Composition for preventing or treating cancer comprising cisplatin and narciclasine or analog thereof
The combination of cisplatin and narcyclacin synergistically induces apoptosis by inhibiting MCL1 and promoting its degradation through NOXA, addressing drug resistance and toxicity in NSCLC, enhancing treatment efficacy.
Patent Information
- Application Number
- PCT/KR2025/013493
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2025-09-02
- Filing Date
- 2025-09-02
- Publication Date
- 2026-03-12
AI Technical Summary
Current cisplatin-based therapies for non-small cell lung cancer (NSCLC) face challenges with drug resistance and toxicity, limiting their efficacy.
A combination therapy using cisplatin and narcyclacin or its analogues, which synergistically induce apoptosis by inhibiting MCL1 protein and promoting its degradation through NOXA, enhancing cisplatin sensitivity and overcoming resistance.
The combined administration of cisplatin and narcyclacin increases cancer cell sensitivity and reduces toxicity, effectively killing cancer cells at lower cisplatin concentrations, thereby improving treatment outcomes.
Smart Images

Figure KR2025013493_12032026_PF_FP_ABST
Abstract
Description
Composition for preventing or treating cancer comprising cisplatin and narcyclacin or an analog thereof
[0001] The present invention relates to a composition for preventing or treating cancer comprising cisplatin and narciclasine or an analog thereof.
[0002]
[0003] Lung cancer has the highest mortality rate among all cancers worldwide, accounting for 21% of cancer-related deaths. Non-small cell lung cancer (NSCLC) is the most common type of lung cancer, accounting for approximately 85% of all lung cancer cases. Targeted therapy is a treatment option for patients with advanced NSCLC harboring oncogenic driver mutations. Patients without oncogenic driver mutations are treated with immune checkpoint inhibitors, either alone or in combination with chemotherapy, or with standard chemotherapy.
[0004] Platinum-based drugs are commonly used as chemotherapeutic agents for NSCLC, and cisplatin is frequently combined with surgery, radiotherapy, targeted therapy, or immunotherapy to enhance therapeutic efficacy. Although cisplatin-based combination therapy can be effective in treating NSCLC, it has limitations, including the development of drug resistance and toxicity (F. Abu Rous, et al., Cancer Invest, 41(1):12-24, 2023; R. Ali, et al., Int. J. Mol. Sci., 23(13):7241, 2022). One approach to overcome these barriers and enhance the efficacy of cisplatin is to explore novel combination strategies that exhibit synergistic anticancer effects, thereby improving patient outcomes and reducing cisplatin toxicity through dose reduction.
[0005]
[0006] Meanwhile, narcissacin, an isocarbostyril alkaloid derived from the bulbs of various daffodils (Narcissus), exhibits antitumor activity against breast, gastric, and brain cancers, and several mechanisms explaining the antitumor effects of narcissacin have been reported. Narcissacin directly binds to eEF1A (elongation factor eukaryotic elongation factor 1-alpha) to inhibit protein synthesis, and induces autophagy-mediated apoptosis by inhibiting Akt / mTOR (Akt / mammalian target of rapamycin) phosphorylation. Recently, it has been reported that narcissacin directly interacts with STAT3 (signal transducer and activator of transcription 3) to inhibit its phosphorylation. Overall, narcyclacin exerts antitumor effects through multiple mechanisms of action and is considered a promising candidate for cancer treatment (C. Lv,et. al.,Mol. Ther. Oncolytics, 24:340-354, 2022).
[0007]
[0008] NOXA, also known as PMAIP1 (phorbol-12-myristate-13-acetate-induced protein 1), is a pro-apoptotic protein belonging to the BH3 (Bcl-2 homology 3)-only family of BCL2 (B-cell lymphoma 2) proteins. Proteins containing only the BH3 domain, including NOXA, PUMA, BID, BAD, BIM, BIK, BMF, and HRK, are activated in response to various cellular stresses and act as upstream regulators of apoptosis. In particular, NOXA binds to the anti-apoptotic proteins MCL1 (myeloid cell leukemia-1) and BCL2A1 (BCL2-related protein A1) of the BCL2 family, neutralizing their ability to inhibit BAX / BAK activation, thereby inducing apoptosis.
[0009] Furthermore, NOXA is required for cisplatin-induced MCL1 phosphorylation, which leads to its proteasome-dependent degradation and ultimately induces apoptosis. Therefore, the balance between NOXA and MCL1 determines cellular susceptibility to apoptosis and plays a crucial role in tumor initiation, progression, and treatment resistance. Therefore, targeting BCL2 family members represents a promising approach for cancer therapy.
[0010]
[0011] Accordingly, in order to select a novel combination therapy capable of increasing the sensitivity of cisplatin in the present invention, a natural substance library was screened, and narcyclacin was identified as the most promising candidate. As a result of co-administration of cisplatin and narcyclacin to NSCLC tumor spheroids, an anticancer synergistic effect by combination administration was confirmed. In addition, it was confirmed that narcyclacin not only inhibited protein translation by inducing the unfolded protein response, but also promoted the degradation of MCL1 by inducing NOXA in particular. In addition, it was confirmed that an anticancer synergistic effect was shown in various cancers, and it was confirmed that cancer cells were effectively killed even when treated with low concentrations of cisplatin, thereby completing the present invention.
[0012]
[0013] Accordingly, an object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer comprising cisplatin and narcyclacin or an analog thereof.
[0014] Another object of the present invention is to provide an anticancer adjuvant comprising cisplatin and narcyclacin or an analog thereof.
[0015]
[0016] To achieve the above-mentioned purpose,
[0017] The present invention relates to a pharmaceutical composition comprising cisplatin or a pharmaceutically acceptable salt thereof; and
[0018] A composition for preventing or treating cancer comprising narcyclasin, a narcyclasin analogue or a pharmaceutically acceptable salt thereof is provided.
[0019]
[0020] In addition, the present invention relates to a pharmaceutical composition comprising cisplatin or a pharmaceutically acceptable salt thereof; and
[0021] An anticancer adjuvant comprising narcyclasin, a narcyclasin analogue or a pharmaceutically acceptable salt thereof is provided.
[0022]
[0023] In a specific embodiment of the present invention, the cancer may be at least one cancer selected from the group consisting of lung cancer, pancreatic cancer, ovarian cancer, colon cancer, breast cancer, glioblastoma, liver cancer, leukemia, melanoma, prostate cancer, kidney cancer, and stomach cancer. Preferably, it may be lung cancer, pancreatic cancer, ovarian cancer, or colon cancer, and more preferably, among lung cancers, it may be non-small cell lung cancer.
[0024] In another specific embodiment of the present invention, the cisplatin and narcyclacin or an analog thereof may be mixed in a ratio of 100:0.01 to 100:1000.
[0025] In another specific embodiment of the present invention, the analogue of narcyclacin may be lycoricidine or pancratistatin.
[0026]
[0027] In the present invention, we confirmed that the combined administration of cisplatin and narcyclacin, or a narcyclacin analog, exhibits a synergistic anticancer effect. We confirmed that narcyclacin induces apoptosis in cisplatin-resistant NSCLC tumor spheroids, thereby increasing cisplatin sensitivity. We also confirmed that the combined administration of cisplatin and narcyclacin weakens the efficacy of MCL1 by inhibiting its translation and promotes its degradation by inducing NOXA.
[0028] In addition, since it was confirmed that excellent anticancer effects were shown through co-administration with narcyclasin or a narcyclasin analogue even under conditions of low concentrations of cisplatin, the composition comprising cisplatin and narcyclasin or a narcyclasin analogue of the present invention can be applied for purposes that can overcome anticancer resistance to cisplatin and improve treatment outcomes.
[0029]
[0030] Figure 1 shows the cell viability of tumor spheroids derived from non-small cell lung cancer cell lines according to the concentration of cisplatin and narcyclacin treatment and the IC for each cell line. 50 This is data that measures the value.
[0031] Figure 1a shows cell viability and IC using A549 and NCI-H460 tumor spheroids, and Figure 1b shows cell viability and IC using NCI-H358, HCC2279, and NCI-H1975 tumor spheroids. 50 These are the measured data. All experiments were repeated three times, and the data are expressed as the mean ± standard deviation.
[0032]
[0033] Figure 2 shows the data confirming the synergistic effect (potential effect) according to the combined administration of cisplatin and narcyclacin at various concentrations in A549, NCI-H358, HCC2279, and NCI-H1975 tumor spheroids. The synergistic effect was measured by the Combination index (CI) value using CompuSyn (CI > 1 antagonism, CI < 1 synergism, CI < 0.3 strong synergism; *p < 0.05 vs. cisplatin at the same concentration; †< 0.05 vs. narcyclacin at the same concentration; $, more than twice that of single treatment; ▼Selected combination concentration). In all figures, Cis represents cisplatin, Nar represents narcyclacin, C+N represents the combined administration of cisplatin and narcyclacin, and veh represents the vehicle.
[0034]
[0035] Figure 3 shows data confirming that narcyclacin enhances the sensitivity of NSCLC tumor spheroids to cisplatin.
[0036] Figure 3a shows images of cell viability and spheroid size when A549 tumor spheroids were treated with vehicle, 10 μM cisplatin, 0.3 μM narcyclacin, or a combination of both drugs for the indicated periods. Images were taken before viability analysis (*p < 0.05 vs. cisplatin; †< 0.05 vs. narcyclacin, scale bar: 100 μm).
[0037] Figure 3b shows data from Western blot analysis of cleaved caspases (cCASP7) levels in A549 tumor spheroids treated with vehicle, 10 μM cisplatin, 0.3 μM narcyclacin, or a combination of the two drugs for 48 hours. GAPDH was used as a loading control.
[0038] Figure 3c shows Western blot data showing cleaved caspases (cCASP7) levels in NCI-H358, HCC2279, and NCI-H1975 tumor spheroids treated with vehicle, 10 μM cisplatin, 0.3 μM narcyclacin, or a combination of the two drugs for 48 hours. GAPDH was used as a loading control.
[0039] Figure 3d shows data observing the live and dead cell areas when A549 tumor spheroids were treated with vehicle, 10 μM cisplatin, 0.3 μM narcyclacin, or a combination of both drugs for 48 hours. Live cells were stained green with calcein-acetoxymethyl ester, and dead cells were stained red with ethidium homodimer-1. Images were captured at 100x magnification using the Operetta high content analysis (HCA) system (scale bar: 200 μm). The dead cell area was quantitatively analyzed and shown at the bottom.
[0040] Figure 3e shows data obtained by flow cytometry analysis of isolated tumor spheroids treated with vehicle, 10 μM cisplatin, 0.3 μM narcyclacin, or a combination of the two drugs for 48 hours. Apoptotic cells were expressed as the percentage of annexin V-positive / 7-amino-actinomycin D (7-AAD)-negative cells.
[0041] Figure 3f shows data measuring the degree of DNA fragmentation when A549 tumor spheroids were treated with vehicle, 10 μM cisplatin, 0.3 μM narcyclacin, or a combination of both drugs for 48 hours. Apoptosis was analyzed using a Cell Death Detection ELISA kit capable of detecting single and oligonucleosomes.
[0042]
[0043] Figure 4 is data confirming the tumor growth inhibition effect of combined administration of cisplatin and narcyclacin in a xenograft mouse model.
[0044] Figure 4a shows data on tumor volume and mouse body weight measured twice a week for 25 days after administration of vehicle, cisplatin, narcyclacin, or a combination of the two drugs to a xenograft mouse model (n = 5 per group).
[0045] Figure 4b shows data measuring the weight of resected tumors 25 days after administering vehicle, cisplatin, narcyclacin, or a combination of the two drugs to a xenograft mouse model.
[0046]
[0047] Figure 5 is data showing the process for selecting genes related to the synergistic effect of combined administration of cisplatin and narcyclacin.
[0048] Figure 5a shows data showing the number of genes whose expression difference is more than two-fold (up- or down-regulated) in A549 tumor spheroids.
[0049] Figure 5b is an image schematically illustrating the workflow for candidate gene selection and validation.
[0050] Figure 5c is a table showing the results of gene set enrichment analysis (GSEA) using the MSigDB Hallmark gene sets (cisplatin vs. cisplatin and narcyclacin). False discovery rate (FDR) < 0.1 and p-value < 0.01 were used as cutoff values for selecting significantly enriched gene sets (NES = normalized enrichment score, NOM = nominal).
[0051] Figure 5d is a heatmap showing changes in expression of potential candidate genes under various treatment conditions.
[0052] Figure 5e is data showing the fold change value of the heat map of Figure 5d.
[0053]
[0054] Figure 6 is data confirming whether the selected candidate genes are related to the synergistic effect of combined administration of cisplatin and narcyclacin.
[0055] Figure 6a is functional validation data of candidate genes, showing cell viability when vehicle, cisplatin, narcyclacin, or a combination of the two drugs was administered to A549 tumor spheroids in which each potential candidate gene was knocked out.
[0056] Figure 6b shows data showing cell viability and spheroid size determined by measuring cellular ATP content when vehicle, cisplatin, narcyclacin, or a combination of both drugs was administered to A549 tumor spheroids in which NOXA, MAFF, or BTG3 were knocked out. The lower image is an image of the tumor spheroid before analyzing cell viability (scale bar: 100 μm).
[0057] Figure 6c is data evaluating cell death by analyzing the level of cleaved caspases (cCASP7) under the treatment conditions of Figure 6b.
[0058] Figure 6d shows data evaluating the mRNA expression levels of NOXA, MAFF, or BTG3 genes by RT-qPCR when vehicle, cisplatin, narcyclacin, or a combination of both drugs was administered to A549 tumor spheroids. GAPDH was used as a loading control, and changes in normalized gene expression compared to GAPDH expression were quantified and presented.
[0059] Figure 6e shows data obtained by Western blot analysis of the protein expression levels of NOXA, MAFF, or BTG3 when treated with drugs for 48 hours under the conditions of Figure 6d. β-Actin was used as a loading control.
[0060]
[0061] Figure 7 shows data confirming whether the selected NOXA gene is associated with apoptosis when cisplatin and narcyclacin were co-administered to various NSCLC tumor spheroids.
[0062] Figure 7a shows data evaluating NOXA mRNA levels by RT-qPCR when cisplatin and narcyclacin were administered alone or in combination to NCI-H358, NCI-H1975, and HCC2279 tumor spheroids.
[0063] Figure 7b shows data confirming cell survival rate when cisplatin and narcyclacin were administered alone or in combination to NCI-H358 and NCI-H1975 tumor spheroids in which the NOXA gene was knocked down.
[0064] Figure 7c is data obtained by Western blot analysis of the expression level of apoptosis-related proteins when the drug was treated for 48 hours under the conditions of Figure 7b.
[0065] Figure 7d shows data evaluating the ATF3 mRNA level by RT-qPCR when cisplatin and narcyclacin were administered alone or in combination to NCI-H358, NCI-H1975, and HCC2279 tumor spheroids.
[0066]
[0067] Figure 8 is data confirming that NOXA increased by combined administration of cisplatin and narcyclacin regulates MCL1 and activates the mitochondrial-mediated apoptosis pathway.
[0068] Figure 8a shows data confirming cell viability when cisplatin and narcyclacin were treated alone or in combination for 48 hours in A549 tumor spheroids transformed with siNC, siTP53, or siATF3.
[0069] Figure 8b shows data obtained by Western blot analysis of the expression levels of p53, ATF3, NOXA, and cCASP7 proteins when treated with drugs for 48 hours under the conditions of Figure 8a. Vinculin was used as a loading control.
[0070] Figure 8c shows data from RT-qPCR confirming the mRNA levels of NOXA, TP53, and ATF3 when treated with the drug for 48 hours under the conditions of Figure 8a. GAPDH was used as a loading control, and the changes in normalized gene expression compared to GAPDH expression were quantified and presented.
[0071] Figure 8d shows data confirming the expression of endogenous apoptosis-related proteins by Western blot when A549 tumor spheroids transformed with siNC or siNOXA were treated with cisplatin and narcyclacin alone or in combination for 48 hours.
[0072] Figure 8e is data evaluating cell death using a Cell Death Detection ELISA kit when the drug was treated for 48 hours under the conditions of Figure 8d.
[0073] Figure 8f shows data confirming cell viability when A549 tumor spheroids transformed with Flag-tagged vector control or Flag-tagged MCL1 vector were treated with cisplatin and narcyclacin alone or in combination for 48 hours.
[0074] Figure 8g is data evaluating cell death using a Cell Death Detection ELISA kit when the drug was treated for 48 hours under the conditions of Figure 8f.
[0075] Figure 8h is data confirming the expression of apoptosis-related proteins by Western blot when the drug was treated for 48 hours under the conditions of Figure 8f.
[0076]
[0077] Figure 9 is data confirming that apoptosis induced by NOXA, which was upregulated by combined administration of cisplatin and narcyclacin, was preferentially mediated by MCL1 rather than survivin.
[0078] Figure 9a shows data confirming cell viability when cisplatin and narcyclacin were treated alone or in combination for 48 hours in A549 tumor spheroids in which the NOXA and / or MCL1 genes were knocked down (scale bar: 100 μm).
[0079] Figure 9b is data evaluating the degree of cell death of Figure 9A.
[0080] Figure 9c shows data confirming cell viability when cisplatin and narcyclacin were treated alone or in combination for 48 hours in A549 tumor spheroids in which NOXA and / or survivin genes were knocked down (scale bar: 100 μm).
[0081] Figure 9d is data evaluating the degree of cell death in Figure 9d above.
[0082]
[0083] Figure 10 is data confirming that NOXA increased by combined administration of cisplatin and narcyclacin reduced MCL1 protein levels through translation inhibition.
[0084] Figure 10a shows data quantifying MCL1 mRNA levels using RT-qPCR after A549 tumor spheroids were treated with 0.3 μM narcyclacin for 24 hours. Changes in MCL1 expression normalized to GAPDH expression were quantified, and data are presented as the mean ± standard deviation of three replicates from two independent experiments.
[0085] Figure 10b shows data obtained by Western blot analysis of MCL1 protein levels after A549 cells were pretreated with 0.05 μM narcyclacin for 2 hours and then treated with 10 μM MG-132 for the indicated time.
[0086] Figure 10c shows the quantitative data obtained by Western blot analysis of MCL1 protein levels at each time point after A549 tumor spheroids were treated with 10 μg / mL cycloheximide and 0.3 μM narcyclacin. Data are presented as the mean ± standard deviation obtained from three independent experiments repeated three times.
[0087] Figure 10d shows data evaluating protein synthesis using SUnSET (surface sensing of translation assay) analysis. The left panel shows A549 tumor spheroids treated with various concentrations of narcyclacin, while the right panel shows protein synthesis evaluated using puromycin after cisplatin (10 μM) and narcyclacin (0.3 μM) were administered alone or in combination.
[0088] Figure 10e shows data obtained by Western blot analysis of the levels of proteins involved in the Unfolded Protein Response (UPR) pathway, such as phospho-eIF2α and phospho-4E-BP1, over time after A549 tumor spheroids were treated with 0.3 μM narcyclacin.
[0089] Figure 10f shows data from Western blot analysis of protein levels related to the UPR pathway when cisplatin (10 μM) and narcyclacin (0.3 μM) were administered alone or in combination to A549 tumor spheroids.
[0090] Figure 10g shows data evaluating the H2O2 level when cisplatin (2, 5 μM) and narcyclacin (0.0.5 μM) were administered alone or in combination to A549 cells.
[0091] Figure 10h shows data evaluating the NOXA mRNA level by RT-qPCR when cisplatin (10 μM) and narcyclacin (0.3 μM) were administered alone or in combination after pretreatment with KIRA6 (0.1 μM) in A549 tumor spheroids.
[0092] Figure 10i shows data obtained by Western blot analysis of NOXA and IRE1α-mediated ER stress-related protein levels when cisplatin (10 μM) and narcyclacin (0.3 μM) were administered alone or in combination to A549 tumor spheroids after pretreatment with KIRA6 (0.1 μM).
[0093] Figure 10j shows data evaluating the NOXA mRNA level by RT-qPCR when cisplatin (10 μM) and narcyclacin (0.3 μM) were administered alone or in combination after pretreatment with SP600125 (10 μM) or SB203580 (10 μM) in A549 tumor spheroids.
[0094] Figure 10k shows data from Western blot analysis of NOXA and IRE1α-mediated ER stress-related protein levels when cisplatin (10 μM) and narcyclacin (0.3 μM) were administered alone or in combination after pretreatment with SP600125 (10 μM) or SB203580 (10 μM) in A549 tumor spheroids.
[0095]
[0096] Figure 11 is data confirming that NOXA increased by combined administration of cisplatin and narcyclacin increases MCL1 protein degradation.
[0097] Figure 11a shows data from RT-qPCR examining MCL1 mRNA levels when cisplatin (10 μM) and narcyclacin (0.3 μM) were administered alone or in combination to A549 tumor spheroids. Changes in MCL1 expression normalized to GAPDH expression were quantified, and data are presented as the mean ± standard deviation obtained from three independent experiments.
[0098] Figure 11b shows data from Western blot analysis of MCL1 and NOXA protein expression levels when A549 tumor spheroids were pretreated with 10 μM MG-132 for 1 hour and then treated with cisplatin (10 μM) and narcyclacin (0.3 μM) alone or in combination for 24 or 48 hours. The numbers below the blots indicate relative protein levels normalized to GAPDH levels.
[0099] Figure 11c shows the data obtained by Western blot analysis of MCL1 and NOXA protein expression levels in A549 cells transfected with siNC or siNOXA, treated with cisplatin (5 μM) and narcyclacin (0.1 μM) alone or in combination for 24 hours, and then treated with 10 μg / mL cycloheximide (CHX) for the indicated time. The right panel shows the MCL1 protein level quantified relative to GAPDH expression. Data are presented as the mean ± standard deviation obtained from three independent experiments repeated three times.
[0100] Figure 11d shows data from Western blot analysis of MCL1 and NOXA protein levels in A549 cells co-transfected with His-Ub (His-tagged ubiquitin) and siNC or siNOXA, when cisplatin and narcyclacin were administered alone or in combination. The right panel shows the MCL1 protein level quantified relative to GAPDH expression. Data are presented as the mean ± standard deviation obtained from three independent experiments repeated three times.
[0101] Figure 12 shows the cell viability of tumor spheroids derived from non-small cell lung cancer cell lines according to the treatment concentration of lycoricidine (Figure 12a) and pancratistatin (Figure 12b), which are narcyclacin analogues, and the IC for each cell line. 50 This is data that measures the value.
[0102] Figure 13 shows data confirming the synergistic effect according to the combined administration of cisplatin and lycorisidine / pancratistatin at various concentrations in A549 (Figure 13a), NCI-H358 (Figure 13b), NCI-H1975 (Figure 13c), and HCC2279 (Figure 13d) tumor spheroids. The synergistic effect was measured by the Combination index (CI) value using CompuSyn. (CI > 1 antagonism, CI < 1 synergism, CI < 0.3 strong synergism; *p < 0.05 vs. cisplatin at the same concentration; †< 0.05 vs. lycorisidine / pancratistatin at the same concentration).
[0103]
[0104] Figure 14 shows the cell viability and IC for each cell line of a pancreatic cancer cell line (PANC1, Figure 14a), an ovarian cancer cell line (SKOV3, Figure 14b), and a colon cancer cell line (HCT116, Figure 14c) according to the concentration of cisplatin and narcyclacin, narcyclacin analogues lycorisidine and pancratistatin treatment. 50 This is data that measures the value.
[0105] Figure 15 is data confirming the synergistic effect of combined administration when cisplatin and narcyclacin / lycorisidin / pancratistatin were treated at various concentrations in a pancreatic cancer cell line (PANC1).
[0106] Figure 16 is data confirming the synergistic effect of combined administration of cisplatin and narcyclacin / lycorisidin / pancratistatin at various concentrations to ovarian cancer cell lines (SKOV3).
[0107] Figure 17 is data confirming the synergistic effect of combined administration of cisplatin and narcyclacin / lycorisidin / pancratistatin at various concentrations to colon cancer cell line (HCT116).
[0108]
[0109] Hereinafter, the present invention will be described in detail.
[0110]
[0111] The present invention relates to a pharmaceutical composition comprising: cisplatin or a pharmaceutically acceptable salt thereof; and
[0112] The present invention relates to a composition for preventing or treating cancer, comprising narcyclasin, a narcyclasin analogue or a pharmaceutically acceptable salt thereof.
[0113] The present invention, in another aspect, comprises cisplatin or a pharmaceutically acceptable salt thereof; and
[0114] It relates to an anticancer adjuvant comprising narcyclasin, a narcyclasin analogue or a pharmaceutically acceptable salt thereof.
[0115]
[0116] In the present invention, the cancer may be at least one cancer selected from the group consisting of lung cancer, pancreatic cancer, ovarian cancer, colon cancer, breast cancer, glioblastoma, liver cancer, leukemia, melanoma, prostate cancer, kidney cancer, and stomach cancer, preferably lung cancer, pancreatic cancer, ovarian cancer, and colon cancer, and more preferably non-small cell lung cancer among lung cancers.
[0117] In the present invention, the cisplatin and narcyclacin or an analog thereof may be mixed at a concentration ratio of 100:0.01 to 100:1000.
[0118] In the present invention, the narcyclasin is represented by the following chemical formula 1, and the narcyclasin analogue may be lycoricidin represented by the following chemical formula 2, or pancratistatin represented by the following chemical formula 3.
[0119] [Chemical Formula 1]
[0120]
[0121] [Chemical Formula 2]
[0122]
[0123] [Chemical Formula 3]
[0124]
[0125]
[0126] In a specific embodiment of the present invention, narcyclacin, a natural product that exhibits a synergistic antitumor effect when combined with cisplatin using a three-dimensional tumor spheroid, was identified.
[0127] When cisplatin and narcyclacin are administered together, each IC 50 We confirmed that narcyclacin had a synergistic effect on inducing apoptosis of tumor spheroids of cisplatin-resistant lung cancer cells at concentrations lower than the value, and that narcyclacin inhibited the viability of NSCLC tumor spheroids and further increased the sensitivity of cisplatin-resistant tumor spheroids to cisplatin by inducing apoptosis.
[0128] Specifically, when cisplatin and narcyclacin were mixed at a concentration ratio of 100:0.01 to 100:300, preferably 100:0.167 to 100:150, an anticancer synergistic effect according to combined administration was confirmed.
[0129]
[0130] In another specific embodiment of the present invention, it was confirmed that lycorisidine and pancratistatin, which are analogues of narcyclacin, also exhibit excellent anticancer synergistic effects when administered in combination with cisplatin.
[0131] Specifically, when cisplatin and lycorisidin were mixed at a concentration ratio of 100:1 to 100:200, and when cisplatin and pancratistatin were mixed at a concentration ratio of 100:0.5 to 100:100, an anticancer synergistic effect according to combined administration was confirmed.
[0132]
[0133] In addition, as a result of confirming the anticancer synergy effect of combined administration of the two drugs in pancreatic cancer, ovarian cancer, and colon cancer in addition to lung cancer, it was confirmed that all of narcyclacin / lycoricidin / pancratistatin showed an anticancer synergy effect according to combined administration with cisplatin.
[0134] In particular, in the case of cisplatin, there is a problem of showing side effects such as nephrotoxicity, neurotoxicity, and bone marrow suppression when administered at high concentrations, but in the present invention, it was confirmed that excellent anticancer effects were shown through co-administration with narcyclacin / lycoricidin / pancratistatin at low concentrations of cisplatin.
[0135]
[0136] Using bioinformatic analysis using RNA sequencing data and functional validation experiments, we identified NOXA as a key gene responsible for the enhanced apoptosis observed with the combination of cisplatin and narcyclacin. Co-administration dramatically increased NOXA while simultaneously downregulating MCL1 levels. Inhibition of NOXA reversed the observed increase in apoptosis and restored MCL1 levels. Furthermore, MCL1 overexpression protected cells from co-administration-induced apoptosis. These findings imply that NOXA-mediated apoptosis is mediated by anti-MCL1 regulation.
[0137]
[0138] Using bioinformatic analysis using RNA sequencing data and functional validation experiments, we identified NOXA as a key gene responsible for the enhanced apoptosis observed with the combination of cisplatin and narcyclacin. Co-administration dramatically increased NOXA while simultaneously downregulating MCL1 levels. Inhibition of NOXA reversed the observed increase in apoptosis and restored MCL1 levels. Furthermore, MCL1 overexpression protected cells from co-administration-induced apoptosis. These findings imply that NOXA-mediated apoptosis is mediated by anti-MCL1 regulation.
[0139] Interestingly, narcyclacin, both alone and in combination with cisplatin, induced an unfolded protein response (UPR) and inhibited global protein synthesis, including MCL1. Furthermore, cisplatin alone and in combination with narcyclacin destabilized MCL1 via NOXA-mediated proteasomal degradation.
[0140] That is, co-administration of cisplatin and narcyclacin induced NOXA expression, down-regulated MCL1, and ultimately induced apoptosis in NSCLC tumor spheroids. Therefore, the composition comprising cisplatin and narcyclacin of the present invention can be applied for purposes that can overcome anticancer resistance to cisplatin and improve treatment outcomes.
[0141]
[0142] The composition of the present invention may be administered orally or parenterally in various dosage forms. When formulating the composition, it may be prepared using one or more buffers (e.g., saline or PBS), antioxidants, bacteriostatic agents, chelating agents (e.g., EDTA or glutathione), fillers, bulking agents, binders, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents, or surfactants, diluents, or excipients.
[0143] Solid dosage forms for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid dosage forms are prepared by mixing one or more compounds with at least one excipient, such as starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose, and hydroxypropylmethyl-cellulose or gelatin. For example, tablets or sugar-coated tablets can be obtained by mixing an active ingredient with a solid excipient, grinding the mixture, adding a suitable auxiliary agent, and then processing the mixture into a granule mixture.
[0144] In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups, and in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, or preservatives may be included. In addition, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as disintegrants in some cases, and anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, and preservatives may be additionally included.
[0145] Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, or suppositories. Non-aqueous solutions and suspensions can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases include witepsol, macrogol, Tween 61, cocoa butter, laurin, glycerol, and gelatin.
[0146] The composition of the present invention can be administered orally or parenterally, and when administered parenterally, it can be formulated in the form of an injection for external use on the skin; intraperitoneally, rectally, intravenously, intramuscularly, subcutaneously, intrauterinely, or intracerebrally, according to a method known in the art.
[0147] In the case of the above injection, it must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. Examples of suitable carriers for the injection include, but are not limited to, solvents or dispersion media including water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), mixtures thereof, and / or vegetable oils. More preferably, suitable carriers include Hanks' solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanolamine, or isotonic solutions such as sterile water for injection, 10% ethanol, 40% propylene glycol, and 5% dextrose. In order to protect the injection from microbial contamination, various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal may be additionally included. In addition, the injection may in most cases additionally include isotonic agents such as sugars or sodium chloride.
[0148] The composition of the present invention is administered in a pharmaceutically effective amount. A pharmaceutically effective amount refers to an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment. The effective dosage level can be determined based on the type and severity of the patient's disease, the activity and sensitivity of the drug to the drug, the time of administration, the route of administration and excretion rate, the duration of treatment, factors including concurrently used drugs, and other factors well known in the medical field. The composition of the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered singly or in multiple doses. That is, the total effective amount of the composition of the present invention can be administered to a patient as a single dose, or can be administered as multiple doses in a fractionated treatment protocol for long-term administration. It is important to consider all of the above factors and administer an amount that achieves the maximum effect with the minimum amount without causing side effects, and this can be easily determined by those skilled in the art.
[0149] The preferred dosage of the above composition varies depending on the patient's condition, body weight, degree of disease, drug form, route of administration, and period of administration, but can be appropriately selected by those skilled in the art. For example, it can be administered at 0.0001 to 2,000 mg / kg per day, more preferably 0.001 to 2,000 mg / kg. Administration can be done once a day or divided into several doses. However, the scope of the present invention is not limited by the above dosage.
[0150] The composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.
[0151]
[0152] The anticancer adjuvant of the present invention refers to any form that enhances the anticancer effect of an anticancer agent or suppresses or ameliorates the side effects of the agent. The anticancer adjuvant of the present invention can be administered in combination with various types of anticancer agents or anticancer adjuvants. When administered in combination, even at lower doses than conventional anticancer agents, the anticancer agent can exhibit an equivalent level of anticancer therapeutic effect, thereby enabling safer anticancer treatment.
[0153] The above-mentioned anticancer adjuvant may be administered via any conventional route as long as it can reach the target tissue. The anticancer adjuvant of the present invention may be administered intraperitoneally, intravenously, intramuscularly, subcutaneously, orally, intrapulmonary, or rectally, depending on the intended purpose, but is not limited thereto. Furthermore, the anticancer adjuvant may be administered via any device capable of transporting the active substance to target cells.
[0154] The anticancer adjuvant of the present invention can be preferably formulated as an anticancer adjuvant by additionally including one or more pharmaceutically acceptable carriers in addition to the active ingredient for administration. Carriers, excipients or diluents that can be included in the anticancer treatment adjuvant of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil.
[0155] The anticancer adjuvant of the present invention may be a formulation for oral or parenteral administration, and the description of the formulation is replaced with the description of the formulation of the pharmaceutical composition.
[0156]
[0157] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.
[0158]
[0159] Example 1: Confirmation of lung cancer cell line survival rate according to cisplatin or narcyclacin treatment.
[0160] A549, NCI-H460, NCI-H1975, and NCI-H358 cells were purchased from the American Type Culture Collection (ATCC, USA), and HCC2279 was purchased from the Korean Cell Line Bank (Korea). All cancer cell lines were cultured in RPMI-1640 supplemented with penicillin (100 unit / ml), streptomycin (100 µg / ml), and 10% fetal bovine serum at 37°C in an atmosphere of 5% CO2.
[0161] To generate tumor spheroids, the following cell lines were seeded in cell suspension 96-well round bottom plates (34896, SPL, Korea) and centrifuged at 1000 rpm for 10 min: A549, HCC2279, and NCI-H1975, 5x10 4 Dog cells / well, 2x10 4 NCI-H460 and 6x10 cells / well 4 NCI-H358 in cells / well.
[0162] Tumor spheroids were cultured in RPMI-1640 culture medium containing 0.5% Matrigel (BD Biosciences, USA) for A549, NCI-H358, and NCI-H460 and 2% Matrigel for H1975 and HCC2279 to promote spheroid formation, and compounds were treated 2 weeks after tumor spheroid formation.
[0163] Cell viability of tumor spheroids was measured using the CellTiter-Glo® cell viability assay (Promega, USA) according to the manufacturer's protocol, and cell fluorescence images were measured using the GloMax-Multi detection system (Promega, USA).
[0164]
[0165] In a preliminary study, the present invention screened a library of natural substances and confirmed that narcyclacin, alone or in combination with cisplatin, significantly inhibited the viability of NSCLC tumor spheroids. Subsequently, the effect of cisplatin on the viability of NSCLC tumor spheroids was investigated and it was found that the A549, NCI-H358, NCI-H1975, and HCC2279 cell lines were relatively resistant to cisplatin compared to the NCI-H460 cell line.
[0166] Therefore, in the present invention, four tumor spheroids derived from A549, NCI-H358, NCI-H1975, and HCC2279 were treated with various concentrations of cisplatin or narcyclacin for 72 hours, and IC was determined from the dose response curve. 50 The values were determined (Fig. 1a and Fig. 1b).
[0167]
[0168] IC 50 Value A549IC 50 (μM)CisplatinNarciclasine2D3.71±1.00.07±0.03D13.53±0.840.96±0.18
[0169]
[0170] Example 2: Confirmation of synergistic effect of combined administration of cisplatin and narcyclacin.
[0171] In the present invention, IC 50Based on the values, the synergistic effect of co-administration of cisplatin and narcyclacin at various concentrations was evaluated, and the combination index (CI) was calculated.
[0172] The combination index (CI) was calculated using CalcuSyn software. A CI value greater than 1 indicates an antagonistic effect, a CI value less than 1 indicates a synergistic effect, and a CI value less than 0.3 indicates a strong synergistic effect.
[0173]
[0174] As a result, as shown in Fig. 2, the decrease in the survival rate of A549 tumor spheroids was greater in combination administration than in individual treatments, and a synergistic effect with a CI value lower than 1 was observed in 7 of the 9 combinations tested in A549 tumor spheroids.
[0175] Additionally, most other cell lines also exhibited synergistic effects in combinations of narcyclacin and cisplatin. For subsequent analysis, the minimum concentration set (indicated by ▼) that resulted in a twofold or greater decrease in cell viability when combined with each cell line compared to individual treatments was selected.
[0176]
[0177] Example 3: Confirmation of enhanced sensitivity of NSCLC tumor spheroids to cisplatin by narcyclacin.
[0178] 3-1: Confirmation of cell viability according to optimal mixing ratio
[0179] Based on the results of the above <Example 2>, 10 μM cisplatin and 0.3 μM narcyclacin were co-administered to A549 tumor spheroids, and in order to investigate the time-dependent response to the co-administration, cell viability was evaluated 24 hours, 48 hours, and 72 hours after treatment at the selected concentrations.
[0180] As a result, as shown in Fig. 3a, the effect of combined administration increased over time.
[0181]
[0182] 3-2: Determination of cleaved caspases-7 and 9 (cCASP7 and 9) levels
[0183] To determine whether the inhibition of cell viability was due to increased cell death caused by the combination of cisplatin and narcyclacin, the degree of cleavage of caspase-7, -8, and -9 was determined through Western blot analysis.
[0184] A549 tumor spheroids were treated with vehicle, 10 μM cisplatin, 0.3 μM narcyclacin, or a combination of both drugs for 48 h, and then cell lysates were prepared for protein isolation. Cell lysates were prepared using Radioimmunoprecipitation Assay (RIPA) buffer (89900, Thermo Scientific, USA) supplemented with a protease inhibitor cocktail, phosphatase inhibitors (Calbiochem, USA), and phenylmethylsulfonyl fluoride (PMSF).
[0185] After measuring protein concentration using a BCA (bicinchoninic acid) protein assay kit (Thermo Scientific, USA), equal amounts of protein were separated by 8–15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, USA), and then treated with primary and secondary antibodies to observe the level of protein expression. Cleaved caspase-7 antibody (Asp198) (#9491, Cell Signaling), caspase-9 antibody (#9502, Cell Signaling), and caspase-8 antibody (#9746, Cell Signaling) were used as primary antibodies, and GAPDH (#2118, Cell Signaling) antibody was used as a loading control.
[0186]
[0187] As a result, as shown in Figure 3b, the cleavage of caspase-7 and -9 was confirmed to be higher in combination treatment than in single treatment. In contrast, the cleavage of caspase-8, which mediates the extrinsic apoptosis pathway, did not differ between cisplatin single treatment and combination treatment.
[0188] Additionally, we confirmed that the amount of apoptosis and cleaved caspase-7 increased in other NSCLC tumor spheroids administered in combination (Fig. 3c).
[0189]
[0190] 3-3: Cell staining
[0191] Tumor spheroids were stained using the LIVE / DEAD™ Viability / Cytotoxicity Kit (Thermo Scientific, USA) according to the manufacturer's protocol. Briefly, tumor spheroids were stained with 1 μM calcein-acetoxymethyl ester (AM) and 10 μM ethidium homodimer-1 (EthD-1) for 20 min at 37°C. Images were captured using the Operetta High Content Screening System (PerkinElmer, USA) and analyzed using Harmony 3.5.2 software.
[0192] As a result, as shown in Fig. 3d, it was confirmed that the number of dead cells increased and the size of spheroids decreased in the combined administration of cisplatin and narcyclacin compared to the single treatment.
[0193]
[0194] 3-4: Flow cytometry
[0195] When A549 tumor spheroids were treated with vehicle, 10 μM cisplatin, 0.3 μM narcyclacin, or a combination of both drugs for 48 hours, tumor spheroids were isolated and subjected to flow cytometry analysis.
[0196] Apoptosis was measured using the BD Pharmingen PE Annexin V Apoptosis Detection Kit. Tumor spheroids were dissociated into single cells using 0.2% trypsin-EDTA for 5 min at 37°C. Cells were counted at 1 × 10 5 Cells were suspended in 100 μL of Annexin V-binding buffer, stained with PE Annexin V and 7-Amino-Actinomycin (7-AAD) for 15 min, and analyzed by flow cytometry. Apoptotic cells were expressed as the percentage of annexin V-positive / 7-amino-actinomycin D (7-AAD)-negative cells.
[0197] Flow cytometric analysis of isolated tumor spheroids stained with Annexin V and 7-amino-actinomycin D revealed a significant increase in the proportion of cells in the early apoptotic stage in the combination treatment (Fig. 3e).
[0198]
[0199] 3-5: ELISA analysis
[0200] When A549 tumor spheroids were treated with vehicle, 10 μM cisplatin, 0.3 μM narcyclacin, or a combination of both drugs for 48 hours, the degree of DNA fragmentation was analyzed using ELISA.
[0201] Apoptosis was assessed using the Cell Death Detection ELISAPlus Kit (Roche, Germany) according to the manufacturer's protocol by quantifying cytoplasmic histone complex DNA fragments (mononucleosomes and oligonucleosomes). Absorbance was measured at 405 nm with a reference wavelength of 490 nm using the GloMax-Multi Detection System (Promega).
[0202]
[0203] Quantification of cytoplasmic histone-complexed DNA fragments revealed increased levels of apoptosis in co-administered A549 tumor spheroids (Fig. 3f).
[0204]
[0205] Example 4: Confirmation of antitumor activity according to combination administration in a xenograft mouse model
[0206] The antitumor activity of combined cisplatin and narcyclacin was evaluated in a xenograft mouse model.
[0207] Five-week-old male BALB / c nude mice were purchased from Orient Bio (Korea) and acclimated for 7 days. A549 (5 × 10 6) cells were suspended in 100 μL phosphate-buffered saline and mixed with 50 μL Matrigel (BD Biosciences), and then injected subcutaneously into 6-week-old BALB / c nude mice under isoflurane (JW Pharmaceutical, Korea) anesthesia. When the tumor size reached 60–70 mm3, the mice were randomly divided into four groups and administered drugs.
[0208] Vehicle (saline / DMSO), cisplatin (2 mg / kg), and / or narcyclacin (1 mg / kg) were injected intraperitoneally twice weekly at a volume of 100 μL each. Tumor diameters were measured twice a week for up to 4 weeks, and volumes were calculated using the following formula: V (mm3) = length × width × width / 2.
[0209] The Institutional Animal Care and Use Committee (IACUC) of the National Cancer Center Research Institute (NCC-23-884) reviewed and approved this study. NCCRI is an Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC International)-accredited facility and adhered to the Institute of Laboratory Animal Resources (ILAR) guidelines.
[0210]
[0211] As shown in Figures 4a and 4b, combined administration significantly inhibited tumor growth and weight compared to the vehicle control group. In summary, the present invention demonstrated, both in vitro and in vivo, that combined administration of cisplatin and narcyclacin exhibited a powerful synergistic effect in inhibiting NSCLC proliferation.
[0212]
[0213] Example 5: Screening of genes associated with the synergistic effect of combined administration of cisplatin and narcyclacin.
[0214] To investigate the mechanism of the synergistic effect of combined administration of cisplatin and narcyclacin, in the present invention, A549 tumor spheroids were treated with cisplatin alone, narcyclacin alone, or cisplatin and narcyclacin combined for 24 and 48 hours, and then RNA sequencing was performed.
[0215] Total RNA was extracted using the RNeasy Mini Kit (QIAGEN), and RNA quality was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Netherlands). QuantSeq 3' mRNA sequence analysis was performed commercially by Ebiogen Inc. (Korea).
[0216] mRNA libraries were prepared using the QuantSeq 3' mRNA-Seq Library Prep Kit (Lexogen, Austria) according to the manufacturer's instructions and sequenced as 75-bp single-end reads on a NextSeq 500 (Illumina, USA).
[0217] Differentially expressed genes (DEGs) with a fold change of 2 or more were identified using Excel-based DEG analysis software (ExDEGA, Ebiogen, Korea), and gene set enrichment analysis (GSEA) was performed to identify enriched gene sets using GSEA software (v.4.0.3, Broad Institute, USA).
[0218] The characteristic gene set of MSigDB (Molecular Signatures Database) was utilized, and the gene set with FDR (false discovery rate) q-value < 0.1 and nominal p-value < 0.01 was considered significant.
[0219]
[0220] As a result, as shown in Fig. 5a, it was confirmed that the number of genes showing a change in gene expression of more than twice that of the single-administration group was greater in the combination administration group.
[0221] As shown in Fig. 5b, to select candidate genes responsible for the synergistic effect of cisplatin and narcyclacin, a bioinformatics analysis integrating differentially expressed genes (DEGs) analysis based on gene expression changes and gene set enrichment analysis (GSEA) for functional gene classification was performed. Initially, 335 genes showing gene expression changes greater than 2-fold in all three comparison groups: combination vs. vehicle, combination vs. cisplatin, and combination vs. narcyclacin were selected.
[0222] Additionally, GSEA was performed to understand the functional categories of enriched genes and compare the cisplatin monotherapy group and the combination therapy group (Fig. 5c).
[0223] We then selected core enriched genes within these gene sets, identifying 89 upregulated and 11 downregulated genes in the combination therapy group compared to the cisplatin monotherapy group. Among the 335 genes extracted from the DEG analysis and the 100 genes extracted from the GSEA, 20 overlapping genes were selected as potential candidates associated with the synergistic effect of the combination therapy.
[0224] The heatmaps in Figures 5d and 5e show the expression patterns of candidate genes, with most genes showing increased expression in response to the treatment.
[0225]
[0226] Example 6: Gene validation associated with the synergistic effect of combined administration of cisplatin and narcyclacin.
[0227] 6-1: Gene knockdown using siRNA
[0228] In the present invention, the function of candidate genes reported to have antitumor activity was experimentally confirmed, and 11 individual genes and the NOXA gene were knocked down, and changes in cell viability in response to single or combined administration of cisplatin and narcyclacin were observed (Fig. 6a).
[0229] Cells were transfected with 20 nM siRNA (Table 2) using Lipofectamine RNAiMAX transfection reagent (Invitrogen, USA) according to the manufacturer's protocol. Negative control siRNA was purchased from Bioneer (Korea).
[0230]
[0231] siRNA sequence used in the present invention Gene sequence (5'-> 3') Sequence number NC siRNAAccuTarget NC siRNA (Bioneer)-ATF3 siRNAGGAGUCCUCAUUGAAUCCU Sequence number 1 GADD45A siRNAGUAGUUACUCAAGCAGUUA Sequence number 2 MAFF siRNACCAGCAAAGCUCUAAAGAU Sequence number 3 PHLADA2 siRNAGUGUACUUCACCAUCGUCA Sequence number 4 EGR1 siRNAACGACAGCAGUCCCAUUUA Sequence number 5 TUBB2A siRNACACACUGUUGAUGUAAUGA Sequence number 6 BCL10 siRNAGAAAUUUCUUGUCGAACAU Sequence number 7 GADD45B siRNAGUUGAUGAAUGUGGACCCA Sequence number 8 BTG3 siRNAUUGAGAGGUUUGCUGAGAA Sequence number 9 ID2 siRNACAAGAAGGUGAGCAAGAUGSEQ ID NO: 10NOXA siRNAGGUGCACGUUUCAUCAAUUSEQ ID NO: 11TP53 siRNA #1CACUACAACUACAUGUGUASEQ ID NO: 12TP53 siRNA #2UGAGGUUGGCUCUGACUGUSEQ ID NO: 13ATF3 siRNA #1GGAGUCCUCAUUGAAUCCUSEQ ID NO: 14ATF3 siRNA #2CACAAGGACGUCGGCUACUSEQ ID NO: 15MCL1 siRNA #1CAGAACGAAUUGAUGUGUASEQ ID NO: 16MCL1 siRNA #2UGUUCAGUUCUAGAGUGUASEQ ID NO: 17Survivin siRNA #1GACUUGGCCCAGUGUUUCUSEQ ID NO: 18Survivin siRNA #2GCAUCUCUACAUUCAAGAASEQ ID NO: 19
[0232]
[0233] For the formation of siRNA-transfected tumor spheroids, cells were replated in 96-well round-bottom plates 6 h after transfection. His-tagged control or ubiquitin plasmids were transfected into A549 cells using Lipofectamine 2000 (Invitrogen, USA).
[0234] When vehicle, cisplatin, narcyclacin, or a combination of both drugs was administered to A549 tumor spheroids knocked down for NOXA, MAFF, or BTG3, cell viability and spheroid size were observed by measuring cellular ATP content.
[0235] As shown in Figures 6b and 6c, cell viability was reversed in the combination treatment group when one of the three genes, NOXA, MAFF, and BTG3, was silenced. Consistent with the viability results, knockdown of NOXA, MAFF, and BTG3 reduced caspase-7 cleavage.
[0236]
[0237] 6-2: Confirmation of mRNA and protein expression levels according to drug administration during gene knockdown
[0238] In addition, in the present invention, when vehicle, cisplatin, narcyclacin, or a combination of the two drugs was administered to A549 tumor spheroids, the mRNA expression levels of NOXA, MAFF, or BTG3 genes were evaluated by RT-qPCR.
[0239] Total RNA was extracted from tumor spheroids using the RNeasy Mini Kit (Qiagen, Germany), and 1 μg of RNA was reverse transcribed using a cDNA synthesis kit (Dyne Bio, Korea). qPCR was performed using the LightCycler 96 Real-Time PCR System (Roche, Germany) and SFC green qPCR master mix (BioFACT, Korea). The primer sequences used for PCR are listed in Table 3.
[0240]
[0241] Primer sequences used in the present invention Gene sequence (5' -> 3') Sequence number NOXA forward CCGGCAGAAACTTCTGAATC Sequence number 20 reverse CGTGCACCTCCTGAGAAAAC Sequence number 21 MCL1 forward CCAAGAAAGCTGCATCGAACCAT Sequence number 22 reverse CAGCACATTCCTGATGCCACCT Sequence number 23 BIRC5 forward TGAGAACGAGCCAGACTTGG Sequence number 24 reverse TGGTTTCCTTTGCATGGGGT Sequence number 25 MAFF forward CTGTCGGACGAGGCGCTGATG Sequence number 26 reverse AGCCCACGGTTTTTTGAGTGTGCG Sequence number 27 BTG3 forward TAGTGACCTGGGCTTGCAAAG Sequence number 28 reverse CCCTGGTAACTTTCCTGGAGATC Sequence number 29 TP53 forward CCTCAGCATCTTATCCGAGTGG Sequence number 30 reverseTGGATGGTGGTACAGTCAGAGCSEQ ID NO: 31 ATF3 forwardCGCTGGAATCAGTCACTGTCAGSEQ ID NO: 32 reverseCTTGTTTCGGCACTTTGCAGCTGSEQ ID NO: 33 GAPDH forwardTGCACCACCAACTGCTTAGCSEQ ID NO: 34 reverseGGCATGGACTGTGGTCATGAGSeq ID NO: 35
[0242]
[0243] Protein expression levels were confirmed by Western blot, and were performed in the same manner as in <Example 3-2> above. The primary antibodies used were NOXA (#14766, Cell Signaling), MAFF (GTX120264, GeneTex), and BTG3 (NBP1-89098, Novus Biologicals).
[0244]
[0245] As a result, as shown in Fig. 6d, the mRNA levels of NOXA and MAFF were most increased in the co-administration, which was consistent with the RNA sequencing results, whereas the BTG3 mRNA level was not.
[0246] Although protein levels of NOXA and MAFF were also significantly increased by co-administration, the NOXA expression pattern was more consistent with previous experimental results, such as cell viability and apoptosis (Fig. 6c and 6e).
[0247]
[0248] Example 7: Confirmation of NOXA gene expression pattern and correlation with apoptosis according to combined administration of cisplatin and narcyclacin in various NSCLC tumor spheroids.
[0249] 7-1: Confirming NOXA gene expression patterns
[0250] When cisplatin and narcyclacin were combined and treated with various NSCLC tumor spheroids, we confirmed whether the NOXA gene was associated with apoptosis.
[0251] When cisplatin and narcyclacin were administered alone or in combination to NCI-H358, NCI-H1975, and HCC2279 tumor spheroids, NOXA mRNA levels were measured by RT-qPCR. As shown in Fig. 7a, NOXA mRNA expression was increased by combination administration in other NSCLC cell lines in addition to the A549 cell line.
[0252]
[0253] Furthermore, when cisplatin and narcyclacin were administered alone or in combination to NCI-H358 and NCI-H1975 tumor spheroids in which the NOXA gene was knocked down, cell viability was confirmed. As shown in Fig. 7b and Fig. 7c, changes in cell viability and apoptosis due to NOXA silencing were consistent with those observed in A549 tumor spheroids. Based on these results, the NOXA gene was selected as a candidate gene supporting the synergistic anticancer effect of combined administration of cisplatin and narcyclacin.
[0254]
[0255] 7-2: Confirming ATF3 gene expression patterns
[0256] In the present invention, we confirmed that NOXA mRNA expression increased in A549 tumor spheroids when cisplatin was administered alone or in combination with narcyclacin. Therefore, the effect of co-administration on the expression of transcription factors that regulate NOXA expression was investigated. p53 is a well-known upstream regulator of NOXA, and activating transcription factor 3 (ATF3) has been reported to regulate cisplatin-induced NOXA in a p53-independent manner.
[0257] Therefore, in the present invention, when cisplatin and narcyclacin were administered alone or in combination to NCI-H358, NCI-H1975, and HCC2279 tumor spheroids, RT-qPCR was performed to determine the ATF3 mRNA level using the same method as in <Example 6-2>.
[0258]
[0259] As a result, as shown in Fig. 7d, it was confirmed that ATF3 mRNA expression increased with combined administration of cisplatin and narcyclacin.
[0260]
[0261] Example 8: Identification of genes associated with NOXA expression regulation
[0262] 8-1: Confirmation of NOXA expression following p53 and ATF3 knockdown
[0263] In the present invention, considering the dramatic increase in ATF3 expression following co-administration of cisplatin and narcyclacin as shown in the results of the above <Example 7>, it was assumed that ATF3 could function as a transcriptional activator of NOXA under such co-administration conditions, and it was investigated whether p53 or ATF3 contributes to the induction of NOXA in response to co-administration.
[0264] To this end, first, using the same method as in <Example 6>, siRNA targeting TP53 (siTP53) or ATF3 (siATF3) was transfected, and the effect of each treatment on the viability of tumor spheroids was investigated. Thereafter, RNA and protein were isolated and analyzed as in <Example 6-2>.
[0265]
[0266] As a result, as shown in Fig. 8a, when narcyclacin was administered alone or in combination with cisplatin, siTP53 tumor spheroids showed increased cell viability compared to the negative control (siNC) when gene expression was knocked down with siRNA. Moreover, siTP53-tumor spheroids showed a significant decrease in NOXA induction by combination treatment at both mRNA and protein levels, which was observed concurrently with a significant decrease in caspase-7 cleavage (Figs. 8b and 8c).
[0267] In contrast, siATF3-tumor spheroids demonstrated increased sensitivity to narcyclacin alone and in combination with cisplatin. In siATF3 tumor spheroids, NOXA induction by combination therapy was increased at both mRNA and protein levels, and this occurred concurrently with increased caspase-7 cleavage.
[0268] That is, the above results indicate that NOXA upregulation by co-administration is transcriptionally regulated by p53.
[0269]
[0270] 8-2: Confirmation of the expression level of apoptosis-related proteins following NOXA knockdown
[0271] NOXA promotes mitochondrial-mediated apoptosis by inhibiting anti-apoptotic proteins, including MCL1. To investigate the effects of increased NOXA induced by co-administration with apoptosis-related proteins, the present invention suppressed NOXA expression in A549 tumor spheroids as described in <Example 6>, followed by single or combined administration with cisplatin and narcyclacin. RNA and protein were then isolated and analyzed as described in <Example 6-2>.
[0272]
[0273] As a result, as shown in Fig. 8d, the expression of MCL1, a major binding partner of NOXA, was significantly reduced when co-administered compared to treatment with cisplatin or narcyclacin alone. The basal expression of MCL1 slightly increased after NOXA knockdown, and the decrease in MCL1 expression induced by co-administration was also reversed.
[0274] In contrast, BCL2A1 expression was barely detectable, regardless of drug treatment, except for a slight increase in cisplatin-treated tumor spheroids. Consistently, co-administration of the drugs with NOXA knockdown had minimal effects on BCL2 expression.
[0275]
[0276] Increased cleavage of caspase-9, its downstream effector caspase-7, and the caspase substrate poly (ADP-ribose) polymerase (PARP) induced by co-administration was significantly reduced after NOXA knockdown. Consistent with these observations, apoptosis assays quantifying histone-associated DNA fragmentation showed that NOXA knockdown significantly inhibited co-administration-induced apoptosis (Fig. 8e).
[0277]
[0278] 8-3: Confirmation of cell death and protein expression levels related to MCL1 overexpression
[0279] To further confirm that MCL1 plays a pivotal role in co-administration-induced apoptosis, MCL1-overexpressing A549 cells were utilized.
[0280] The full-length cDNA of human MCL1 (KU016524) was purchased from the Korea Human Gene Bank and subcloned into the pLenti-c-MYC-DDK-P2A-RFP vector (OriGene, USA), replacing the original puro segment with RFP. To generate cells overexpressing MCL1, lentiviruses were produced by transfecting 293FT cells with the pLenti-Ctrl and pLenti-MCL1 vectors together with pMD2G and psPAX. Medium containing lentiviral particles was applied to A549 cells together with 0.8 μg / ml polybrene for 3 days, and RFP-positive cells were sorted using a FACSAria II (BD Biosciences).
[0281] As shown in Fig. 8f, when A549 tumor spheroids transfected with Flag-tagged vector control or Flag-tagged MCL1 vector were treated with cisplatin and narcyclacin, alone or in combination, for 48 h, the significant decrease in survival induced by the combination of drugs was significantly reversed. These results suggest that combination therapy induces apoptosis through NOXA-induced downregulation of MCL1.
[0282] Additionally, the results of apoptosis analysis and PARP and caspase-7 cleavage in Figures 8g and 8h indicate that MCL1-overexpressing tumor spheroids reduced apoptosis induced by combination therapy.
[0283] These results imply that NOXA plays a crucial role in the synergistic effect observed in the combination of cisplatin and narcyclacin, and that NOXA-mediated regulation of MCL1 levels underlies the induction of apoptosis in response to combination treatment in NSCLC tumor spheroids.
[0284]
[0285] Example 9: Confirmation of activation of the mitochondrial-mediated apoptosis pathway by NOXA expression.
[0286] When A549 tumor spheroids with NOXA and / or MCL1 gene knockout were treated with cisplatin and narcyclacin alone or in combination for 48 hours, apoptosis was measured.
[0287] As shown in Figure 9a, the increased cell viability observed upon NOXA knockdown was significantly reduced in tumor spheroids in which NOXA and MCL1 were simultaneously knocked down. Consistent with this observation, apoptosis assay results also showed that co-administration significantly enhanced apoptosis induced by NOXA and MCL1 compared to NOXA knockdown alone (Figure 9b).
[0288]
[0289] Because survivin expression coincided with cell death induced by co-administration, the role of survivin was further verified in the present invention.
[0290] When A549 tumor spheroids with NOXA and / or survivin genes knocked down were treated with cisplatin and narcyclacin alone or in combination for 48 hours, the cell viability was examined. The effect of survivin knockdown appeared to be similar to that of MCL1, but the reversal of cell death due to combination administration was more prominent in MCL1 knockdown (Fig. 9c and 9d).
[0291]
[0292] Example 10: Confirmation of regulation of MCL1 expression through translational inhibition of NOXA increased by combined administration of cisplatin and narcyclacin.
[0293] 10-1: Confirming MCL1 mRNA expression levels
[0294] After A549 tumor spheroids were treated with 0.3 μM narcyclacin for 24 h, MCL1 mRNA levels were quantified using RT-qPCR.
[0295] In Fig. 8d of the above <Example 8>, it was confirmed that the MCL1 protein level was reduced by narcyclacin, whereas, as shown in Fig. 10a, the MCL1 mRNA expression level was upregulated.
[0296]
[0297] 10-2: Confirmation of involvement in proteasome degradation
[0298] In order to determine whether the decrease in MCL1 protein level by narcyclacin was potentially due to acceleration of proteasome degradation, A549 cells were pretreated with 0.05 μM narcyclacin for 2 hours and then treated with 10 μM MG-132 (proteasome inhibitor) for the indicated time, and then MCL1 protein level was determined by Western blot.
[0299]
[0300] As a result, as shown in Fig. 10b, MG-132 treatment alone induced time-dependent accumulation of MCL1 protein. In contrast, despite the inhibition of protein degradation by MG-132 treatment, no accumulation of MCL1 was observed in narcyclacin-treated cells.
[0301] Despite increased mRNA levels by narcyclacin and simultaneous prevention of protein degradation by MG-132, MCL1 protein levels were not increased upon narcyclacin treatment, indicating that translation of MCL1 is blocked in response to narcyclacin treatment.
[0302]
[0303] 10-3: Confirmation of the relevance of protein translation inhibition
[0304] Additionally, A549 tumor spheroids were treated with 10 μg / mL cyclohexamide and 0.3 μM narcyclacin, and MCL1 protein levels were determined by Western blotting at each time point. As a result, the kinetics of MCL1 expression reduction by narcyclacin were similar to those of cyclohexamide, a widely used translation inhibitor, confirming that narcyclacin inhibits the translation of MCL1 mRNA (Fig. 10c).
[0305]
[0306] 10-4: Protein Synthesis Evaluation
[0307] To determine the effect of narcyclacin on protein translation, protein synthesis in A549 tumor spheroids was assessed using surface sensing of translation (SUnSET) analysis.
[0308] Tumor spheroids were cultured for 2 hours with cisplatin, narcyclacin, or a combination thereof, and then treated with 5 μg / ml puromycin for 15 minutes to label initial peptides. As a positive control, tumor spheroids were treated with 100 μg / ml cycloheximide for 15 minutes prior to puromycin treatment. Tumor spheroids were lysed, and puromycin-labeled peptides were analyzed by western blot using an anti-puromycin antibody, clone 12D10 (Sigma Aldrich, USA).
[0309]
[0310] As a result, as shown in Fig. 10d, narcyclazine was found to decrease the level of early peptides in a concentration-dependent manner, and although cisplatin alone did not reduce protein synthesis, co-administration of cisplatin and narcyclazine dramatically inhibited translation, similar to that observed with narcyclazine alone.
[0311]
[0312] 10-5: Checking protein levels involved in the UPR pathway
[0313] In the present invention, we investigated the effects of narcyclacin and the combined administration of cisplatin and narcyclacin on pathways regulating protein translation, including the mTOR and integrated stress response (ISR) pathways. A549 tumor spheroids were treated with 0.3 μM narcyclacin, and the levels of proteins involved in the Unfolded Protein Response (UPR) pathway, such as phospho-eIF2α and phospho-4E-BP1, were determined over time using Western blot.
[0314]
[0315] As a result, as shown in Figure 10e, narcyclacin immediately increased phosphorylation of eIF2α, a key component of the ISR, including a decrease in general protein synthesis, which may explain the rapid decrease in MCL1 levels. However, phosphorylation of 4E-BP, a target protein of the mTOR pathway, was only slightly increased at later time points.
[0316] PERK (Protein kinase R-like endoplasmic reticulum kinase), a member of the eIF2α kinase family, responds to endoplasmic reticulum (ER) stress and activates the unfolded protein response (UPR). PERK phosphorylation increased immediately after narcyclacin administration, which coincided with eIF2α phosphorylation, indicating that PERK is an upstream kinase.
[0317] Furthermore, narcyclacin significantly increased the phosphorylation of IRE1α (inositol-requiring enzyme type 1α), another ER stress sensor, which in turn increased the phosphorylation of its downstream targets, c-Jun N-terminal kinase (JNK) and p38. The expression of ATF3 and C / EBP homologous protein (CHOP), transcription factors induced by ER stress, was also increased after narcyclacin treatment.
[0318]
[0319] Next, the expression of proteins associated with UPR signaling was investigated for 1, 4, 24, and 48 hours after administration of cisplatin, narcyclacin, or their combination.
[0320] As a result, as shown in Figure 10f, eIF2α phosphorylation was higher in combination treatment than in narcyclacin alone, and this increase persisted for up to 48 hours. PERK and IRE1α phosphorylation levels were increased in cells treated with narcyclacin. ATF3 expression was most significantly increased in combination-treated tumor spheroids, whereas CHOP expression was highest in narcyclacin-treated cells. In general, changes in the expression of UPR-related proteins due to cisplatin treatment were minimal.
[0321] As shown in Figure 10g, the level of H2O2 significantly increased when narcyclacin was administered alone or in combination with cisplatin. This suggests that ER stress was induced by the increase in ROS caused by narcyclacin alone or in combination with cisplatin.
[0322] That is, the above results indicate that narcyclacin alone and in combination with cisplatin induces translational inhibition of MCL1 by activating UPR through PERK and IRE1α pathways due to ER stress induced by reactive oxygen species (ROS).
[0323]
[0324] 10-6: Confirmation of IRE1α-mediated ER stress-related protein and NOXA expression levels
[0325] To further elucidate the mechanism by which NOXA is upregulated in response to combination therapy, in addition to p53, the potential involvement of the IRE1α-mediated UPR pathway was investigated.
[0326] As a result, as shown in Fig. 10h, pretreatment with KIRA6 suppressed NOXA mRNA expression induced by co-administration of cisplatin and narcyclacin. Furthermore, consistent with the mRNA results, inhibition of IRE1α activity significantly suppressed NOXA protein expression induced by co-administration (Fig. 10i), and the increase in CHOP and ATF3 levels was also reduced by IRE1α inhibition (Fig. 10i). In other words, the results indicate that co-administration upregulates NOXA through the IRE1α-mediated UPR pathway.
[0327] Furthermore, as shown in Fig. 10i, phosphorylation of p38 induced by narcyclazine or co-administration was significantly inhibited by KIRA6 pretreatment, whereas phosphorylation of JNK was only slightly inhibited. These results imply that JNK and p38 activation by narcyclazine and co-administration of cisplatin and narcyclazine is mediated by IRE1α.
[0328] Next, we analyzed the changes in NOXA mRNA and protein levels by co-administration of cisplatin and narcyclacin after inhibiting JNK and p38 activities using SP600125, a JNK inhibitor, and SB203580, a p38 inhibitor.
[0329] As a result, as shown in Figures 10j and 10k, p38 inhibition significantly reduced both NOXA mRNA and protein levels in co-administered tumor spheroids, suggesting an important role of p38 in NOXA regulation. JNK inhibition had little effect on NOXA mRNA levels but reduced NOXA protein levels similar to those observed with p38 inhibition, indicating that JNK regulates NOXA protein levels.
[0330] That is, the above results imply that the IRE1α-JNK / p38 axis contributes to the upregulation of NOXA in response to co-administration.
[0331]
[0332] 10-7: Confirming the expression level of genes related to deubiquitinating enzymes
[0333] The stability of MCL1 is regulated by various E3 ubiquitin ligases and deubiquitinases. In the present invention, using the RNA sequencing analysis results of <Example 5>, the mRNA expression level of USP13 (ubiquitin-specific protease 13), a deubiquitinase responsible for removing polyubiquitin chains from MCL1, was analyzed in four NSCLC tumor spheroids when co-administered with cisplatin and narcyclacin.
[0334]
[0335] Analysis of USP13 mRNA expression levels. USP13A549 24hA549 48hNCI-H1975NCI-H358HCC2279Cis / veh0.7120.5020.5970.6690.905Nar / veh0.6400.7070.7920.2550.705C+N / veh0.1980.2170.2430.0680.271
[0336]
[0337] RNA sequencing results showed that the mRNA level of USP13 was reduced approximately 4- to 15-fold in four NSCLC tumor spheroids after combination therapy.
[0338]
[0339] Example 11: Confirmation of MCL1 degradation promotion by increased NOXA by combined administration of cisplatin and narcyclacin
[0340] 11-1: Confirming MCL1 mRNA expression levels
[0341] When cisplatin (10 μM) and narcyclacin (0.3 μM) were administered alone or in combination to A549 tumor spheroids, RT-qPCR was performed using the same method as in <Example 6-2> to confirm the MCL1 mRNA level.
[0342]
[0343] As a result, despite increased MCL1 mRNA expression and translation due to cisplatin treatment (Figs. 11a and 10d), protein levels were decreased compared to vehicle-treated cells (Figs. 8d and 10f). This suggests that MCL1 levels are regulated by a post-translational mechanism.
[0344]
[0345] 11-2: Confirming MCL1 protein expression levels
[0346] Therefore, A549 tumor spheroids were pretreated with MG-132 prior to administration of cisplatin and narcyclacin alone or in combination, and MCL1 levels were assessed via Western blotting. Specifically, A549 tumor spheroids were pretreated with 10 μM MG-132 for 1 h, then treated with cisplatin (10 μM) and narcyclacin (0.3 μM), alone or in combination, for 24 or 48 h, and then Western blotting was performed.
[0347] As a result, MG-132 pretreatment increased basal levels of MCL1 and further induced its accumulation in response to cisplatin treatment (Fig. 11b). This is consistent with a previous report that cisplatin induces proteasomal degradation of MCL1 (W. Nakajima, et al., Oncotarget. 7(24):36353-36365, 2016). However, tumor spheroids treated with narcyclacin after MG-132 pretreatment exhibited lower levels of MCL1 than vehicle-treated cells, confirming that narcyclacin inhibits MCL1 translation.
[0348] The decrease in MCL1 protein levels due to combination therapy was not restored to the same extent as that observed with narcyclacin monotherapy even after pretreatment with MG-132. This may be due to the significantly lower MCL1 mRNA levels and lower protein synthesis in the combination group compared to the narcyclacin group.
[0349] After 48 hours, the MCL1 level in the combination group was 4.2-fold lower than that in the narcyclacin monotherapy group, and the reduction due to MG-132 pretreatment was only 1.6-fold compared to that in the narcyclacin monotherapy group. This indicates that combination therapy increases the proteasomal degradation of MCL1 more than narcyclacin monotherapy.
[0350]
[0351] 11-3: Confirmation of MCL1 protein half-life
[0352] The results of the present invention imply that increased NOXA, when administered alone or in combination with cisplatin, plays a key role in MCL1 degradation (Fig. 8d and Fig. 11b). Therefore, in the present invention, changes in MCL1 levels were analyzed using cycloheximide tracking analysis after each drug administration along with the regulation of NOXA expression.
[0353] First, cells were transfected with siNC or siNOXA for 24 h, and then treated with cisplatin (5 μM) and narcyclacin (0.1 μM) alone or in combination. After 24 h, cells were treated with 10 μg / ml cycloheximide for 10, 20, 30, and 40 min and then lysed for Western blotting. The MCL1 and GAPDH bands were scanned, and their intensities were semi-quantified using ImageJ. The relative concentration of MCL1 at 10 min, when the effect of cycloheximide began, was defined as 1. The intensity of the MCL1 band at each time point was normalized to the relative concentration of MCL1 at 10 min. Protein half-lives were calculated using linear regression analysis.
[0354]
[0355] Protein half-life 1 / 2 (min)VehCisNarCis + NarsiNC41.8 ± 2.230.3 ± 1.995.1 ± 8.924.9 ± 1.4siNOXA51.1 ± 4.447.9 ±7.490 ± 4.949.1 ± 6.2
[0356]
[0357] As a result, as shown in Fig. 11c and Table 5, the half-life of MCL1 in the untreated group was approximately 41.8 minutes, while that in the cisplatin-treated group was significantly shorter (t1 / 2= 30.3 ± 1.9 minutes). In the cisplatin and narcyclacin co-administration group, the half-life of MCL1 was found to be the shortest due to the highest induction of NOXA (t1 / 2= 24.9 ± 1.4 minutes).
[0358] Furthermore, NOXA knockdown prolonged the half-life of MCL1 in the vehicle-treated group (approximately 51.1 ± 4.4 min), the cisplatin-treated group (approximately 47.9 ± 7.4 min), and the combination group (approximately 49.1 ± 6.2 min). We confirmed that the stability of MCL1 was enhanced when NOXA was silenced, and that increased NOXA levels in response to cisplatin alone or in combination mediate the degradation of MCL1.
[0359]
[0360] 11-4: Confirming the Ubiquitin-Proteasome Pathway
[0361] To investigate whether NOXA-mediated MCL1 degradation occurred via the ubiquitin-proteasome pathway, A549 cells were co-transfected with siNC or siNOXA and polyhistidine-tagged control (His-Ctrl) or ubiquitin (His-Ub), followed by treatment with cisplatin, narcyclacin, or their combination. Proteins were then isolated, and MCL1 and NOXA protein levels were determined by Western blotting.
[0362]
[0363] As a result, as shown in Fig. 11d, the MCL1 level was confirmed to be lower after His-Ub transfection compared to His-Ctrl transfection in the vehicle, cisplatin, and combination treatment groups.
[0364] As expected, MCL1 levels were overall increased in siNOXA-transfected cells compared to siNC-transfected cells, but when NOXA was knocked down, MCL1 levels were not significantly altered by forced expression of ubiquitin (His-Ub), indicating that NOXA is required for ubiquitination of MCL1.
[0365] Specifically, co-administration and forced expression of ubiquitin reduced MCL1 levels by 25% compared to the co-administered His-Ctrl group. However, in the NOXA knockdown group, MCL1 levels were similar regardless of ubiquitin levels. In other words, co-administration significantly induced NOXA expression, which mediates ubiquitin-proteasomal degradation of MCL1.
[0366] That is, the results of the present invention indicate that NOXA expression was significantly increased by combined administration of cisplatin and narcyclacin, which enhanced proteasomal degradation and induced translational inhibition of MCL1, thereby downregulating MCL1, and ultimately resulting in synergistic cell death in NSCLC tumor spheroids.
[0367]
[0368] Example 12: Confirmation of synergistic effect through combined administration of cisplatin and narcyclacin analogues.
[0369] In the present invention, it was attempted to determine whether lycorisidine or pancratistatin, which are analogues of narcyclacin, exhibit a synergistic effect on anticancer effects when administered in combination with cisclacin.
[0370]
[0371] 12-1: Measurement of IC50 values of narcyclacin analogues
[0372] First, IC for lycoricidin and pancratistatin 50To measure the value, four tumor spheroids derived from A549, NCI-H358, NCI-H1975, and HCC2279 were treated with various concentrations of lycoricidin or pancratistatin for 72 hours in the same manner as in <Example 1> above, and IC was calculated from the dose response curve. 50 The values were determined (Fig. 12a and Fig. 12b).
[0373]
[0374] 12-2: Confirmation of synergistic effects following combined administration with cisplatin
[0375] In the present invention, IC 50 Based on the values, the synergistic effect of co-administration of cisplatin and lycorisidin / pancratistatin at various concentrations was evaluated, and the combination index (CI) was calculated.
[0376] The combination index (CI) was calculated using CalcuSyn software, and a CI value less than 1 indicates a synergistic effect.
[0377] As a result, as shown in Figures 13a to 13d, it was confirmed that a synergistic effect was observed with the combined administration of cisclacine and lycoricidin / pancratistatin.
[0378]
[0379] Furthermore, in the present invention, the Colby equation was utilized to confirm the synergistic effect of anticancer activity according to combined administration. When the anticancer activity of two compounds combined is greater than the simple sum (expected activity) of the anticancer activities of each compound, this is called a synergistic effect. The predicted synergistic effect according to combined administration of the present invention can be calculated as follows using the Colby equation of the following mathematical formula 1 (SR, Colby, Weeds, 1967, 15, 20-22).
[0380]
[0381] [Mathematical Formula 1]
[0382] E = α + β-(α × β÷ 100)
[0383]
[0384] α and β are the measured anticancer activity values when each compound is treated alone, and E is the predicted value, which is the predicted anticancer activity when α and β are mixed.
[0385] In the present invention, the actual value of anticancer activity according to combination administration was expressed as cancer cell growth inhibition rate (%), and this was substituted into the Colby equation to measure the predicted value (E) according to combination administration. If the actual value is greater than the predicted value, it can be determined that there is a synergistic effect. In the present invention, in order to further verify the synergistic effect of combination administration, the predicted value calculated by the Colby equation was compared with the actual value.
[0386]
[0387] Anticancer synergistic effect of combined administration of cisplatin and lycorisidine in A549 cell line. Cisplatin (μM) Lycorisidine (μM) Cancer cell death rate (%) Actual value Cancer cell death rate (%) Predicted value 50.5 21.236 125.44 0.22 46.24 3.25 58.05 1.71 0 74.27 0.41 00.5 36.14 4.9 149.94 8.12 74.05 0.85 66.75 8.11 0 77.97 4.3
[0388] Anticancer synergistic effect of combined administration of cisplatin and pancratistatin in A549 cell line. Cisplatin (μM) Pancratistatin (μM) Cancer cell death rate (%) Actual value Cancer cell death rate (%) Predicted value 5 1 2 6.2 3 3.4 2.5 3 6.5 3 9.5 5 6 7.2 5 1.7 1 0 1 4 9.5 3 8.7 2.5 6 0.6 44.4 5 7 0.9 5 5.6
[0389] Anticancer synergistic effect of combined administration of cisplatin and lycorisidine in H358 cell line. Cisplatin (μM) Lycorisidine (μM) Cancer cell death rate (%) Actual value Cancer cell death rate (%) Predicted value 100.532.528.1147.334.1556.943.7200.558.944.1163.148.8566.156.2300.572.661.1171.564.3576.469.5
[0390] Anticancer synergistic effect of combined administration of cisplatin and pancratistatin in H358 cell line. Cisplatin (μM) Pancratistatin (μM) Cancer cell death rate (%) Actual value Cancer cell death rate (%) Predicted value 100.221.520.40.546.531.7150.136.4257.046.14200.251.638.10.561.446.9160.250.5264.058.1300.273.656.90.569.463.0167.365.55272.070.84
[0391] Anticancer synergistic effect of combined administration of cisplatin and lycorisidine in H1975 cell line. Cisplatin (μM) Lycorisidine (μM) Cancer cell death rate (%) Actual value Cancer cell death rate (%) Predicted value 10 1 2 6.5 10.4 2 3 7.2 2.7 5 6 6.1 4 9 2 0 1 4 0.8 2 2.1 2 4 8.3 3 2.8 5 7 8.6 5 2.1 3 0 147.4 4 8.2 2.6 8.5 5.3 5 87.8 6 8.2
[0392] Anticancer synergistic effect of combined administration of cisplatin and pancratistatin in H1975 cell line. Cisplatin (μM) Pancratistatin (μM) Cancer cell death rate (%) Actual value Cancer cell death rate (%) Predicted value 100.5-10.6-12.11 28.3-5.6 244.7 7.9 200.5-1.7 2.5 113.38.2 256.3 19.9 300.5 25.0 35.2 141.0 38.9 270.4 46.8
[0393] Anticancer synergistic effect of combined administration of cisplatin and lycorisidine in HCC2279 cell line. Cisplatin (μM) Lycorisidine (μM) Cancer cell death rate (%) Actual value Cancer cell death rate (%) Predicted value 20 16 0.2 16 3 28 5.14 7 14 9 5.46 7 14 0 19 5.8 8 3.8 29 7.7 8 9.7 49 7.7 9 3.6
[0394] Anticancer synergistic effect of combined administration of cisplatin and pancratistatin in HCC2279 cell line. Cisplatin (μM) Pancratistatin (μM) Cancer cell death rate (%) Actual value Cancer cell death rate (%) Predicted value 200.2 26.0-13.6 187.55 2.4 293.77 3.6 400.29 1.3 78.0 196.8 90.8 297.19 0.8
[0395]
[0396] As shown in Tables 6 to 13 above, the synergy effect confirmed by the combination index (CI) and the synergy effect confirmed by the Colby method were found to have almost the same results.
[0397] In addition, when cisplatin was treated at a low concentration of 5 μM, the cancer cell death rate was found to be low, but the anticancer effect was confirmed to increase by co-administration with lycorisitin / pancratistatin. Specifically, when lycorisitin / pancratistatin was treated at a concentration of 2 to 10 μM with cisplatin at a concentration of 5 μM, it was confirmed that an anticancer synergistic effect was shown.
[0398]
[0399] Example 13: Synergistic effects of combined administration of cisplatin and narcyclacin in various cancers.
[0400] 13-1: Measuring IC50 values
[0401] First, in the same manner as in <Example 1> above, various concentrations of cisplatin, narcyclacin, lycorisidin, and pancratistatin were treated to pancreatic cancer cell lines (PANC1), ovarian cancer cell lines (SKOV3), and colon cancer cell lines (HCT116) for 72 hours, and IC was determined from the dose response curve. 50 The values were determined (Figs. 14a to 14c).
[0402]
[0403] 13-2: Confirmation of the effectiveness of combination therapy in pancreatic cancer
[0404] In the present invention, in order to confirm the effect of combined administration on pancreatic cancer, [cisplatin + narcyclacin], [cisplatin + lycoricidin], and [cisplatin + pancratistatin] were combined and administered to the pancreatic cancer cell line PANC1 under various concentration conditions based on the IC50 value, and the synergistic effect was confirmed using the combination index (CI).
[0405]
[0406] As a result, as shown in Fig. 15, [cisplatin + narcyclacin] and [cisplatin + lycorisidin] were confirmed to have a high synergistic effect on pancreatic cancer, and [cisplatin + pancratistatin] was shown to have an anticancer synergistic effect at some concentrations.
[0407] Specifically, [cisplatin + narcyclacin] showed an anticancer synergy effect at a concentration ratio of 100:0.25 to 100:20, [cisplatin + lycoricidin] showed an anticancer synergy effect at a concentration ratio of 100:5 to 100:200, and [cisplatin + pancratistatin] showed an anticancer synergy effect at a concentration ratio of 100:2 to 100:40.
[0408]
[0409] 13-3: Confirmation of the effectiveness of combination therapy in ovarian cancer
[0410] In the present invention, in order to confirm the effect of combined administration on ovarian cancer, [cisplatin + narcyclacin], [cisplatin + lycoricidin], and [cisplatin + pancratistatin] were combined and administered to the SKOV3 cell line, an ovarian cancer cell line, under various concentration conditions based on the IC50 value, and the synergistic effect was confirmed using the combination index (CI).
[0411]
[0412] As a result, as shown in Figure 16, [cisplatin + narcyclacin], [cisplatin + lycoricidin], and [cisplatin + pancratistatin] were all shown to have anticancer synergistic effects.
[0413] Specifically, [cisplatin + narcyclacin] showed an anticancer synergy effect at a concentration ratio of 100:12.5 to 100:100, [cisplatin + lycoricidin] showed an anticancer synergy effect at a concentration ratio of 100:250 to 100:1000, and [cisplatin + pancratistatin] showed an anticancer synergy effect at a concentration ratio of 100:125 to 100:500.
[0414]
[0415] 13-4: Confirmation of the effect of combination therapy in colon cancer
[0416] In the present invention, in order to confirm the effect of combined administration on colon cancer, [cisplatin + narcyclacin], [cisplatin + lycoricidin], and [cisplatin + pancratistatin] were combined and administered to the colon cancer cell line HCT116 cell line under various concentration conditions based on the IC50 value, and the synergistic effect was confirmed using the combination index (CI).
[0417]
[0418] As a result, as shown in Figure 17, [cisplatin + narcyclacin], [cisplatin + lycoricidin], and [cisplatin + pancratistatin] were shown to have a high synergistic effect in colon cancer.
[0419] Specifically, [cisplatin + narcyclacin] showed an anticancer synergy effect at a concentration ratio of 100:0.05 to 100:2, [cisplatin + lycoricidin] showed an anticancer synergy effect at a concentration ratio of 100:1 to 100:100, and [cisplatin + pancratistatin] showed an anticancer synergy effect at a concentration ratio of 100:0.25 to 100:50.
[0420]
[0421] In the present invention, it was confirmed that a synergistic anticancer effect was exhibited by combined administration of cisplatin and narcyclasin, or a narcyclasin analogue, and therefore, the composition comprising cisplatin and narcyclasin, or a narcyclasin analogue of the present invention can be applied for purposes that can overcome anticancer resistance to cisplatin and improve treatment results.
Claims
1. Cisplatin or a pharmaceutically acceptable salt thereof; and A composition for the prevention or treatment of cancer comprising narciclasine, a narciclasine analogue, or a pharmaceutically acceptable salt thereof.
2. In paragraph 1, A composition for preventing or treating cancer, characterized in that the above cancer is one or more cancers selected from the group consisting of lung cancer, pancreatic cancer, ovarian cancer, colorectal cancer, breast cancer, glioblastoma, liver cancer, leukemia, melanoma, prostate cancer, kidney cancer, and stomach cancer.
3. In paragraph 1, A composition for preventing or treating cancer, characterized in that the above cisplatin and narcyclacin or an analog thereof are mixed in a ratio of 100:0.01 to 100:1000.
4. In paragraph 1, The above narciclacin is represented by the following chemical formula 1, and A composition for the prevention or treatment of cancer, characterized in that the above-mentioned narcyclacin analog is lycoricidine represented by the following chemical formula 2 or pancratistatin represented by the following chemical formula 3: [Chemical Formula 1] [Chemical Formula 2] [Chemical Formula 3] .
5. Cisplatin or a pharmaceutically acceptable salt thereof; and An anticancer adjuvant comprising narciclasine, a narciclasine analog, or a pharmaceutically acceptable salt thereof.
6. In Article 5, An anticancer adjuvant characterized in that the above cancer is one or more cancers selected from the group consisting of lung cancer, pancreatic cancer, ovarian cancer, colorectal cancer, breast cancer, glioblastoma, liver cancer, leukemia, melanoma, prostate cancer, kidney cancer, and stomach cancer.
7. In paragraph 5, An anticancer adjuvant characterized by the above cisplatin and narcyclacin or an analog thereof being mixed in a ratio of 100:0.01 to 100:1000.
8. In Paragraph 5, The above narciclacin is represented by the following chemical formula 1, and An anticancer adjuvant, characterized in that the narcyclacin analogue is lycoricidine represented by the following chemical formula 2 or pancratistatin represented by the following chemical formula 3: [Chemical Formula 1] [Chemical Formula 2] [Chemical Formula 3] .
Citation Information
Patent Citations
Nitrogenated derviatives of pancratistatin
KR1020110036842A