System for calcium-dependent modular gene expression regulation
A modular calcium-responsive gene circuit using split transcription factors activated by ultrasound or receptor-mediated calcium influx addresses the challenge of precise gene expression control in larger animals, achieving safe and efficient regulation without thermal damage.
Patent Information
- Application Number
- PCT/EP2025/073256
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-13
- Filing Date
- 2025-08-13
- Publication Date
- 2026-03-19
AI Technical Summary
Existing gene expression systems lack precise, spatial, and temporal control, particularly in larger animals, and induce thermal damage at high ultrasound frequencies, necessitating a system that can regulate gene expression through calcium-dependent mechanisms without hyperthermia and respond to endogenous cellular signals.
A modular calcium-responsive synthetic gene circuit using split transcription factors activated by ultrasound or receptor-mediated calcium influx, comprising polypeptides with DNA binding, heterodimerization, and transcriptional regulation domains, allowing independent adaptation to different targets and inputs.
Provides precise, efficient, and safe gene expression control with reduced background activity and increased specificity, enabling spatially confined regulation in response to cytosolic calcium changes without thermal damage.
Smart Images

Figure IMGF000025_0001 
Figure IMGF000026_0001 
Figure IMGF000027_0001
Abstract
Description
[0001] System for calcium-dependent modular gene expression regulation
[0002] The present invention provides a system for calcium-dependent modular gene expression regulation, nucleic acids encoding the polypeptides of the system, an isolated cell comprising the system and / or nucleic acids encoding its polypeptides, a method of altering expression of a polynucleotide in a cell with regulation of calcium influx, and use of the system for various applications involving gene expression regulation.
[0003] The present invention relates generally to the field of molecular biology. More specifically, the invention relates to methods and compositions regarding calcium-responsive proteins and nucleic acids for gene expression.
[0004] The precise control of gene expression, influenced by endogenous cues, holds significant promise for cellular reprogramming and gene therapy in cell-based approaches. Synthetic gene circuits have emerged as invaluable tools for orchestrating protein expression and manipulating cellular physiology, enabling the precise regulation of both exogenous and endogenous gene expression. Within the field of synthetic biology, remarkable progress has been achieved in designing gene circuits that respond to a wide array of internal or external stimuli, including small molecules, cell interactions, light, radio-waves, and temperature variations.
[0005] Engineered transcription factors, leveraging custom-designed DNA-binding domains such as transcription activator-like effectors (TALEs) and clustered regularly interspaced short palindromic repeats (CRISPR), possess the remarkable capacity to target an extensive repertoire of DNA sequences. This makes them potent tools for controlling the expression of virtually any desired gene. When integrated with inducible systems, these tunable transcription factors enable external manipulation of gene expression.
[0006] Split transcription factors offer researchers precise control over the localization and activity of transcription factors within a cell. By using split transcription factors with orthogonal dimerization domains, researchers can employ different split transcription factor systems independently in the same cell, preventing interference between them. This orthogonal control is particularly valuable when manipulating multiple activities simultaneously within a cell. Furthermore, concatenation of dimerizing partners enables precise control of the stoichiometry of the bound transcriptional activation or repressor domains, leading to enhanced transcriptional activation or repression. This precision is crucial for designing complex gene circuits with specific network topologies. Among the various transcription factors available for synthetic biology applications, those dependent on calcium ions have garnered particular interest. Calcium influx or uptake in cells can be initiated by a variety of external and internal stimuli, serving as a central signal transduction mechanism across diverse physiological contexts. External stimuli such as mechanical forces, temperature changes, ultrasound, light, and chemical agents can trigger calcium entry through the activation of mechanosensitive or ligand-gated ion channels. Internally, cellular pathways involving receptor engagement — including G-protein-coupled receptors (GPCRs), tyrosine kinase receptors, T-cell receptors (TCRs), chimeric antigen receptors (CARs), purinergic receptors and others know to art — can activate downstream signaling cascades that result in calcium release from intracellular stores (e.g., endoplasmic reticulum) or the opening of calcium-permeable channels in the plasma membrane. This receptor-mediated activation of calcium signaling is essential for a wide range of cellular processes and provides multiple entry points for the modulation of synthetic gene circuits designed to respond to intracellular calcium dynamics. The nuclear factor of activated T-cells (NFAT) signaling pathway is especially useful in constructing calcium-dependent synthetic gene circuits in eukaryotic cells. In mammalian cells, NFAT is a pivotal transcription factor regulated by calcium influx, facilitated by the activation of the calcineurin phosphatase. Upon rising calcium levels in the cell, Ca2+and a complex of calmodulin with Ca2+are known to activate the phosphatase calcineurin. Calcium-induced dephosphorylation of NFAT by calcineurin phosphatase triggers the translocation of NFAT from the cytosol to the nucleus, where it influences gene expression. Several approaches have successfully exploited NFAT regulation through external and internal stimuli, such as fatty acids, radio-waves, light, ultrasound, menthol, CAR, TCR and others.
[0007] As explained above spatially and temporally confined activation of calcium influx can be achieved through the engagement of native or engineered cell surface receptors, such as for example CARs and TCRs. These receptors mediate target-specific cellular responses by recognizing antigens presented on the surface of target cells. Upon antigen binding, CARs and TCRs initiate signaling cascades that culminate in calcium influx and NFAT dephosphorylation. This mode of activation ensures that calcium signaling — and thus any linked synthetic gene expression system — occurs exclusively in the presence of the target antigen, providing a high degree of spatial and temporal specificity. By coupling gene expression to calcium influx initiated by target engagement, the present invention allows for selective gene activation in microenvironments of interest, enabling context-aware cell behavior.
[0008] The challenge of regulating cells in terms of both spatial and temporal control is profound and additional control can be achieved by external remote control. In this pursuit, optogenetic techniques have emerged as a promising avenue for wireless manipulation of engineered cells. These techniques employ genetically encoded light-sensitive proteins and ion channels to activate or deactivate cellular processes through ion flux or protein domain interactions. However, the limited tissue penetration of light has restricted its non-invasive application in larger animals, necessitating alternative approaches. One such alternative, ultrasound, addresses this limitation by offering substantial advantages in controlling cellular processes within deep tissues.
[0009] Unlike light, ultrasound can penetrate tissues more effectively, making it a compelling choice for cellular manipulation. With a frequency range of 1-15 MHz and a long history of safe medical imaging use, ultrasound can be precisely focused on an area as small as 1 mm2. Low- frequency ultrasound, in particular, has demonstrated superior tissue penetration capabilities compared to its high-frequency counterparts, with innovative technologies such as phased- focused ultrasound transducer arrays addressing challenges posed by sound absorption and refraction. This versatile tool has been employed to stimulate neurons in various model organisms, both in vitro and in vivo, spanning from salamanders to mice and non-human primates.
[0010] The impact of low-intensity ultrasound on neurons is primarily mechanical, influencing the cells through changes in membrane elasticity or activation of mechanosensitive transmembrane proteins. Moreover, innovative elements such as protein-based gas vesicles and microbubbles have served as actuators for ultrasound-mediated neuromodulation. Recent research in the field of ultrasound-mediated immunotherapy has opened new avenues, including the systemic administration of genetically engineered bacteria that release therapeutic payloads upon precise stimulation using focused ultrasound. An alternative approach involves the activation of engineered T-cells in the presence of microbubbles or through localized heat generated by focused ultrasound, demonstrating the ability to enhance the recognition and elimination of target tumor cells via transcriptional activation of CAR expression. Alongside the thermal effects associated with higher ultrasound frequencies, the mechanisms for ultrasound-dependent tissue excitation encompass phenomena such as membrane oscillation, cavitation, and radiation force.
[0011] While significant progress has been made in cancer immunotherapy through the utilization of therapeutic bacterial cells and T cells responding to localized hyperthermia facilitated by focused ultrasound, a prominent challenge persists. This challenge arises from the extensive macromolecular alterations induced by hyperthermia, affecting cellular functions across various compartments, particularly at temperatures exceeding 43°C. It is worth noting that although fewer macromolecular changes occur within the range of 40.5°C to 42°C, these changes are still substantial in number and span multiple cellular compartments. In the context of tumor therapy, thermal tissue damage, albeit considerable, can be synergistic; however, its implications in non-tumor applications or potential harm to therapeutic cells in specific scenarios cannot be overlooked.
[0012] Thus, the task of the present invention is to provide a system for precise, tight and efficient cellular gene expression control through calcium-dependent mechanisms. In particular, it is desired that the system enables external and / or internal control of gene expression via modulation of cytosolic calcium levels. To this end, the system of the present invention should be compatible with low-intensity ultrasound that works without induction of local hyperthermia. Furthermore, it is desired that the system may also respond to endogenous cellular signals, such as receptor activation following specific cell interactions - for example, through antigen engagement of engineered receptors like chimeric antigen receptors (CARs) or T-cell receptors (TCRs). These natural or synthetic receptor pathways provide highly localized and target-dependent calcium signaling, allowing spatially restricted gene expression in the presence of a specific antigen or tissue context. Additionally, the system should be modular and adaptable, allowing regulation of transcription of any transcribable polynucleotide sequence of choice, wherein the transcriptional regulation may comprise transcriptional activation, enhancement or repression.
[0013] This task is surprisingly solved by the present invention, which introduces an advantageous modular approach for precise calcium-dependent cellular control, operable via both remote stimuli and receptor-mediated biological cues. In one embodiment, the system is centred around a calcium-responsive synthetic circuit that is activatable with ultrasound, preferably low-intensity ultrasound avoiding hyperthermia. The present invention thus explores the potential of ultrasound as a non-invasive and remote activator of engineered cells. Without wishing to be bound by a theory, it is assumed that ultrasound waves induce mechanical perturbations that trigger a rise in cytosolic Ca2+levels, for example through activation of mechanosensitive ion channels. Surprisingly, the rise in cytosolic Ca2+levels upon ultrasound stimulation, also at low intensities, is sufficient to activate Ca2+-calmodulin signalling pathways, including translocation of NFAT or modified NFAT proteins into the nucleus (Ivanovski et al., Nature Communications 15, 7369 (2024)).
[0014] In another embodiment, the present invention leverages cell-intrinsic mechanisms to induce calcium influx through activation of engineered surface receptors. For example, upon recognition of a specific antigen, CARs or TCRs initiate intracellular signaling cascades that lead to phospholipase Cy activation and inositol trisphosphate (IP3)-mediated calcium release from intracellular stores, followed by store-operated calcium entry through CRAC channels. This endogenous signaling route enables spatially confined activation of gene expression, restricted to the site of antigen encounter. By coupling the synthetic gene circuit to these natural calcium influx mechanisms, the system of the invention enables target cell-specific or tissue-specific transcriptional regulation without external stimulation.
[0015] To translate calcium signals - whether ultrasound-induced or receptor-mediated - into targeted gene expression, the inventors have devised a modular synthetic Ca2+-sensitive signaling pathway that operates independently of the Ca2+-dependent nuclear factor of T-cell (NFAT)-regulated promoters within the cells. Instead, the system of polypeptides of the invention, which may be regarded as a split transcription factor system, may employ any DNA binding domain recognizing any desired sequence. The split transcription factor system of the invention is highly modular, allowing fast adaptation to different target genes or different desired transcriptional regulation modes. Moreover, using inducible dimerization partners in the split transcription factor system of the invention, tighter regulation is achieved through a double-signal approach, one for reconstitution and the second for translocation of the transcription factor.
[0016] The present invention introduces a novel system for precisely and efficiently controlling gene expression with change in cytosolic calcium concentration. This technology offers a system comprising polypeptides of a split transcription factor, nucleic acid molecules, cells and methods that enable the regulation of gene expression in response to calcium influx, for instance triggered by physical stimuli (e.g. ultrasound) or receptor activation (e.g. CAR engagement). Specifically, the invention provides split transcription factors that become functional upon increase of intracellular calcium concentration and can regulate the transcription of target polynucleotide sequences.
[0017] In a first aspect, the invention provides a system for calcium-dependent modular gene expression regulation, comprising:
[0018] (a) a polypeptide comprising a DNA binding domain and at least one heterodimerization domain A,
[0019] (b) a polypeptide comprising a Ca2+-responsive modified NFAT protein lacking an active DNA binding domain, and comprising at least one heterodimerization domain A’, suitable to dimerize with heterodimerization domain A, and
[0020] (c) a polypeptide comprising a domain for transcriptional regulation, wherein the polypeptide of (a) is one protein and the polypeptides of (b) and (c) are present as one fusion protein or as two proteins, in which case the polypeptide of (b) further comprises at least one heterodimerization domain B and the polypeptide of (c) further comprises at least one heterodimerization domain B’ suitable to dimerize with heterodimerization domain B, with B and B’ being orthogonal to A and A’.
[0021] The split transcription factor architecture confers the following non-trivial and synergistic benefits:
[0022] • Reduced background expression: functional activation occurs only upon co-localization and assembly of the individual modules, reducing background expression (’’leakiness”) of genes.
[0023] • Increased temporal resolution: the split components can be designed to assemble only in response to several satisfactory conditions, such as transient stimuli (e.g. Ca2+influx by ultrasound), co-localization and optionally inducible dimerization.
[0024] • Modularity of the system: each component / module ((a) and / or (b) and / or (c) of claim 1) can be modified independently, allowing rapid adaptation to new targets or inputs.
[0025] • Increased biosafety and specificity: functional expression requires multiple matching events, minimizing off-target activation and unintended gene expression.
[0026] The split system is not a mere reorganization — it introduces conditional reconstitution as a regulatory mechanism. In such systems, reconstitution is dependent on a specific trigger (e.g., ultrasound-induced calcium influx). This enables a novel control modality.
[0027] A fusion protein as referred to herein describes a protein comprising two or more proteins or polypeptides operably linked or connected such that each protein or polypeptide continues to serve its intended function. Such proteins are typically linked via peptide bonds and may be constructed using standard techniques known in the art. It is understood that one of skills in the art may combine multiple proteins to create fusion proteins and may also alter the proteins comprised in a fusion protein by inserting, deleting or rearranging one or more amino acids in the amino acid sequence of the proteins or domains within the proteins to produce variants that retain the intended function.
[0028] The polypeptides (a)-(c) of the system of the invention constitute a calcium-responsive split transcription factor (TF) system. Polypeptide (a) may herein also be called a DNA binding module, polypeptide (b) may be called a control module and polypeptide (c) a regulatory module.
[0029] In an especially preferred embodiment, the polypeptides (b) and (c) are present as one fusion protein. In this case, the system of the invention may also be called a bipartite split transcription factor system, and the polypeptides and / or proteins of the invention constitute a bipartite split transcription factor. A bipartite split transcription factor system of the invention is illustrated in Fig. 1A.
[0030] In another preferred embodiment, the polypeptides (b) and (c) are present as two separate proteins further comprising heterodimerization domains B and B’ as described above. In this case, the system of the invention may also be called a tripartite split transcription factor system, and the polypeptides and / or proteins of the invention constitute a tripartite split transcription factor. A tripartite split transcription factor system of the invention is illustrated in Fig. 1 B.
[0031] The present invention surprisingly solves the task of the invention, by providing a split transcription factor system in which a DNA binding domain of polypeptide (a) and a transcriptional regulation domain of polypeptide (c) are present in two separate proteins, and polypeptide (c) comprising the transcriptional regulation domain is fused to or can heterodimerize with a Ca2+-responsive modified NFAT protein lacking an active DNA binding domain of polypeptide (b). Separation of the DNA binding domain and transcriptional regulation domain under constitutive conditions allows for a tighter regulation and less background activity of the split TF in the absence of stimulation. Moreover, it makes the system highly modular and allows for easy exchange of the functional domains as desired. Without wishing to be bound by a theory, upon increased cytosolic calcium concentration and under conditions that allow heterodimerization of the complementary heterodimerization domains, rising cellular Ca2+levels may lead to calcineurin-dependent activation of the modified NFAT domain, causing a translocation of polypeptides (b) and (c), which are either fused or bound to each other via heterodimerization domains, into the nucleus. It is further suggested that polypeptides (b) and (c) bind to polypeptide (a) in the nucleus, thereby reconstituting a functional transcription factor which can regulate gene expression of its target gene.
[0032] In a preferred embodiment, the system of the invention may further comprise a membrane anchoring peptide fused to the polypeptide (b) or (c). Preferably, the membrane anchoring peptide is fused to the polypeptide (c), more preferably to the C terminus of the polypeptide (c). The inventors have found that the presence of a membrane anchoring peptide allows for a tighter control and lower background expression of the target nucleotide sequence in the absence of increased cytosolic calcium concentration.
[0033] The membrane anchoring peptide is preferably suitable for reversible anchoring to the plasma membrane. It is especially preferred that the membrane anchoring peptide at least partially loses affinity to and / or is more easily released from the plasma membrane upon rising Ca2+levels in the cell. The membrane anchoring peptide may be derived from a naturally occurring protein or may be a synthetic peptide. In a particularly preferred embodiment, the membrane anchoring peptide is a KR(p peptide, that is, a peptide corresponding to the synthetic peptide sequence KRcp which is known in the art.
[0034] In a particular embodiment of the invention, one or both of the heterodimerization domains A and A’, and optionally one or both of the heterodimerization domains B and B’, are present in the respective polypeptides in more than one repeat, preferably 2-15 repeats, more preferably 8-12 repeats. For example, if a heterodimerization domain A, A’, B or B’ is part of a coiled coil forming peptide system, the polypeptide comprising the heterodimerization domain may comprise 10 repeats of the coiled coil forming peptide. Under conditions suitable for their heterodimerization, the presence of multiple repeats of either one or both complementary domains A and A’, or B and B’, may enhance the affinity of the polypeptides comprising these domains. For example, if both complementary domains, e.g. A and A’, of a heterodimerization system are present in multiple repeats, several repeats of the first domain, e.g. A, may bind to several repeats of the second domain, e.g. A’. If only one of both complementary domains, e.g. either A or A’, is present in multiple repeats, this may still increase affinity of the polypeptides comprising the domains, by increasing the avidity and / or binding probability of the complementary heterodimerization domains. Conditions suitable for heterodimerization may be constitutive conditions for non-inducible heterodimerization systems, and the presence of the inducer for inducible heterodimerization system.
[0035] In one preferred embodiment of the invention, polypeptide (a), which comprises a DNA binding domain, comprises 2-15, more preferably 8-12 repeats of heterodimerization domain A, and polypeptide (b) comprises one heterodimerization domain A’. In this case, it is particularly preferred that A and A’ are a coiled coil forming peptide pair.
[0036] Adjacent domains within one protein of the system of the invention may be connected directly or through an amino acid linker. A preferred embodiment of the amino acid linker is a glycine-serine (GS) peptide linker consisting of glycine and serine units. For example, the linker may comprise alternating glycine and serine units or small stretches of repeating glycine units (e.g. 1-5 G) alternating with small stretches of repeating serine units (e.g. 1-3 S). The amino acid linker may have a variable length; preferably the linker has a length of 4-20 amino acids, more preferably of 8-10 amino acids. In a preferred embodiment, the amino acid linker is a GS peptide linker comprising 4-20 amino acids, more preferably 8-10 amino acids. In a particularly preferred embodiment, all adjacent domains within each protein of the system of the invention are connected via GS peptide linkers with a length of 4-20, preferably 8-10 amino acids.
[0037] The Ca2+-responsive modified NFAT protein comprised in polypeptide (b) of the system of the invention is an NFAT protein lacking an active DNA binding domain, wherein the NFAT protein may be selected from any endogenous or exogenous member of the NFAT protein family responsive to calcium signaling. Preferably, the NFAT protein on which the modified NFAT protein is based is selected from NFATc1-c4, more preferably selected from mammalian NFATc1-c4, most preferably selected from human or mouse NFATc1-c4.
[0038] In one preferred embodiment, the Ca2+-responsive modified NFAT protein is an NFAT protein truncated of its transactivation domain and DNA binding domain. In an alternative preferred embodiment, the modified NFAT protein is an NFAT protein with an inactivated DNA binding domain.
[0039] In one embodiment, polypeptide (c) of the system of the present invention may comprise a protein selected from a transcription factor, transcriptional activator, transcriptional enhancer or transcriptional repressor, wherein the protein comprises a domain for transcriptional regulation.
[0040] It is preferred that the domain for transcriptional regulation of polypeptide (c) of the system of the invention is selected from a transcriptional activation domain, transcriptional enhancer domain or transcriptional repressor domain.
[0041] The transcriptional activation domain may be selected from any transcriptional activation domain known to art, including but not limited to, acidic transcriptional activation domains, such as from GAL4 or the C-terminal portion of the herpes simplex virus viron protein 16 (VP16) or VP64 (4 repeats of VP16), VPR activation domain, assembled p65, VP64 and Rta activator from Epstain-Barr virus; proline-rich transcriptional activation domains, such as from ITF1 or lTF2; glutamine-rich transcriptional activation domains, such as from Octi or Sp1 ; and / or part of NF-KB transcription factor-p65 domain. Other suitable transcriptional activation domains are known in the art and would be readily available to one skilled in the art.
[0042] The transcriptional repressor domain herein may be selected from any transcriptional repressor domain known to art, including but not limited to Kruppel associated box or KRAB domain and its analogs, parts of Zinc finger protein-based transcription factors, MBD repression domain, SNAG domain, a chromoshadow domain, a SID domain, or EAR- repression domain (SRDX). Other suitable transcriptional repressor domains are known in the art and would be readily available to one skilled in the art.
[0043] It is understood that the heterodimerization domains A and A’ are complementary domains of a heterodimerization system A-A’. If polypeptides (b) and (c) of the system of the invention are present as two separate proteins, (b) comprises a heterodimerization domain B and (c) comprises a heterodimerization domain B’, wherein B and B’ are complementary domains of a heterodimerization system B-B’ orthogonal to A-A’. Apart from being orthogonal, the heterodimerization systems A-A’ and B-B’ are selected independently, e.g., if both heterodimerization systems are present, they may both be inducible, both be non-inducible, or one may be inducible and the other non-inducible.
[0044] In a preferred embodiment of the invention, heterodimerization of A and A’ and / or optionally of B and B’ is non-inducible. In this case, complementary heterodimerization domains may dimerize as soon as they are in the same subcellular location, e.g., the same cellular compartment. For example, upon ultrasound-induced or receptor-mediated calcium influx, the fusion protein or heterodimer of polypeptides (b) and (c) may translocate into the nucleus and reconstitute with polypeptide (a) via heterodimerization of A-A’ to form a functional transcription factor which can regulate the transcription of the target nucleic acid sequence.
[0045] Preferably, non-inducible heterodimerization systems are coiled-coil forming peptide pairs, which can reconstitute due to their intrinsic affinity without addition of any inducer. Such peptide pairs may heterodimerize in in parallel (e.g. N5-N6, P3-P4 etc.) or anti-parallel (e.g.P3- AP4) manner. In a particularly preferred embodiment, the non-inducible heterodimerization systems are selected from coiled-coil forming peptide pairs known in the art, such as P3-P4, N5-N6 and P3S-P4S.
[0046] In a further embodiment of the invention, peptide pairs that form coiled-coils are chosen as heterodimerization systems A-A’ or B-B’ based on their physical properties (e.g. Kd values, their orthogonality properties etc.). Peptide pairs that form coiled-coils can have strong heterodimerization properties: for example, peptide pair N5-N6 exhibits stronger heterodimerization affinity than peptide pair P3S-P4S. From this follows that transcriptional activation and / or repression of a target nucleotide sequence upon increased cytosolic calcium concentration may be greater if A-A’ is N5-N6 than if A-A’ is P3S-P4S.
[0047] In another preferred embodiment of the invention, heterodimerization of A and A’ and / or optionally of B and B’ is inducible, either chemically or non-chemically. Addition of and / or exposure to one or more chemical or non-chemical inducers of heterodimerization before or during increased cytosolic calcium concentration, wherein the latter induces nuclear localization of polypeptides (b) and (c) (fused or heterodimerized), can trigger heterodimerization of the complementary heterodimerization domain(s) of the bipartite or tripartite split transcription factor of the system according to the invention, thereby resulting in a functional split transcription factor, which can regulate the transcription of the target nucleic acid sequence, preferably in the nucleus.
[0048] In a particularly preferred embodiment, heterodimerization of A and A’ and / or optionally of B and B’ is chemically inducible with at least one physiologically acceptable chemical compound, preferably selected from abscisic acid, rapalog, rapamycin and gibberellin. In this case, heterodimerization systems A-A’ and / or B-B’ may preferably be selected from FKBP- FRB (inducible with rapalog or rapamycin), ABI-PYL1 (inducible with abscisic acid), GID-GA1 (inducible with gibberellin) or from any other chemically inducible heterodimerization system with a physiologically acceptable chemical inducer known in the art.
[0049] In another preferred embodiment, heterodimerization of A and A’ and / or optionally of B and B’ is inducible non-chemically, preferably with light of a defined wavelength range. In this case, heterodimerization systems A-A’ and / or B-B’ may preferably be inducible with blue light of a wavelength range of 400-500 nm, in which case A-A’ and / or B-B’ are preferably selected from CIBN-CRY2PHR or LOVpep-ePDZb, or A-A’ and / or B-B’ may be inducible with red light of a wavelength range of -620-700 nm, in which case A-A’ and / or B-B’ are preferably selected from PIF-PHYB or FKF1-GI.
[0050] DNA binding domains, in general, are well known in the art, and refer herein to protein domains that recognise a specific or consensus DNA sequence. Alternatively, a DNA binding domain may have a general affinity to DNA, without recognizing a specific sequence. The motif or motifs within the DNA binding domain that recognise DNA can recognize and bind to double- or single-stranded DNA. There are numerous DNA binding domains known in the art, including helix-turn-helix domains, helix-loop-helix domains, zinc finger domains, leucine zipper domains, high mobility group box domains, PAM-interacting domain, Transcriptional activatorlike effector (TALE) domains, catalytically inactive Cas9 (dCas9), and modified endogenous or exogenous DNA binding proteins for example, from families like interferon regulatory factor (IRF), forkhead box protein (FOX), signal transducer and activator of transcription (STAT), runt-related transcription factor (RLINX), T cell factor (TCF) and others, i.e. , endogenous or exogenous DNA binding proteins truncated to its DNA binding domain or full length proteins with mutated nuclear translocation signals. A DNA binding domain of peptide (a) of the system of the present invention may comprise any DNA binding domain known to the art.
[0051] In a particularly preferred embodiment, the split transcription factor system of the invention is a bipartite split TF system, wherein the protein comprising polypeptides (b) and (c) is hNFAT2'409:P4:VP16:KR(p and the protein comprising polypeptide (a) is TAL:2xP3. In this case, the protein comprising polypeptides (b) and (c) preferably corresponds to SEQ ID NO: 13 and its coding sequence preferably corresponds to SEQ ID NO: 1 , and the protein comprising polypeptide (a) preferably corresponds to SEQ ID NO: 16 and its coding sequence preferably corresponds to SEQ ID NO: 4.
[0052] In another preferred embodiment, the split transcription factor system of the invention is a tripartite split TF system, wherein the protein comprising polypeptide (b) is hNFAT2-409:P4:P6A, the protein comprising polypeptide (c) is P5A:VP16:KRcp and the protein comprising polypeptide (a) is TAL:2xP3. In this case, the protein comprising polypeptide (b) preferably corresponds to SEQ ID NO: 14 and its coding sequence preferably corresponds to SEQ ID NO: 2, the protein comprising polypeptide (c) preferably corresponds to SEQ ID NO: 15 and its coding sequence preferably corresponds to SEQ ID NO: 3, and the protein comprising polypeptide (a) preferably corresponds to SEQ ID NO: 16 and its coding sequence preferably corresponds to SEQ ID NO: 4.
[0053] Alternatively the protein comprising polypeptide (a) in bipartite or tripartite transcription factor systems may be dCas9-10xP3 (DNA binding module consists of SEQ ID NO: 17 and its coding sequence preferably corresponds to SEQ ID NO: 5) or F OXO12-271-2xP3 (DNA binding module consists of SEQ ID NO: 18 and its coding sequence preferably corresponds to SEQ ID NO: 6) or FOXO1151-271-2xP3 (DNA binding module consists of SEQ ID NO: 19 and its coding sequence preferably corresponds to SEQ ID NO: 7) or RUNX12-244-2xP3 (DNA binding module consists of SEQ ID NO: 20 and its coding sequence preferably corresponds to SEQ ID NO: 8) or RUNX150-178-2xP3 (DNA binding module consists of SEQ ID NO: 21 and its coding sequence preferably corresponds to SEQ ID NO: 9) or TCF1269-359-2xP3 (DNA binding module consists of SEQ ID NO: 22 and its coding sequence preferably corresponds to SEQ ID NO: 10) or TCF1269-392-2xP3 (DNA binding module consists of SEQ ID NO: 23 and its coding sequence preferably corresponds to SEQ ID NO: 11) or IRF71-128-2xP3 (DNA binding module consists of SEQ ID NO: 24 and its coding sequence preferably corresponds to SEQ ID NO: 12).
[0054] It is preferred that the DNA binding domain of (a) recognizes a DNA binding site, preferably a specific nucleic acid sequence. Even more preferably, the system of the invention is a system for expression regulation of a target nucleic acid sequence, wherein the target nucleic acid sequence is a transcribable polynucleotide operably linked to a DNA binding site which is recognized by the DNA binding domain of (a). The target nucleic acid sequence may also be called gene of interest (GOI).
[0055] The target nucleic acid sequence may be an exogenous or heterologous transcribable polynucleotide operably linked to a DNA binding site, transformed or transfected into the host cell or organism with a method known in the art, as will be detailed below. In such a case, one or more nucleic acid molecules encoding the calcium-responsive split transcription factor of the system of the invention and a nucleic acid molecule comprising the target transcribable polynucleotide sequence can be introduced into a host cell or organism linked as single molecule or as two or more separate molecules, for instance by co-transfection or cotransformation or successive transfection or transformation of one molecule and then other. Alternatively, the target nucleic acid sequence may be an endogenous transcribable polynucleotide sequence. In such a case, an exogenous DNA binding site may be incorporated into the host cell in such a manner that it is operably linked to the endogenous transcribable polynucleotide sequence. Operable linkage of the DNA binding site to the endogenous transcribable polynucleotide sequence may occur through any method know in the art, for instance, by homologous recombination between two sequences. Homologous recombination techniques and methods are well known and available to one of skill in the art.
[0056] The target nucleic acid sequence may be any desirable transcribable polynucleotide sequence.
[0057] In a preferred embodiment, the target nucleic acid sequence encodes a protein. In preferred embodiments, the target nucleic acid sequence encodes a reporter protein, a cell stress tolerance protein, an industrial enzyme, a biofuel production enzyme, a cell lysis protein or a cell regulatory protein. In particular embodiments, reporter proteins of the invention may be any proteins known in the art that when expressed may be readily identified or measured. These reporter proteins may be useful in identifying or selecting cells or individuals of interest and may include for instance green fluorescent protein (GFP), luciferase, GUS, or lacZ. Cell stress tolerance proteins useful in the present application may provide tolerance to stresses including, but not limited to heat stress, drought stress, biotic stress, nutrient deficiency stress or oxidative stress. Many industrial enzymes are known in the art that may be useful in the present invention. These enzymes may include any enzyme that can provide a functional use in an industrial or commercial setting, such as amylase, protease, trypsin, pectinase, lipase, lactase, xylanase or catalase. One class of industrial enzyme may include biofuel production enzymes such as cellulase or ligninase. Cell lysis proteins are also well known in the art and include any enzyme or other protein that breaks down the structural integrity of a cell, such as lysozyme, proteinase K or lysin. There are numerous cell regulatory proteins known in the art that may be useful in the present invention, such as kinase regulatory proteins, regulators of cell metabolism, regulators of cell differentiation, or regulators of cell division or growth.
[0058] In another preferred embodiment, the target nucleic acid sequence encodes, i.e. , may be transcribed into an active RNA molecule, such as transfer or ribosomal RNA molecules, or into a regulatory RNA molecule, preferably an RNA molecule for gene suppression in the cell, such as an antisense RNA, dsRNA, shRNA, siRNA or miRNA molecule. Transcription of such molecules under control of the system of the present invention may therefore provide calciumdependent regulatory control within the host cell, for instance, via protein expression inhibition or suppression. In one aspect, the present invention further comprises a nucleic acid comprising the coding sequences of polypeptides (a)-(c) of the system of the invention. The nucleic acid is preferably DNA and may be present as one nucleic acid molecule comprising the coding sequences of all proteins of the invention comprising polypeptides (a)-(c), or it may be present as more than one nucleic acid molecule each comprising the coding sequence of a subset of the proteins comprising polypeptides (a)-(c), such that the coding sequence of each polypeptide (a)-(c) is present at least once.
[0059] Regulatory sequences to be operably linked to a nucleic acid according to the invention may include promoters, enhancers, leaders, introns, polyadenylation signals and other expression control elements. Regulatory sequences are known in the art and are available to those skilled in the art. The design of a suitable expression vector may depend on various factors including host cell to be transformed or transfected or the level of gene expression desired. Nucleic acid molecules according to the invention may therefore be introduced into a host cell via recombinant expression vector comprising such nucleic acids and suitable for the host cell. Alternatively, nucleic acids according to the invention can be operably linked to regulatory sequences, such as promoter, enhancer, leader or intron sequences, without additional vector sequences.
[0060] In a preferred embodiment, the nucleic acid of the invention comprises at least one regulatory sequence operably linked to the coding sequence of at least one of polypeptides (a)-(c), preferably at least one regulatory sequence selected from a promoter, enhancer, leader, intron or polyadenylation signal.
[0061] The present invention also comprises a vector comprising the nucleic acid of the invention, encoding polypeptides (a)-(c). Moreover, the present invention comprises a kit comprising nucleic acid molecules encoding polypeptides (a), (b) and (c) of the system of the invention.
[0062] Nucleic acids according to the invention, such as one or more nucleic acids encoding polypeptides (a)-(c), or vectors according to the invention, may be introduced into a host cell for the regulation of gene expression of such a cell in any manner known in the art, for instance, through transformation or transfection techniques known in the art. Techniques for transformation and transfection of animal, plant, fungal, insect and other cells are available to those of skill in the art and include, but are not limited to calcium phosphate co-precipitation, DEAPE-dextran-mediated transfection, lipofection, electroporation, sonoporation, microinjection, polyethylene glycol-mediated transformation, viral infection, Agrobacterium- mediated transformation, cell fusion, ballistic bombardment, and lipid nanoparticles mediated transfection. Cells comprising the nucleic acids according to the invention may be transiently or stably transformed. Such cells may therefore transiently or stably express the gene product, i.e., the system of the invention which is a calcium-responsive bipartite or tripartite split transcription factor. Suitable methods for transforming are known in the art. The nucleic acid molecules encoding polypeptides (a)-(c), which constitute the modules of bipartite or tripartite calcium-responsive split transcription factor, can be introduced into a host cell or organism linked as single molecule or as two or more separate molecules, for instance by co-transfection or co-transformation or successive transfection or transformation of one molecule and then the other.
[0063] The present invention provides a unique advantage over presently available gene expression systems. For instance, in one embodiment exchange of only one plasmid in a bipartite system, wherein the plasmid comprises the coding sequence of a fusion protein of polypeptides (b) and (c), can change the transcriptional activation system to a transcriptionally repressive system (e.g. mNFAT:P4:VP16:KR(p to mNFAT:P4:KRAB:KR(p). In another embodiment exchange of only one plasmid in a tripartite system, wherein the plasmid comprises the coding sequence of polypeptide (c) comprising a heterodimerization domain B’, can change the transcriptional activation system to a transcriptionally repressive system (e.g. P5A:VP16:KRcp to P5A:KRAB:KRcp). In yet another embodiment exchange of only one plasmid in bipartite or tripartite system, wherein the plasmid comprises the coding sequence of polypeptide (a), can change the DNA binding domain and thus the DNA recognition and / or binding site (e.g. changing the TAL sequence in TAL:P3, changing gRNA in dCas9:P3, etc.).
[0064] Preferably, the target nucleic acid sequence of the present invention is also introduced into a host cell using a technique known in the art as described above. The target nucleic acid of the invention and the nucleic acid encoding polypeptides (a)-(c) of the invention may be introduced into a host cell linked as a single molecule or as separate molecules.
[0065] In another aspect, the present invention comprises an isolated cell comprising
[0066] (I) polypeptides (a)-(c) of the system according to the invention, and / or
[0067] (II) a nucleic acid according to the invention, encoding polypeptides (a)-(c).
[0068] Preferably, the isolated cell further comprises (III) a target nucleic acid sequence operably linked to a DNA binding site, wherein the DNA binding site is recognized by the DNA binding domain of polypeptide (a). The target nucleic acid sequence (III) is preferably characterized as described above for the target nucleic acid sequence of the system of the invention. The nucleic acids (II) and preferably (III) may be transformed stably or transiently into the cell of the invention. The cell according to the present invention may be a eukaryotic cell, such as a mammalian, insect, plant, yeast or fungal cell, or a prokaryotic cell, such as a bacterial cell. The cell of the invention may be a cell suitable for producing the nucleic acid, a plasmid comprising the nucleic acid or a vector of the invention. Moreover, the cell of the invention may be a cell suitable for producing a nucleic acid, vector or plasmid comprising the target nucleic acid of the invention. In this case, in a preferred embodiment, the cell is a prokaryotic cell, such as a bacterial cell, preferably E. coli.
[0069] In a particularly preferred embodiment, the cell of the invention is a cell in which expression of a target nucleic acid sequence can be regulated with change in cytosolic calcium concentration and optionally with suitable inducers of heterodimerization of A-A’ and optionally B-B’. In this case, the cell comprises a target nucleic acid sequence (III) and is preferably a eukaryotic cell, more preferably selected from CHO cells, dhfr-cells, 293 cells, myeloma cells such as SP2 or NSO, hematopoetic stem cells, myoblasts, hepatocytes, lymphocytes, neuronal cells, skin epithelial cells, airway epithelial cells, induced pluripotent stem cells, nonhuman embryonic stem cells, non-human fertilized oocytes, plant root cells, leaf cells, flower cells, and plant seed cells.
[0070] The present invention further comprises a method of altering expression of a polynucleotide in a cell with ultrasound, comprising the following steps:
[0071] (i) providing a cell comprising the system of the invention,
[0072] (ii) optionally providing at least one chemical or non-chemical inducer suitable to induce heterodimerization of the domains A and A’, and optionally of B and B’, of the system according to any one of items 1-30, and
[0073] (iii) stimulating the cell with ultrasound.
[0074] The cell in step (i) is preferably a eukaryotic cell, more preferably corresponding to a eukaryotic cell of the invention as described above. Preferably, the cell in step (i) comprises (I) polypeptides (a)-(c) of the system of the invention and (III) a target nucleic acid sequence as described above. More preferably, the cell in step (i) further comprises (II) a nucleic acid according to the invention, encoding polypeptides (a)-(c).
[0075] The method of the invention may be applied to individual cells, cell lines, cells in culture, cells to be modified for gene therapy purposes, cells modified to create transgenic or homologous recombinant non-human organisms, cells comprised in part of a non-human organism or cells comprised in an entire non-human organism. If the system of the invention in step (i) comprises inducible heterodimerization domains, it is preferred that suitable inducers are provided in step (ii), preferably immediately before, immediately after or during ultrasound stimulation (iii).
[0076] In step (iii) of the method of the invention, the cell is preferably stimulated with ultrasound at a frequency of 0.1-50 MHz, more preferably 0.3-3 MHz. It is preferred that the ultrasound stimulation parameters are chosen such that they do not induce strong local hyperthermia in the cell but are still able to stimulate calcium influx into the cell. Ultrasound intensity is preferably chosen to be in a low-intensity regime below 1 W / cm2(spatial-peak temporal-average intensity, SPTA), more preferably < 720 mW / cm2. Preferably, temperature during ultrasound stimulation is not increased by more than 6 K, more preferably not more than 3K.
[0077] A setup and parameters for stimulation of cells with ultrasound are disclosed and discussed in a publication of the present inventors, Ivanovski et al., Nature Communications 15, 7369 (2024). Preferably, ultrasound stimulation in step (iii) of the method of the present invention is conducted with pulsed ultrasound characterized by the following parameters:
[0078] • A frequency of 0.1-50 MHz, preferably 0.3-3 MHz,
[0079] • A peak negative pressure of 0.1 - 2 MPa, preferably 1 MPa,
[0080] • A pulse repetition frequency (PRF) of 0.1 - 10 kHz, preferably 1 kHz,
[0081] • A duty cycle (DC) of 1-100%, preferably 8-32%, more preferably 10%,
[0082] • A stimulation time of 1-60 s, preferably 10 s,
[0083] • A pause of 1-400 s, preferably 110 s between stimulations, and
[0084] • A total treatment time of 5 min to 3 h, preferably 2 h.
[0085] In a preferred embodiment, cells are stimulated with ultrasound at 1MHz frequency, 1000 PRF, 10% DC, 10s stimulation time and 110s pause between stimulations, preferably for 2 h.
[0086] The inventors have surprisingly found that the system of the invention, preferably applied to cells using the method of the present invention, allows for robust control of reporter gene expression using ultrasound. Surprisingly, both a bipartite and a tripartite system used in combination with different DNA binding domains and sites yield low background expression in the absence of ultrasound stimulation and robust reporter expression after ultrasound stimulation. The system of the invention thus allows for robust gene expression regulation with ultrasound, even using ultrasound parameters that do not induce strong hyperthermia in the target cells. In addition, it is highly modular as single modules of the system can easily be exchanged, as shown by the inventors. The present invention further comprises a method of altering expression of a polynucleotide in a cell with CAR engagement, comprising the following steps:
[0087] (i) providing a cell comprising the system of the invention and expressing CAR,
[0088] (ii) optionally providing at least one chemical or non-chemical inducer suitable to induce heterodimerization of the domains A and A’, and optionally of B and B’, of the system according to any one of items 1-30, and
[0089] (iii) engaging the CAR with its corresponding antigen.
[0090] The cell in step (i) is preferably a eukaryotic cell, more preferably corresponding to a eukaryotic cell of the invention as described above. Preferably, the cell in step (i) comprises (I) polypeptides (a)-(c) of the system of the invention and (III) a target nucleic acid sequence as described above. More preferably, the cell in step (i) further comprises (II) a nucleic acid according to the invention, encoding polypeptides (a)-(c).
[0091] The method of the invention may be applied to individual cells, cell lines, cells in culture, cells to be modified for gene therapy purposes, cells modified to create transgenic or homologous recombinant non-human organisms, cells comprised in part of a non-human organism or cells comprised in an entire non-human organism.
[0092] If the system of the invention in step (i) comprises inducible heterodimerization domains, it is preferred that suitable inducers are provided in step (ii), preferably immediately before, immediately after or during CAR engagement (iii).
[0093] In step (iii) of the method of the invention, the cell is preferably stimulated with antigen that binds to the expressed CAR.
[0094] The inventors have surprisingly found that the system of the invention, preferably applied to cells using the method of the present invention, allows for robust control of reporter gene expression upon CAR engagement. Surprisingly, a bipartite system based on TAL DNA binding module yield low background expression in the absence of antigen and robust reporter expression after engagement with the antigen. The system of the invention thus allows for robust gene expression regulation upon CAR target engagement. In addition, it is highly modular as single modules of the system can easily be exchanged, as shown by the inventors.
[0095] Without wishing to be bound by a theory, it is assumed that CAR engagement and ultrasound stimulation causes a rise in cytosolic Ca2+levels, for example ultrasound through activation of mechanosensitive ion channels and CAR engagement through downstream signaling pathway. Rising Ca2+levels may lead to an activation of the modified NFAT protein of polypeptide (b), which causes the protein or heterodimer comprising polypeptides (b) and (c) to translocate into the nucleus and form a functional transcription factor with polypeptide (a) through heterodimerization of A-A’. Thus, the desired transcriptional regulation of the target nucleic acid is induced by increased cytosolic calcium concentration, optionally with addition of heterodimerization inducers if any of the heterodimerization systems is inducible.
[0096] The effect of ultrasound stimulation or CAR engagement is preferably measurable during ultrasound treatment or CAR engagement time or up to 24 h after, in certain cases up to 48 h, depending on the components of the split transcription factor system, the target nucleic acid sequence and the transcription and potentially translation product of the target nucleic acid sequence. In one embodiment, the method of the present invention further comprises ceasing ultrasound stimulation or CAR engagement, whereby target sequence expression reverts to baseline, preferably starting from around 24 h after cessation of stimulation.
[0097] The system, method, and / or nucleic acids of the present invention may be useful in any instance where it is desirable to control gene expression in a targeted, rapid and reversible manner without undesirable pleiotropic effects or cytotoxicity. In a certain embodiment, the invention may be useful, for instance, for developmental studies, in which gene expression is only desired or necessary during a particular stage of development; treatment of diseases via gene therapy, where localized expression is particularly desirable; removal or reduction of undesirable gene products in a conditional manner via antisense or ribozyme molecules, for instance to alter biochemical pathways; large scale production of a protein of interest when desired; production of transgenic plants or animals without expression of the target transcribable polynucleotide effecting proper development, or to target particular tissues within such transgenic organisms.
[0098] Thus, in a further aspect, the present invention comprises use of the system for calcium-dependent modular gene expression regulation of the invention for targeted gene therapy and / or for targeted treatment of diseases with therapeutic cells, such as CAR-T cells.
[0099] In a further aspect, the present invention comprises use of the system for calciumdependent modular gene expression regulation of the invention for regulation of industrial enzyme production, regulation of biofuel enzyme expression, stress tolerance enhancement in cells, alteration of biochemical pathways in cells and / or cell lysis control.
[0100] In a further aspect, the present invention comprises use of the system for calciumdependent modular gene expression regulation of the invention for regulating expression of at least one target gene in a non-human transgenic organism. BRIEF DESCRIPTION OF THE DRAWINGS
[0101] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
[0102] FIG. 1 : A schematic diagram of action of (A) bipartite and (B) tripartite engineered split transcription factor, change in cytosolic calcium concentration regulates transcription of gene of interest (GOI). A) Increase in cytosolic calcium concentration influences the reconstitution of bipartite split transcription factor by promoting the translocation of regulatory module to nucleus and heterodimerization of protein partners of HD system thus inducing transcriptional activation if the regulatory module is fused with activation domain (e.g. VP16) or transcriptional repression if regulatory module is fused with repression domain (e.g. KRAB). B) Increase in cytosolic calcium concentration influences the reconstitution of tripartite split transcription factor by promoting the translocation of heterodimerized regulatory module and control module to nucleus and heterodimerization with DNA binding module thus inducing transcriptional activation if the control module is fused with activation domain (e.g. VP16) or transcriptional repression if control module is fused with repression domain (e.g. KRAB). C) Ultrasound influences permeability of mechanosensitive ion channels and triggers increase in cytosolic calcium concentration which in turn influences the reconstitution of bipartite split transcription factor by promoting the translocation of regulatory module to nucleus and heterodimerization of protein partners of HD system thus inducing transcriptional activation if the regulatory module is fused with activation domain (e.g. VP16) or transcriptional repression if regulatory module is fused with repression domain (e.g. KRAB). D) Ultrasound influences permeability of mechanosensitive ion channels and triggers increase in cytosolic calcium concentration which in turn influences the reconstitution of tripartite split transcription factor by promoting the translocation of heterodimerized regulatory module and control module to nucleus and heterodimerization with DNA binding module thus inducing transcriptional activation if the control module is fused with activation domain (e.g. VP16) or transcriptional repression if control module is fused with repression domain (e.g. KRAB). E) CAR engagement triggers increase in cytosolic calcium concentration which in turn influences the reconstitution of bipartite split transcription factor by promoting the translocation of regulatory module to nucleus and heterodimerization of protein partners of HD system thus inducing transcriptional activation if the regulatory module is fused with activation domain (e.g. VP16) or transcriptional repression if regulatory module is fused with repression domain (e.g. KRAB).
[0103] FIG. 2: Activation of bipartite and tripartite transcription factor based on TAL DNA binding module. A) a schematic presentation of constructs forming a bipartite split transcription factor used in this experiment. B) a schematic presentation of constructs forming a tripartite split transcription factor used in this experiment. C) a schematic presentation of luciferase reporter with ten TAL binding sites. D, E) With ionophore A23187 stimulation reconstitution of functional (D) bipartite and (E) tripartite transcription factor occurs, thus resulting in an activation of luciferase reporter. RLU = relative luciferase units, ns = not stimulated, ion = ionophore A23187 stimulated.
[0104] FIG. 3: Activation of bipartite and tripartite transcription factor based on dCas9 / sgRNA DNA binding module. A) a schematic presentation of constructs forming a bipartite split transcription factor used in this experiment. B) a schematic presentation of constructs forming a tripartite split transcription factor used in this experiment. C) a schematic presentation of luciferase reporter with one dCas9 / sgRNA complex binding site. D, E) With ionophore A23187 stimulation reconstitution of functional (D) bipartite and (E) tripartite transcription factor occurs thus resulting in an activation of luciferase reporter. RLU = relative luciferase units, ns = not stimulated, ion = ionophore A23187 stimulated.
[0105] FIG. 4: Activation of bipartite and tripartite transcription factor based on modified mammalian DNA binding protein IRF7. A) a schematic presentation of constructs forming a bipartite split transcription factor used in this experiment. B) a schematic presentation of constructs forming a tripartite split transcription factor used in this experiment. C) a schematic presentation of luciferase reporter with multiple IRF binding sites. D, E) With ionophore A23187 stimulation reconstitution of functional (D) bipartite and (E) tripartite transcription factor occurs thus resulting in an activation of luciferase reporter. RLU = relative luciferase units, ns = not stimulated, ion = ionophore A23187 stimulated.
[0106] FIG. 5: Activation of bipartite transcription factor based on modified mammalian DNA binding protein FOXO1. A) a schematic presentation of constructs forming a bipartite split transcription factor used in this experiment. B) a schematic presentation of luciferase reporter with three FOXO1 binding sites. C) With ionophore A23187 stimulation reconstitution of functional transcription factor occurs thus resulting in an activation of luciferase reporter. RLU = relative luciferase units, ns = not stimulated, ion = ionophore A23187 stimulated.
[0107] FIG. 6: Activation of bipartite transcription factor based on modified mammalian DNA binding protein RUNX1. A) a schematic presentation of constructs forming a bipartite split transcription factor used in this experiment. B) a schematic presentation of luciferase reporter with four RUNX1 binding sites. C) With ionophore A23187 stimulation reconstitution of functional transcription factor occurs thus resulting in an activation of luciferase reporter. RLU = relative luciferase units, ns = not stimulated, ion = ionophore A23187 stimulated. FIG. 7: Activation of bipartite transcription factor based on modified mammalian DNA binding protein TCF1. A) a schematic presentation of constructs forming a bipartite split transcription factor used in this experiment. B) a schematic presentation of luciferase reporter with three TCF1 binding sites. C) With ionophore A23187 stimulation reconstitution of functional transcription factor occurs thus resulting in an activation of luciferase reporter. RLU = relative luciferase units, ns = not stimulated, ion = ionophore A23187 stimulated.
[0108] FIG. 8: Ultrasound activation of bipartite and tripartite transcription factor based on TAL DNA binding module. A) a schematic presentation of constructs forming a bipartite split transcription factor used in this experiment. B) a schematic presentation of constructs forming a tripartite split transcription factor used in this experiment. C) a schematic presentation of luciferase reporter with ten TAL binding sites. D) With ultrasound stimulation reconstitution of functional transcription factor occurs, thus resulting in an activation of luciferase reporter. nRLU = normalized relative luciferase units, ns = not stimulated, US = ultrasound stimulated.
[0109] FIG. 9: Ultrasound activation of bipartite and tripartite transcription factor based on dCas9 / sgRNA DNA binding module. A) a schematic presentation of constructs forming a bipartite split transcription factor used in this experiment. B) a schematic presentation of constructs forming a tripartite split transcription factor used in this experiment. C) a schematic presentation of luciferase reporter with one dCas9 / sgRNA complex binding site. D) With ultrasound stimulation reconstitution of functional transcription factor occurs thus resulting in an activation of luciferase reporter. nRLU = normalized relative luciferase units, ns = not stimulated, US = ultrasound stimulated.
[0110] FIG. 10: Ultrasound activation of bipartite and tripartite transcription factor based on modified IRF7 DNA binding module. A) a schematic presentation of constructs forming a bipartite split transcription factor used in this experiment. B) a schematic presentation of constructs forming a tripartite split transcription factor used in this experiment. C) a schematic presentation of luciferase reporter with multiple IRF binding sites. D) With ultrasound stimulation reconstitution of functional transcription factor occurs, thus resulting in an activation of luciferase reporter. nRLU = normalized relative luciferase units, ns = not stimulated, US = ultrasound stimulated.
[0111] FIG. 11 : Activation of bipartite transcription factor based on TAL DNA binding module, due to CAR engagement. A) a schematic presentation of constructs forming a bipartite split transcription factor used in this experiment. B) a schematic presentation of luciferase reporter with ten TAL binding sites. C) With CAR engagement reconstitution of functional transcription factor occurs, thus resulting in an activation of luciferase reporter. RLU = relative luciferase units, ns = not stimulated, Raji Her2 = co-culture with Her2-positive Raji cells. Examples
[0112] The examples described in more detail below are designed to best describe the invention. These examples do not limit the scope of the invention but are merely intended to provide a better understanding of the invention and its use.
[0113] Implementation examples:
[0114] Example 1 : Preparation of cells, which feature a signaling pathway mediated by engineered calcium -regulated NFAT based split transcription factor
[0115] Preparation of DNA coding for engineered NFAT transcription factors and theirtargets. In order to prepare DNA constructs, the inventors used molecular biology methods such as: chemical transformation of competent E. coli cells, plasmid DNA isolation, polymerase chain reaction (PCR), reverse transcription - PCR, PCR linking, nucleic acid concentration determination, DNA agarose gel electrophoresis, isolation of fragments of DNA from agarose gels, chemical synthesis of DNA, DNA restriction with restriction enzymes, cutting of plasmid vectors, ligation of DNA fragments, purification of plasmid DNA in large quantities. The exact course of experimental techniques and methods are well known to experts in the field and are described in the manuals of molecular biology.
[0116] All the work was performed using sterile techniques, which are also well known to the experts in the field. All plasmids, completed constructs and partial constructs were transformed into the bacteria Escherichia coli by chemical transformation. Plasmids for transfection into cell lines (animal or human) have been isolated using a DNA isolation kit that removes endotoxins.
[0117] In the described cases, plasmids that encode polypeptides (a), (b) and (c) of the invention, in the form of bipartite or tripartite split transcription factor as described above were used.
[0118] For (a), the C-terminus of the DNA binding domain was fused with 2 or 10 concatenated peptides (P3) from peptide pair (P3-P4). The peptides were connected via 8 amino acid long GS linker. For the DNA binding domain TALE domain, catalytically inactive Cas9 and sgRNA complex (dCas9 / sgRNA) or modified mammalian DNA binding protein was used. Polypeptide (a), which is a DNA binding module, also comprises of His-tag or Flag-tag on the C-terminus of the DNA binding domain and at least one NLS signal.
[0119] For (b), human NFAT2 (hNFAT2) was selected from the NFAT family of transcription factors. Truncated form of hNFAT2 was prepared by removing hNFAT2 transactivation domain and DNA binding domain. The C- terminus of the modified NFAT was connected via GS peptide linker with a length of 10 amino acids with one peptide (P4) from peptide pair (P3-P4) that forms coiled-coils. Fused to the N-terminus of the modified NFAT is a Myc-tag to allow detection. For (c), the C-terminus of the transcriptional activation domain VP16 was connected via GS peptide linker with a length of 10 amino acids with a membrane anchoring peptide KRcp.
[0120] The polypeptide (a) is one protein and the polypeptides of (b) and (c) are present as one fusion protein linked via GS peptide linker with a length of 10 amino acids or as two proteins, in which case the polypeptide of (b) is further connected via 10 amino acid GS linker with one peptide (P6A) from peptide pair (P5A-P6A) and the polypeptide of (c) further comprises of peptide (P5A) from peptide pair (P5A-P6A) connected via 10 amino acid GS linker with the N-terminus of the transactivation domain VP16.
[0121] Peptide pair P3-P4 is orthogonal to peptide pair P5A-P6A. The sequences and description of preferred embodiments of polypeptide (a) (DNA binding module), polypeptide (b) (control module), polypeptide (c) (regulatory module) or a fusion protein of (b) and (c) according to the invention are listed in Table 1. All operons were prepared by techniques according to methods known to experts in the field. The operons were inserted into plasmids suitable for eukaryotic systems. The suitability of the nucleotide sequence was confirmed by the inventors by sequencing and restriction analysis.
[0122] Table 1 : Fusion proteins of components of artificial engineered split transcription factors to illustrate the invention.
[0123] Methods and techniques of cultivating cell cultures are well known to experts in the field and are therefore briefly described in order to illustrate the implemented examples. Cells from the HEK293 cell line were grown at 37 °C and 5% CO2. For cultivation, a DMEM medium containing 10% FBS was used, containing all the necessary nutrients and growth factors. Jurkat cells were grown in RPMI medium containing 10% FBS at 370C and 5% CO2. When the cell culture reached the appropriate density, the cells were grafted into a new breeding flask and I or diluted. For the use of HEK293 cells in experiments, the number of cells was determined by a hemocytometer and seeded in density of 6x105cells per hole into the 35mm glass bottom petri dish 18-24 hours before transfection. The seeded dishes were incubated at 37 °C and 5% CO2 until the cells were 50-70% confluent and ready for transfection by transfection reagent. The transfection was carried out according to the instructions of the transfection reagent manufacturer (e.g., JetPei, Lipofectamine 2000) and was adapted for the petri dish used. On the next day the cells were stimulated with ionophore A23187 (2.5 pM) or ultrasound, using the preferred parameters described above. For the use of Jurkat cells in experiments, the number of cells was determined by a hemocytometer and 3x106cells were electroporated with the plasmids using a Neon electroporation system in 100 pl electroporation tips. Afterwards the cells were kept in a 35mm glass bottom petri dish, with RPMI medium, supplemented with 10% FBS. Next day the cells were co-cultured as explained below.
[0124] Example 2. Activity of engineered NFAT split transcription factors in model mammalian cells at stimulation with calcium ionophore A23187
[0125] To detect the activity of engineered NFAT transcription factor, firefly (Flue) luciferase reporter was used. Firefly, used as a reporter protein, was placed downstream of an I FN-p promoter (containing multiple IRF binding DNA consensus sequences (aanngaaa)) or downstream of ten consecutive identical TALE binding DNA sequences {tttactgctgctcccgct), or a single sgRNA binding DNA sequence (ccctgaagttcatctgcaccaccggcaagctgcccgtgccctgg), or three consecutive identical insulin response element (IRE) binding DNA sequences (caaaacaaacttattttgaa), or four consecutive identical Runxl binding DNA sequences (tgtggttaaccaca), or six consecutive identical TCF1 binding DNA sequences (gggagactgagaacaaagcgctctcacac), followed by a minimal promoter with a DNA sequence tagagggtatataatggaagctcgacttccag. HEK293 cells, seeded in 96-well plate, were transfected one day prior to the experiment with plasmids, which encode for bipartite split transcription factor (plasmids that encode polypeptides (a)-(c) of the invention, in the form of a bipartite split transcription factor as described above); plasmids that encode previously described luciferase as a reporter protein and plasmid that encodes for luciferase from organism Renilla reniformis Rluc (GenBank AF362545.1). Cells were stimulated on the next day with 2.5 pM ionophore A23187 for six hours, which increases the cytosolic concentration of calcium.
[0126] To analyze the activity of reporter proteins, cells were lysed with appropriate buffer according to instructions provided by the manufacturers (Promega). Next, the activity of Flue and Rluc respectively was measured. Rluc is expressed independently of all other components in the system and therefore provides the information of fraction of transfected cells. Flue represents activity of induced transcription of Flue, which depends on binding of the reconstituted split TF to the respective DNA binding sites in front of the minimal promoter or in front of the IFN-p promoter. The ratio Fluc / Rluc (RLU - relative luciferase units) therefore indicates the normalized value of stimulated cells with respect to transfected cells.
[0127] Results:
[0128] The constructs and results of the experiment are shown in Fig. 2-7 for bipartite and tripartite split transcription factors using different DNA binding domains in polypeptide (a).
[0129] It is clear from Figure 2D, 3D, 4D, 50, 60 and 70 that stimulation with ionophore A23187 influences the reconstitution of engineered NFAT transcription factor by promoting the translocation of regulatory module comprising polypeptides (b) and (c) to the nucleus and heterodimerization of coiled-coil protein partners of HD system thus inducing high transcriptional activation. The assembly of two modules of bipartite split TF leads to a reconstitution of a functional engineered split transcription factor. Functional TF bound to the respective DNA binding site, e.g. the TAL DNA binding site in the case of the experiment of figure 2D, the dCas9 / sgRNA binding site in the case of the experiment of figure 3D, the IRF binding site in the case of the experiment of figure 4D, the IRE DNA binding site in the case of the experiment of figure 50, the Runxl DNA binding site in the case of the experiment of figure 60, and the TCF1 binding site in the case of the experiment of figure 70, enhances the transcription of Flue. This action takes place only in the presence of ionophore A23187 that increases the intracellular calcium concentration which is needed for translocation of regulatory module. The presence of only one module, e.g. the DNA binding module (a), did not enhance reporter protein expression and production.
[0130] Same observation can be seen on figures 2E, 3E and 4E for tripartite TF. The assembly of all three modules after ionophore A23187 stimulation leads to a reconstitution of a functional engineered split TF. The functional TF bound to its respective DNA binding site enhances the transcription of Flue.
[0131] Example 3. Activity of engineered NFAT split transcription factors in model mammalian cells at stimulation with ultrasound
[0132] To detect the activity of engineered NFAT transcription factor, firefly (Flue) luciferase reporter was used. Firefly, used as a reporter protein, was placed downstream of an IFN-p promoter (containing multiple IRF binding DNA consensus sequences (aanngaaa)) or downstream of ten consecutive identical TALE binding DNA sequences {tttactgctgctcccgct) , or a single sgRNA binding DNA sequence (ccctgaagttcatctgcaccaccggcaagctgcccgtgccctgg), followed by a minimal promoter with a DNA sequence tagagggtatataatggaagctcgacttccag.
[0133] HEK293 cells, seeded in 35mm petri dishes, were transfected one day prior to the experiment with plasmids, which encode for bipartite or tripartite split transcription factor (plasmids that encode polypeptides (a)-(c) of the invention, in the form of a bipartite or tripartite split transcription factor as described above); plasmids that encode previously described luciferase as a reporter protein and plasmid that encodes for luciferase from organism Renilla reniformis Rluc (GenBank AF362545.1). Cells were stimulated on the next day with ultrasound using the preferred parameters described above.
[0134] To analyze the activity of reporter proteins, cells were lysed with appropriate buffer according to instructions provided by the manufacturers (Promega). Next, the activity of Flue and Rluc respectively was measured. Rluc is expressed independently of all other components in the system and therefore provides the information of fraction of transfected cells. Flue represents activity of induced transcription of Flue, which depends on binding of the reconstituted split TF to the respective DNA binding sites in front of the minimal promoter or in front of the IFN-p promoter. The ratio Fluc / Rluc (RLU - relative luciferase units) therefore indicates the normalized value of stimulated cells with respect to transfected cells. Normalized RLU (nRLU) values were calculated by normalizing the RLU values of each sample to the average RLU value of the nonstimulated cells within the same experiment.
[0135] Results:
[0136] The constructs and results of the experiment are shown in Fig. 8 for bipartite and tripartite split transcription factors using a TAL DNA binding domain in polypeptide (a), in Fig. 9 for bipartite and tripartite split transcription factors using a dCas9 / sgRNA DNA binding domain in polypeptide (a), and in Fig. 10 for bipartite and tripartite split transcription factors using a modified IRF7 DNA binding domain in polypeptide (a).
[0137] It is clear from Figure 8D that stimulation with ultrasound influences the reconstitution of engineered NFAT transcription factor by promoting the translocation of regulatory module comprising polypeptides (b) and (c) to the nucleus and heterodimerization of coiled-coil protein partners of HD system thus inducing high transcriptional activation. The assembly of two modules of bipartite split TF leads to a reconstitution of a functional engineered split transcription factor. Functional TF bound to the respective DNA binding site, e.g. the TAL DNA binding site in the case of the experiment of figures 8A-D, the dCas9 / sgRNA binding site in the case of the experiment of figure 9A-D, and the IRF binding site in the case of the experiment of figure 10A-D, enhances the transcription of Flue. This action takes place only in the presence of ultrasound stimulation that increases the intracellular calcium which is needed for translocation of regulatory module.
[0138] Same observation can be seen on Figure 8D, 9D and 10D for tripartite TF. The assembly of all three modules after ultrasound stimulation leads to a reconstitution of a functional engineered split TF. The functional TF bound to its respective DNA binding site enhances the transcription of Flue.
[0139] Example 4. Activity of engineered NFAT split transcription factor in model mammalian cells expressing HER2-specific CAR through CAR engagement.
[0140] To detect the activity of engineered NFAT transcription factor, firefly (Flue) luciferase reporter was used. Firefly, used as a reporter protein, was placed downstream of ten consecutive identical TALE binding DNA sequences {tttactgctgctcccgct) followed by a minimal promoter with a DNA sequence tagagggtatataatggaagctcgacttccag.
[0141] Jurkat cells (3x106) were electroporated with the plasmids, which encode for bipartite split transcription factor (plasmids that encode polypeptides (a)-(c) of the invention, in the form of a bipartite split transcription factor as described above); plasmid that encodes previously described luciferase as a reporter protein; plasmid that encodes for luciferase from organism Renilla reniformis Rluc (GenBank AF362545.1) and plasmid that encodes HER2-specific 2. generation CAR. Cells were electroporated using a Neon electroporation system in 100 pl electroporation tips. Afterwards the cells were kept in a 24-well plate, with RPMI medium, supplemented with 10% FBS. Next day the cells were co-cultured with Raji cells stably expressing HER2 antigen.
[0142] To analyze the activity of reporter proteins, cells were lysed twenty-four hours after coculture with appropriate buffer according to instructions provided by the manufacturers (Promega). Next, the activity of Flue and Rluc respectively was measured. Rluc is expressed independently of all other components in the system and therefore provides the information of fraction of transfected cells. Flue represents activity of induced transcription of Flue, which depends on binding of the reconstituted split TF to the respective DNA binding sites in front of the minimal promoter. The ratio Fluc / Rluc (RLU - relative luciferase units) therefore indicates the normalized value of stimulated cells with respect to transfected cells. Results:
[0143] The constructs and results of the experiment are shown in Fig. 11 for bipartite split transcription factors using a TAL DNA binding domain in polypeptide (a). It is clear from Figure 11C that engagement of HER2-specific CAR receptor with HER2 antigen, influences the reconstitution of engineered NFAT transcription factor by promoting the translocation of regulatory module comprising polypeptides (b) and (c) to the nucleus and heterodimerization of coiled-coil protein partners of HD system thus inducing high transcriptional activation. The assembly of two modules of bipartite split TF leads to a reconstitution of a functional engineered split transcription factor. Functional TF bound to the respective DNA binding site, e.g. the TAL DNA binding site in the case of the experiment of figures 11A-C, enhances the transcription of Flue. This action takes place only in the presence of HER2 antigen (e.g. co-culture with Raji cells stably expressing HER2 antigen) that engages HER2-specific CAR that increases the intracellular calcium concentration which is needed for translocation of regulatory module. The absence of HER2-specific CAR in cells expressing all modules of bipartite transcription factor did not enhance reporter protein expression and production.
[0144] The present invention is summarized by the following items:
[0145] 1. A system for calcium-dependent modular gene expression regulation, comprising:
[0146] (a) a polypeptide comprising a DNA binding domain and at least one heterodimerization domain A,
[0147] (b) a polypeptide comprising a Ca2+-responsive modified NFAT protein lacking an active DNA binding domain, and comprising at least one heterodimerization domain A, suitable to dimerize with heterodimerization domain A, and
[0148] (c) a polypeptide comprising a domain for transcriptional regulation, wherein the polypeptide of (a) is one protein and the polypeptides of (b) and (c) are present as one fusion protein or as two proteins, in which case the polypeptide of (b) further comprises at least one heterodimerization domain B and the polypeptide of (c) further comprises at least one heterodimerization domain B’ suitable to dimerize with heterodimerization domain B, with B and B’ being orthogonal to A and A’.
[0149] 2. The system according to item 1 , wherein the polypeptide (c) further comprises a membrane anchoring peptide, preferably a KRcp peptide.
[0150] 3. The system according to item 2, wherein the membrane anchoring peptide is located at the C terminus of the polypeptide of (c).
[0151] 4. The system according to any one of the preceding items, wherein one or both of the heterodimerization domains A and A are present in the respective polypeptides in more than one repeat, preferably 2-15 repeats, more preferably 8-12 repeats.
[0152] 5. The system according to any one of the preceding items, wherein the polypeptides of (b) and (c) are present as two proteins and one or both of the heterodimerization domains B and B’ are present in more than one repeat, preferably 2-15 repeats, more preferably 8-12 repeats.
[0153] 6. The system according to any one of the preceding items, wherein adjacent domains within one protein are connected directly or through an amino acid linker, preferably through a glycine-serine peptide linker.
[0154] 7. The system according to any one of the preceding items, wherein each pair of adjacent domains within one protein is connected through an amino acid linker, preferably through a glycine-serine peptide linker.
[0155] 8. The system according to any one of items 6-7, wherein each amino acid linker independently has a length of 4-20 amino acids, preferably of 8-10 amino acids.
[0156] 9. The system according to any one of the preceding items, wherein the modified NFAT protein is an NFAT protein lacking an active DNA binding domain, wherein the NFAT protein is selected from any endogenous or exogenous member of the NFAT protein family responsive to calcium signaling, preferably selected from NFATc1-c4, more preferably selected from mammalian NFATc1-c4, most preferably selected from human or mouse NFATc1-c4. The system according to any one of the preceding items, wherein the modified NFAT protein is an NFAT protein truncated of its transactivation domain and DNA binding domain. The system according to any one of the preceding items, wherein the modified NFAT protein is an NFAT protein with an inactivated DNA binding domain. The system according to any one of the preceding items, wherein the polypeptide of (b) comprises a protein selected from a transcription factor, transcriptional activator, transcriptional enhancer or transcriptional repressor, wherein the protein comprises a domain for transcriptional regulation. The system according to any one of the preceding items, wherein the domain for transcriptional regulation is selected from a transcriptional activation domain, transcriptional enhancer domain or transcriptional repressor domain. The system according to any one of the preceding items, wherein the domain for transcriptional regulation is a transcriptional activation domain, preferably selected from acidic transcriptional activation domains, such as VP16 or VP64, VPR, proline-rich transcriptional activation domains, glutamine-rich transcriptional activation domains, NF-KB subunit p65, or Rta activator, more preferably VP16, VP64 or VPR. The system according to any one of the preceding items, wherein the domain for transcriptional regulation is a transcriptional repressor domain, preferably a KRAB domain, MBD repression domain, SNAG domain, a chromoshadow domain, a SID domain, or EAR-repression domain (SRDX). The system according to any one of the preceding items, wherein heterodimerization of A and A’ and / or optionally of B and B’ is non-inducible. The system according to item 16, wherein the heterodimerization domains are peptides of coiled-coil forming peptide pairs, preferably selected from P3-P4, N5-N6 and P3S- P4S. The system according to any one of the preceding items, wherein heterodimerization of A and A’ and / or optionally of B and B’ is chemically or non-chemically inducible. The system according to any one of the preceding items, wherein heterodimerization of A and A and / or optionally of B and B’ is chemically inducible with at least one compound selected from abscisic acid, rapalog, rapamycin and gibberellin. The system according to any one of the preceding items, wherein heterodimerization of A and A and / or optionally of B and B’ is inducible with light of a defined wavelength range, preferentially with light having a wavelength of 400-500 nm, preferably around 450 nm, or 620-700 nm, preferably around 650 nm. The system according to any one of the preceding items, wherein the DNA binding domain of (a) recognizes and / or binds to double-stranded DNA. The system according to any one of the preceding items, wherein the DNA binding domain of (a) recognizes and / or binds to single-stranded DNA. The system according to any one of the preceding items, wherein the DNA binding domain of (a) is selected from a helix-turn-helix domain, helix-loop-helix domain, zinc finger domain, leucine zipper domain, high mobility group box domain, PAM-interacting domain, TALE domain, catalytically inactive Cas9, a DNA binding domain of interferon regulatory factor (IRF) or IRF with mutated localization signals. The system according to any one of the preceding items, wherein the DNA binding domain of (a) recognizes a DNA binding site, preferably a specific nucleic acid sequence. The system according to any one of the preceding items, for expression regulation of a target nucleic acid sequence, wherein the target nucleic acid sequence is a transcribable polynucleotide operably linked to a DNA binding site which is recognized by the DNA binding domain of (a). The system according to item 25, wherein the target nucleic acid sequence is an exogenous or heterologous nucleic acid sequence. The system according to item 25, wherein the target nucleic acid sequence is an endogenous nucleic acid sequence. The system according to item 25, wherein the DNA binding site operably linked to the endogenous target nucleic acid sequence is an exogenous DNA binding site. The system according to any one of items 25-28, wherein the target nucleic acid sequence encodes a protein, such as a reporter protein, a cell stress tolerance protein, an industrial enzyme, a biofuel production enzyme, a cell lysis protein or a cell regulatory protein. The system according to any one of items 25-28, wherein the target nucleic acid sequence encodes an active RNA molecule, such as a tRNA, rRNA or regulatory RNA, preferably a regulatory RNA selected from antisense RNA, dsRNA, shRNA, siRNA or miRNA. A nucleic acid comprising the coding sequences of polypeptides (a)-(c) of the system according to any one of the preceding items. The nucleic acid according to item 31 , wherein the nucleic acid is present as one nucleic acid molecule comprising the coding sequences of all polypeptides (a)-(c), or as 2-3 nucleic acid molecules each comprising the coding sequence of one protein comprising polypeptide (a), (b), (c) or (b) and (c). The nucleic acid according to any one of items 31-32, comprising at least one regulatory sequence operably linked to the coding sequence of at least one of polypeptides (a)-(c), preferably at least one regulatory sequence selected from a promoter, enhancer, leader, intron or polyadenylation signal. A vector comprising the nucleic acid according to any one of items 31-33. A kit comprising 1-3 nucleic acid molecules encoding polypeptides (a), (b) and (c) of the system according to any one of items 1-30. An isolated cell comprising
[0157] (I) polypeptides (a)-(c) of the system according to any one of items 1-30, and / or
[0158] (II) a nucleic acid according any one of items 31-33 encoding polypeptides (a)-(c). The cell according to item 36, further comprising (III) a target nucleic acid sequence operably linked to a DNA binding site, wherein the DNA binding site is recognized by the DNA binding domain of polypeptide (a). The cell according to any one of items 36-37, which is a eukaryotic cell, such as a mammalian, insect, plant, yeast or fungal cell, or a prokaryotic cell, such as a bacterial cell. The cell according to any one of items 36-38, which is a eukaryotic cell, preferably selected from CHO cells, dhfr-cells, 293 cells, myeloma cells such as SP2 or NSO, hematopoetic stem cells, myoblasts, hepatocytes, lymphocytes, neuronal cells, skin epithelial cells, airway epithelial cells, induced pluripotent stem cells, non-human embryonic stem cells, non-human fertilized oocytes, plant root cells, leaf cells, flower cells, and plant seed cells. A method of altering expression of a polynucleotide in a cell with ultrasound, comprising the following steps:
[0159] (i) providing a cell comprising the system according to any one of items 1-30,
[0160] (ii) optionally providing at least one chemical or non-chemical inducer suitable to induce heterodimerization of the domains A and A, and optionally of B and B’, of the system according to any one of items 1-30, and
[0161] (iii) stimulating the cell with ultrasound. The method according to item 40, wherein the cell is a eukaryotic cell, such as a mammalian, insect, plant, yeast or fungal cell, preferably a mammalian or plant cell, more preferably selected from CHO cells, dhfr-cells, 293 cells, myeloma cells such as SP2 or NSO, hematopoetic stem cells, myoblasts, hepatocytes, lymphocytes, neuronal cells, skin epithelial cells, airway epithelial cells, induced pluripotent stem cells, non- human embryonic stem cells, non-human fertilized oocytes, plant root cells, leaf cells, flower cells, and plant seed cells. The method according to any one of items 40-41 , wherein the cell is stimulated with ultrasound at a frequency of 0.1 - 50 MHz, preferably 0.3 - 3 MHz. The method according to any one of items 40-42, wherein the cell is stimulated for a certain time, preferably 15 min to 180 min, more preferably for 120 min. The method according to any one of items 40-43, further comprising (iv) ceasing ultrasound stimulation. A method of altering expression of a polynucleotide in a cell with CAR engagement, comprising the following steps:
[0162] (i) providing a cell comprising the system of the invention and expressing CAR,
[0163] (ii) optionally providing at least one chemical or non-chemical inducer suitable to induce heterodimerization of the domains A and A’, and optionally of B and B’, of the system according to any one of items 1-30, and
[0164] (iii) engaging the CAR with its corresponding antigen. The method according to item 45, wherein in step (iii) the cell is stimulated with antigen that binds to the expressed CAR. Use of a system according to any one of items 1-30 for targeted gene therapy and / or for targeted treatment of diseases with therapeutic cells, such as CAR-T cells. Use of a system according to any one of items 1-30 for regulation of industrial enzyme production, regulation of biofuel enzyme expression, stress tolerance enhancement in cells, alteration of biochemical pathways in cells and / or cell lysis control. Use of a system according to any one of items 1-30 for regulating expression of at least one target gene in a non-human transgenic organism.
Claims
Claims1. A system for calcium-dependent modular gene expression regulation, comprising:(a) a polypeptide comprising a DNA binding domain and at least one heterodimerization domain A,(b) a polypeptide comprising a Ca2+-responsive modified NFAT protein lacking an active DNA binding domain, and comprising at least one heterodimerization domain A, suitable to dimerize with heterodimerization domain A, and(c) a polypeptide comprising a domain for transcriptional regulation, wherein the polypeptide of (a) is one protein and the polypeptides of (b) and (c) are present as one fusion protein or as two proteins, in which case the polypeptide of (b) further comprises at least one heterodimerization domain B and the polypeptide of (c) further comprises at least one heterodimerization domain B’ suitable to dimerize with heterodimerization domain B, with B and B’ being orthogonal to A and A’.
2. The system according to claim 1 , wherein the polypeptide (c) further comprises a membrane anchoring peptide, preferably a KRcp peptide.
3. The system according to any one of the preceding claims, wherein one or both of the heterodimerization domains A and A, and optionally one or both of the heterodimerization domains B and B’, are present in the respective polypeptides in more than one repeat, preferably 2-15 repeats, more preferably 8-12 repeats.
4. The system according to any one of the preceding claims, wherein adjacent domains within one protein are connected directly or through an amino acid linker, preferably through a glycine-serine peptide linker, wherein the length of the amino acid linker is preferably 4-20 amino acids.
5. The system according to any one of the preceding claims, wherein the modified NFAT protein is an NFAT protein with an inactivated DNA binding domain or truncated of its transactivation domain and DNA binding domain, wherein the NFAT protein is selected from any endogenous or exogenous member of the NFAT protein family responsive to calcium signaling, preferably selected from NFATc1-c4, more preferably selected from mammalian NFATc1-c4, most preferably selected from human or mouse NFATc1-c4.
376. The system according to any one of the preceding claims, wherein the domain for transcriptional regulation is selected from a transcriptional activation domain, transcriptional enhancer domain or transcriptional repressor domain.
7. The system according to any one of the preceding claims, wherein heterodimerization of A and A’ and / or optionally of B and B’ is non-inducible, and wherein the heterodimerization domains are preferentially peptides of coiled-coil forming peptide pairs.
8. The system according to any one of the preceding claims, wherein heterodimerization of A and A’ and / or optionally of B and B’ is chemically or non-chemically inducible, preferably inducible with abscisic acid, rapalog, rapamycin, gibberellin or light of a defined wavelength range, having a wavelength of 400-500 nm, preferably around 450 nm, or 620-700 nm, preferably around 650 nm.
9. The system according to any one of the preceding claims, wherein the DNA binding domain of (a) recognizes a DNA binding site, preferably a specific exogenous or endogenous nucleic acid sequence.
10. The system according to any one of the preceding claims, for expression regulation of a target nucleic acid sequence, wherein the target nucleic acid sequence is a transcribable polynucleotide operably linked to a DNA binding site which is recognized by the DNA binding domain of (a).
11. The system according to claim 10, wherein the target nucleic acid sequence is exogenous or endogenous and encodes a protein or an active RNA molecule.
12. A nucleic acid comprising the coding sequences of polypeptides (a)-(c) of the system according to any one of the preceding claims, wherein the nucleic acid may be present in the form of 1-3 separate molecules, in particular 2 or 3 separate molecules.
13. An isolated cell comprising(I) polypeptides (a)-(c) of the system according to any one of claims 1-11 , and / or(II) a nucleic acid according to claim 12 encoding polypeptides (a)-(c), and preferably further comprising(Ill) a target nucleic acid sequence operably linked to a DNA binding site, wherein the DNA binding site is recognized by the DNA binding domain of polypeptide (a).
14. A method of altering expression of a polynucleotide in a cell with ultrasound, comprising the following steps:(i) providing a cell comprising the system according to any one of claims 1-11 ,(ii) optionally providing at least one chemical or non-chemical inducer suitable to induce heterodimerization of the domains A and A, and optionally of B and B’, of the system according to any one of claims 1-11 , and(iii) stimulating the cell with ultrasound, preferably at a frequency of 0.1 - 50 MHz, more preferably at a frequency of 0.3 - 3 MHz.
15. A method of altering expression of a polynucleotide in a cell with CAR engagement, comprising the following steps:(i) providing a cell comprising the system according to any one of claims 1-11 and expressing CAR,(ii) optionally providing at least one chemical or non-chemical inducer suitable to induce heterodimerization of the domains A and A, and optionally of B and B’, of the system according to any one of claims 1-11 , and(iii) engaging the CAR with its corresponding antigen.
16. Use of a system according to any one of claims 1-11 for targeted gene therapy, and / or targeted treatment of diseases with therapeutic cells, such as CAR-T cells, and / or for regulation of industrial enzyme production, regulation of biofuel enzyme expression, stress tolerance enhancement in cells, alteration of biochemical pathways in cells and / or cell lysis control, and / or for regulating expression of at least one target gene in a non-human transgenic organism.