells sensitive again to RAItherapy. In the case of benign hyperthyroid disease patients, the compound of the invention increases NIS expression in the affected cells thus making them more sensitive to the RAI therapy. In subjects in which the affected cells have anormally low expression of NIS, such as for examplebreast cancer patients, the compound of the inventionincreases NIS expression thus making the affected cellssensitive to RAI therapy. The pathology can thus betreated with RAI therapy.RAI therapy is in fact more effective with higher expression of NIS. The compound of the invention thus acts as a radiosensitizer. Preferably, the pathology is one in which theaffected cells have no or a low expression of NIS. Cells are considered to have no or low expressionof NIS when they are RAI-refractory.Preferably, the pathology is one in which the affected cells are RAI-refractory. Cells are considered to be RAI-refractory when RAItherapy is not effective or partially effective in thetreatment of the pathology. This can occur because theaffected cells are typically low in NIS expression (suchas in breast cancer) or insufficient in NIS expression to provide full efficacy of RAI therapy (such as inbenign hyperthyroid disease), or because the affectedcells have lost part or all of their NIS expression (suchas in thyroid cancer), thus affecting the uptake of theradiolabelled iodine by the affected cells. For example, in the case in which the pathology isa cancer, preferably thyroid cancer or breast cancer,cells are classified as being radioiodine (RAI)-refractory when any of the following criteria apply(Aashiq et al, 2019):i.Absence of RAI uptake at initial diagnosis oflocoregional recurrence or distant metastasis; ii.Absence or progressive loss of radioiodine uptake in the post-therapy scan after RAI therapy; iii.Presence of more than 1 metastatic lesion with at least one lesion without RAI uptake in the post-therapy scan; iv.Structural progression of tumors 12 to 16 months after RAI therapy despite the presence of iodine uptake in the post-therapy scan; v.Tumors in patients who have received 600 millicurie (mCi) / 22.2 gigabecquerel (GBq) or more of RAI cumulatively without signs of remission; vi.Significant uptake on 2-deoxy-2-[fluorine-18] fluoro- D-glucose positron emission tomography integrated with computed tomography (F-18 FDG PET / CT). The treatment of the invention comprises theadmnistration of said compound of the invention orpharmaceutical composition of the invention. Preferably, said treatment is carried out on asubject affected by said pathology characterised by theexpression of the Na / I symporter (NIS) in the affectedcells, preferably chosen from thyroid cancer, benignhyperthyroid disease, and breast cancer, more preferablywhose affected cells are radioiodine (RAI)-refractory. In a preferred embodiment, said compound of theinvention or pharmaceutical composition of the inventionis administered to a subject affected by said pathologycharacterised by the expression of the Na / I symporter(NIS) in the affected cells, that has previouslyundergone RAI therapy and / or surgical resection,optionally followed by RAI therapy.Preferably, the surgical resection is chosen frommastectomy and thyroidectomy. In an alternative preferred embodiment, said compound of the invention or pharmaceutical composition of the invention is administered to a subject affected by said pathology characterised by the expression of theNa / I symporter (NIS) in the affected cells, that has notpreviously undergone RAI therapy. In the case that the subject is affected by thyroid cancer, for example, the subject may have previouslyundergone one or more RAI therapies, which may havebecome ineffective over time. The subject may also haveundergone surgical resection to remove part of the cancercells, optionally followed by RAI therapy for examplefor ablation of any remaining cancer cells. In the case of breast cancer, the subject may havenever undergone RAI therapy, as this is not a typicaltherapy for breast cancer. The subject may however have undergone a surgical resection. In the case of benign hyperthyroid disease, as inthyroid cancer, the subject may have previouslyundergone one or more RAI therapies, which may have beenpartially effective. The subject may also have undergonesurgical resection to remove part of the thyroid cells, optionally followed by RAI therapy. Preferably, said treatment of said pathologycomprises radioactive iodine (RAI) therapy.The RAI therapy is carried out according to protocols well known in the field. In particular, it comprises the administration of a radioactive form ofiodine to the patient, more preferably Iodine-131.Preferably, said compound of the invention orpharmaceutical composition of the invention isadministered prior to the RAI therapy, more preferably 6 to 48 hours prior to RAI therapy, even more preferably12 to 36 hours prior to RAI therapy.Preferably, said compound of the invention orpharmaceutical composition of the invention isadministered prior to the RAI therapy and optionallyalso during and / or after the RAI therapy. Preferably, in the RAI therapy, the radioactiveform of iodine, more preferably Iodine-131, isadministered in the form of oral capsules, oral drinkingsolution, intravenous injections or a mixture thereof, even more preferably in the form of oral capsules. Preferably, Iodine-131 is administered in the(therapeutic) amount of from 500 to 900 MBq, morepreferably from 600 to 800 MBq, even more preferablyfrom 650 to 670 MBq.Preferably, the pharmaceutical composition has aconcentration of the compound of the invention, morepreferably sitagliptin phosphate monohydrate accordingto formula (II), from 1 to 50 µM, more preferably from5 to 20 µM, most preferably 10 µM. Preferably, the pharmaceutical composition is in a form chosen from an aqueous or non-aqueous solution, a suspension, an emulsion (e.g. a microemulsion), a solid,a gel and an aerosol.In an embodiment of the invention, the pharmaceutical composition is solid, more preferably in the form of a tablet, a capsule, a powder, or any combination thereof. The pharmaceutical composition can be a lyophilized product. In another embodiment of the invention, thepharmaceutical composition is in the form of an aqueousor non-aqueous solution, a suspension, an emulsion, orany combination thereof. Preferably, the pharmaceutical composition is for administration via a route chosen from intraperitoneal, intravenous, intramuscular, transdermal, intradermal, infusion (for example bolus infusion), subcutaneous, oral, enteral, rectal, intranasal, by inhalation, buccal, sublingual, topical, intraocular, vaginal, intracranial injection, and any combination thereof,more preferably oral administration.The present invention also concerns a combination of a)a compound of formula (I), or enantiomers thereof, orpharmaceutically acceptable salts thereof as definedabove or a pharmaceutical composition comprising thecompound of formula (I), or enantiomers thereof, orpharmaceutically acceptable salts thereof and b) aradiolabelled iodine, preferably iodine-131, forseparate or sequential use in the treatment of apathology characterised by the expression of the Na / Isymporter (NIS) in the affected cells.“Separate use” is understood as meaning the administration, at the same time, of the two compoundsof the combination according to the invention in distinctpharmaceutical forms.“Sequential use” is understood as meaning the successiveadministration of the two compounds of the combination according to the invention, each in a distinctpharmaceutical form. In particular, said compound orpharmaceutical composition a) is preferably administeredprior to compound b) and optionally it can also beadministered at the same time or after compound b). In another aspect, the present invention refers toa method for the treatment of a pathology characterisedby the expression of the Na / I symporter (NIS) in theaffected cells that comprises administering a therapeutically effective amount of the compound offormula (I), or enantiomers thereof, or pharmaceuticallyacceptable salts thereof: (I)or a pharmaceutical composition comprising the compoundof formula (I), or enantiomers thereof, orpharmaceutically acceptable salts thereof, and at leastone pharmaceutically acceptable excipient, to a subjectin need thereof. According to an embodiment of the invention, said method for treatment can further comprise the administration of a radiolabelled iodine, preferably iodine-131. Preferably, the administration of a radiolabelled iodine is simultaneous, separate or sequential with respect to the compound of formula (I), or enantiomers thereof, or pharmaceutically acceptable salts thereof, or the pharmaceutical composition comprising the compound of formula (I), or enantiomers thereof, or pharmaceutically acceptable salts thereof, and at least one pharmaceutically acceptable excipient. “Simultaneous” is understood as meaning that the compound of the invention or pharmaceutical composition of the invention is administered at the same time as theradiolabelled iodine, in a single and identicalpharmaceutical form. “Separate” is understood as meaning that the compound of the invention or pharmaceutical composition of the invention is administered at the same time as the radiolabelled iodine, each in a distinct pharmaceutical form. “Sequential” is understood as meaning that the compound of the invention or pharmaceutical composition of the invention is administered at a different time as the radiolabelled iodine, each in a distinct pharmaceutical form. Preferably, said compound of the invention orpharmaceutical composition of the invention isadministered prior to the administration of aradiolabelled iodine and optionally also during and / orafter the administration of a radiolabelled iodine. Preferably, said pathology is chosen from thyroidcancer, benign hyperthyroid disease, and breast cancer.Preferably, said compound of formula (I), orenantiomers thereof, or pharmaceutically acceptablesalts thereof is sitagliptin phosphate monohydrate(compound of formula (II)). The Applicant has in fact surprisingly found thatthe compound of the invention enhances the expression ofsodium and iodide transporter NIS in human cells. As can be seen from the Examples below, in fact, the effects of sitagliptin phosphate monohydrate areshown in terms of in vitro modulation of the expressionof both mRNA and protein of NIS in thyroid and breast cancer cells, as well as normal thyroid cells. The mainfinding was that sitagliptin phosphate monohydrateincreases mRNA and protein levels of NIS in both thyroidand breast cancer cell lines, as well as normal thyroidcells. Given the increase in NIS mRNA levels shown, there follows the recovery of an adequate expression of NIS bythyroid cancer cells, making them more responsive totreatment with RAI, and thus increasing the possibilityof response of patients with more aggressive cancer, via an increase of RAI up-take by thyroid cells and enhanced ablation efficacy of RAI. The therapeutic results clearly stem from the notion that the sodium iodide symporter (NIS) is highly expressed on the cell membrane of thyrocytes (Levy et al., 1997). As mentioned above, sitagliptin phosphate monohydrate is an oral dipeptidyl peptidase-4 (DPP-4) inhibitor used to improve glycemic control in patients with type 2 diabetes mellitus. At present, there are no literature data reportingan attempt to use sitagliptin, or enantiomers thereof,or pharmaceutically acceptable salts thereof, in thetreatment of cancer or benign hyperthyroid disease, inparticular as an up-regulator of NIS, in order topotentiate or allow RAI-therapy in thyroid patients.The Examples below also report on an in vitro studyevaluating the effect of sitagliptin phosphatemonohydrate on NIS expression in breast cancer cell lines(MDA-MB-231 and HCC1806). The results reported in theExamples show that treatment with sitagliptin phosphatemonohydrate is able to enhance the mRNA and protein membrane expression of NIS in both MDA-MB-231 and HCC1806 breast cancer cell lines. At present, also in the case of breast cancer, no literature data or other data reported the use ofsitagliptin, or enantiomers thereof, or pharmaceuticallyacceptable salts thereof, as an up-regulator of NIS inbreast cancer cells.As mentioned above, RAI therapy is a standardtherapy in selected cases of thyroid cancer. On the otherhand, it is not a standard therapy for the treatment ofbreast cancer. Breast cancer cells usually have arelatively low NIS expression compared to thyroid cells, usually about 20 times lower. It follows that, in thyroid cancer, the use of thecompound of the invention, by increasing the expressionof NIS in thyroid cells, ameliorates the efficacy of RAItherapy for currently performed therapy at least in somepatients, and allows RAI therapy in advanced thyroidcancer after the partial or total loss of expression ofNIS. At difference, in breast cancer, the use of suchcompounds for the enhancement of the expression of NISallow performing RAI therapy.Benign hyperthyroid disease is also a conditionthat is commonly treated by RAI therapy and that isdependent upon expression of NIS by the thyroid cells.The Examples below (Example 7) show that NIS is expressedalso in non-cancer cells. It follows that, in benignhyperthyroid disease, the use of the compound of theinvention, by increasing the expression of NIS in thyroidcells, increases the therapeutic efficacy of RAI therapy. Therefore, the compound of the invention can be useful for treating conditions in which cells expressing NIS represent the therapeutic target. In another aspect, the present invention alsorefers to the compound of formula (I), or enantiomersthereof, or pharmaceutically acceptable salts thereof: for use in an in vivo diagnostic method of a pathologycharacterised by the expression of the Na / I symporter(NIS) in the affected cells. In another aspect, the present invention refers to a pharmaceutical composition comprising the compound of formula (I), or enantiomers thereof, or pharmaceutically acceptable salts thereof: (I) and at least one pharmaceutically acceptable excipient,for use in an in vivo diagnostic method of a pathologycharacterised by the expression of the Na / I symporter(NIS) in the affected cells.Preferably, the pathology characterised by theexpression of the Na / I symporter (NIS) in the affectedcells is chosen from thyroid cancer, benign hyperthyroid disease and breast cancer. Preferably, the compound of formula (I) is in the enantiomer R configuration. Preferably, the pharmaceutically acceptable salt is a phosphate salt or a hydrate thereof. Preferably, the hydrate is a monohydrate or a dihydrate, more preferably a monohydrate. Preferably the compound of the invention is a salt of the compound of formula (I) or a hydrate thereof, more preferably a phosphate salt of the compound offormula (I) or a hydrate thereof, even more preferablya phosphate monohydrate thereof. Preferably, the compound of the invention is a monohydrate phosphate salt of the compound of formula (I) in the R enantiomeric configuration, having formula (II). Preferably, the diagnostic method is amorphofunctional imaging technique, more preferably scintigraphy. By way of such diagnostic method, it is possible to observe the presence of NIS-expressing cells, which can be associated to the above pathology characterised bythe expression of the Na / I symporter (NIS) in theaffected cells. Preferably, the diagnostic method comprises theadministration to a subject of a radiolabelled isotope,more preferably chosen from radiolabelled iodine and radiolabelled technetium, even more preferably radiolabelled iodine.Preferably the radiolabelled iodine is Iodine-131.Preferably the radiolabelled technetium is Technetium 99m. Preferably, the radiolabelled isotope isadministered in a diagnostic amount.With the term “diagnostic amount” is meant an amount that is sufficient to be detected in the cell by the above morphofunctional imaging technique, but not sufficient to kill or damage the cells. It is within the capabilities of the skilled person in the field to determine such diagnostic amount of radiolabelled isotope. Preferably, the diagnostic amount of theradiolabelled isotope is from 37 to 200 MBq, morepreferably 40 to 150 MBq, even more preferably 50 to10000 MBq. Preferably, the compound of the invention or thepharmaceutical composition of the invention isadministered prior to the administration of the radiolabelled isotope. Preferably, both the compound of the invention orthe pharmaceutical composition of the invention and theradiolabelled isotope are administered prior to theperformance of the morphofunctional imaging technique.Preferably, the diagnostic method is performed on subjects in which the affected cells have no or a low expression of NIS, that is to say, they are RAI- refractory, as defined above. Preferably, said subject has been previouslydiagnosed with said pathology characterised by theexpression of the Na / I symporter (NIS) in the affectedcells. In a preferred embodiment, the diagnostic method isperformed on a subject that has previously undergone RAItherapy; and / or surgical resection optionally followedby RAI therapy. Preferably, said subject has beenpreviously diagnosed with said pathology characterisedby the expression of the Na / I symporter (NIS) in theaffected cells. In an alternative preferred embodiment, the diagnostic method is performed on a subject that has notpreviously undergone RAI therapy. Preferably, saidsubject has been previously diagnosed with saidpathology characterised by the expression of the Na / Isymporter (NIS) in the affected cells.Preferably, in the diagnostic method, theradioactive isotope, more preferably Iodine-131, is administered as oral capsules, oral drinking solution, intravenous injections or a mixture thereof, even more preferably oral capsules. Preferably, the pharmaceutical composition has a concentration of the compound of the invention, more preferably sitagliptin phosphate monohydrate according to formula (II), from 1 to 50 µM, more preferably from 5 to 20 µM, most preferably 10 µM. Preferably, the pharmaceutical composition is in a form chosen from an aqueous or non-aqueous solution, a suspension, an emulsion (e.g. a microemulsion), a solid,a gel and an aerosol.In an embodiment of the invention, the pharmaceutical composition is solid, more preferably in the form of a tablet, a capsule, a powder, or any combination thereof. The pharmaceutical composition can be a lyophilized product. In another embodiment of the invention, the pharmaceutical composition is in the form of an aqueousor non-aqueous solution, a suspension, an emulsion, orany combination thereof. Preferably, the pharmaceutical composition is for administration via a route chosen from intraperitoneal, intravenous, intramuscular, transdermal, intradermal, infusion (for example bolus infusion), subcutaneous,oral, enteral, rectal, intranasal, by inhalation,buccal, sublingual, topical, intraocular, vaginal,intracranial injection, and any combination thereof,more preferably for oral administration. It is known in fact that by administering adiagnostic amount of radiolabelled isotope, it ispossible to detect by way of a morphofunctional imagingtechnique, such as scintigraphy, the presence of NIS-expressing cells, which can be associated to the abovepathology characterised by the expression of the Na / Isymporter (NIS) in the affected cells.However, when the affected cells have lost part orall of their NIS expression or show low NIS expression,this technique cannot be used successfully. It has now been surprisingly found that, by administering the compound of the invention, the expression of NIS can be increased in the above pathology, thus making it possible to apply the above diagnostic method successfully. Thanks to the compound of the invention used in a diagnostic method, it is possible to observe in a subject the presence of any cells affected by the above pathology. In the case of cancer, such as thyroid canceror breast cancer, it is possible not only to detect thepresence of the pathology prior to any treatment, butalso to detect for example any residual cancer cellsfollowing surgical resection (for example thyroidectomyor mastectomy), and any metastases.The subject may in fact undergo the diagnosticmethod of the invention as a first diagnostic tool ormay be already undergoing treatment for the pathology, wherein the diagnostic method of the invention is usedto monitor the progress of treatment. The subject mayhave previously undergone RAI treatment and / or surgical resection, or may have previously received neither. In another aspect, the present invention alsorefers to an in vivo diagnostic method of a pathologycharacterised by the expression of the Na / I symporter(NIS) in the affected cells that comprises administeringa diagnostic amount of the compound of formula (I), orenantiomers thereof, or pharmaceutically acceptablesalts thereof: or the pharmaceutical composition comprising thecompound of formula (I), or enantiomers thereof, orpharmaceutically acceptable salts thereof, and at leastone pharmaceutically acceptable excipient, to a subjectin need thereof. Brief description of the drawings In the figures “Sitagliptin phosphate monohydrate” isabbreviated to “Sitagliptin PM”.Figure 1 is a graph showing the increased mRNA levels ofNIS in thyroid cancer cell lines following treatmentwith sitagliptin phosphate monohydrate. In particular,a significant up-regulation of the basal mRNA levels of NIS in TPC-1 and 8505C, was registered followingtreatment with sitagliptin phosphate monohydrate.Student-T test p<0.05 Sitagliptin phosphate monohydratevs. Basal.Figure 2 is a graph showing the increased mRNA levels ofNIS in breast cancer cell lines following treatment withsitagliptin phosphate monohydrate. In particular, asignificant up-regulation of the basal mRNA levels ofNIS in MDA-MB-231 and HCC1806, was registered followingtreatment with sitagliptin phosphate monohydrate.Student-T test p<0.05 Sitagliptin phosphate monohydratevs. Basal. Figure 3 shows images of Immunocytochemistry showing NIS expression on TPC-1 thyroid cancer cells acquired by an Olympus XM10 microscope (Olympus, Deutschland GmbH, Hamburg, Germany). In particular, Panel A) shows representative immunofluorescence staining for NIS transporter in TPC-1. Images show NIS expression in TPC- 1 cells in basal condition. Panel B) shows that after treatment with sitagliptin phosphate monohydrate, the expression increased. (staining: HOECHST= nuclei; FITC= NIS expression on cells membranes, scale bar = 50 µm objective 20X).Figure 4 shows images of Immunocytochemistry showing NISexpression on 8505C thyroid cancer cells acquired by an Olympus XM10 microscope (Olympus, Deutschland GmbH, Hamburg, Germany). In particular Panel A) shows representative immunofluorescence staining for NIS transporter in 8505C. Images show NIS expression in 8505C cells in basal condition. Panel B) shows that after treatment with sitagliptin phosphate monohydrate, NIS expression increased (staining: HOECHST= nuclei; FITC= NIS expression on cells membranes, scale bar = 50 µm objective 20X).Figure 5 shows images of Immunocytochemistry showing NISexpression on MDA-MB-231 breast cancer cells acquired byan Olympus XM10 microscope (Olympus, Deutschland GmbH, Hamburg, Germany). In particular, Panel A) shows representative immunofluorescence staining for NIS transporter in MDA-MB-231. Images show NIS expression in MDA-MB-231 cells in basal condition. Panel B) shows that after treatment with sitagliptin phosphate monohydrate,the expression increased. (staining: HOECHST= nuclei;FITC= NIS expression on cells membranes, scale bar = 50 µm objective 20X). Figure 6 shows images of Immunocytochemistry showing NIS expression on HCC1806 breast cancer cells acquired by an Olympus XM10 microscope (Olympus, Deutschland GmbH,Hamburg, Germany.) In particular, Panel A) showsrepresentative immunofluorescence staining for NIStransporter in HCC1806. Images show NIS expression inHCC1806 cells in basal condition. Panel B) shows that after treatment with sitagliptin phosphate monohydrate, the expression increased. (staining: HOECHST= nuclei; FITC= NIS expression on cells membranes, scale bar = 50 µm objective 20X).Figure 7 shows images of NIS mRNA and protein expressionshowing in Panel A) that treatment with sitagliptinphosphate monohydrate increased NIS mRNA levels in Normal human thyroid cells (Student t-test *p<0.025); in Panel B) representative immunofluorescence staining for NIS transporter in Normal human thyroid cells. Images show NIS expression in normal human thyroid cells inbasal condition. (staining: (HOECST)= nuclei; (FITC) = NISexpression on cells membranes, scale bar = 50 µm objective 20X). Detailed description of the invention The invention is further described by way of the following non-limiting examples.EXAMPLE 1Material and MethodsSitagliptin phosphate monohydrateSitagliptin phosphate monohydrate (Merck catalogue n.Y0001812) C16H15F6N5O European Pharmacopoeia (EP)Reference Standard, CAS number 654671-77-9, IUPAC NAME(r)-3-amino-1-(3-(trifluoromethyl)-5,6-dihydro- [1,2,4]triazolo[4,3-a]pyrazin-7(8h)-yl)-4-(2,4,5-trifluorophenyl)butan-1-one phosphate hydrate, waspurchased from Merck (Merck KGaA, Italy). Sitagliptinphosphate monohydrate standard was dissolved in water(Milliq®, Millipore Corporation, Milano, Italy)producing stocks of 50 mg / ml concentration that werefiltered and stocked at -20 °C until usage.Thyroid tumor cell lines 8505C and TPC-1 Human thyroid cancer cell lines, 8505C harboring theBRAF V600E mutation (ACC 219, Leibniz institute DSMZGerman collection, Braunschweig GERMANY) and TPC-1bearing the RET / PTC rearrangement (SCC147, SigmaAldrich), were used for these experiments. These cell lines had been previously tested and authenticated by DNA analysis. Cancer cells were propagated in Dulbecco’s Modified Eagle Medium (DMEM) and RPMI (Sigma, Saint Louis, MO, USA) supplemented with 10% fetal bovine serum (Sigma, Saint Louis, MO, USA), 2mM L-glutamine and 100 U / ml penicillin / streptomycin (Sigma, Saint Louis, MO,USA). Cells were incubated with the chosen stimuli(Sitagliptin phosphate monohydrate 10 µM) in serum-freemedium. Breast tumor cells MDA-MB-231 and HCC1806 Human breast cancer cell lines, MDA-MB-231 andHCC1806 (CRM-HTB-26 and CRL-2335, respectively, ATCC,10801 University Boulevard Manassas USA) were used forthese experiments. These cell lines had been previously tested and authenticated by DNA analysis. Cancer cells were propagated in RPMI (Sigma, Saint Louis, MO, USA) supplemented with 10% fetal bovine serum (Sigma, Saint Louis, MO, USA), 2mM L-glutamine and 100 U / ml penicillin / streptomycin (Sigma, Saint Louis, MO, USA).Cells were incubated with the chosen stimuli(Sitagliptin phosphate monohydrate 10 µM) in serum-free medium. Real-time PCR According to the manufacturer’s instructions, total RNA was isolated from thyroid and breast cancer cell lines, untreated and treated with sitagliptin phosphate monohydrate 10 µM for 24 hours using a TotalRNA purification kit (Norgen Biotek, Canada). Genomic DNA was digested using the DNAse enzyme (Norgen Biotek,Canada) at room temperature for 15 minutes and following the manufacturer's protocol. Total RNA from samples was reverse-transcribed into cDNA using a Sensi Fast cDNA synthesis kit (Bioline, London, UK). Real-time PCR was performed using Sensi-Fast SYBR Green Hi-ROX kit (Bioline, London, UK) on a StepOne Plus Applied Biosystems real-time PCR system. Amplification was performed under the following conditions: 95°C for 2 minutes; followed by 40 cycles of 95°C, 10 seconds, and 56°C, 10 seconds. GAPDH was used as endogenous control. Pre-designed primers targeting human NIS (F: CACCGGAATTATCTGCACCT (SEQ ID NO:1); R:TACATGGAGAGCCACACCAA (SEQ ID NO:2)) and GAPDH (F:AAATCCCATCACCATCTTCC (SEQ ID NO:3); R:GGTTCACACCCATGACGAAC (SEQ ID NO:4)) were obtained fromBiomers.net GMBH (Soflinger, Germany). All samples were run in triplicate. The mean number of Cycles-1 of NISand GAPDH, genes was compared and the expression of NISin GAPDH was calculated among all the samples. Allexperiments were performed in triplicates. Immunocytochemistry Thyroid cell lines TPC-1 and 8505C, as well as breast cancer cell lines MDA-MB-231 and HCC1806, were seeded onto 12-mm glass cover slips in a 24-well plate at a concentration of 10×104cells per well. Cells were incubated for 24 h with complete medium alone (basalcondition) or with 10µM of Sitagliptin phosphatemonohydrate. At the end of incubation, samples were washed with PBS, fixed with 4 % paraformaldehyde (PFA) (Thermoscientific) for 8 min, and blocked with 10 % FBS for 1 hour at room temperature. For immunofluorescence evaluation, samples were stained with anti-NIS-FITC-conjugated antibody (1:200) (Thermofisher Scientific,BS-0448R) overnight at 4°C. The day after, samples were washed three times with PBS for 10 minutes and then incubated with Alexa Fluor secondary antibody (1:250) (Life Technologies, Monza, Italy) in the dark for 1 h atroom temperature. Nuclei were stained with Hoechst 33258(1:2000) (Life Technologies, Monza, Italy). Finally, the cover slips were mounted onto glass slides with DAKO (Invitrogen, Milan, Italy). Negative controls were performed by omitting the primary antibody in some untreated samples. Images were acquired by an Olympus XM10 microscope (Olympus, Deutschland GmbH, Hamburg, Germany), using the same settings for all specimens. Statistical analysis Statistical analysis was performed using the SPSS software (SPSS, Inc., Evanston, IL). Mean group values were compared by using one-way ANOVA for normallydistributed variables. Post hoc analysis was performedaccording to the Bonferroni’s correction for multiple comparisons. Between-group comparisons were performed by means of Student t-test for unpaired data. Values arereported as mean ± SD unless otherwise noted. A ^ value< 0.05 was considered statistically significant. Results Treatment with Sitagliptin phosphate monohydrate increased the mRNA levels of NIS in thyroid cancer cell lines In order to investigate potential modification in the mRNA levels of expression of NIS, TPC-1 and 8505Ccells were treated with sitagliptin phosphatemonohydrate (10µM) and after 24 hours, changes in mRNAlevels of NIS were evaluated. Results of RT-PCR demonstrated that NIS mRNA expression levels increased in both TPC-1 and 8505C cells treated with Sitagliptinphosphate monohydrate as compared to basal expressionlevels (Student t-test, p<0.01) (Figure 1). Treatment with Sitagliptin phosphate monohydrate increased the mRNA levels of NIS in breast cancer cell lines The effect of sitagliptin phosphate monohydrate on the expression levels of NIS mRNA was tested in breast cancer cell lines. MDA-MB-231 and HCC1806 were treated withSitagliptin phosphate monohydrate (10µM) for 24 hours inorder to evaluate potential modifications in the mRNA levels of expression of NIS by RT-PCR. Results showed that NIS mRNA levels increased in both MDA-MB-231 andHCC1806 cells after treatment with Sitagliptin phosphatemonohydrate as compared to basal expression levels(Student t-test, p<0.01) (Figure 2). NIS protein expression on thyroid cancer cells increasedafter treatment with Sitagliptin phosphate monohydrateNIS protein expression on thyroid cancer cells was evaluated by immunofluorescence. Representative images in Figure 3 show that NIS protein was detected in basal condition in TPC-1 thyroid cancer cells, and its expression increased after treatment with Sitagliptin phosphate monohydrate (Figure 3, Panel A-B). Similarly, in 8505C cells, the basal expression of NIS was increased by treatment with Sitagliptin phosphate monohydrate (Figure 4, Panel A-B). These results were in line with what was found for mRNA levels by RT-PCR. The negative control showed no specific binding of the secondary antibody (data not shown). NIS protein expression on breast cancer cells increasedafter treatment with Sitagliptin phosphate monohydrateImmunofluorescence was employed for detecting the presence of NIS on cell surface of MDA-MB-231 andHCC1806. Representative images of Figure 5 Panel A andFigure 6 Panel A, show that the presence of NIS protein,was detected in basal condition in both MDA-MB-231 and HCC1806 breast cancer cells. Interestingly, significant changes in the expression of NIS protein were observedafter treatment with Sitagliptin phosphate monohydrate.Indeed, the NIS protein expression on MDA-MB-231 cell membranes increased after treatment with Sitagliptinphosphate monohydrate as compared to basal condition(Figure 5, Panel A-B). The same scenario was registered for HCC1806, in which, NIS protein basal expression wasenhanced by Sitagliptin phosphate monohydrate treatment(Figure 6, Panel A-B). The negative control showed no specific binding of the secondary antibody (data not shown).EXAMPLE 2Material and methods Primary cultures of human thyroid cells Surgical specimens of normal human thyroid (NHT) were obtained from the contralateral disease-free lobe ofpatients who underwent thyroidectomy for a solitarybenign nodule (n=4). Surgical specimens were minced and then incubated with collagenase type II (Sigma, Saint Louis, MO, USA) 5 mg / ml, in 5 ml of Coon’s F12 medium, for 4 hours at 37°C. Then, 10 ml of Coon’s F12 medium were added, following which, cells were filtered, spun at 1000 x g for 10 min, washed with Coon’s F12 medium, spun again, and finally re-suspended in a complete medium containing 5% newborn calf serum and a mixture of six hormones including insulin (5μg / ml), hydrocortisone (50 μg / ml), transferrin (5 μg / ml), somatostatin (10 ng / ml), gly-his-lysine (10 ng / ml) and bovine TSH (1 mU / ml). Real-time PCR According to the manufacturer’s instructions, total RNAwas isolated from thyroid cells in primary cultures,untreated and treated with Sitagliptin phosphatemonohydrate ((Merck catalogue n. Y0001812)C16H15F6N5O European Pharmacopoeia (EP) ReferenceStandard, CAS number 654671-77-9, IUPAC NAME (r)-3-amino-1-(3-(trifluoromethyl)-5,6-dihydro- [1,2,4]triazolo[4,3-a]pyrazin-7(8h)-yl)-4-(2,4,5-trifluorophenyl)butan-1-one phosphate hydrate) 10 µM for24 hours using a Total RNA purification kit (NorgenBiotek, Canada). Genomic DNA was digested using theDNAse enzyme (Norgen Biotek, Canada) at room temperature for 15 minutes and following the manufacturer's protocol. Total RNA from samples was reverse-transcribed into cDNA using a Sensi Fast cDNA synthesis kit (Bioline, London, UK). Real-time PCR was performed using Sensi- Fast SYBR Green Hi-ROX kit (Bioline, London, UK) on a StepOne Plus Applied Biosystems real-time PCR system. Amplification was performed under the following conditions: 95°C for 2 minutes; followed by 40 cycles of 95°C, 10 seconds, and 56°C, 10 seconds. GAPDH was used as endogenous control. Pre-designed primers targeting human NIS (F: CACCGGAATTATCTGCACCT (SEQ ID NO:1); R: TACATGGAGAGCCACACCAA (SEQ ID NO:2)) and GAPDH (F: AAATCCCATCACCATCTTCC (SEQ ID NO:3); R: GGTTCACACCCATGACGAAC (SEQ ID NO:4)) were obtained from Biomers.net GMBH (Soflinger, Germany). All samples were run in triplicate. The mean number of Cycles-1of NIS andGAPDH genes was compared and the expression of NIS inGAPDH was calculated among all the samples. Allexperiments were performed in triplicates. Immunocytochemistry Thyroid cell in primary cultures, were seeded onto 12- mm glass cover slips in a 24-well plate at a concentration of 10×104cells per well. Cells were incubated for 24 h with complete medium alone used as a positive control of NIS antibody. At the end of incubation, samples were washed with PBS, fixed with 4 % paraformaldehyde (PFA) (Thermoscientific) for 8 min, and blocked with 10 % FBS for 1 hour at room temperature. For immunofluorescence evaluation, samples were stainedwith anti-NIS-FITC-conjugated antibody (1:200)(Thermofisher Scientific, BS-0448R) overnight at 4°C. The day after, samples were washed three times with PBS for 10 minutes and then incubated with Alexa Fluor secondary antibody (1:250) (Life Technologies, Monza, Italy) in the dark for 1 h at room temperature. Nuclei were stained with Hoechst 33258 (1:2000) (Life Technologies, Monza, Italy). Finally, the cover slips were mounted onto glass slides with DAKO (Invitrogen, Milan, Italy). Negative controls were performed by omitting the primary antibody in some untreated samples. Images were acquired by an Olympus XM10 microscope (Olympus, Deutschland GmbH, Hamburg, Germany), using the same settings for all specimens. Statistical analysis Statistical analysis was performed using the SPSS software (SPSS, Inc., Evanston, IL). Mean group values were compared by using one-way ANOVA for normallydistributed variables. Post hoc analysis was performedaccording to the Bonferroni’s correction for multiple comparisons. Between-group comparisons were performed by means of Student t-test for unpaired data. Values arereported as mean ± SD unless otherwise noted. A ^ value< 0.05 was considered statistically significant. ResultsTreatment with Sitagliptin phosphate monohydrateincreased the mRNA levels of NIS in normal thyroid cells In order to investigate potential modification in the mRNA levels of expression of NIS, normal human thyroid cells were treated with sitagliptin phosphatemonohydrate (10µM) and after 24 hours, changes in mRNAlevels of NIS were evaluated. Results of RT-PCR demonstrated that NIS mRNA expression levels increased in normal thyroid cells treated with sitagliptin phosphate monohydrate (Student t-test, p<0.01) (Figure 7 Panel A). NIS protein expression on normal thyroid cellsNIS protein expression on normal thyroid cells in basalcondition was evaluated by immunofluorescence. Normal human thyroid cells were used for positive control of NIS antibody. Representative images in Figure 7 Panel B show that NIS protein was detected in basal condition.REFERENCE LIST:Aashiq, M., Silverman, D. A., Na’ara, S., Takahashi, H.,& Amit, M. (2019). Radioiodine-Refractory ThyroidCancer: Molecular Basis of Redifferentiation Therapies, Management, and Novel Therapies. Cancers, 11(9), 1382. Amit, M., Na'ara, S., Francis, D., Matanis, W., Zolotov, S., Eisenhaber, B., Eisenhaber, F., Weiler Sagie, M., Malkin, L., Billan, S., Charas, T., Gil, Z., 2017. Post- translational Regulation of Radioactive Iodine Therapy Response in Papillary Thyroid Carcinoma. J Natl Cancer Inst 109.Chatterjee, S., Thaker, N., De, A., 2015. Combined 2-deoxy glucose and metformin improves therapeutic efficacy of sodium-iodide symporter-mediated targeted radioiodine therapy in breast cancer cells. Breast Cancer (Dove Med Press) 7, 251-265.Choudhury, P.S., Gupta, M., 2018. Differentiated thyroidcancer theranostics: radioiodine and beyond. Br J Radiol 91, 20180136. Crocetti, E., Mattioli, V., Buzzoni, C., Franceschi, S., Serraino, D., Vaccarella, S., Ferretti, S., Busco, S., Fedeli, U., Varvarà, M., Falcini, F., Zorzi, M., Carrozzi, G., Mazzucco, W., Gasparotti, C., Iacovacci, S., Toffolutti, F., Cavallo, R., Stracci, F., Russo, A.G., Caldarella, A., Rosso, S., Musolino, A., Mangone, L., Casella, C., Fusco, M., Tagliabue, G., Piras, D., Tumino, R., Guarda, L., Dinaro, Y.M., Piffer, S., Pinna, P., Mazzoleni, G., Fanetti, A.C., Dal Maso, L., group,f.A.w., 2021. Risk of thyroid as a first or secondprimary cancer. A population-based study in Italy, 1998- 2012. Cancer Med 10, 6855-6867.Dai, G., Levy, O., Carrasco, N., 1996. Cloning andcharacterization of the thyroid iodide transporter. Nature 379, 458-460.Durante, C., Haddy, N., Baudin, E., Leboulleux, S.,Hartl, D., Travagli, J.P., Caillou, B., Ricard, M., Lumbroso, J.D., De Vathaire, F., Schlumberger, M., 2006. Long-term outcome of 444 patients with distant metastases from papillary and follicular thyroid carcinoma: benefits and limits of radioiodine therapy. J Clin Endocrinol Metab 91, 2892-2899. Hartmann, J., Haap, M., Kopp, H.-G., & Lipp, H.-P.(2009). Tyrosine Kinase Inhibitors – A Review onPharmacology, Metabolism and Side Effects. Current Drug Metabolism, 10(5), 470–481. Haugen, B.R., 2017. 2015 American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer: What is new and what has changed? Cancer 123, 372-381.Herman, G.A., Stevens, C., Van Dyck, K., Bergman, A.,Yi, B., De Smet, M., Snyder, K., Hilliard, D., Tanen, M., Tanaka, W., Wang, A.Q., Zeng, W., Musson, D., Winchell, G., Davies, M.J., Ramael, S., Gottesdiener, K.M., Wagner, J.A., 2005. Pharmacokinetics and pharmacodynamics of sitagliptin, an inhibitor of dipeptidyl peptidase IV, in healthy subjects: results from two randomized, double-blind, placebo-controlled studies with single oral doses. Clin Pharmacol Ther 78, 675-688. Kahaly, G.J., Bartalena, L., Hegedüs, L., Leenhardt, L., Poppe, K., Pearce, S.H., 2018. 2018 European Thyroid Association Guideline for the Management of Graves' Hyperthyroidism. Eur Thyroid J 7, 167-186. Levy, O., Dai, G., Riedel, C., Ginter, C.S., Paul, E.M., Lebowitz, A.N., Carrasco, N., 1997. Characterization ofthe thyroid Na+ / I- symporter with an anti-COOH terminusantibody. Proc Natl Acad Sci U S A 94, 5568-5573. Łukasiewicz S, Czeczelewski M, Forma A, Baj J, SitarzR, Stanisławek A. Breast Cancer-Epidemiology, RiskFactors, Classification, Prognostic Markers, and Current Treatment Strategies-An Updated Review. Cancers(Basel). 2021 Aug 25;13(17):4287.doi:10.3390 / cancers13174287 Ravera, S., Reyna-Neyra, A., Ferrandino, G., Amzel, L.M., Carrasco, N., 2017. The Sodium / Iodide Symporter (NIS): Molecular Physiology and Preclinical and Clinical Applications. Annu Rev Physiol 79, 261-289.Renier, C., Yao, C., Goris, M., Ghosh, M., Katznelson,L., Nowles, K., Gambhir, S.S., Wapnir, I., 2009. Endogenous NIS expression in triple-negative breast cancers. Ann Surg Oncol 16, 962-968.

Claims

CLAIMS 1. A compound of formula (I), or enantiomers thereof, orpharmaceutically acceptable salts thereof:for use in the treatment of a pathology characterisedby the expression of the Na / I symporter (NIS) in theaffected cells.

2. A pharmaceutical composition comprising the compoundof formula (I), or enantiomers thereof, orpharmaceutically acceptable salts thereof:and at least one pharmaceutically acceptable excipient, for use in the treatment of a pathology characterised bythe expression of the Na / I symporter (NIS) in theaffected cells.

3. The compound of formula (I), or enantiomers thereof,or pharmaceutically acceptable salts thereof, for use orthe pharmaceutical composition for use according toclaim 1 or claim 2, wherein said pathology characterisedby the expression of the Na / I symporter (NIS) in theaffected cells is chosen from thyroid cancer, benignhyperthyroid disease and breast cancer 4. The compound of formula (I), or enantiomers thereof,or pharmaceutically acceptable salts thereof, for use orthe pharmaceutical composition for use according to anyone of the previous claims, wherein said compound offormula (I), or enantiomers thereof, or pharmaceutically acceptable salts thereof, is a salt of the compound offormula (I) or a hydrate thereof, preferably a phosphatesalt of the compound of formula (I) or a hydrate thereof,more preferably a phosphate monohydrate thereof.

5. The compound of formula (I), or enantiomers thereof,or pharmaceutically acceptable salts thereof, for use orthe pharmaceutical composition for use according to anyone of the previous claims, wherein said compound of formula (I), or enantiomers thereof, or pharmaceuticallyacceptable salts thereof, is a monohydrate phosphatesalt of the compound of formula (I) in the R enantiomeric configuration, having formula (II):(II)6. The compound of formula (I), or enantiomers thereof,or pharmaceutically acceptable salts thereof, for use orthe pharmaceutical composition for use according to anyone of the previous claims, wherein said pathology isone in which the affected cells are RAI-refractory.

7. The compound of formula (I), or enantiomers thereof, or pharmaceutically acceptable salts thereof, for use or the pharmaceutical composition for use according to anyone of the previous claims, wherein said compound offormula (I), or enantiomers thereof, or pharmaceutically acceptable salts thereof, or pharmaceutical composition is administered to a subject affected by said pathologycharacterised by the expression of the Na / I symporter(NIS) in the affected cells, that has previously undergone RAI therapy and / or surgical resection, optionally followed by RAI therapy.

8. The compound of formula (I), or enantiomers thereof, or pharmaceutically acceptable salts thereof, for use orthe pharmaceutical composition for use according to anyone of claims 1 to 6, wherein said compound of formula (I), or enantiomers thereof, or pharmaceutically acceptable salts thereof, or pharmaceutical compositionis administered to a subject affected by said pathologycharacterised by the expression of the Na / I symporter(NIS) in the affected cells, that has not previously undergone RAI therapy.

9. The compound of formula (I), or enantiomers thereof, or pharmaceutically acceptable salts thereof, for use or the pharmaceutical composition for use according to anyone of the previous claims, wherein said treatment ofsaid pathology comprises radioactive iodine (RAI)therapy.

10. The pharmaceutical composition for use according toany one claims 2 to 9, having a concentration of thecompound of formula (I), or enantiomers thereof, orpharmaceutically acceptable salts thereof, from 1 to 50µM, preferably from 5 to 20 µM, more preferably 10 µM.

11. The pharmaceutical composition for use according toany one of claims 2 to 10, wherein the pharmaceuticalcomposition is for administration via a route chosenfrom intraperitoneal, intravenous, intramuscular,transdermal, intradermal, infusion, subcutaneous, oral,enteral, rectal, intranasal, by inhalation, buccal,sublingual, topical, intraocular, vaginal, intracranialinjection, and any combination thereof, preferably oraladministration.

12. Method for the treatment of a pathology characterisedby the expression of the Na / I symporter (NIS) in theaffected cells that comprises administering atherapeutically effective amount of the compound offormula (I), or enantiomers thereof, or pharmaceuticallyacceptable salts thereof:or a pharmaceutical composition comprising the compoundof formula (I), or enantiomers thereof, orpharmaceutically acceptable salts thereof, and at leastone pharmaceutically acceptable excipient, to a subjectin need thereof.

13. The compound of formula (I), or enantiomersthereof, or pharmaceutically acceptable salts thereof:for use in an in vivo diagnostic method of a pathologycharacterised by the expression of the Na / I symporter(NIS) in the affected cells.

14. A pharmaceutical composition comprising the compoundof formula (I), or enantiomers thereof, orpharmaceutically acceptable salts thereof:(I)and at least one pharmaceutically acceptable excipient,for use in an in vivo diagnostic method of a pathologycharacterised by the expression of the Na / I symporter(NIS) in the affected cells.

15. The compound of formula (I), or enantiomers thereof, or pharmaceutically acceptable salts thereof, for use orthe pharmaceutical composition for use according to anyone of claim 13 or claim 14, wherein said compound offormula (I), or enantiomers thereof, or pharmaceuticallyacceptable salts thereof, is a monohydrate phosphatesalt of the compound of formula (I) in the R enantiomeric configuration, having formula (II):(II)16. The compound of formula (I), or enantiomers thereof, or pharmaceutically acceptable salts thereof, for use orthe pharmaceutical composition for use according to anyone of claims 13 to claim 15, wherein said diagnosticmethod is a morphofunctional imaging technique, preferably scintigraphy.

17. The compound of formula (I), or enantiomers thereof, or pharmaceutically acceptable salts thereof, for use orthe pharmaceutical composition for use according to anyone of claims 13 to 16, wherein said diagnostic methodcomprises the administration to a subject of aradiolabelled isotope, preferably chosen from radiolabelled iodine and radiolabelled technetium, more preferably radiolabelled iodine, most preferably Iodine- 131.

Images