Plant with flowering-time regulation and method for producing same
By targeting the EMF3 gene with specific mutations, flowering times in plants can be regulated, addressing high-temperature sterility and enhancing seed production efficiency.
Patent Information
- Application Number
- PCT/JP2025/031949
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-10
- Filing Date
- 2025-09-10
- Publication Date
- 2026-03-19
AI Technical Summary
Existing methods struggle to adjust flowering times in plants effectively, particularly in the context of global warming, leading to high temperature sterility and reduced seed setting rates, and are limited to specific genetic lines and species.
Identification of the EMF3 gene and introduction of targeted mutations at specific amino acid positions in the EMF3 protein to regulate flowering time, allowing for advanced or delayed flowering, or loss of synchronization, using genetic engineering and genome editing techniques.
The method enables precise control of flowering times, enhancing seed setting rates by avoiding high-temperature sterility and improving hybrid seed production efficiency across various plant species, including rice, wheat, and other crops.
Smart Images

Figure JPOXMLDOC01-APPB-T000001 
Figure JPOXMLDOC01-APPB-T000002 
Figure JPOXMLDOC01-APPB-T000003
Abstract
Description
Plant with adjusted flowering time and method for producing the same
[0001] The present invention relates to a plant with an adjusted flowering time and a method for producing the same.
[0002] Plants have their own specific flowering times. Also, generally in plants, the flowering stage is the most stress-sensitive, and just by being exposed to high temperatures for a few hours, fertilization becomes poor and seeds cannot be formed. That is, it becomes sterile. On the other hand, it is known that even if the plant is exposed to high temperatures one hour after fertilization, it hardly becomes sterile.
[0003] Therefore, in cereal production in the era of global warming, it has been proposed to establish a cereal production system that ensures fertilization and improves the seed setting rate by shifting the flowering time to early morning when the temperature is low. The present inventors have succeeded in modifying the specific flowering time of rice (10 - 12 am in the variety) by using genetic resources of rice wild species rich in flowering time mutations (Non-Patent Document 1), and have demonstrated that the world-unique "early morning flowering rice" is effective in reducing high temperature sterility (Non-Patent Documents 2 and 3). More specifically, the present inventors have selected the early morning flowering line "EMF20" derived from an interspecific cross between O. sativa and the distant rice C-genome wild species O. officinalis. Furthermore, in order to clarify the genetic factors of the early morning flowering property possessed by "EMF20", quantitative trait locus (QTL) analysis was carried out, and the early morning flowering QTL; qEMF3 was identified, and the present inventors have also succeeded in producing near-isogenic lines (NILs) into which qEMF3 was introduced. And it has also been clarified that the flowering times of these NILs are advanced.
[0004] However, the responsible gene involved in the phenotype of this mutant has not yet been identified. Therefore, it has been difficult to create such plants with adjusted flowering times in rice other than the lines into which "EMF20" and qEMF3 were introduced, and in plant species other than rice.
[0005] Tsutomu Ishimaru et al., Annals of Botany, September 2010, Vol. 106, No. 3, pp. 515-520. Hideyuki Hirabayashi et al., Journal of Experimental Botany, March 2015, Vol. 66, No. 5, pp. 1227-1236. Tsutomu Ishimaru et al., Field Crops Research, March 2022, Vol. 277, pp. 108400. Mumei Wang et al. Molecular Plant, June 2022, Vol. 15, No. 6, pp. 956-972. Peizhou Xu et al. Plant Biotechnol Journal, August 2022, Vol. 20, No. 8, pp. 1441-1443.
[0006] This invention has been made in view of the problems of the prior art described above, and aims to identify the responsible gene involved in regulating flowering time in "EMF20" and to provide a method for producing plants with regulated flowering time that targets the said gene.
[0007] To achieve the above objective, the inventors performed further QTL analysis using the above-mentioned NILs and their background parent varieties. As a result, they succeeded in identifying the gene encoding a sequence in which leucine at position 61 is replaced with phenylalanine in the amino acid sequence described in Sequence ID No. 1 as the responsible gene involved in regulating flowering time (hereinafter, the rice-derived gene into which such amino acid substitutions and other mutations are introduced will also be referred to as the "rice EMF3 gene," and the protein it encodes will also be referred to as the "rice EMF3 protein").
[0008] Furthermore, using the Tilling method, we created numerous mutants (38 lines) of the rice EMF3 gene and analyzed their flowering times. As a result, we found that, in addition to the amino acid substitution at position 61, it is also possible to advance the flowering time by substituting at least position 560 or 563 of the rice EMF3 protein with other amino acids. On the other hand, we also revealed that it is possible to delay the flowering time by substituting at least position 100, 215, 296, or 547 of the rice EMF3 protein with other amino acids. Furthermore, we found that, for example, substituting position 719 of the rice EMF3 protein with a stop codon can cause the peak of flowering time to be lost (loss of synchronization).
[0009] Furthermore, we created numerous mutants of the rice EMF3 gene using genome editing and analyzed their flowering times. As a result, we found that it is possible to delay the flowering time by substituting positions 62, 105, 104, and 105, and positions 104-106 of the rice EMF3 protein with other amino acids. In addition, we found that when positions 562 and 563 of the rice EMF3 protein were homozygously substituted with other amino acids, the flowering time was delayed, and when they were heterozygously substituted with other amino acids, the flowering time was slightly accelerated.
[0010] Thus, it has become clear that the flowering time can be regulated by introducing a mutation involving an amino acid substitution at least one of the 13 sites described above into the rice EMF3 gene. Furthermore, it has been revealed that the amino acids at these sites are highly conserved in EMF3 proteins in various other plants (for example, proteins consisting of the amino acid sequences described in SEQ ID NOs: 2 to 14), and it has been found that by introducing a mutation into the EMF3 gene, the flowering time can be regulated not only in rice but also in a wide range of crops, thus completing the present invention.
[0011] In other words, the present invention provides the following embodiments.
[0012] [1] A method for producing a plant with a controlled flowering time, comprising the step of introducing a mutation into a gene that encodes an amino acid sequence having 90% or more identity with the amino acid sequence described in any of Sequence IDs 1 to 14.
[0013] [2] The method for manufacturing according to [1], wherein the mutation introduced into the gene is a mutation that causes the deletion, insertion and / or substitution of one or more amino acids in at least one of the following regions (a) to (d): (a) A region consisting of the amino acid sequence at positions 50 to 121 described in SEQ ID NO: 1 or the amino acid sequence corresponding thereto; (b) A region consisting of the amino acid sequence at positions 209 to 302 described in SEQ ID NO: 1 or the amino acid sequence corresponding thereto; (c) A region consisting of the amino acid sequence at positions 541 to 564 described in SEQ ID NO: 1 or the amino acid sequence corresponding thereto; (d) A region consisting of the amino acid sequence at positions 690 to 720 described in SEQ ID NO: 1 or the amino acid sequence corresponding thereto.
[0014] [3] The method for producing the product according to [1], wherein the adjustment of the flowering time is to advance the flowering time, and the mutation introduced into the gene is a substitution of at least one of the following (1) to (3) with another amino acid: (1) Substitution of another amino acid at position 61 or the corresponding site as described in SEQ ID NO: 1; (2) Substitution of another amino acid at position 560 or the corresponding site as described in SEQ ID NO: 1; (3) Substitution of another amino acid at position 563 or the corresponding site as described in SEQ ID NO: 1.
[0015] [4] The method for producing the product according to [1], wherein the adjustment of the flowering time is to delay the flowering time, and the mutation introduced into the gene is a substitution of at least one of the following (4) to (13) for another amino acid: (4) Substitution of another amino acid at position 62 or the corresponding site as described in SEQ ID NO: 1, (5) Substitution of another amino acid at position 90 or the corresponding site as described in SEQ ID NO: 1, (6) Substitution of another amino acid at position 100 or the corresponding site as described in SEQ ID NO: 1, (7) Substitution of another amino acid at position 104 or the corresponding site as described in SEQ ID NO: 1, (8) Substitution of another amino acid at position 105 or the corresponding site as described in SEQ ID NO: 1, (9) Substitution of another amino acid at position 106 or the corresponding site as described in SEQ ID NO: 1, (10) Substitution of another amino acid at position 215 or the corresponding site as described in SEQ ID NO: 1, (11) Substitution of another amino acid at position 296 or the corresponding site as described in SEQ ID NO: 1, (12) Substitution of another amino acid at position 547 or the corresponding site as described in SEQ ID NO: 1 (13) Substitution of another amino acid at position 562 or the corresponding site as described in Sequence ID No. 1.
[0016] [5] A plant in which a mutation has been artificially introduced into a gene encoding an amino acid sequence that has 90% or more identity with any of the amino acid sequences described in Sequence ID No. 1 to 14, thereby regulating the flowering time.
[0017] [6] The mutation introduced into the gene is a mutation that causes the deletion, insertion and / or substitution of one or more amino acids in at least one of the following regions (a) to (d): (a) A region consisting of the amino acid sequence at positions 50 to 121 described in SEQ ID NO: 1 or the amino acid sequence corresponding thereto; (b) A region consisting of the amino acid sequence at positions 209 to 302 described in SEQ ID NO: 1 or the amino acid sequence corresponding thereto; (c) A region consisting of the amino acid sequence at positions 541 to 564 described in SEQ ID NO: 1 or the amino acid sequence corresponding thereto; (d) A region consisting of the amino acid sequence at positions 690 to 720 described in SEQ ID NO: 1 or the amino acid sequence corresponding thereto.
[0018] [7] The plant according to [5], wherein the adjustment of the flowering time is to advance the flowering time, and the mutation introduced into the gene is a substitution of at least one of the following (1) to (3) with another amino acid: (1) A substitution of another amino acid at position 61 or the corresponding site as described in Sequence ID No. 1; (2) A substitution of another amino acid at position 560 or the corresponding site as described in Sequence ID No. 1; (3) A substitution of another amino acid at position 563 or the corresponding site as described in Sequence ID No. 1.
[0019] [8] The plant according to [5], wherein the adjustment of the flowering time is to delay the flowering time, and the mutation introduced into the gene is a substitution of at least one of the following (4) to (13) for another amino acid: (4) Substitution of another amino acid at position 62 or the corresponding site as described in SEQ ID NO: 1, (5) Substitution of another amino acid at position 90 or the corresponding site as described in SEQ ID NO: 1, (6) Substitution of another amino acid at position 100 or the corresponding site as described in SEQ ID NO: 1, (7) Substitution of another amino acid at position 104 or the corresponding site as described in SEQ ID NO: 1, (8) Substitution of another amino acid at position 105 or the corresponding site as described in SEQ ID NO: 1, (9) Substitution of another amino acid at position 106 or the corresponding site as described in SEQ ID NO: 1, (10) Substitution of another amino acid at position 215 or the corresponding site as described in SEQ ID NO: 1, (11) Substitution of another amino acid at position 296 or the corresponding site as described in SEQ ID NO: 1, (12) Substitution of another amino acid at position 547 or the corresponding site as described in SEQ ID NO: 1 (13) Substitution of another amino acid at position 562 or the corresponding site as described in Sequence ID No. 1.
[0020] Furthermore, in 2022, a Chinese group isolated the early flowering gene dfot1 (diurnal flower opening time 1) using a mutant, and reported that flowering time can be regulated by regulating the expression of PME42 (pectin methylesterase), which promotes cell wall softening, using genetic engineering technology (Non-patent documents 4 and 5).
[0021] However, while these genes have been experimented with using Chinese hybrid varieties, their effectiveness in avoiding high-temperature sterility has not been demonstrated. Furthermore, it is unclear whether they can regulate flowering time in genetically diverse varieties such as Indian and Japonica varieties.
[0022] On the other hand, as shown in the examples described later, the present invention makes it possible to advance the flowering time, suggesting its effectiveness in avoiding high-temperature sterility. Furthermore, unlike the reports in Non-Patent Documents 4 and 5, the present invention makes it possible to regulate the flowering time even by targeting only one gene (the EMF3 gene). In addition, the effectiveness of the near-isogenic line into which qEMF3 was introduced, which formed the basis of the present invention, has already been demonstrated in genetically diverse varieties such as Indica and Japonica varieties. Furthermore, as shown in the examples described later, the amino acid substitution sites that can contribute to regulating the flowering time according to the present invention are highly conserved in various plants, suggesting that the flowering time can be regulated in a wide range of plants, not just rice.
[0023] According to the present invention, it is possible to adjust the flowering time of plants. More specifically, it is possible to produce plants in which the flowering time is advanced or delayed, or in which the peak flowering time is lost (loss of synchronicity). According to the present invention, for example, by shifting the flowering time of plants that normally flower during the hottest part of the day to the early morning when the temperature is low, it is possible to avoid sterility. Furthermore, by advancing or delaying the flowering time, or by losing synchronicity, it is possible to improve the production efficiency of hybrid seeds by overlapping the flowering times of different lines. It should be noted that the ability to improve the production efficiency of hybrid seeds by losing synchronicity is suggested by Li Liu et al., Journal of Experimental Botany, July 2017, Vol. 68, No. 16, pp. 4613-4625, which found that the production efficiency was improved by scattering the flower opening time (FOT) (see Figure 1, etc. in the same document).
[0024] This graph shows the time course of the flowering and glenoid rate of Koshihikari rice into which qEMF3 (a mutation that replaces the amino acid at position 61 of the rice EMF3 protein from leucine to phenylalanine; L61F) has been introduced. The graph also shows the data for the background parent variety. This graph shows the time course of the flowering and glenoid rate of Koshihikari mutants into which T90S has been introduced into the rice EMF3 gene, either homozygously or heterozygously. The graph also shows the data for lines from the cross between Koshihikari and the mutant in which the genotype of the aforementioned amino acid substitution site is the same as that of Koshihikari (hereinafter referred to as "Koshihikari type" in conjunction with the graph). This graph shows the time course of the flowering and glenoid rate of Koshihikari mutants into which T100I has been introduced into the rice EMF3 gene, either homozygously or heterozygously. The graph also shows the data for the Koshihikari type. This graph shows the time course of the flowering and glenoid rate in Koshihikari mutants in which L215R was introduced into the rice EMF3 gene in a homozygous or heterozygous manner. The graph also shows the graph for the Koshihikari type. This graph shows the time course of the flowering and glenoid rate in Koshihikari mutants in which E296G was introduced into the rice EMF3 gene in a homozygous or heterozygous manner. The graph also shows the graph for the Koshihikari type. This graph shows the time course of the flowering and glenoid rate in Koshihikari mutants in which D547V was introduced into the rice EMF3 gene in a homozygous or heterozygous manner. The graph also shows the graph for the Koshihikari type. This graph shows the time course of the flowering and glenoid rate in Koshihikari mutants in which N560I was introduced into the rice EMF3 gene in a homozygous or heterozygous manner. The graph also shows the graph for the background parent variety (Koshihikari), the Koshihikari type, and Koshihikari with qEMF3 introduced (Koshi qEMF3). This graph shows the cumulative flowering and glenoid rate over time for Koshihikari rice in which N560I was introduced into the rice EMF3 gene in a homozygous or heterozygous manner. The graph also shows the background parent variety (Koshihikari), Koshihikari type, and Koshihikari in which qEMF3 was introduced (Koshihikari qEMF3). This graph shows the change in flowering and glenoid rate over time for Koshihikari mutants in which T563I was introduced into the rice EMF3 gene in a homozygous or heterozygous manner (indicated as "T563I homozygous type" or "T563I heterozygous type" in the graph), and for Toyomeki in which qEMF3 was introduced (Toyo qEMF3).The figure also shows the background parent variety (Toyomeki) and the progeny of crosses between Toyomeki and the T563I mutant in which the genotype of the aforementioned amino acid substitution site is the same as that of Toyomeki (indicated as "Toyo type" in the figure). The graph shows the time course of flowering glenoids for Toyomeki in which T563I was introduced homozygously into the rice EMF3 gene (indicated as "Toyo T563I homozygous type" in the figure), and for Toyomeki or IR64 in which qEMF3 was introduced (indicated as "Toyo qEMF3" or "IR64 qEMF3" in the figure). The figure also shows the time course of flowering glenoids for these background parent varieties (Toyomeki or IR64). The graph shows the time course of flowering glenoids for Koshihikari in which L719* (stop codon) was introduced homozygously or heterozygously into the rice EMF3 gene. The figure also shows the data for the Koshihikari variety. Figures 1-9 are graphs showing the time course of sunshine duration and temperature on the days when the flowering glenoid rate was investigated. This is a schematic diagram showing the mutant sites involving the above amino acid substitutions in the rice EMF3 gene and the positions of the primers used to analyze them. In the figure, the CDS indicated by the long arrow at the top is the CDS of the rice EMF3 gene revealed by the present inventors' analysis. On the other hand, the CDS indicated by the arrow below it is based on the results of annotation using the public database RAP-DB. This is a graph showing the time course of the flowering glenoid rate of a Koshihikari mutant in which A62V was introduced homozygously into the rice EMF3 gene. The figure also shows the data for the background parent variety (Koshihikari). This graph shows the time course of flowering glenoids in Koshihikari mutants in which V105I, V104&IV105I, or V104I, V105I&E106K were introduced homozygously into the rice EMF3 gene. The graph also shows the graph for the background parent variety (Koshihikari). This graph shows the time course of flowering glenoids in Koshihikari mutants in which C562W&T563I were introduced homozygously or heterozygously into the rice EMF3 gene. The graph also shows the graph for the background parent variety (Koshihikari). This figure shows the results of comparing the rice EMF3 protein (amino acid sequence from positions 1 to 131) with corresponding sequences from other plants. In the figure, amino acids marked in black indicate 100% conservation, and amino acids marked in gray indicate 50% or more conservation.Furthermore, the amino acid sequences of each of these plant-derived EMF3 proteins are shown in sequence numbers 1 to 14 (see Table 1). The explanations for these figures are the same for Figures 15B to 15E below. This figure shows the results of comparing the rice EMF3 protein (amino acid sequence from positions 132 to 254) with the corresponding sequences from other plants. This figure shows the results of comparing the rice EMF3 protein (amino acid sequence from positions 255 to 406) with the corresponding sequences from other plants. This figure shows the results of comparing the rice EMF3 protein (amino acid sequence from positions 407 to 578) with the corresponding sequences from other plants. This figure shows the results of comparing the rice EMF3 protein (amino acid sequence from positions 579 to 723) with the corresponding sequences from other plants.
[0025] (Method for producing plants with regulated flowering time) As shown in the examples below, the inventors have revealed that the gene encoding the amino acid sequence described in Sequence ID No. 1 (rice EMF3 gene) is involved in regulating flowering time. Furthermore, the inventors have revealed that by introducing mutations into this rice EMF3 gene, it is possible to advance or delay the flowering time, or to lose the peak of flowering time. In addition, it has been revealed that these mutation sites are highly conserved in EMF3 proteins in various plants (for example, proteins consisting of the amino acid sequences described in Sequence ID Nos. 2 to 14).
[0026] Therefore, the present invention relates to a method for producing a plant with a controlled flowering time, comprising the step of introducing a mutation into a gene encoding an amino acid sequence that has 90% or more identity with the amino acid sequence described in any of Sequence IDs 1 to 14.
[0027] In this invention, "flowering time" means the time when a plant's flowers bloom. If multiple flowers bloom on a single plant, it means the time of day when the most of those multiple flowers bloom (e.g., the peak). "Adjustment of flowering time" means that by introducing the mutation described later in this invention, the flowering time may become earlier (brought forward) (for example, at least 30 minutes earlier, preferably 1 hour earlier) or later (for example, at least 30 minutes later, preferably 1 hour later) compared to before the introduction. Furthermore, if multiple flowers bloom on a single plant, it may also mean the loss of the peak (loss of synchronization). "Synchronization" means the consistency of the flowering times of multiple flowers on a single plant. In addition, such advancement or delay of flowering time, or loss of synchronization, can be evaluated by those skilled in the art by comparing it with the plant before the introduction of the mutation. Furthermore, as shown in the examples described later, it is also possible to evaluate by calculating the flowering rate (the ratio of the number of flowers that bloomed in each observation period (e.g., every 30 minutes) to the total number of flowers that bloomed in a day). Moreover, as shown in Figure 7B, it is also possible to evaluate by calculating the cumulative value of the flowering rates in each of these observation periods. Additionally, for example, if flowers bloom throughout the day (e.g., from 9 a.m. to 5 p.m.) and the flowering rate in each observation period falls below 20%, it can be evaluated that the synchronization has been lost.
[0028] In the present invention, there are no particular restrictions on the "plants" whose flowering time is to be controlled, and examples include angiosperms (monocotyledonous plants and dicotyledonous plants). Any type of "monocotyledonous plant" is acceptable, but examples include grasses, lilies, bananas, pineapples, and orchids. Examples of "grasses" include rice (Japonica and Indica varieties), wheat, barley, corn, oats, grass, sorghum, fonio, rye, millet, proso millet, and sugarcane. Examples of "lilies" include onions and asparagus. Examples of "bananas" include bananas. Examples of "pineapples" include pineapples. Examples of "orchids" include orchids. Examples of "dicotyledonous plants" include Brassicaceae, Fabaceae, Solanaceae, Apiaceae, Rosaceae, Vitaceae, Rutaceae, Cucurbitaceae, Convolvulaceae, Moraceae, Malvaceae, Asteraceae, Amaranthaceae, and Polygonaceae. Examples of "Brassicaceae" include Arabidopsis thaliana, rapeseed, Chinese cabbage, cabbage, cauliflower, and radish. Examples of "Fabaceae" include soybeans, adzuki beans, kidney beans, peas, cowpeas, and alfalfa. Examples of "Solanaceae" include tomatoes, eggplants, potatoes, tobacco, and chili peppers. Examples of "Apiaceae" include carrots and parsley. Examples of "Rosaceae" include roses, strawberries, and apples. Examples of "Vitaceae" include grapes, wild grapes, and wild vines. Examples of Rutaceae plants include mandarins (Unshu mandarins), yuzu, and lemons. Examples of Cucurbitaceae plants include cantaloupes, cucumbers, melons, and watermelons. Examples of Convolvulaceae plants include morning glories, sweet potatoes, and bindweed. Examples of Moraceae plants include mulberries, figs, and rubber trees. Examples of Malvaceae plants include cotton and kenaf. Examples of Asteraceae plants include lettuce. Examples of Amaranthaceae plants include sugar beets. Examples of Polygonaceae plants include buckwheat.
[0029] Furthermore, the plants used in this invention may be wild species or cultivated species. In addition, these plants may be genetically modified or genome-edited (for example, disease-resistant crops, herbicide-resistant crops, insect-resistant crops, crops with improved taste, crops with improved storage life, or crops with improved yield).
[0030] In this invention, the genes targeted for mutation introduction (hereinafter collectively referred to as "EMF3 genes") are shown in Table 1 below, and are examples of typical amino acid sequences encoded by genes derived from each plant species.
[0031]
[0032] It should be noted that mutations in nucleotide sequences can occur in nature. Consequently, the encoded amino acids can also change. Furthermore, the same protein derived from plants belonging to the same family exhibits high amino acid sequence identity. Therefore, the EMF3 protein according to the present invention is not limited to the above-mentioned typical sequences, but may include amino acid sequences having high homology (high similarity), preferably high identity, to these. Here, "high" means at least 40%, more preferably 50%, even more preferably 60%, more preferably 70%, even more preferably 80%, and even more preferably 85% (for example, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more).
[0033] Sequence homology can be determined using the BLAST program (Altschul et al. J. Mol. Biol., 215:403-410, 1990). This program is based on the BLAST algorithm by Karlin and Altschul (Proc. Natl. Acad. Sci. USA, 87:2264-2268, 1990, Proc. Natl. Acad. Sci. USA, 90:5873-5877, 1993). For example, when analyzing amino acid sequences using BLAST, the parameters are, for example, score=50 and wordlength=3. Furthermore, when analyzing amino acid sequences using the Gapped BLAST program, the procedure can be carried out as described by Altschul et al. (Nucleic Acids Res. 25:3389-3402, 1997). When using BLAST and the Gapped BLAST program, the default parameters of each program should be used. The specific methods for these analysis techniques are publicly known.
[0034] In the present invention, the "mutations" introduced into the EMF3 gene include, for example, mutations that cause the deletion, insertion, and / or substitution of one or more amino acids, and are not particularly limited as long as they can regulate the flowering time. Mutations that cause the deletion or substitution of all amino acids in the EMF3 protein are also acceptable. Furthermore, "one or more" here does not have any particular restrictions as long as the flowering time can be adjusted, but examples include 1-700 amino acids, 1-600 amino acids, 1-500 amino acids, 1-400 amino acids, 1-300 amino acids, 1-200 amino acids, 1-150 amino acids, 1-100 amino acids, 1-90 amino acids, 1-80 amino acids, 1-70 amino acids, 1-60 amino acids, 1-50 amino acids, 1-40 amino acids, 1-30 amino acids, 1-20 amino acids, 1-15 amino acids, 1-10 amino acids, 1-9 amino acids, 1-8 amino acids, 1-7 amino acids, 1-6 amino acids, 1-5 amino acids, 1-4 amino acids, 1-3 amino acids, and 1-2 amino acids. Also, there are no particular restrictions on the number of mutations introduced into the EMF3 gene as long as the flowering time can be adjusted; it may be one, or multiple (for example, two, three or fewer, five or fewer, ten or fewer, or twenty or fewer).
[0035] More specifically, examples of mutations related to the present invention include the following amino acid substitutions, as shown in the examples described below.
[0036]
[0037] As shown in the examples described later, the sites to be substituted with amino acids shown in Table 2 are those in the EMF3 protein consisting of the amino acid sequence described in SEQ ID NO: 1. However, in EMF3 proteins containing sequences homologous to this sequence, and further in EMF3 proteins containing sequences homologous to any of the amino acid sequences described in SEQ ID NOs: 2 to 14, these should be read as the sites corresponding to each part of the amino acid sequence described in SEQ ID NO: 1. Here, "corresponding" means a relationship in which the amino acid sequence described in SEQ ID NO: 1 and the corresponding amino acid sequence (the homologous sequence described above) are aligned using nucleotide and amino acid sequence analysis software (GENETYX, Sequencher, etc.) or BLAST (http: / / blast.ncbi.nlm.nih.gov / Blaster.cgi), and are in the same position.
[0038] Furthermore, as shown in the examples described later (particularly Figures 15A to 15E), the arrangements of each part and its surrounding areas shown in Table 2 are highly conserved in various plants. Therefore, it is probable that flowering time can be controlled not only by introducing mutations in these specific parts but also in the surrounding arrangements. In other words, in the present invention, the target of mutation is: (a) a region consisting of the amino acid sequence at positions 50 to 121 described in SEQ ID NO: 1 or the amino acid sequence corresponding to said sequence (preferably, a region consisting of the amino acid sequence at positions 50 to 61 described in SEQ ID NO: 1 or the amino acid sequence corresponding to said sequence, a region consisting of the amino acid sequence at positions 62 to 91 described in SEQ ID NO: 1 or the amino acid sequence corresponding to said sequence, a region consisting of the amino acid sequence at positions 95 to 121 described in SEQ ID NO: 1 or the amino acid sequence corresponding to said sequence), (b) a region consisting of the amino acid sequence at positions 209 to 302 described in SEQ ID NO: 1 or the amino acid sequence corresponding to said sequence (preferably, a region consisting of the amino acid sequence at positions 209 to 250 described in SEQ ID NO: 1 or the amino acid sequence corresponding to said sequence, a region consisting of the amino acid sequence at positions 262 to 302 described in SEQ ID NO: 1 or the amino acid sequence corresponding to said sequence), (c) A region consisting of the amino acid sequence at positions 541 to 564 described in SEQ ID NO: 1 or the amino acid sequence corresponding to said sequence (preferably, a region consisting of the amino acid sequence at positions 541 to 547 described in SEQ ID NO: 1 or the amino acid sequence corresponding to said sequence, or a region consisting of the amino acid sequence at positions 557 to 564 described in SEQ ID NO: 1 or the amino acid sequence corresponding to said sequence), (d) A region consisting of the amino acid sequence at positions 690 to 720 described in SEQ ID NO: 1 or the amino acid sequence corresponding to said sequence (preferably, a region consisting of the amino acid sequence at positions 717 to 720 described in SEQ ID NO: 1 or the amino acid sequence corresponding to said sequence).
[0039] Furthermore, the substituted amino acids shown in Table 2 are typical examples for each site and are not limited to them; other amino acids different from the original may be used as long as they can adjust the flowering time. Such "other amino acids" may be any of the 19 amino acids different from the original, or they may be stop codons (no further amino acids), but other amino acids that are similar to the typical substituted amino acids for each site (having chemically similar side chains) are preferred. Groups of amino acids having chemically similar amino acid side chains are well known in the art to which the present invention belongs. For example, acidic amino acids (aspartic acid and glutamic acid), basic amino acids (lysine, arginine, histidine), and neutral amino acids can be classified into amino acids with hydrocarbon chains (glycine, alanine, valine, leucine, isoleucine, proline), amino acids with hydroxyl groups (serine, threonine), amino acids containing sulfur (cysteine, methionine), amino acids with amide groups (asparagine, glutamine), amino acids with imino groups (proline), and amino acids with aromatic groups (phenylalanine, tyrosine, tryptophan).
[0040] More specifically, in the present invention, when accelerating the flowering time, it is preferable to introduce heterozygous or homozygous mutations into the nucleotide sequence encoding the amino acid sequence at positions 50 to 75 described in SEQ ID NO: 1 or the region consisting of the amino acid sequence corresponding to said sequence, or the amino acid sequence at positions 557 to 564 described in SEQ ID NO: 1 or the region consisting of the amino acid sequence corresponding to said sequence; it is more preferable to introduce heterozygous or homozygous mutations to replace the amino acid at position 61 described in SEQ ID NO: 1 or the amino acid at the corresponding site with another amino acid (for example, an amino acid with an aromatic group (particularly phenylalanine)); it is more preferable to introduce heterozygous or homozygous mutations to replace the amino acid at position 560 or 563 described in SEQ ID NO: 1 or the amino acid at the corresponding site with another amino acid (for example, an amino acid with a hydrocarbon chain (particularly isoleucine)); or It is more preferable to introduce a heterozygous mutation in which the amino acids at positions 562 and 563 described in SEQ ID NO: 1, or the amino acids at the corresponding sites, are replaced with other amino acids (for example, an amino acid having an aromatic group at position 562 or the corresponding site described in SEQ ID NO: 1 (especially tryptophan), or an amino acid having a hydrocarbon chain at position 563 or the corresponding site described in SEQ ID NO: 1 (especially isoleucine)).
[0041] On the other hand, to delay the flowering time, it is preferable to introduce a heterozygous or homozygous mutation into the nucleotide sequence encoding the amino acid sequence at positions 62 to 91 described in SEQ ID NO: 1 or the region consisting of the amino acid sequence corresponding to said sequence, more preferably a homozygous mutation that replaces the amino acid at position 62 or the amino acid at the corresponding site described in SEQ ID NO: 1 with another amino acid (for example, an amino acid with a hydrocarbon chain (especially valine)), or more preferably a heterozygous or homozygous mutation that replaces the amino acid at position 90 or the amino acid at the corresponding site described in SEQ ID NO: 1 with another amino acid (for example, an amino acid with a hydroxyl group (especially serine)). It is preferable to introduce a heterozygous mutation into the nucleotide sequence encoding the amino acid sequence at positions 95 to 121 described in SEQ ID NO: 1 or the region consisting of the amino acid sequence corresponding to said sequence, more preferably a heterozygous mutation that replaces the amino acid at position 100 or the amino acid at the corresponding site described in SEQ ID NO: 1 with another amino acid (for example, an amino acid with a hydrocarbon chain (especially isoleucine)).Furthermore, it is more preferable to introduce a homozygous mutation in which at least one of the amino acids at positions 104-106 or the corresponding site described in SEQ ID NO: 1 is replaced with another amino acid (for example, an amino acid having a hydrocarbon chain at position 104 or the corresponding site described in SEQ ID NO: 1 (especially isoleucine), an amino acid having a hydrocarbon chain at position 105 or the corresponding site described in SEQ ID NO: 1 (especially isoleucine), or a basic amino acid at position 106 or the corresponding site described in SEQ ID NO: 1 (especially lysine)), it is even more preferable to introduce a homozygous mutation in which the amino acid at position 105 or the corresponding site described in SEQ ID NO: 1 is replaced with another amino acid (for example, an amino acid having a hydrocarbon chain (especially isoleucine)), it is even more preferable to introduce a homozygous mutation in which the amino acids at positions 104 and 105 or the corresponding sites described in SEQ ID NO: 1 are replaced with other amino acids (for example, an amino acid having a hydrocarbon chain at position 104 or the corresponding site described in SEQ ID NO: 1 (especially isoleucine), or, It is even more preferable to introduce a homozygous mutation in which the amino acids at positions 104 to 106 described in SEQ ID NO: 1 or the amino acids at the corresponding sites are replaced with other amino acids (for example, an amino acid having a hydrocarbon chain at position 104 or the corresponding site described in SEQ ID NO: 1 (especially isoleucine), an amino acid having a hydrocarbon chain at position 105 or the corresponding site described in SEQ ID NO: 1 (especially isoleucine), or an amino acid having a hydrocarbon chain at position 106 or the corresponding site described in SEQ ID NO: 1 (especially isoleucine)). It is preferable to introduce a heterozygous mutation in the nucleotide sequence encoding the amino acid sequence at positions 209 to 250 described in SEQ ID NO: 1 or the region consisting of the amino acid sequence corresponding to said sequence, and it is even more preferable to introduce a heterozygous mutation in which the amino acid at position 215 described in SEQ ID NO: 1 or the amino acid at the corresponding site is replaced with other amino acids (for example, a basic amino acid (especially arginine)).It is preferable to introduce a homozygous mutation into the nucleotide sequence encoding the amino acid sequence at positions 262 to 302 described in SEQ ID NO: 1 or the region consisting of the amino acid sequence corresponding to said sequence, and it is more preferable to introduce a homozygous mutation that replaces the amino acid at position 296 described in SEQ ID NO: 1 or the amino acid at the corresponding site with another amino acid (for example, an amino acid with a hydrocarbon chain (particularly glycine)). It is also preferable to introduce a heterozygous mutation into the nucleotide sequence encoding the amino acid sequence at positions 541 to 547 described in SEQ ID NO: 1 or the region consisting of the amino acid sequence corresponding to said sequence, and it is more preferable to introduce a heterozygous mutation that replaces the amino acid at position 547 described in SEQ ID NO: 1 or the amino acid at the corresponding site with another amino acid (for example, an amino acid with a hydrocarbon chain (particularly valine)). Furthermore, the flowering time can also be delayed by introducing a homozygous mutation in which the amino acids at positions 562 and 563 described in SEQ ID NO: 1, or the amino acids at the corresponding sites, are replaced with other amino acids (for example, amino acids with an aromatic group at position 562 or the corresponding site described in SEQ ID NO: 1 (especially tryptophan), and amino acids with a hydrocarbon chain at position 563 or the corresponding site described in SEQ ID NO: 1 (especially isoleucine)).
[0042] On the other hand, when losing synchrony regarding the flowering time, it is preferable to introduce a homologous mutation into the nucleotide sequence encoding the amino acid sequence at positions 95 to 121 described in SEQ ID NO: 1 or the region consisting of the corresponding amino acid sequence, and it is more preferable to introduce a homologous mutation that substitutes the amino acid at position 100 described in SEQ ID NO: 1 or the amino acid at the corresponding site with another amino acid (for example, an amino acid having a hydrocarbon chain (particularly isoleucine)). It is preferable to introduce a homologous mutation into the nucleotide sequence encoding the amino acid sequence at positions 209 to 250 described in SEQ ID NO: 1 or the region consisting of the corresponding amino acid sequence, and it is more preferable to introduce a homologous mutation that substitutes the amino acid at position 215 described in SEQ ID NO: 1 or the amino acid at the corresponding site with another amino acid (for example, a basic amino acid (particularly arginine)). It is preferable to introduce a homologous mutation into the nucleotide sequence encoding the amino acid sequence at positions 541 to 547 described in SEQ ID NO: 1 or the region consisting of the corresponding amino acid sequence, and it is more preferable to introduce a homologous mutation that substitutes the amino acid at position 547 described in SEQ ID NO: 1 or the amino acid at the corresponding site with another amino acid (for example, an amino acid having a hydrocarbon chain (particularly valine)).
[0043] It is preferable to introduce a homologous mutation into the nucleotide sequence encoding the amino acid sequence at positions 557 to 564 described in SEQ ID NO: 1 or the region consisting of the corresponding amino acid sequence, and it is more preferable to introduce a homologous mutation that substitutes the amino acid at position 560 described in SEQ ID NO: 1 or the amino acid at the corresponding site with another amino acid (for example, an amino acid having a hydrocarbon chain (particularly isoleucine)). Further, it is preferable to introduce a heterologous or homologous mutation into the nucleotide sequence encoding the amino acid sequence at positions 717 to 720 described in SEQ ID NO: 1 or the region consisting of the corresponding amino acid sequence, and it is more preferable to introduce a heterologous or homologous mutation that substitutes the amino acid at position 719 described in SEQ ID NO: 1 or the amino acid at the corresponding site with another amino acid (for example, a stop codon).
[0044] The introduction of mutations into the EMF3 gene according to the present invention can be achieved by mutation introduction methods known to those skilled in the art. Such known methods include, but are not limited to, genome editing, homologous recombination, physical mutagenesis, methods using chemical mutagens, and methods introducing transposons into genomic DNA.
[0045] Genome editing is a method of modifying target genes using site-specific nucleases (for example, DNA double-strand cleavage enzymes such as zinc finger nuclease (ZFN), transcription-activating effector nuclease (TALEN), and CRISPR-Cas enzyme). For example, fusion proteins such as ZFNs (US Patents 6,265,196, 8,524,500, 7,888,121, European Patent No. 1,720,995), TALENs (US Patents 8,470,973, 8,586,363), PPR (pentatricopeptiderepeat) with a fused nuclease domain (Nakamura et al., Plant Cell Physiol 53:1171-1179 (2012)), CRISPR-Cas9 (US Patent No. 8,697,359, International Publication 2013 / 176772), CRISPR-Cpf1 (Zetsche B. et al.) Examples include using guide RNA-protein complexes, or protein complexes, such as K. Nishida et al., Cell, 163(3):759-71, (2015) or Target-AID (K. Nishida et al., Targeted nucleotide editing using hybrid prokalyotic and vertebrate adaptive immunosystems, Science, DOI:10.1126 / science.aaf8729, (2016)).
[0046] The "Cas enzyme" is not particularly limited and can be appropriately selected according to the purpose. More specifically, it can be appropriately selected and used from class 1 CRISPR-related enzymes (for example, type I such as Cas3, type IV, type III such as Cas10), class 2 CRISPR-related enzymes (for example, type II such as Cas9, Cas12 (Cas12a (Cpf1), Cas12b (C2c1), Cas12e (CasX) and Cas12f1), and type V such as Cas14, type VI such as Cas13), etc.
[0047] Further, in the genome editing method, a donor DNA containing a sequence encoding a desired amino acid mutation (for example, a DNA in which homology arms corresponding to the endogenous EMF3 gene are arranged at both ends of a sequence encoding a desired amino acid substitution) can be used in combination, and a mutation can be introduced into the endogenous EMF3 gene through a homologous recombination reaction (SDN - type 2 genome editing). The length of such a homology arm may be any number that allows the homologous recombination to occur, for example, 50 to 200 nucleotides.
[0048] Furthermore, regarding the genome editing method, a method not involving double-strand breakage can also be used in the present invention. For example, as shown in the examples described later, a method (base editing) of modifying only one base in a target gene using a mutant Cas having no nuclease activity and added deaminase and a guide RNA can also be used. In addition, a method (prime editing) of modifying a base or inserting a DNA sequence in a target gene using a mutant Cas having no double-strand cleavage ability and added reverse transcriptase and a guide RNA (pegRNA) added with a primer binding site sequence and a reverse transcriptase template sequence can also be used in the present invention.
[0049] In the "homologous recombination method," by using a donor sequence containing a sequence encoding a desired amino acid mutation (for example, a vector in which homology arms corresponding to the endogenous EMF3 gene are positioned at both ends of the sequence encoding the desired amino acid mutation), the endogenous EMF3 gene can be converted into a gene encoding the EMF3 protein into which the target mutation has been introduced through homologous recombination. The length of such homology arms can be any number that allows homologous recombination to occur, for example, 500 to 7000 nucleotides (preferably 1000 to 5000 nucleotides, more preferably 2000 to 4000 nucleotides).
[0050] Examples of "physical mutation induction methods" include heavy ion beam (HIB) irradiation, fast neutron irradiation, gamma ray irradiation, and ultraviolet irradiation (see Hayashi et al., Cyclotrons and Their Applications, 2007, 18th International Conference, pp. 237-239, and Kazama et al., Plant Biotechnology, 2008, Vol. 25, pp. 113-117).
[0051] Examples of "methods using chemical mutagens" include methods of treating seeds, etc., with chemical mutagens (see Zwar and Chandler, Planta, 1995, Vol. 197, pp. 39-48, etc.). There are no particular restrictions on the chemical mutagens, but examples include N-methyl-N-nitrosourea (MNU), ethylmethanesulfate (EMS), N-ethyl-N-nitrosourea (ENU), sodium azide, sodium bisulfite, hydroxylamine, N-methyl-N'-nitro-N-nitroguanidine (MNNG), N-methyl-N'-nitrosoguanidine (NTG), O-methylhydroxylamine, nitrite, formic acid, and nucleotide analogs.
[0052] "Methods for introducing transposons, etc., into genomic DNA" include, for example, T OSExamples include methods for inserting transposons such as 17, T-DNA, etc., into the plant's genomic DNA (see Kumar et al., Trends Plant Sci., 2001, Vol. 6, No. 3, pp. 127-134, and Tamara et al., Trends in Plant Science, 1999, Vol. 4, No. 3, pp. 90-96).
[0053] For plants into which mutations have been introduced using the methods described above, the presence of mutations in the EMF3 gene can be confirmed by known methods. Examples of such known methods include DNA sequencing (next-generation sequencing, etc.), PCR, microarray analysis, and Southern blotting. Using these methods, it is possible to determine whether or not a mutation has been introduced into the EMF3 gene by comparing the sequence or length of the EMF3 gene before and after the introduction of the mutation.
[0054] Another method for confirming the introduction of mutations into the EMF3 gene is TILLING (Targeting Induced Local Lessons in Genomes) (see Slade et al., Transgenetic Res., 2005, Vol. 14, pp. 109-115, and Comai et al., Plant J., 2004, Vol. 37, pp. 778-786). In particular, when non-selective mutations are introduced into the plant genome using heavy ion beam irradiation or chemical mutagens, the EMF3 gene or a part thereof can be amplified by PCR, and then individuals with mutations in the amplified product can be selected by TILLING or the like.
[0055] Furthermore, by crossing plants into which mutations have been introduced using the method described above with wild-type plants and then performing a backcross, it is possible to remove mutations introduced into sequences other than the target EMF3 gene.
[0056] Plants into which a mutation has been introduced into the EMF3 gene may be heterozygotes (for example, heterozygotes consisting of a wild type and an EMF3 gene mutant) or homozygotes, as long as the flowering time is controlled, as shown in the examples described below. Homozygotes can be selected from F1 plants, for example, by crossing the heterozygotes with each other to obtain F1 plants, and then selecting homozygotes from the F1 plants that have the introduced EMF3 gene mutation. In this case, "plants that are homozygotes having the introduced EMF3 gene mutation" include not only plants that have two alleles of the EMF3 gene with identical mutations, but also plants that have an EMF3 gene with a first mutation and an EMF3 gene with a second mutation.
[0057] In the present invention, the introduction of mutations into the EMF3 gene can be carried out in plants, seeds, or plant cells according to the methods described above. Plant cells include cultured cells as well as cells within the plant body. Furthermore, various forms of plant-derived cells are included, such as suspension culture cells, protoplasts, leaf sections, callus, immature embryos, pollen, etc.
[0058] Furthermore, in the present invention, the above-mentioned site-specific nucleases, fusion proteins, or DNA encoding a complex of guide RNA and protein, DNA encoding a transposon, etc., may be introduced into plant cells in a form inserted into a vector.
[0059] The vector into which the DNA for introducing a mutation into the EMF3 gene is inserted is not particularly limited as long as it is capable of expressing the inserted gene in plant cells, but it may contain a promoter for constitutive or inductive expression of the DNA. Examples of promoters for constitutive expression include the rice ubiquitin promoter, the cauliflower mosaic virus 35S promoter, the rice actin promoter, and the maize ubiquitin promoter. Examples of promoters for inductive expression include promoters known to be expressed by external factors such as infection or invasion by filamentous fungi, bacteria, or viruses, low temperature, high temperature, drought, ultraviolet irradiation, and spraying of specific compounds. Furthermore, as a promoter for expressing DNA encoding a short RNA such as guide RNA as the DNA according to the present invention, poll III-type promoters such as the U6 promoter are preferably used.
[0060] Various methods known to those skilled in the art can be used to introduce the DNA or a vector containing the DNA into plant cells, such as particle bombardment, the Agrobacterium method (Agrobacterium method), the polyethylene glycol method, and electroporation.
[0061] Furthermore, even without taking the form of DNA, the aforementioned site-specific nucleases and fusion proteins can be introduced into plant cells as proteins, and the aforementioned guide RNA can be introduced as RNA, thereby inducing mutations.
[0062] Thus, in the present invention, the flowering time of plants can be adjusted by using substances that target the EMF3 gene, such as the DNA, the vector into which the DNA is inserted, the protein, and the RNA. Accordingly, the present invention can also provide a drug for adjusting the flowering time of plants, which contains as an active ingredient at least one substance that targets the EMF3 gene, selected from the group consisting of the DNA, the vector into which the DNA is inserted, the protein, and the RNA.
[0063] Such a drug may be configured to contain two active ingredients in a single composition, or it may be configured to contain two active ingredients in separate compositions (a so-called kit). In addition, the drug of the present invention may contain other components such as buffer solutions, stabilizers, preservatives, and antiseptics in addition to the above-mentioned substances.
[0064] Furthermore, by regenerating a plant from cells into which a mutation has been introduced into the EMF3 gene according to the present invention using the methods described above, it is possible to obtain a plant with a controlled flowering time.
[0065] For example, in rice, methods for producing transgenic plants include a method of regenerating plants by introducing genes into protoplasts using polyethylene glycol (Datta, S.K. In Gene Transfer To Plants (Potrykus I and Spagenberg Eds.) pp66-74, 1995), a method of regenerating plants by introducing genes into protoplasts using electrical pulses (Toki et al. Plant Physiol. 100, 1503-1507, 1992), a method of regenerating plants by directly introducing genes into cells using the particle gun method (Christou et al. Bio / technology, 9:957-962, 1991), and a method of regenerating plants by introducing genes via Agrobacterium (Hiei et al. Several techniques have already been established and are widely used in the technical field of the present invention, such as those described in al. Plant J. 6:271-282, 1994, Takuma Ishizaki, Mol. Breeding, 2016, Vol. 36, Article No. 165).
[0066] For maize, examples include the methods described by Shillito et al. (Bio / Technology, 7:581, 1989) and Golden-Kamm et al. (Plant Cell 2:603, 1990).
[0067] Suitable methods for regenerating sorghum plants include, for example, the Agrobacterium method or the particle gun method, which involves gene transfer into immature embryos or callus to regenerate the plant, and pollination using pollen genetically modified by ultrasound (J.A. Able et al., In Vitro Cell. Dev. Biol. 37:341-348, 2001; A.M. Casas et al., Proc. Natl. Acad. Sci. USA 90:11212-11216, 1993; V. Girijashankar et al., Plant Cell Rep 24:513-522, 2005; J.M. JEOUNG et al., Hereditas 137:20-28, 2002, V Girijashankar et al. , Plant Cell Rep 24(9):513-522, 2005, Zuo-yu Zhao et al. , Plant Molecular Biology 44:789-798, 2000, S. Gurel et al. , Plant Cell Rep 28(3):429-444, 2009, ZY Zhao, Methods Mol Biol, 343:233-244, 2006, AK Shrawat and H Lorz, Plant Biotechnol J, 4(6): 575-603, 2006, D Syamala and P Devi Indian J Exp Biol, 41(12): 1482-1486, 2003, Z Gao et al. , Plant Biotechnol J, 3(6):591-599, 2005).
[0068] For example, methods for producing transgenic plants related to wheat include those described by Tingay et al. (Tingay S. et al. Plant J. 11:1369-1376, 1997), Murray et al. (Murray F et al. Plant Cell Report 22:397-402, 2004), Travalla et al. (Travalla S et al. Plant Cell Report 23:780-789, 2005), Vasil et al. (Vasil V. et al. Nat Biotechnology 10:667-674, 1992), and Ishida et al. (Ishida Y. et al. Methods in The method described in Molecular Biology 1223:189-193, 2015) can be cited.
[0069] For Arabidopsis thaliana, methods include the floral dip method (Clough SJ & Bent AF, Plant J 16:735-743, 1998) and the method by Akama et al. (Akama et al. Plant Cell Reports 12:7-11, 1992).
[0070] For tomatoes, examples include the methods described by Matsukura et al. (J. Exp. Bott., 44: 1837-1845, 1993), Sun et al. (Plant cell physics, 2006; 47(3): 426-431), and Sonia Hamza et al. (J. Exp. Bott., 44: 1837-1845, 1993).
[0071] For soybeans, one example is the method described in the U.S. Patent Publication No. 5,416,011.
[0072] Furthermore, transformation and regeneration into plants can be carried out using methods such as those described in Tabei et al. (ed., Yutaka Tabei, "Transformation Protocols [Plant Edition]", Kagaku Dojin Co., Ltd., published September 20, 2012).
[0073] (Plants with regulated flowering time) By the methods described above, etc., it is possible to obtain plants in which a mutation is artificially introduced into the EMF3 gene and the flowering time is regulated. Therefore, the present invention relates to plants in which a mutation is artificially introduced into the EMF3 gene and the flowering time is regulated.
[0074] As described above, the EMF3 gene, the introduction of mutations into it, and the plants whose flowering time is regulated by the introduction of such mutations are as described in the present invention. Furthermore, once a plant body in which the flowering time has been regulated by artificially introducing mutations into the EMF3 gene is obtained, it is possible to obtain offspring from the plant body through sexual or asexual reproduction. Moreover, it is possible to obtain reproductive materials (e.g., seeds, cuttings, stems, callus, protoplasts, etc.) from the plant body, its offspring, or clones, and mass-produce the plant body based on these materials. Therefore, the present invention includes offspring and clones of plants whose flowering time has been regulated, as well as their reproductive materials. Examples of reproductive materials include seeds, stems, callus, and protoplasts.
[0075] Furthermore, in plants whose flowering time is controlled according to the present invention, it is desirable to exclude "EMF20," hybrids with "EMF20," and progeny of "EMF20." It is also desirable to exclude rice lines into which qEMF3 has been introduced. However, this does not apply to rice hybrids, progeny, and rice lines in which, in addition to the mutation in "EMF20" involving the substitution of leucine at position 61 to phenylalanine, other mutations (for example, mutations involving substitution of other amino acids at positions 560 and / or 563) have been introduced into the EMF3 gene, and these may be included in plants whose flowering time is controlled according to the present invention.
[0076] The present invention will be described more specifically below based on examples, but the present invention is not limited to the following examples.
[0077] (Example 1) Identification of the gene responsible for early morning flowering The inventors have selected an early morning flowering line "EMF20" (Norin 29 tetraploid / O. officinalis / Koshihikari) derived from an interspecific hybrid of O. sativa and the rice distant relative C genome wild species O. officinalis. Furthermore, in order to elucidate the genetic factors of early morning flowering in "EMF20", quantitative trait locus (QTL) analysis was performed, and the early morning flowering QTL; qEMF3 was identified. The inventors have also succeeded in creating near-isogenic lines (NILs) by introducing qEMF3 into the genetic backgrounds of the Indian rice varieties "Nanjing 11" and "IR64". They have also revealed that the flowering time of these NILs is earlier (Non-Patent Documents 1-3). Furthermore, as shown in Figure 1, the inventors have developed an early-flowering line, "Koshihikari + qEMF3," by introducing qEMF3 into the Japanese rice variety "Koshihikari" and others.
[0078] In this study, to identify the gene responsible for early morning flowering, further QTL analysis was performed using the aforementioned NILs and their background parent varieties. More specifically, the F2 recombinant individuals 6110 of Nanjing 11 and Nanjing 11 + qEMF3, and the F2 recombinant individuals 1248 of IR64 and IR64 + qEMF3 were analyzed to narrow down the gene region related to early morning flowering. Furthermore, using the F3 generation of four individuals, the gene region was limited to 61-kb between RM14380 (chromosome 3, 2,484,467) and HID3010 (chromosome 3, 2,546,128). In Hirabayashi 2015, RM14360 (chromosome 3, 2,055,583), RM14374 (chromosome 3, 2,386,958), and RM14394 (chromosome 3, 2,813,89) were reported as markers (SSR markers) located near qEMF3. Whole-genome sequencing was then performed on these candidate regions in relation to IR64+qEMF3.
[0079] As a result, we successfully identified Os03g0145400, which had a single nucleotide substitution in its exon. We found that this single nucleotide substitution caused the 61st leucine in the amino acid sequence encoded by the identified gene (rice EMF3 gene) (the amino acid sequence described in SEQ ID NO: 1) to be replaced with phenylalanine, and that this amino acid substitution contributes to accelerating the flowering time.
[0080] The cDNA sequence of the rice EMF3 gene is shown in Sequence ID No. 15, and the CDS sequence of the rice EMF3 gene is shown in Sequence ID No. 16. Regarding the CDS sequence, prior to filing this application, the annotation results from the public database RAP-DB were as shown second from the top in Figure 11. However, as a result of detailed experimental analysis by the present inventors, including RT-PCR and cDNA cloning, we succeeded in identifying the sequence shown first from the top in Figure 11 as the accurate transcription unit at this gene locus, and the annotation results from the aforementioned public database revealed that amino acids at positions 440-591 of the rice EMF3 protein are deleted.
[0081] (Example 2) Production of mutants by Tilling Method Using the Targeting Induced Local Lessons In Gene (Tilling) method, mutant populations of "Koshihikari" and "Toyomeki" rice were produced by mutagen treatment, and individuals in which mutations were induced in the rice EMF3 gene were screened from among them. Specifically, mutants of the gene were produced by the following method.
[0082] (1) 200g of "Koshihikari" seeds (also called "M0 seeds") were soaked in water at 28°C for 24 hours, and then treated with 500mL of 20mM ethylnitrosourea (ENU) at 28°C for 10 hours. The resulting seeds (also called "M1 seeds") were then washed five times with 500mL of water for 5 minutes each, followed by 5L of water for 16 hours. After that, they were germinated in a 28°C incubator and cultivated in seedling trays filled with a soil mixture of equal parts Bonsol No. 1 and fertilizer-free turf soil. When seedlings reached 15cm or taller, they were transplanted to the experimental field, one ear of rice was taken from each plant, and M2 individuals were cultivated to create a "Koshihikari ethylnitrosourea mutant population (ENU)" consisting of 768 individuals.
[0083] (2) 200g of Koshihikari seeds (M0 seeds) were soaked in water at 28°C for 24 hours, then treated with 3mM sodium azide at 28°C for 10 hours in 500mL of 50mM sodium phosphate buffer (pH 3.0) to produce seeds (M1), then treated with 50mM sodium phosphate buffer (pH 7.0) for 10 minutes to neutralize, followed by four washes of 500mL of water for 5 minutes each, and then washing with 5L of water for 16 hours. After that, the seeds were germinated in a 28°C incubator and cultivated in seedling trays filled with a soil mixture of equal parts Bonsol No. 1 and fertilizer-free turf soil. When seedlings reached 15cm or taller, they were transplanted to the experimental field, one panicle was taken from each plant, and a "Koshihikari sodium azide mutant population (Az3)" consisting of 768 individuals was created.
[0084] (3) 200 g of Koshihikari rice seeds were soaked in water at 28°C for 24 hours, then treated with 500 mL of 0.03% diepoxybutane (DEB) at 28°C for 12 hours, washed five times with 500 mL of water for 5 minutes each, and then washed with 5 L of water for 16 hours. After that, the seeds were germinated, raised, transplanted, cultivated, and harvested, and two grains were harvested from each individual. Furthermore, as a second mutagen treatment, the seeds were soaked in water at 28°C for 24 hours, then treated with 0.06% DEB at 28°C for 12 hours, washed five times with water for 5 minutes each, and then washed with 5 L of water for 16 hours. After that, the seeds were germinated, raised, transplanted, cultivated, and harvested, and one grain was harvested from each individual, creating a "Koshihikari DEB double-treated mutant population (DEBx2)" consisting of 1,536 individuals.
[0085] (4) The Koshihikari rice plants cultivated in the field were transplanted into pots, all but the open flowers were removed, and the flowers four hours after opening were treated with 30 mM methylnitrosourea (MNU) at room temperature for one hour. The plants were then cultivated and harvested. The harvested seeds were cultivated and collected to create a Koshihikari methylnitrosourea mutant population (MNU2) consisting of 2,304 individuals.
[0086] (5) 200g of Koshihikari seeds (M0 seeds) were soaked in water at 28°C for 24 hours, then treated with 2mM sodium azide at 28°C for 10 hours in 500mL of 50mM sodium phosphate buffer (pH 3.0) (M1 seeds), then treated with 50mM sodium phosphate buffer (pH 7.0) for 10 minutes to neutralize, then washed four times with 500mL of water for 5 minutes each, followed by washing with 5L of water for 16 hours. After that, the seeds were germinated in a 28°C incubator, raised as seedlings, and transplanted to the experimental field. One seed was harvested from each plant, yielding 2,400 seeds. Furthermore, these seeds were treated with 0.75% ethyl methanesulfonic acid (EMS) for 12 hours, washed five times for 5 minutes each, and then washed again with 5 liters of water for 16 hours. After germination, seedling cultivation, transplanting, cultivation, and harvesting, one seed was harvested from each individual plant, creating a "Koshihikari sodium azide-ethyl methanesulfonic acid mutant population (AzE)" consisting of 1,536 individuals.
[0087] (6) "Toyomeki" seeds (M0 seeds) were treated under the same conditions as in (1), and a "Toyomeki sodium azide treated population (ToyAz)" consisting of 6,144 individuals was created.
[0088] DNA was extracted from M2 individuals (1) to (6), and the DNA obtained by mixing the DNA from the two individuals was used as a template to amplify the rice EMF3 gene by performing PCR or other methods on combinations of 5400_p1_F1 (5' cgtttcgtttgcagatttccca 3' (SEQ ID NO: 17)) and 5400_p1_R2 (5' gcaagaacatcgccaccag 3' (SEQ ID NO: 18)) or 5400_p2_F1 (5' catcatgacggctttgcgg 3' (SEQ ID NO: 19)) and 5400_p2-R1 (5' tcacgtttttccactaccct 3' (SEQ ID NO: 20)). Then, thermal dissociation and reassociation were performed, and the mismatched portion due to the mutation was cleaved using Cel-I nuclease to detect the mutation site. The positional relationship of these primers on the rice EMF3 gene is shown in Figure 11.
[0089] Using the Tilling method, 44 lines with the Os03g0145400 mutation were selected from the mutant populations of "Koshihikari" and "Toyomeki". These 44 lines are shown in Tables 3 and 4 below. Furthermore, analysis was performed on 38 lines with sufficient seeds (31 "Koshihikari" mutant lines and 7 "Toyomeki" mutant lines) (these 38 lines are numbered 1 to 38 in Tables 3 and 4).
[0090]
[0091]
[0092] Then, in these 38 Tilling strains, lines with clear variations in flowering time were continuously backcrossed with the background parents, "Koshihikari" and "Toyomeki," up to the BC2 generation. In addition, SNP markers were prepared at each mutation point for genotyping analysis, and the genotypes of the progeny (mutant homozygous, heterozygous, wild-type homozygous) were identified.
[0093] If differences in flowering characteristics are observed among these three groups, which are divided by genotype, then the mutation can be determined to affect flowering characteristics. However, if no differences in flowering characteristics are observed, it is possible that mutations at other gene loci are involved. Therefore, in order to eliminate this possibility and to clean up the genetic background, a BC2 generation (the background parents, "Koshihikari" and "Toyomeki," were backcrossed twice: a total of three crosses) was created, and the flowering time of these was analyzed. Figures 2 to 9 show the analysis results of mutants in which differences in flowering characteristics were observed in the genotype-specific flowering survey of the BC2F2 generation.
[0094] The flowering survey by genotype was conducted outdoors after the plants were moved from the field to pots once their genotypes were determined. The survey of Koshihikari rice was conducted from August 2nd to 5th, 2023, and the survey of Toyomeki rice was conducted on August 16th and 18th, 2023. Both surveys were conducted at the Tanihara rice paddy of the National Agriculture and Food Research Organization (NARO) in Tsukubamirai City, Ibaraki Prefecture, Japan. The temperature and sunshine hours at that time are shown in Figure 10. The morning of August 18th was slightly cloudy, but as shown in the figure, the weather was almost the same throughout the survey days.
[0095] In Figures 1-9, the "Flowering Spiraea Rate (%)" shown on the vertical axis represents the ratio of the number of glumes that bloomed at each time (every 30 minutes) to the total number of glumes that bloomed on the surveyed day (9:00 AM to 5:00 PM). However, in Figure 7B, the vertical axis shows the ratio of the cumulative number of glumes that bloomed up to each time point to the total number of glumes. Furthermore, compared with the standard varieties (background parent varieties: Koshihikari, Toyomeki), the varieties were evaluated as early-blooming, late-blooming, loss of synchronicity, etc., based on the following criteria. Early blooming: Blooms more than one hour earlier than the background parent variety. Slightly early blooming: Blooms about 30 minutes earlier than the background parent variety. Normal blooming: Blooms with the same flowering characteristics (flowering progression) as the background parent variety. Slightly late blooming: Blooms about 30 minutes later than the background parent variety. Late blooming: Blooms more than one hour later than the background parent variety (including gradual blooming). Loss of synchronicity: Blooms throughout the surveyed time period (9am to 5pm), with a flowering glume rate of 20% or less at each observation time.
[0096] Furthermore, for the mutants shown in Figures 2-9, the base sequences including each mutant site were determined using 5400_p1_F1 for T90S and T100I, 5400_p1_MR1 (5' ACGAGGTCCATGTGCAGG 3' (Sequence ID: 21)) for L215R, 5400_p1_MF1 (5' TGCTGTTCCCTCCGGAGAAG 3' (Sequence ID: 22)) for E296G, 5400_p1_MR1 (5' ttctcggccatgattgtcct 3' (Sequence ID: 23)) for D547V, 5400_p2_MR1 (5' ttctcggccatgattgtcct 3' (Sequence ID: 23)) for N561I and T563I, and 5400_p2-R1 for L719*. The positional relationship between these primers and the mutant sites with each amino acid substitution in the rice EMF3 gene is shown in Figure 11.
[0097] As shown in Figure 2, the substitution of the 90th amino acid from threonine (T) in the cultivar to serine (S) in the mutant resulted in a later flowering time in the homozygous line compared to the standard cultivar. On the other hand, the flowering time in the heterozygous line was slightly later than that of the standard cultivar.
[0098] As shown in Figure 3, the substitution of the 100th amino acid from threonine (T) in the cultivar to isoleucine (I) in the mutant resulted in the loss of a clear peak in flowering time in the homozygous line, meaning there was no concentrated period of flowering, and the synchronicity was lost. On the other hand, in the heterozygous line, the flowering time was later compared to the standard cultivar.
[0099] As shown in Figure 4, the substitution of amino acid 215 from leucine (L) in the variety to arginine (R) in the mutant resulted in the loss of a clear peak in flowering time in the homozygous line, meaning there was no concentrated period of flowering, and the synchronicity was lost. On the other hand, in the heterozygous line, the flowering time was later compared to the standard variety.
[0100] As shown in Figure 5, the substitution of the 296th amino acid from glutamic acid (E) in the variety to glycine (G) in the mutant resulted in a later flowering time in the homozygous line compared to the standard variety, while no significant difference in flowering time was observed in the heterozygous line.
[0101] As shown in Figure 6, the substitution of amino acid 547 from aspartic acid (D) in the variety to valine (V) in the mutant resulted in the loss of a clear peak in flowering time in the homozygous line, meaning there was no concentrated period of flowering, and synchronization was lost. On the other hand, in the heterozygous line, the flowering time was later compared to the standard variety.
[0102] As shown in Figure 7A, the substitution of amino acid 560 from asparagine (N) in the cultivar to isoleucine (I) in the mutant resulted in a significantly earlier flowering time in the heterozygous line compared to the standard cultivar. On the other hand, the homozygous line lacked a clear peak in flowering time, meaning there was no concentrated period of flowering, and the synchronicity was lost. This trend was also observed in Figure 7B, which shows the cumulative value of the flowering glume rate.
[0103] As shown in Figure 8A, the substitution of amino acid 563 from threonine (T) in the cultivar to isoleucine (I) in the mutant resulted in a significantly earlier flowering time in the homozygous line compared to the standard cultivar. On the other hand, no significant difference in flowering time was observed in the heterozygous line compared to the standard cultivar.
[0104] Furthermore, when a flowering survey was conducted by aligning the heading times of Japonica and Indica varieties, the flowering times of the Indica variety "IR64," which is widely cultivated in tropical and subtropical regions, and the flowering time modified line of "Toyomeki," in which the 563rd amino acid is substituted from threonine (T) in the variety to isoleucine (I) in the mutant, were found to be perfectly aligned (Figure 8B). (Normally, "Toyomeki" heads in early August and "IR64" heads in mid-August, making it impossible to conduct a flowering time survey on the same day. However, by delaying the transplanting of the "Toyomeki" background, the heading times of the "Toyomeki" background and "IR64" were aligned.)
[0105] Furthermore, as mentioned above (as shown in Figure 11), the existence of regions containing amino acids 547, 560, and 563 in the EMF3 protein is not indicated in any public database. Therefore, it was previously difficult to conceive of introducing mutations targeting at least these amino acids.
[0106] As shown in Figure 9, the 719th amino acid was substituted from leucine (L) in the variety to a stop codon (*) in the mutant, and it is thought that the function of the Os03g0145400 gene was lost. Furthermore, in this line, both homozygous and heterozygous lines lost a clear peak in flowering time, meaning that there was no time period in which flowering was concentrated, and the synchronicity was lost.
[0107] Furthermore, as shown in Figure 1, in the original early-blooming qEMF3 line, as described above, the substitution of the 61st amino acid from leucine (L) in the variety to phenylalanine (F) in the mutant results in a significantly earlier flowering time in homozygous plants compared to the standard variety. Although not shown in the figure, heterozygous lines also bloom earlier than the standard variety (see Non-Patent Literature 2, Figure 2, etc.).
[0108] (Example 3) Genesis of mutants by genome editing A line was created in which a mutation was introduced into the rice EMF3 gene by genome editing, and the flowering time of these lines was evaluated.
[0109] (Plasmid Construction) In order to perform base substitution type genome editing, a binary vector for cytosine base substitution type genome editing was constructed. First, the following three sequences were selected as target sequences (sgRNA sequences) for genome editing in the EMF3 gene: sgRNA sequence 1: 5'-CGCCGTCCTCGAGAAGGCGG-3' (SEQ ID NO: 24), sgRNA sequence 2: 5'-CACCACCAGCAGCCGGTGA-3' (SEQ ID NO: 25), sgRNA sequence 3: 5'-GTGCACCTAGCCCGGGCGACG-3' (SEQ ID NO: 26). It was assumed that by targeting sgRNA sequences 1 and 3, cytosine (C) around positions 186 and 1688 of the EMF3 gene cDNA (SEQ ID NO: 15), respectively, would be replaced with thymine (T). Furthermore, since sgRNA sequence 2 targets the antisense strand, it was assumed that guanine (G) around position 315 of the EMF3 gene cDNA (sequence number: 15) would be replaced with adenine (A).
[0110] Next, these sgRNA sequences were cloned into the BbsI site of an sgRNA expression vector in order to express them (Masafumi Mikami et al., Plant Mol. Biol., August 2015, Vol. 88, No. 6, pp. 561-572). Furthermore, these sgRNA cassettes were excised and inserted into the AscI / PacI sites, respectively, of the cytosine base substitution type genome editing binary vector pZH_AmUbi_nSpCas9-NG_AID_UGI (Masafumi Mikami et al., Plant Mol. Biol., August 2015, Vol. 88, No. 6, pp. 561-572).
[0111] (Creation of rice mutants) The binary vector plasmid was introduced into the Agrobacterium tumefaciens LBA4404 strain by electroporation using an Eppendorf Eporator (registered trademark, Eppendorf GmbH, Hamburg, Germany). Transgenic rice was produced using the Agrobacterium method with immature embryos (Takuma Ishizaki, Mol. Breeding, 2016, Vol. 36, paper number: 165). The presence of the transgene was confirmed by PCR using primer pairs HPT F (5'-TCGTGCTTTCAGCTTCGATG-3' (SEQ ID NO: 27)) and HPT R (5'-TCCATCACAGTTTGCCAGTG-3' (SEQ ID NO: 28)) that amplify a portion of the hydroxyl kinase (HPT) gene contained in the T-DNA region of the binary vector. The target region of the T0 transformants created using the binary vector was analyzed by DNA sequencing. The base substitutions introduced in the created mutants and the resulting amino acid substitutions are shown in Table 5 below.
[0112]
[0113] (Cultivation of Breeding Lines) T0 plants with mutations in the target region were grown in pots in a glass greenhouse at the Tropical and Island Research Station (TARF, JIRCAS; 124°1'E, 24°2'N) of the Japan International Research Center for Agricultural Sciences, located on Ishigaki Island, Okinawa Prefecture. The temperature was controlled to 30°C during the day and 25°C at night, to mimic natural day length conditions. From the obtained T1 seeds, T1 plants that retained the target mutation in a homozygous state were selected and grown in the greenhouse. T2 seeds harvested from homozygous T1 plants were used to observe the flowering time. The changes in flowering time in various mutants were then evaluated. The evaluation criteria for early flowering, late flowering, loss of synchrony, etc., are as described above.
[0114] (Results) As shown in Figure 12, the substitution of the 62nd amino acid from alanine (A) in the variety to valine (V) in the mutant resulted in a later flowering time in the homozygous line compared to the standard variety.
[0115] As shown in Figure 13, when the 105th amino acid was substituted from valine (V) in the variety to isoleucine (I) in the mutant, the homozygous line flowered slightly later than the standard variety. Furthermore, when the 104th and 105th amino acids were substituted from valine (V) and valine (V) in the variety to isoleucine (I) and isoleucine (I) in the mutant, respectively, the homozygous line flowered later than the standard variety. In addition, when the 104th, 105th, and 106th amino acids were substituted from valine (V), valine (V), and glutamic acid (E) in the variety to isoleucine (I), isoleucine (I), and lysine (K) in the mutant, the homozygous line flowered later than the standard variety.
[0116] As shown in Figure 14, the substitution of amino acids 562 and 563 from cysteine (C) and threonine (T) in the cultivar to tryptophan (W) and isoleucine (I) in the mutant resulted in later flowering times in the homozygous lines compared to the standard cultivar. On the other hand, the heterozygous lines flowered slightly earlier than the standard cultivar.
[0117] Thus, it has become clear that the flowering time can be regulated by introducing a mutation involving at least one of the above 13 amino acid substitutions into the EMF3 gene. Furthermore, as shown in Figures 15A to 15E, the amino acids in these regions are highly conserved across various plants. In other words, mutations involving any of the above eight amino acid substitutions can regulate the flowering time of a wide range of crops, not just rice.
[0118] As explained above, the present invention makes it possible to adjust the flowering time of plants. Consequently, by shifting the flowering time of plants that normally flower during the hottest part of the day to early morning when temperatures are lower, it becomes possible to avoid sterility. Furthermore, by advancing or delaying the flowering time, or by losing the peak of the flowering time (losing synchronicity), it becomes possible to overlap the flowering times of different lines, thereby improving the production efficiency of hybrid seeds. For example, as shown in Figure 8B, by matching the flowering times of different varieties (in this case, "Toyomeki" and "IR64"), it becomes easier to obtain these hybrid seeds. In particular, in China and India, where hybrid rice is widely cultivated, there is a need for technology to adjust the flowering times of the parents to the same time in order to obtain F1 hybrid vigor such as high yield. Therefore, the present invention can be suitably used in the production of hybrid rice seeds utilizing F1 hybrid vigor.
[0119] Therefore, the present invention is extremely useful in the agricultural field, as it contributes to stabilizing crop production and improving the production efficiency of hybrid seeds.
Claims
A method for producing plants with controlled flowering time, comprising the step of introducing a mutation into a gene encoding an amino acid sequence that has 90% or more identity with any of the amino acid sequences described in Sequence IDs 1 to 14. The manufacturing method according to claim 1, wherein the mutation introduced into the gene is a mutation that causes the deletion, insertion, and / or substitution of one or more amino acids in at least one of the regions (a) to (d) below. (a) Sequence ID: A region consisting of the amino acid sequence from position 50 to 121 described in 1 or the amino acid sequence corresponding to said sequence. (b) Sequence ID: A region consisting of the amino acid sequence at positions 209 to 302 described in 1 or the amino acid sequence corresponding to said sequence. (c) Sequence ID: A region consisting of the amino acid sequence at positions 541 to 564 described in 1 or the amino acid sequence corresponding to said sequence. (d) Sequence ID: A region consisting of the amino acid sequence from position 690 to 720 described in 1, or the amino acid sequence corresponding to said sequence. The aforementioned adjustment of the flowering time involves bringing the flowering time forward. The manufacturing method according to claim 1, wherein the mutation introduced into the gene is a substitution of at least one of the following (1) to (3) with another amino acid. (1) Substitution of another amino acid at position 61 or the corresponding site as described in Sequence ID No. 1, (2) Substitution of other amino acids at position 560 or the corresponding site as described in Sequence ID No. 1, (3) Substitution of another amino acid at position 563 or the corresponding site as described in Sequence ID No.
1. The adjustment of the flowering time mentioned above involves delaying the flowering time. The manufacturing method according to claim 1, wherein the mutation introduced into the gene is a substitution of at least one of the following amino acids (4) to (13) for another amino acid. (4) Substitution of another amino acid at position 62 or the corresponding site as described in Sequence ID No. 1, (5) Substitution of other amino acids at position 90 or the corresponding site as described in Sequence ID No. 1, (6) Substitution of another amino acid at position 100 or the corresponding site as described in Sequence ID No. 1, (7) Substitution of another amino acid at position 104 or the corresponding site as described in Sequence ID No. 1, (8) Substitution of another amino acid at position 105 or the corresponding site as described in Sequence ID No. 1, (9) Substitution of another amino acid at position 106 or the corresponding site as described in Sequence ID No. 1, (10) Substitution of another amino acid at position 215 or the corresponding site as described in Sequence ID No. 1, (11) Substitution of another amino acid at position 296 or the corresponding site as described in Sequence ID No. 1, (12) Substitution of another amino acid at position 547 or the corresponding site as described in Sequence ID No. 1, (13) Substitution of another amino acid at position 562 or the corresponding site as described in Sequence ID No.
1. Plants in which the flowering time has been regulated by artificially introducing mutations into a gene encoding an amino acid sequence that has 90% or more identity with any of the amino acid sequences described in Sequence ID No. 1 to 14. The mutation introduced into the gene is a mutation that causes the deletion, insertion, and / or substitution of one or more amino acids in at least one of the regions (a) to (d) below, according to claim 5. (a) Sequence ID: A region consisting of the amino acid sequence from position 50 to 121 described in 1 or the amino acid sequence corresponding to said sequence. (b) Sequence ID: A region consisting of the amino acid sequence at positions 209 to 302 described in 1 or the amino acid sequence corresponding to said sequence. (c) Sequence ID: A region consisting of the amino acid sequence at positions 541 to 564 described in 1 or the amino acid sequence corresponding to said sequence. (d) Sequence ID: A region consisting of the amino acid sequence from position 690 to 720 described in 1, or the amino acid sequence corresponding to said sequence. The aforementioned adjustment of the flowering time involves bringing the flowering time forward. The plant according to claim 5, wherein the mutation introduced into the gene is a substitution of at least one of the following (1) to (3) with another amino acid. (1) Substitution of another amino acid at position 61 or the corresponding site as described in Sequence ID No. 1, (2) Substitution of other amino acids at position 560 or the corresponding site as described in Sequence ID No. 1, (3) Substitution of another amino acid at position 563 or the corresponding site as described in Sequence ID No.
1. The adjustment of the flowering time mentioned above involves delaying the flowering time. The plant according to claim 5, wherein the mutation introduced into the gene is a substitution of at least one of the following amino acids (4) to (13) for another amino acid. (4) Substitution of another amino acid at position 62 or the corresponding site as described in Sequence ID No. 1, (5) Substitution of other amino acids at position 90 or the corresponding site as described in Sequence ID No. 1, (6) Substitution of another amino acid at position 100 or the corresponding site as described in Sequence ID No. 1, (7) Substitution of another amino acid at position 104 or the corresponding site as described in Sequence ID No. 1, (8) Substitution of another amino acid at position 105 or the corresponding site as described in Sequence ID No. 1, (9) Substitution of another amino acid at position 106 or the corresponding site as described in Sequence ID No. 1, (10) Substitution of another amino acid at position 215 or the corresponding site as described in Sequence ID No. 1, (11) Substitution of another amino acid at position 296 or the corresponding site as described in Sequence ID No. 1, (12) Substitution of another amino acid at position 547 or the corresponding site as described in Sequence ID No. 1, (13) Substitution of another amino acid at position 562 or the corresponding site as described in Sequence ID No. 1.
Citation Information
Patent Citations
Related protein for controlling early flowering time of oryza sativa and coding gene of related protein
CN113774037A