Constructs and vectors for treatment of diamond-blackfan anemia

The use of ribosomal protein-encoding constructs and vectors in autologous gene therapy for DBA addresses the limitations of current treatments by optimizing codon usage and improving therapeutic efficacy and safety, effectively treating DBA symptoms.

WO2026061636A1PCT designated stage Publication Date: 2026-03-26APRILIGEN INC +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/035005
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-01-31
Filing Date
2025-09-22
Publication Date
2026-03-26

AI Technical Summary

Technical Problem

Current therapeutic options for Diamond-Blackfan Anemia (DBA) are limited, with gene therapy being complex and unpredictable due to challenges in predicting therapeutic efficacy and safety, and existing treatments like corticosteroids and hematopoietic stem cell transplantation having significant limitations and risks.

Method used

Development of constructs and vectors encoding ribosomal proteins (RPS19, RPS17, RPS24, RPS10, RPL35a, RPL11, RPS26, RPL5) for autologous gene therapy, optimized for human codon usage, and lentiviral vectors for efficient expression, along with methods for monitoring therapeutic response and cell manufacturing.

Benefits of technology

The constructs and vectors effectively ameliorate DBA symptoms by enhancing erythropoiesis, improving blood cellularity and hemoglobin levels, and providing a safer, more predictable gene therapy approach.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000070_0001
    Figure IMGF000070_0001
  • Figure IMGF000071_0001
    Figure IMGF000071_0001
  • Figure IMGF000132_0001
    Figure IMGF000132_0001
Patent Text Reader

Abstract

In the field of gene therapy, a major hurdle is the design and identification of constructs and gene therapy vectors providing therapeutic effects while displaying satisfactory safety profiles. In the treatment of Diamond-Blackfan Anemia (DBA), therapies alleviating several crucial anemia symptoms, such as blood or bone marrow cellularity, hemoglobin levels, erythrocytes levels, or platelet levels, while showing satisfactory safety profiles remain a challenge. The present invention provides constructs encoding ribosomal protein genes involved in DBA, such as genes encoding RPS19, RPS17, RPS24, RPS10, RPL35a, RPL11, RPS26, and RPL5, vectors, methods, cells, and medical uses thereof, addressing these challenges and finding particular applications in the field of autologous cell therapy treatment of DBA. Further, the present invention provides a non-genotoxic conditioning protocol for preparing a subject prior to cell therapy treatment for DBA using construct of the present invention.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] P7403PC00

[0002] Constructs and vectors for treatment of Diamond-Blackfan anemia

[0003] Technical field

[0004] The present invention relates to constructs, and vectors encoding ribosomal proteins which find applications in autologous cell therapy for Diamond-Blackfan Anemia (DBA). The constructs, vectors cells and methods described herein are for example capable of rescuing several symptoms of DBA and modifying the disease. The present invention also provides methods for monitoring the response to gene therapy treatment using such constructs and vectors.

[0005] Background

[0006] Diamond-Blackfan Anemia (DBA) is a rare genetic disorder (inherited bone marrow failure syndrome) characterized by insufficient red blood cell (erythrocytes) production and decreased red blood cell progenitors in the bone marrow. DBA typically manifests within the first year of life, although in rare cases where anemia is absent, the diagnosis may not occur until adulthood. Approximately 70-80% of DBA has an identifiable genetic defect, most commonly an autosomal dominant mutation in a ribosomal protein (RP) gene, the most prominent being the RPS19 gene.

[0007] Managing anemia in DBA patients usually requires lifelong treatment. Current therapeutic options are limited and include corticosteroid administration, which is longterm effective in 30-40% of patients, regular blood transfusions, which are necessary for about 30-40% of patients, and hematopoietic stem cell transplantation (HSCT), the only curative option but applicable to a minority of patients (Wlodarski et al., 2024).

[0008] Spontaneous remission is rare, and biological stresses such as infections or pregnancy can trigger a relapse.

[0009] Gene therapy, particularly autologous gene therapy, has shown great potential for treating genetic disorders by introducing therapeutic transgenes into a patient's own cells. Gene therapy targeting the genetic mutations responsible for DBA thus represents a promising potential cure.

[0010] One approach to enhance the efficacy of these therapies is codon optimization, where the therapeutic gene’s codon sequence is altered to align with human codon usage P7403PC00 preferences. This modification can lead to increased protein expression and stability, making it a valuable tool in improving gene therapy outcomes. However, despite these advantages, the application of codon optimization in gene therapy remains complex and unpredictable.

[0011] The challenges of codon optimization arise from the difficulty in predicting therapeutic efficacy and safety. While optimizing codons can enhance expression, the specific impact varies based on disease type, target tissues, and individual patient factors. Previous attempts to develop a gene therapy vector for infantile malignant osteopetrosis for example (Thudium et al. 2016) showed that although mRNA expression of the codon-optimized transgene (coTCIRGI) was increased, codonoptimization had also interfered with an unknown regulatory mechanism preventing the protein from being expressed from the transcript, and resulting in lower functional rescue.

[0012] In the field of DBA, Gimenez et al. 2024 for instance reported a non-significant increase of mature erythroid cells in vitro following the transduction of DBA patients’ CD34+ cells with a vector comprising a codon-optimized version of the RPS19 gene. The study also showed that the use of the PGK promoter on the vector provided more consistent results compared to EF1a promoters, thus highlighting the difficulties in vector design providing optimal efficacy, safety and therapeutically relevant effects.

[0013] HSCT is associated with severe risks and lifelong complications, and no other potentially curative therapies exist, highlighting the urgent need for innovative gene therapy approaches to enhance therapeutic outcomes for DBA patients, in particular approaches enabling the improvement of crucial anemia symptoms such as impaired blood or bone marrow cellularity, hemoglobin levels, erythrocyte levels, or reticulocyte levels. The identification of constructs and gene therapy vectors providing such therapeutic effects thus remains a challenge.

[0014] Summary

[0015] The present invention provides solutions to this challenge. Most importantly, the constructs, vectors, cells and methods as disclosed herein ameliorate or rescue P7403PC00 symptoms of DBA. Most importantly, the constructs, vectors, cells and methods as disclosed herein can be used in a disease modifying treatment of DBA.

[0016] A first aspect of the invention relates to a construct which, upon expression, encodes a polypeptide selected from the group consisting of: RPS19 (SEQ ID NO. 1), RPS17 (SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, or SEQ ID NO. 5), RPS24 (SEQ ID NO.

[0017] 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10), RPS10 (SEQ ID NO. 11), RPL35a (SEQ ID NO. 12), RPL11 (SEQ ID NO. 13, SEQ ID NO. 14), RPS26 (SEQ ID NO. 15), and RPL5 (SEQ ID NO. 16), or a sequence having at least 70% identity to said SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO.

[0018] 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, or SEQ ID NO. 16.

[0019] A second aspect of the invention relates to a vector comprising the construct of the first aspect of the invention.

[0020] A third aspect of the invention relates to a method of manufacturing a transfer vector, said method comprising the steps of: a. providing the construct of the first aspect; and b. inserting the construct into a transfer vector backbone.

[0021] A fourth aspect of the invention relates to a host cell comprising the construct of the first aspect or vector of the second aspect of the present invention.

[0022] A fifth aspect of the present invention relates to lentiviral vector comprising the construct of the first aspect of the present invention.

[0023] A sixth aspect of the present invention relates to a method of manufacturing a lentiviral vector, said method comprising a step of transfecting a host cell with the vector of the second aspect of the present invention.

[0024] A seventh aspect of the present invention relates to a method of manufacturing a cell expressing a ribosomal protein gene, said method comprising the steps of: a. Providing a cell; and P7403PC00 b. Transducing said cell with the lentiviral vector of the fifth aspect, thereby obtaining a cell expressing a ribosomal protein gene.

[0025] An eighth aspect of the present invention relates to a method of manufacturing a cell expressing a ribosomal protein encoded by a ribosomal protein gene, said method comprising the steps of: a. Providing a cell; and b. Transducing said cell with the lentiviral vector of the fifth aspect, thereby obtaining a cell expressing the ribosomal protein encoded by the ribosomal protein gene.

[0026] A ninth aspect of the present invention relates to a cell obtained by method of the seventh or the eighth aspect.

[0027] A tenth aspect of the present invention relates to a cell comprising in its genome a codon-optimized ribosomal protein polynucleotide sequence described herein.

[0028] An eleventh aspect of the present invention relates to a composition comprising a sterile dispersion of the host cells of the fourth aspect or the cells of the ninth or tenth aspect of the present invention.

[0029] A twelfth aspect of the present invention relates to a pharmaceutical composition comprising the construct of the first aspect of the present invention, the vector of the second aspect of the present invention, the host cell of the fourth aspect of the present invention, the lentiviral vector of the fifth aspect of the present invention, the cell of the ninth or tenth aspect of the present invention, or the composition of the eleventh aspect of the present invention, and a pharmaceutically acceptable diluent or carrier.

[0030] A thirteenth aspect of the present invention relates to a method of treating Diamond- Blackfan anemia (DBA) in a subject, the method comprising administering the construct of the first aspect of the present invention, the vector of the second aspect of the present invention, the host cell of the fourth aspect of the present invention, the lentiviral vector of the fifth aspect of the present invention, the cell of the ninth or tenth aspect of the present invention, the composition of the eleventh aspect of the present P7403PC00 invention, or the pharmaceutical composition of the twelfth aspect of the present invention to the subject.

[0031] A fourteenth aspect of the present invention relates to the construct of the first aspect of the present invention, the vector of the second aspect of the present invention, the host cell of the fourth aspect of the present invention, the lentiviral vector of the fifth aspect of the present invention, the cell of the ninth or tenth aspect of the present invention, the composition of the eleventh aspect of the present invention, or the pharmaceutical composition of the twelfth aspect of the present invention, for use in medicine.

[0032] A fifteenth aspect of the present invention relates to the construct of the first aspect of the present invention, the vector of the second aspect of the present invention, the host cell of the fourth aspect of the present invention, the lentiviral vector of the fifth aspect of the present invention, the cell of the ninth or tenth aspect of the present invention, the composition of the eleventh aspect of the present invention, or the pharmaceutical composition of the twelfth aspect of the present invention, for use in treating Diamond- Blackfan anemia (DBA).

[0033] A sixteenth aspect of the present invention relates to the use of the construct of the first aspect of the present invention, the vector of the second aspect of the present invention, the host cell of the fourth aspect of the present invention, the lentiviral vector of the fifth aspect of the present invention, the cell of the ninth or tenth aspect of the present invention, the composition of the tenth aspect of the present invention, or the pharmaceutical composition of the twelfth aspect of the present invention, for the manufacture of a medicament for the treatment of Diamond-Blackfan anemia (DBA).

[0034] A seventeenth aspect of the present invention relates to a kit-of-parts comprising: a. the construct of the first aspect of the present invention, the vector of the second aspect of the present invention, the host cell of the fourth aspect of the present invention, the lentiviral vector of the fifth aspect of the present invention, the cell of the ninth or tenth aspect of the present invention, the composition of the tenth aspect of the present invention, and / or the pharmaceutical P7403PC00 composition of the twelfth aspect of the present invention; and b. instructions for use.

[0035] An eighteenth aspect of the present invention relates to a method of assessing a response in a subject suffering from DBA receiving or having received RPS19, RPS17, RPS24, RPS10, RPL35a, RPL11 , RPS26, or RPL5-based gene therapy, said method comprising the steps of: a. Determining the values of one or more markers selected from the group consisting of P53, CD70, BAX, RPS27L.RPL22L1 , and ADA in said subject after administration of the gene therapy; and b. Comparing said values with reference values of the one or more markers; and c. Assessing said response in said subject based on a comparison made in said comparing step, wherein a downregulation of the levels of CD70, BAX, RPS27L, or ADA, and / or an upregulation of the levels of RPL22L1 compared to the reference values is indicative of a response.

[0036] A nineteenths aspect of the present invention relates to a method for autologous gene therapy in a subject suffering from or suspected suffering from Diamond-Blackfan Anemia (DBA), the method comprising the steps of:

[0037] (a) mobilizing hematopoietic stem and progenitor cells (HSPCs) from the bone marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor;

[0038] (b) performing apheresis for collecting CD34+HSPCs;

[0039] (c) manufacturing a gene therapy product by genetic modification of the collected CD34+HSPCs ex vivo to express a functional transgene of RPS 19, RPS17, RPS24, RPS10, RPL35A, RPL11 , RPS26 or RPL5, wherein the genetic modification is performed by transducing the CD34+ HSPCs with the vector according the second and fifth aspect, thereby obtaining the gene therapy product;

[0040] (d) conditioning the subject by one of the following options i. performing non-genotoxic conditioning by performing a further mobilization of HSPCs from the bone marrow to the blood of the subject P7403PC00 using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor, and collecting CD34+HSPCs via apheresis; or ii. performing genotoxic conditioning by administering a genotoxic conditioning regimen comprising busulfan to the subject;

[0041] (e) administering the gene therapy product comprising genetically modified CD34+HSPCs to the subject via infusion.

[0042] A twentieth aspect of the present invention relates to method for autologous gene therapy in a subject suffering from or suspected suffering from an inherited bone marrow failure syndrome (IBMFS), the method comprising the steps of:

[0043] (a) mobilizing hematopoietic stem and progenitor cells (HSPCs) from the bone marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor;

[0044] (b) performing apheresis for collecting a cell population;

[0045] (c) manufacturing a gene therapy product by genetic modification of the collected cell population ex vivo to express a functional transgene, thereby obtaining the gene therapy product;

[0046] (d) conditioning the subject by one of the following options i. performing non-genotoxic conditioning by performing a further mobilization of HSPCs from the bone marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor, and collecting a further cell population via apheresis; or ii. performing genotoxic conditioning by administering a genotoxic conditioning regimen comprising busulfan to the subject;

[0047] (e) administering the gene therapy product comprising the genetically modified cell population to the subject via infusion.

[0048] Description of Figures

[0049] Figure 1 : Gene therapy cures the anemia and lethal bone marrow failure in a mouse model of RPS19-deficient Diamond-Blackfan anemia

[0050] The Rps19 knockdown mouse model and the design of lentiviral vectors. (A) Map of the clinical plasmid to be used for expression of the RPS19 gene. pCCL.EFS.rsp19co.pre#-KAN BB includes kanamycin resistance (unpublished data from the laboratory of Prof. Axel Schambach, Hannover Medical School Germany) P7403PC00

[0051] Size: 6748 base pairs (6.7 kb). (B) Overview of the modified loci. (C) Breeding strategy to adjust the level of Rps19 downregulation. (D) Overview of the generated vectors. (E- F) c-Kit-enriched hematopoietic progenitors (0.25x106) from the BM of uninduced mice were transduced and seeded in liquid cultures in the presence of doxycycline. (E) Cell counts on day 4. (E) Expression of endogenous RPS19 and vector-derived RPS19 on day 4. Data shown in (D) and (F) represent the average of two independent experiments with two technical replicates each. SA: splice acceptor; pA: polyadenylation signal; RSV: Rous sarcoma virus; ip:packaging signal; SD: splice donor; RRE: rev-response element; cPPt: polypurine tract. Black arrowheads in panel (A) indicate transcriptional start sites.

[0052] Enforced expression of RPS19 rescues the lethal bone marrow failure in Rps19- deficient mice. (G) Experimental strategy to validate the therapeutic potential of RPS19 gene correction. (H) Erythrocyte number, hemoglobin concentration, mean corpuscular volume (MCV), reticulocyte number, white blood cell number and platelet number on day 14 after doxycycline administration (n = 23, 24, 16, 16, 10 and 11 for the Control SFFV-GFP, Control SFFV-RPS19, D / + SFFV-GFP, D / + SFFV-RPS19, D / D SFFV-GFP and D / D SFFV-RPS19, respectively). Error bars represent standard deviation.

[0053] Enforced expression of RPS19 results in long-term rescue of the hematopoietic defect of Rps19-deficient mice. (I) Experimental strategy to validate the long-term therapeutic potential of RPS19 gene correction. (J-K) Erythrocyte number, hemoglobin concentration, mean corpuscular volume (MCV), reticulocyte number, white blood cell number and platelet number after 4 months of doxycycline administration (n = 22, 24, 14, 16 and 11 for the Control SFFV-GFP, Control SFFV-RPS19, D / + SFFV-GFP, D / + SFFV-RPS19 and D / D SFFV-RPS19, respectively). Error bars represent standard deviation.

[0054] Enforced expression of RPS19 confers a competitive advantage over untransduced Rps19-deficient cells. (L) Experimental strategy to validate the therapeutic potential of RPS19 gene correction. The percentage of transduced (M) total donor-derived white blood cells (CD45.2+GFP+) or (N) myeloid cells (CD45.2+Gr1+CD11b+GFP+) in the peripheral blood before doxycycline administration, 2 weeks and 4 months after doxycycline administration (n = 9-24 per group). (O) BM cellularity of the recipients 17- 23 weeks after the doxycycline administration (n = 11-24 per group). (P) The percentage of transduced cells in the hematopoietic stem and progenitor compartments P7403PC00

[0055] (n = 11-24 per group). Data in (M) are presented as box whisker plots with minimum and maximum values. Error bars in (N) represent standard deviation.

[0056] Figure 2: : Lentiviral Vectors with Cellular Promoters Correct Anemia and Lethal Bone Marrow Failure in a Mouse Model for Diamond-Blackfan Anemia

[0057] Mouse model for RPS-Deficient DBA and SIN lentiviral vectors for DBA Gene Therapy Transgenic mice containing a doxycycline-regulatable Rps19-targeting shRNA allow an inducible and graded downregulation of Rps19. (A, top left panel) Overview of modified loci. Black arrowheads indicate TSSs. (A, top right panel) Breeding strategy to adjust the level of RPS19 downregulation. (A, bottom panel) EFS-RPS19 vector, codon- optimized human RPS19 cDNA was constructed under the control of the human elongation factor 1a short (EFS) promoter and inserted into a lentiviral vector.

[0058] Following the RPS19 cDNA, an internal ribosomal entry site (IRES), a GFP sequence, and improved WHV post-transcriptional regulatory element (Pre*) were inserted. EFS- Spacer vector, in which the RPS19 cDNA was replaced with an equally long noncoding spacer sequence, was used as a control. The LCR-EFS-RPS19 vector, where in locus control region of p-globin gene was inserted before the EFS promoter. LTR, long terminal repeat; pA, polyadenylation signal; PPT, polypurine tract; RRE, Rev response element; SA, splice acceptor; Wt, wild-type.

[0059] Enforced expression of RPS19 derived from the EFS promoter is sufficient to rescue the DBA Phenotype In Vitro c-Kit-enriched hematopoietic progenitors (0.5 x 106) from the BM of uninduced mice were transduced and seeded in liquid culture or methyl cellulose in the presence of doxycycline. (B) Experimental design. (C) Total cell counts on day 8 after growth in liquid culture. (D) Total erythroid colony counts in methyl cellulose cultures (M3436) in the presence of doxycycline on day 14. Data shown in (C) and (D) represent the average of three independent experiments with three technical replicates. *p < 0.05; ***p < 0.001. Wt, wild-type.

[0060] Enforced Expression of RPS19 Derived from the EFS Promoter Is Sufficient to Rescue the Acute DBA Phenotype In Vivo Enforced expression of RPS19 results in short-term rescue of the hematological defect in RPS19-deficient mice. (E) Experimental strategy to validate the short-term therapeutic potential of EFS-RPS19 and LCR-EFS-RPS19 vectors. (F) Transduction efficiency is shown. (G and H) GFP reconstitution and donor reconstitution are shown. (I-K) Erythrocyte number (I), hemoglobin concentration (J), P7403PC00 and mean corpuscular value (K) (n = 20-21). Error bars represent the SD. ***p < 0.001. MCV, mean corpuscular value; Wt, wild-type.

[0061] RPS19-Deficient BM cells can be transduced and the transduced Cells provide Longterm reconstitution RPS19-deficient BM can be transduced; after genetic correction, these cells show long-term engraftment in lethally irradiated wild-type mice. (L, top panel) Experimental strategy to validate the long-term reconstitution capacity of corrected Rps19-deficient cells. (L-N) Pre-transplant Wt and DD mice erythrocyte numbers (L, bottom right panel), hemoglobin concentration (L, bottom middle panel), transduction efficiency (L, bottom right panel), survival curve (M), and BM cellularity (N) after 16 weeks of doxycycline induction. (O-R) Erythrocyte number (O), mean corpuscular volume (P), hemoglobin concentration (Q), white blood cell count (R, left panel), and platelet number (R, right panel) after 16 weeks of doxycycline induction (n = 20-28). Error bars represent the SD. *p < 0.05; **p < 0.01; ***p < 0.001. MCV, mean corpuscular volume; Wt, wild-type.

[0062] Figure 3: Engineered human Diamond-Blackfan anemia disease model confirms therapeutic effects of clinically applicable lentiviral vector at single-cell resolution

[0063] Genome editing via homologous recombination using electroporation leads to strongly decreased cell viability. (A) Schematic overview of RPS19 editing strategy. The RPS19 gene is targeted with Cas9, and gene fluorescent protein (GFP)-encoding adeno- associated virus (AAV) with homology arms flanking the cut site. Successful integration of the homology-directed repair (HDR) template leads to disruption of RPS19 expression, which allows traceable GFP expression. (B) Timeline of experiment. (C and D) Representative FACS plots of cell viability and GFP expression of cells on (C) day 1 and (D) day 4 after electroporation. (E) Percentage of live cell recovery relative to completely untreated cells on days 1 and 4 after electroporation (*P<0.05 by / -test, N=3). (F) Relative percentage of GFP+cells compared to total recovered live cell numbers of the untreated condition, on days 1 and 4 after electroporation (*P<0.05, **P<0.01, ****P<0.0001 by one-way ANOVA test, N=3). LHA: left homology arm; RHA: right homology arm; HSPC: hematopoietic stem and progenitor cells.

[0064] Nanostraw-mediated Cas9 mRNA delivery enables CD45 knockout in human hematopoietic stem and progenitor cells. (G) Schematic overview and false-colored scanning electron microscope picture of the nanostraw delivery system. (H) Timeline of P7403PC00 experiment. (I) Representative FACS plots of cell viability (7-AAD- / Annexin-) on day 1 (D1). (J) Representative FACS plots of edited cells on day 4. (K-L) Percentage of live cell recovery compared to completely untreated cells on days 1 and 4 upon Cas9 mRNA and RNP delivery to knockout CD45 (*P<0.05, **P<0.01, ***P<0.001 by oneway ANOVA test, N=3). (M) Efficiency of CD45 knockout in live (7-AAD) cells on day 4 (***P<0.001 , ****P<0.0001 by one-way ANOVA test, N=3). HSPC: hematopoietic stem and progenitor cells.

[0065] Delivery of Cas9 mRNA with nanostraws enables the recovery of heterozygous GFP+RPS19-deficient hematopoietic stem and progenitor cells with reduced cell viability. (N) Timeline of experiment. (O) Percentage of live cell recovery compared to completely untreated cells on days 1 (D1) and 4 upon using nanostraw to deliver Cas9 mRNA (*P<0.05 by / -test, N=3). (P-Q) Representative FACS plots of cell viability and GFP+cells on (left) day 1 and (right) day 4. (R) Relative percentage of GFP+cells compared to total recovered live cell numbers of the untreated condition, using a nanostraw to deliver Cas9 mRNA on days 1 and 4 (**P<0.01 , ***P<0.001 by / -test, N=3). (S, left panel) Number of colonies for BFU-E, CFU-G / M / GM and CFU-GEMM in each dish after culture with methylcellulose media for 14 days (####P<0.0001 ,#P<0.05 compared with the same colony category in the RPS19-deficient group by unpaired Mann-Whitney test, N=12 dishes in each group). (S, right panel) Ratio of edited allele (HDR-RPS19-GFP) to reference gene (APOE) by ddPCR (a total of 20 colonies in the mock group, and 100 colonies in the RPS 79-deficient group were analyzed). HSPC: hematopoietic stem and progenitor cells.

[0066] RPS79-deficient cells showed impaired erythroid differentiation ability which can be rescued by the lentiviral EFS-RPS19 vector. (T) Schematic overview of erythroid differentiation analysis of RPS 79-deficient CD34+cord blood hematopoietic stem and progenitor cells (HSPC). (II) Expression of endogenous RPS19 (*P <0.05, **P <0.01, ***P <0.001 by two-way ANOVA test, N=3). (V) Transgene RPS19 (coRPS19) expression (****P<0.0001 by two-way ANOVA test, N=3). (W) Representative FACS plots of GFP+cells for erythroid differentiation on day (D) 10 in each group. (X) Statistical analysis of each population during erythroid differentiation from stage I (day 6) to stage II (day 10) (#P<0.001 compared to the CD34 and the Cas9 only groups; **P<0.01 compared to the RPS19-D group; ***P<0.001 compared to the RPS19-D group; ****P<0.0001 compared to the RPS19-D group, by two-way ANOVA test, N=3). (Y) Formation of red blood cell pellets on day 21 in each group. EM: expansion medium; ED: erythroid differentiation. P7403PC00

[0067] Figure 4: Successful gene therapy of Diamond-Blackfan anemia in a mouse model and human CD34+ cord blood hematopoietic stem cells using a clinically applicable lentiviral vector

[0068] The inducible Rps 79-deficient mouse model and structure of the EFS-RPS19 selfinactivating lentiviral vector. (A, top left panel) Overview of modified loci. Black arrowheads indicate the transcriptional start sites. (A, top right panel) Breeding strategy to adjust the level of Rps19 downregulation. Homozygous mice (D / D mice) are used in the project. (A, bottom panel) The self-inactivating lentiviral vector harboring a codon- optimized human RPS19 cDNA driven by human elongation factor 1a short (EFS) promoter. LTR: long terminal repeat; pA: polyadenylation signal; PPT: polypurine tract; RRE: Rev response element; SA: splice acceptor.

[0069] Effective correction of anemia by the EFS-RPS19 vector at 2 weeks after induction of the Diamond-Blackfan phenotype. (B) The scheme of the uninduced gene-corrected cell transplantation model and plan for examining short-term therapeutic effects. (C-D) Blood cellularity at 2 weeks after doxycycline induction (n=13-16, error bars represent the standard deviation, *P<0.05, **P<0.01 , ***P<0.005 ****P<0.001 by one-way analysis of variance). BM: bone marrow; MOI: multiplicity of infection; WT: wild-type; RBC: red blood cells; MOV: mean corpuscular volume; WBC: white blood cells.

[0070] Effective long-term correction of the anemia and bone marrow failure in mice treated with the EFS-RPS19 vector. (E) The scheme of the induced gene-corrected cell transplantation model and the plan for examining long-term therapeutic effects. (F) Survival rate analysis. (G-H) Blood cellularity at 16 weeks after doxycycline induction (n=13-16, error bars represent the standard deviation, *P<0.05, **P<0.01, ***P<0.005 by one-way analysis of variance). BM: bone marrow; MOI: multiplicity of infection; WT: wild-type; RBC: red blood cells; MCV: mean corpuscular volume; WBC: white blood cells.

[0071] Gene-corrected bone marrow cells show a competitive advantage in contributing to long-term hematopoiesis in vivo. (I) Vector copy number in peripheral blood (A) and bone marrow (B). (J) Donor reconstitution in peripheral blood (J, left panel) and bone marrow (J, right panel). (K) The percentage of transduced cells in hematopoietic stem cells (HSC) (K, top left panel)), megakaryocyte progenitors (K, top middle panel), pre- granulocyte-macrophage and granulocyte-macrophage progenitors (K, top right panel), pre-megakaryocyte-erythroid (K, bottom left panel), and pre-colony-forming unit erythroid and colony-forming unit erythroid (K, bottom right panel) (n=13-16, error bars P7403PC00 represent the standard deviation, black asterisks indicate the statistical significance of the comparison of recipient-derived cells between the mock and EFS-RPS19 groups, orange asterisks indicate the statistical significance of the comparison of donor-derived cells between the mock and EFS-RPS19 groups. *P<0.05, **P<0.01, ***P<0.005, ****p<0 001 by one-way analysis of variance). VCN: vector copy number; PB: peripheral blood; BM: bone marrow; HSC: hematopoietic stem cells; MkP: megakaryocyte progenitors; pre-GM / GMP: pre-granulocyte macrophage and granulocyte macrophage progenitors; preMegE: pre-megakaryocyte-erythroid; preCFU- E / CFU-E: pre-colony-forming unit-erythroid (CFU-E) / CFU-E.

[0072] Amelioration of disease phenotype in Rps 79-deficient animals transplanted with gene- corrected cells. (L) Scheme of the gene-corrected Rps 79-deficient cell transplantation model and plan for examining short-term and long-term therapeutic effects. (M) Survival rate analysis. (N-O) Blood cellularity at 4 and 16 weeks after doxycycline induction (n=14-16, error bars represent the standard deviation, *P<0.05, **P<0.01, ***P<0.005 ****P<0.001 by one-way analysis of variance). WT: wild-type; RBC: red blood cells; MCV: mean corpuscular volume; WBC: white blood cells.

[0073] EFS-RPS19 vector-treated Rps 79-deficient cells show a competitive advantage in contributing to long-term hematopoiesis in vivo. (P) Vector copy number in peripheral blood (P, top left panel) and bone marrow (P, top right panel). (P-Q) Donor reconstitution in peripheral blood (Q, top left panel) and bone marrow (Q, top right panel). The percentage of transduced cells in hematopoietic stem cells (P, bottom left panel), megakaryocyte progenitors (P, bottom right panel), pre-granulocyte- macrophage and granulocyte-macrophage progenitors (Q, bottom left panel), pre- megakaryocyte-erythroid (Q, bottom middle panel), and pre-colony-forming unit erythroid and colony-forming unit erythroid (Q, bottom right panel) (n=14-16, error bars represent the standard deviation, black asterisks indicate the statistical significance of the comparison of recipient-derived cells between the mock and EFS-RPS19 groups, orange asterisks indicate the statistical significance of the comparison of donor-derived cells between the mock and EFS-RPS19 groups. *P<0.05, **P<0.01, ***P<0.005, ****p<0 001 by one-way analysis of variance). VCN: vector copy number; PB: peripheral blood; BM: bone marrow; HSC: hematopoietic stem cells; MkP: megakaryocyte progenitors; pre-GM / GMP: pregranulocyte macrophage and granulocyte macrophage progenitors; preMegE: pre-megakaryocyte-erythroid; preCFU- E / CFU-E: pre-colony-forming unit -erythroid (CFLIE) / CFLI-E. P7403PC00

[0074] Impaired erythroid differentiation of RPS 79-deficient CD34+cord blood cells can be rescued by the EFS-RPS19 vector. (R) RPS19 mRNA expression in CD34+cord blood cells transduced with shRNA. (S) Percentage of GFPhighpopulation in RPS 19-defi ci ent CD34+cord blood cells treated or not with EFS-RPS19 during erythroid differentiation from stage I to stage III. (T) Percentage of indicated cell outputs of GFPhighpopulations on day 16. (data shown as mean ± standard deviation,AP<0.05 compared to the shRNAI group,#P<0.05 compared to the shRNA2 group, *P<0.05, **P<0.01 , ***P<0.005 by a / -test, 3 independent experiments).

[0075] Gene-corrected bone marrow cells show a vector integration pattern that indicates low risk of mutagenesis and a highly polyclonal insertion site pattern. (II) The top ten integration sites in each sample ^indicates that the integration was within a transcription unit, ~ indicates that the insertion was within 50 kb of a cancer-related gene). (V) Percent of all integrations inside transcriptional units (V, top panel) and percent of integrations within 100 kb of proto-oncogenes compared to matched random control sites (V, bottom panel). (W) Genomic heatmap analysis of the insertion site profile, mrc: matched random control. ***P<0.001 by an unpaired t-test.

[0076] Figure 5: Single-Cell-Multiomics Demonstrates Molecular Efficacy of a Clinical Lentiviral Vector for Gene Therapy of RPS19-Deficient Diamond-Blackfan Anemia (A) Experimental setup of high-throughput single-cell gene expression analysis combined with immunophenotypic profiling (CITE-Seq). CD34-positive cells were isolated from bone marrow / cord blood from healthy and DBA individuals. Next the CD34+ cells were co-cultured with CLIN-LV-EFS-coRPS19-PRE* or negative control supernatant (Mock), according to a two-day transduction protocol developed for manufacturing of the gene therapy product APR-2020 (as described in Figure 10A herein). Transduced cells were next cultured in medium supporting erythroid and myeloid differentiation for 3 weeks. Cell counting, morphology analysis and FACS analysis were performed on days 9-12, 15 and 20. On day 9-12, cells were sorted labelled with antibody-derived tags (ADTs), sorted and processed for CITE-Seq analysis. (B) Activation of p53-pathway, apoptosis and DNA damage in DBA erythroid cells. (C) Gene expression of selected genes which are differentially expressed in DBA. Expression of PHLDA3 and GDF15 in DBA erythroblasts is shown. (D) General enrichment of p53-pathway and apoptosis in all mock-treated DBA samples, and p53- target genes robustly associated with DBA phenotype across all patients, including P7403PC00 upregulation of BAX, MDM2, and RPS27L genes. (E-G) Pathway analysis in DBA- coRPS19+ vs. mock-treated cells.

[0077] Figure 6: Flow chart of the isolation and transduction process for producing LV- EFS-RPS19-PRE transduced hematopoietic stem and progenitor cells

[0078] CCV=Cell Counting Viability, VCN=vector copy number

[0079] Figure 7: Overview of analyzed DNA samples isolated from sub-cultured final product (FP, cryopreserved CD34+ cells) cells measured by ddPCR in duplicates.

[0080] 5x10A5 viable nucleated cells (VNC) were used for DNA isolation of DR01 - DR05 samples and 5x10A4 VNC for DR06 and DR07. The data is based on the WHV_WPRE assay for DR01 - DR05 and WPRE5 assay for DR06 and DR07.

[0081] A) Determined bulk VCN for each development run based on the calculation of detected WPRE copies compared to the detected PTBP2 copies. B) Determined total copies of WPRE and PTBP2 within a ddPCR sample.

[0082] Figure 8: Codon-optimization approach

[0083] Alignment of the wild-type RPS19 sequence (including stop codon, SEQ ID NO: 48) (top strand, wt) with the codon-optimized coRPS19 sequence (SEQ ID NO: 18) (bottom strand, codon-optimized). Modified nucleotide positions are indicated in grey.

[0084] Figure 9: CITE-Seq analysis of gene therapy-treated hematopoietic progenitor cells derived from DBA and healthy individuals.

[0085] (A) Scheme of the clinical candidate gene therapy vector CLIN-LV-EFS-coRPS19- PRE* expressing a carefully codon-optimized human RPS19 (coRPS19) transgene from a minimal elongation factor 1 -alpha (EFS) promoter (Liu et al., 2022).

[0086] (B) Overview of the experimental procedure. CD34-positive cells were isolated from bone marrow / cord blood from healthy and DBA individuals. Next, the CD34+ cells were co-cultured with CLIN-LV-EFS-coRPS19-PRE* or negative control supernatant (Mock), according to a two-day transduction protocol developed for manufacturing of the gene therapy product APR-2020 . Transduced cells were next cultured in medium supporting erythroid and myeloid differentiation for 3 weeks. Cell counting, morphology analysis and FACS analysis were performed on days 9-12, 15 and 20. On day 9-12 cells were sorted labeled with antibody-derived tags (ADTs), sorted and processed for CITE-Seq analysis. (C) Cell expansion in representative experiment (patient 1 vs healthy control P7403PC00

[0087] 1). (D-E) Pictogram of representative cells day 20 (DBA patient 1) stained with May- Grunwald-Giemsa demonstrates increased fraction of cells with orthochromatic erythroblast and reticulocyte morphologies in GT treated DBA cells compared to Mock- treated DBA cells. (F) LIMAP visualization of integrated healthy and DBA GT- and Mock-treated cells at day 9-12 of culture profiled with CITE-seq. Defined cell populations include erythro-megakaryocyte progenitors (EMP), BFU-E / CFU-E population, proerythroblast / basophilerythroblast population (ProE / BasoE), polychromatic erythroblasts (PolyE), orthochromatic erythroblasts (OrthoE), megakaryocyte precursors (Meg), mast cell precursors (MastP), lympho-myeloid primed progenitors (LMPP), granulocyte-monocyte progenitors (GMP) and macrophage / monocyte precursors (Macro / Mono). (G) Average expression of genes and cell surface proteins representative for distinct hematopoietic cell types. (H-l) coRPS19 expression in GT-treated cells from healthy and DBA samples. (J-K) Numbers of cells with detected coRPS19 expression (+) and without detected coRPS19 expression (-) in healthy and DBA GT-treated early progenitor cells (LMPP) and cells developed into myeloid and erythroid lineages.

[0088] Figure 10: Overview of the experimental settings.

[0089] (A) Experimental scheme (as used in Examples 7 and 9 herein). (B-C) coRPS19 expression in GT-treated and Mock-treated healthy (B) and DBA (C) cells.

[0090] Figure 11 : Expression of markers for erythroid and myeloid lineages on UMAP representation of all sequenced cells. (A) Not-transformed mRNA expression of KIT (C-Kit protein), GATA2 (GATA-Binding Protein 2), RLINX1 (Rll NX family transcription factor 1), GATA1 (GATA-Binding Protein 2), TFRC (Transferrin receptor 1, CD71), ALAD (Aminolevulinate Dehydratase), GYPA (Glycophorin A, CD235a), ALAS2 (5'- Aminolevulinate Synthase 2), (B) Not-transformed mRNA expression of HBB (Hemoglobin Subunit Beta), IGHM (Immunoglobulin Heavy Constant Mu), LYZ (Lysozyme), ELANE (Elastase, Neutrophil Expressed), CD14 (cluster of differentiation 14), S100A9 (S100 Calcium Binding Protein A9), S100A8 (S100 Calcium Binding Protein A8) and Expression of ADT-markers for erythroid and myeloid lineages on UMAP representation of all sequenced cells withLog-transformed normalized ADT expression of CD34, CD71 (Transferrin receptor, TFRC) (C) Expression of ADT- markers for erythroid and myeloid lineages on UMAP representation of all sequenced cells withLog-transformed normalized ADT expression of CD235a (Glycophorin A, P7403PC00

[0091] GYPA), CD41 (Integrin Subunit Alpha 2b, ITGA2B), CD49f (Integrin Subunit Alpha 6, ITGA6), CD38, CD4, CD45RA (Protein Tyrosine Phosphatase Receptor Type C - RA isoform), CD45 (Protein Tyrosine Phosphatase Receptor Type C, PTPRC), CD123 (Interleukin 5 Receptor Subunit Alpha, IL5RA), (D) Expression of ADT-markers for erythroid and myeloid lineages on LIMAP representation of all sequenced cells with Log-transformed normalized ADT expression of CD5, CD11b (Integrin Subunit Alpha M, ITGAM), CD52, CD33, CD63, CD49d (Integrin Subunit Alpha 4, ITGA4), CD95 (Fas Cell Surface Death Receptor, FAS), CD44 (E) Expression of ADT-markers for erythroid and myeloid lineages on LIMAP representation of all sequenced cells with Log-transformed normalized ADT expression of CD135 (Fms Related Receptor Tyrosine Kinase 3, FLT3), CD74, CD3 (CD3 Gamma Subunit Of T-Cell Receptor Complex, CD3G), CD195 (C-C Motif Chemokine Receptor 5, CCR5), CD19, CD178 (Fas Ligand, FASLG), CD90 (Thy-1 Cell Surface Antigen, THY1), CD56 (Neural Cell Adhesion Molecule 1 , NCAM1).

[0092] Figure 12: Gene therapy reverses gene expression signatures of TP53 activation and apoptosis in erythroid development.

[0093] (A-B) Gene-set enrichment analysis (GSEA) plots for p53 pathway, apoptosis and DNA repair gene sets from Hallmark MSigDB for erythroid lineage in DBA-Mock vs Healthy- Mock (A), and DBA-coRPS19 vs DBA-Mock (B) settings.

[0094] (C-D). GSEA with gene sets from Hallmark MSigDB for erythroid and myeloid subtypes in DBA-Mock vs Healthy-Mock (C), and DBA-coRPS19 vs DBA-Mock (D) comparisons. (E-F) GSEA with gene sets from GO Biological Processes MSigDB for erythroid and myeloid subtypes in DBA-Mock vs Healthy-Mock (E), and DBA-coRPS19 vs DBA-Mock (F) comparisons.

[0095] Figure 13: Differential expression analysis for DBA vs Healthy and coRPS19+ vd Mock comparisons in erythro-megakaryocyte progenitors (EMP) (A-C); BFU-E / CFU-E precursors (D-F); proerythroblasts / basophil erythroblasts (ProE / BasoE) (G-l); polychromatic erythroblasts (PolyE) (J-L).

[0096] Figure 14: Differential expression analysis for DBA vs Healthy and coRPS19+ vs Mock comparisons in Multipotent progenitors - LMPP (A-C); granulocyte / monocyte progenitors - GMP (D-F); monocytes / macrophages (Macro / Mono) (G-l); mast cell precursors (MastP) (J-L). P7403PC00

[0097] Figure 15: Gene therapy induced p53-pathway and apoptosis downregulation in lympho-myeloid progenitors. GSEA* plots and statistics were generated with the following gene sets: Hallmark (HM) apoptosis; HM DNA repair; HM p53 pathway; p53- upregulated genes(Fischer, 2017), and a set of genes present in both HM p53 pathway and p53-upregulated genes (p53-intersection).

[0098] *Phenotype permutation (N=1000) was used for statistical verification.

[0099] Figure 16: Expression of individual ribosomal protein genes in Healthy (A-B) and DBA (C-D) erythroid and myeloid lineages. (A, C) Expression of genes encoding proteins in the small ribosomal subunit (RPS genes). (B,D) Expression of genes encoding proteins in the large ribosomal subunit (RPL genes).

[0100] Figure 17: Identification and verification of a robust gene expression signature for RPS19-deficient DBA.

[0101] (A) 21 genes were selected based on consistent erythroid gene expression changes in Mock DBA versus cells in the other three groups (coRPSI 9 treated DBA, Mock Healthy and coRPS19-treated Healthy) across all samples.

[0102] (B-l) Violin plots demonstrating expression of a selection of the 21 genes in our dataset as well in the public GSE156441 (Iskander et al., 2021) single-cell dataset with 3 healthy, 3 RPS19-deficient, and 3 RPL11 / RPL5-deficient donors. (B-C) BAX mRNA expression in erythroid cells from our single-cell data and from GSE156441.

[0103] (D-E) RPL27L mRNA expression in our dataset and in GSE156441.

[0104] (F-G) CD70 mRNA expression in our dataset and in GSE156441.

[0105] (H-l) RPL22L1 mRNA expression in our dataset and in GSE156441.

[0106] (J-M) DBA-signature (all cells) expression in healthy-mock, healthy-coRPS19+, DBA- mock, and DBA-coRPS19+ cells.

[0107] (N) DBA signature score in erythroid cells with different levels of coRPSI 9 expression. Transduced DBA cells were divided in three groups based on expression of coRPSI 9 mRNA, undetectable (DBA coRPSI 9-), low (DBA low coRPSI 9), medium (DBA medium coRPS19), high (DBA high coRPS19).

[0108] (O) DBA signature score plotted against expression levels of coRPSI 9 in single transduced DBA cells. P7403PC00

[0109] Figure 18: Identification and verification of a robust gene expression signature for RPS19-deficient DBA. (A-C) Genes were selected based on consistent erythroid gene expression changes in Mock DBA versus cells in the other three groups (coRPSI 9 treated DBA, Mock Healthy and coRPS19-treated Healthy) across all samples. Violin plots for mRNA expression of the DBA signature genes and for ADT huCD70 for CD70 cell surface signal our dataset as well in the public GSE156441 single cell dataset with 3 healthy, 3 RPS19-deficient, and 3 RPL11 / RPL5-deficient donors.

[0110] Figure 19: RPL22L1 expression transformation for DBA signature. RPL22L1 correlates negatively with the DBA condition, therefore, in order to account for its deficiency in DBA cell, we used an artificial "anti-RPL22L1" value for calculating DBA signature score. Artificial "anti-RPL22L1" was calculated for each cell by subtracting its maximum value in the dataset from its expression level in each cell and multiplying the result by -1.

[0111] Figure 20: Improvement of DBA signature gene expression in GT-corrected DBA erythroid cells. (A-B) Volcano plots for differential expression analysis results for erythroid progenitors for DBA vs Healthy (A) and DBA-coRPS19+ vs DBA (B) comparisons. Genes included in the 21-gene DBA signature are labelled. (C) DBA score calculated for 21-gene DBA signature for erythroid progenitors for Healthy-Mock, Healthy-coRPS19+, DBA-Mock, DBA-coPS19+ cells. (D-E) GSEA* plots and statistics for DBA vs Healthy (D) and DBA-Mock vs DBA-coRPS19+ (E) comparisons. *phenotype permutations with 1000 iterations was used for significance verification

[0112] Figure 21 : Expression of erythropoietic and selected DBA-signature genes along erythroid differentiation pseudotime.

[0113] (A) Expression of well-established erythroid differentiation state marker genes in cells from all samples aligned by pseudotime.

[0114] (B-E) Expression of selected DBA-signature genes, TP53 and GATA1 in erythroid cells from Healthy-Mock, Healthy-coRPS19+, DBA-Mock, DBA-coRPS19+ erythroid cells aligned by pseudotime.

[0115] Figure 22: Expression of well-established erythroid differentiation state marker genes in cells from all samples aligned by pseudotime. P7403PC00

[0116] Healthy-Mock, Healthy-coRPS19+, DBA-Mock, DBA-coRPS19+ erythroid cells aligned by pseudotime.

[0117] Figure 23: Expression of DBA-signature genes in erythroid cells.

[0118] Healthy-Mock, Healthy-coRPS19+, DBA-Mock, DBA-coRPS19+ erythroid cells aligned by pseudotime.

[0119] Figure 24: Dynamics of TP53 and GATA1 transactivating activity mapped in pseudotime of erythroid development.

[0120] (A) Healthy and DBA cell types in erythroid development from EMPs to PolyEs aligned by calculated diffusion pseudotime.

[0121] (B-E) A gene set with 113 genes demonstrated to be activated by TP53 “p53-up targets” (Fischer, 2017) was chosen to investigate TP53 transactivating activity in pseudotime. Healthy-Mock, Healthy-coRPS19+, DBA-Mock, DBA-coRPS19+ erythroid cells.

[0122] (F-G) GSEA* plots for p53-up targets gene set in DBA-Mock vs Healthy-Mock and DBA-coRPS19+ vs DBA-Mock comparisons.

[0123] (H-K) The "GATA1 21h-UP" geneset consisting of genes significantly induced 21 hours after the activation of GATA1 expression in G1E-ER4 cells, a GATA1-null erythroblast line that undergoes synchronous erythroid maturation when GATA1 activity is restored (Welch et al., 2004), was chosen to investigate GATA1 transactivating activity in pseudotime. Healthy-Mock, Healthy-coRPS19+, DBA-Mock, DBA-coRPS19+ erythroid cells.

[0124] (L-M) The geneset “Reduced in GATAs" consists of 31 genes that exhibit binding of GATA1 and are down-regulated by GATA1S relative to full-length GATA1 (Chlon et al., 2015). GSEA* plots for the two GATA1 -transactivation gene sets "GATA1 21h-UP" (blue line) and “Reduced in GATAs" (red line) in DBA-Mock vs Healthy-Mock and DBA- coRPS19+ vs DBA-Mock comparisons.

[0125] *Phenotype permutation (N=1000) was used for statistical verification.

[0126] Figure 25: TP53 transactivating activity and coRPS19-induced improvement.

[0127] (A) Comparison of utilized p53 gene sets: p53 pathway from Hallmark MSigDB (left) and p53-upregulated targets from (Fischer, 2017). P7403PC00

[0128] (B-l) Gene set score in Healthy-Mock, Healthy-coRPS19+, DBA-Mock, DBA-coRPS19+ erythroid cells for Hallmark p53 pathway gene set (B-E) and a list of genes present in both p53 gene sets (F-l)*.

[0129] (J-K) GSEA** plots and statistics for p53 gene sets: Hallmark p53 pathway, p53- upregulated targets and their intersection in DBA-Mock vs Healthy-Mock and DBA- coRPS19+ vs DBA-Mock comparisons.

[0130] (L-M) Score for p53-upregulated targets in erythroid cells with different levels of coRPS19 expression. Transduced DBA cells were divided in three groups based on expression of coRPS19 mRNA, undetectable (DBA CORPS19-), low (DBA low coRPS19), medium (DBA medium coRPS19), high (DBA high coRPS19).

[0131] *Plots for p53-upregulated targets (Fischer) gene set are given in Figure 24. **Phenotype permutation (N=1000) was used for statistical verification.

[0132] Figure 26: Comparison of codon-optimized and non codon-optimized RPS19 constructs.

[0133] K562 hematopoietic target cells were transduced with lentiviral vectors with a PGK- driven codon-optimized and non-codon optimized (native) RPS19 expression cassettes.

[0134] (A) Titers generated from the codon-optimized RPS19 cDNA and the non-codon- optimized cDNA, as measured in infectious units (III) per ml.

[0135] (B) The codon-optimized RPS19 cassette produced higher number of transcripts copies / vector copies than the non-codon-optimized RPS19 cassette.

[0136] Figure 27: Comparison of codon-optimized RPS19 variants.

[0137] (A) Gene expression (transcript copies / vector copies) of the codon-optimized RPS19 variants, with higher gene expression of variant 1 constructs.

[0138] (B) Titers generated from the codon-optimized RPS19 variants, as measured in lU / ml.

[0139] Figure 28: Codon-optimized RPS17, RPS24, RPS10, RPL35A, RPL11, RPS26, RPL5 variants.

[0140] Lentiviral vectors expressing RPS and RPL variants can produce a similar high titer (A) and express the therapeutic RNA cassette in transduced hematopoietic target cells, as determined via ddPCR (B). The data indicate that the respective lentiviral vectors are functional, can integrate and produce the respective therapeutic mRNAs in hematopoietic cells for production of therapeutic proteins. P7403PC00

[0141] Detailed description

[0142] Definitions

[0143] As used herein, the singular forms "a", "an", and "the" include plural forms unless the context clearly dictates otherwise.

[0144] It will also be appreciated that “one or more” can be interchangeably substituted by “a plurality”, or “at least one”

[0145] Unless otherwise indicated, sequence identities are expressed with respect to the full length of the sequence to which they refer.

[0146] As used herein “construct” refers to an artificially assembled or isolated nucleic acid molecule which may comprise one or more nucleic acid sequences, wherein the nucleic acid sequences may be coding sequences (that is, sequence which encodes for an end product), regulatory sequences, non-coding sequences, or any combination thereof. The term construct includes, for example, expression cassettes, but should not be seen as being limited thereto.

[0147] “RPS19” as used herein refers to Ribosomal protein S19 (RPS19), “RPS17” as used herein refers to Ribosomal protein S17 (RPS17), “RPS24” as used herein refers to Ribosomal protein S24 (RPS24), “RPS10” as used herein refers to Ribosomal protein S10 (RPS10), “RPS26” as used herein refers to Ribosomal protein S26 (RPS26), key components of the 40S small ribosomal subunit.

[0148] “RPL35A” as used herein refers to Ribosomal protein L35a (RPL35A), “RPL11” as used herein refers to Ribosomal protein L11 (RPL11), “RPL5” as used herein refers to Ribosomal protein L5 (RPL5), key components of the 60S large ribosomal subunit. Both subunits are involved in the assembly and maturation of ribosomes, which are essential for protein synthesis.

[0149] Mutations in RPS19 are notably associated with Diamond-Blackfan anemia (DBA). RPS19 also plays a role in regulating ribosomal biogenesis and cellular proliferation. P7403PC00

[0150] The gene encoding RPS19 is located on chromosome 19q13.2, NCBI Gene ID: 6223, the gene encoding RPS17 is located on chromosome 15q25.2, NCBI Gene ID: 6218, the gene encoding RPS24 is located on chromosome 10q22.23, NCBI Gene ID: 6229, the gene encoding RPS10 is located on chromosome 6p21.31 , NCBI Gene ID: 6204, the gene encoding RPL35A is located on chromosome 3q29, NCBI Gene ID: 6165, the gene encoding RPL11 is located on chromosome 1 p36.11 , NCBI Gene ID: 6135, the gene encoding RPS26 is located on chromosome 12q13.2, NCBI Gene ID: 6231 , the gene encoding RPL5 is located on chromosome 1 p22.1 , NCBI Gene ID: 6125, sequences are as under the Gene IDs, unless indicated otherwise herein, for instance when referring to specific variant gene versions, such as codon-optimized versions.

[0151] “Promoter exhibiting essentially the same effect” as used herein refers to any promoter that drives gene expression at a similar level, timing, or tissue specificity as the original promoter described. It indicates that alternative promoters can be used, provided they achieve comparable expression efficiency and regulatory control over the transgene, without significantly altering the desired biological outcome.

[0152] “Lentiviral vector” as described herein refers to a modified viral vector derived from lentiviruses, designed to deliver genetic material into target cells. The term includes both the vector itself and lentiviral particles containing the therapeutic transgene which can be for example purified and used for cell transduction, such as in the context of cell therapy.

[0153] HEMGN refers to Hemogen (also known as EDAG - Erythroid Differentiation- Associated Gene), is a nuclear protein involved in hematopoiesis and erythroid differentiation, NCBI Gene ID: 55363.

[0154] HBB as used herein refers to Hemoglobin Subunit Beta, a key component of hemoglobin responsible for oxygen transport in red blood cells, with NCBI Gene ID: 3043.

[0155] AHSP as used herein refers to Alpha Hemoglobin Stabilizing Protein, which stabilizes free alpha-globin chains during hemoglobin assembly, with NCBI Gene ID: 51327. EPB42 as used herein refers to Erythrocyte Membrane Protein Band 4.2, crucial for maintaining erythrocyte membrane stability, with NCBI Gene ID: 2038.

[0156] GYPA as used herein refers to Glycophorin A, a major sialoglycoprotein contributing to the negative charge of red blood cells, with NCBI Gene ID: 2993. P7403PC00

[0157] BAX as used herein refers to BCL2 Associated X, a pro-apoptotic regulator that promotes cell death, with NCBI Gene ID: 581.

[0158] MDM2 as used herein refers to MDM2 Proto-Oncogene, a regulator of the tumor suppressor p53, with NCBI Gene ID: 4193.

[0159] ZMAT3 as used herein refers to Zinc Finger Matrin-Type 3, a p53-inducible gene involved in apoptosis, with NCBI Gene ID: 64393.

[0160] MIR34AHG as used herein refers to MIR34A Host Gene, associated with the regulation of the miR-34a microRNA, with NCBI Gene ID: 106614088.

[0161] LINC01133 as used herein refers to a long intergenic non-coding RNA, with NCBI Gene ID: 100505633.

[0162] XACT as used herein refers to X-active specific transcript, a long non-coding RNA associated with X chromosome inactivation, with NCBI Gene ID: 105463123.

[0163] RPL22L1 as used herein refers to Ribosomal Protein L22 Like 1 , a paralog of the ribosomal protein L22 involved in ribosome function, with NCBI Gene ID: 200916. CD70 as used herein refers to CD70 Molecule, a ligand for CD27 involved in immune responses, with NCBI Gene ID: 970.

[0164] ADA as used herein refers to Adenosine Deaminase, an enzyme that plays a key role in the purine salvage pathway, with NCBI Gene ID: 100.

[0165] Constructs encoding ribosomal proteins

[0166] In one aspect, the invention relates to a construct which, upon expression, encodes a polypeptide selected from the group consisting of: RPS19 (SEQ ID NO. 1), RPS17 (SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, or SEQ ID NO. 5), RPS24 (SEQ ID NO.

[0167] 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10), RPS10 (SEQ ID NO. 11), RPL35a (SEQ ID NO. 12), RPL11 (SEQ ID NO. 13, SEQ ID NO. 14), RPS26 (SEQ ID NO. 15), and RPL5 (SEQ ID NO. 16), or a sequence having at least 70% identity to said SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO.

[0168] 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, or SEQ ID NO. 16.

[0169] In another aspect, the invention relates to a construct which, upon expression, encodes a polypeptide selected from the group consisting of: RPS19 (SEQ ID NO. 1), RPS17 (SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, or SEQ ID NO. 5), RPS24 (SEQ ID NO. P7403PC00

[0170] 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10), RPS10 (SEQ ID NO. 11), RPL35a (SEQ ID NO. 12), RPL11 (SEQ ID NO. 13, SEQ ID NO. 14), RPS26 (SEQ ID NO. 15), and RPL5 (SEQ ID NO. 16), or biologically active variants thereof having at least 70% identity, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to said SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, or SEQ ID NO. 16.

[0171] In some embodiments, the polypeptide sequence has at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 1 SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, or SEQ ID NO. 16.

[0172] In some embodiments, the construct comprises the RPS19 polynucleotide sequence of SEQ ID. NO 17 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 17. In other embodiments the RPS19 polynucleotide sequence has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 17.

[0173] The skilled person will appreciate that codon optimization refers to the modification of the codon composition within a protein-coding nucleotide sequence to enhance the expression of the encoded protein. Various codon optimization techniques are well known in the art, but many suffer from significant limitations. Traditional methods often focus on substituting each amino acid with the most frequently used codon for that amino acid, resulting in a one-to-one codon usage. However, the skilled person would not know in advance whether any specific codon-optimized sequence will result in improved therapeutic outcomes. Prior art showed that codon optimization can enhance mRNA production without necessarily increasing protein levels, let alone achieving P7403PC00 therapeutic effects. The skilled person will also appreciate that codon-optimization can be performed inter-species, in an attempt to optimize protein expression of a protein from a first species in a second species, by optimizing the sequence to codon usage in the second species. Within the same species, such as human, the result of codon optimization may be even more unpredictable than inter-species, as it requires to an even higher extent fine-tuning of sequence residues which may lead to opposite effects on protein expression. The present invention overcomes these challenges by disclosing a codon-optimized ribosomal protein genes, such as a codon-optimized RPS19, RPS17, RPS24, RPS10, RPL35A, RPL11, RPS26, or RPL5 gene, which leads to both higher protein expression and effective therapeutic outcomes.

[0174] RPS19

[0175] Thus, in other embodiments, the construct comprises the codon-optimized RPS19 polynucleotide sequence of SEQ ID. NO 18 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 18.

[0176] In preferred embodiments, the codon-optimized RPS19 (coRPS19) polynucleotide sequence has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO. 18.

[0177] In other embodiments, the construct comprises the codon-optimized RPS19 (coRPS19) polynucleotide sequence of SEQ ID. NO. 19 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 19.

[0178] In further embodiments, the codon-optimized RPS19 (coRPS19) polynucleotide sequence has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 19.

[0179] SEQ. ID. NO.: 18 - Codon optimized RPS19 polynucleotide sequence ATGCCCGGCGTGACCGTGAAGGACGTGAACCAGCAGGAATTCGTCAGAGCCCTG GCCGCCTTTCTGAAGAAAAGCGGCAAACTCAAGGTGCCCGAGTGGGTGGACACC GTGAAGCTGGCCAAGCACAAAGAGCTGGCCCCCTACGACGAGAACTGGTTCTAC P7403PC00

[0180] ACCAGAGCCGCCAGCACCGCCAGACACCTGTACCTGAGAGGCGGAGCCGGCGT GGGCAGCATGACCAAGATCTACGGAGGAAGGCAGCGGAACGGCGTCATGCCCA GCCACTTCAGCCGGGGCAGCAAGAGCGTGGCCAGACGGGTGCTGCAGGCCCTG GAAGGCCTGAAGATGGTGGAGAAGGACCAGGACGGCGGCAGGAAGCTGACCCC CCAGGGCCAGCGGGACCTGGACCGGATCGCCGGACAGGTGGCCGCTGCCAACA AGAAACACTGA

[0181] SEQ. ID. NO.: 18 may be referred to as variant 1.

[0182] SEQ. ID. NO.: 19 - Codon optimized RPS19 polynucleotide sequence, alternative variant ATGCCCGGCGTGACCGTGAAGGACGTGAACCAGCAGGAGTTCGTGAGGGCCCT GGCAGCCTTTCTGAAGAAGAGCGGCAAGCTGAAGGTGCCCGAGTGGGTGGACAC AGTGAAGCTGGCCAAGCACAAGGAGCTGGCCCCTTACGATGAGAACTGGTTCTAT ACCAGGGCAGCCTCCACAGCAAGGCACCTGTACCTGAGGGGAGGAGCAGGAGT GGGCTCTATGACCAAGATCTATGGCGGCAGGCAGCGCAATGGCGTGATGCCATC TCACTTTAGCCGGGGCAGCAAGTCCGTGGCAAGGAGAGTGCTGCAGGCCCTGGA GGGCCTGAAGATGGTGGAGAAGGACCAGGATGGCGGCAGAAAGCTGACACCAC AGGGACAGCGGGACCTGGATAGAATCGCAGGACAGGTGGCAGCAGCCAATAAGA AGCACTGATAG

[0183] SEQ. ID. NO.: 19 may be referred to as variant 2.

[0184] RPS17

[0185] In preferred embodiments, the construct encodes RPS17 encoded by the polypeptide sequence set forth in SEQ ID NO. 2, or a biologically active variant thereof having at least 70% identity, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to said SEQ ID NO. 2.

[0186] In some embodiments, the polypeptide sequence has at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as P7403PC00 at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO. 2.

[0187] In some embodiments, the construct comprises the RPS17 polynucleotide sequence of SEQ ID. NO 20 encoding RPS17, or a sequence having at least 90% identity to SEQ ID. NO 20. In other embodiments, the RPS17 polynucleotide sequence has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 20.

[0188] In some embodiments, the construct comprises a codon-optimized RPS17 (coRPS17) polynucleotide sequence. In preferred embodiments, the coRPS17 polynucleotide sequence is of SEQ ID. NO 37, or a sequence having at least 90% identity to SEQ ID. NO 37, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 37.

[0189] SEQ. ID. NO.: 37 - RPS17 codon-optimized DNA sequence ATGGGAAGAGTGCGGACCAAGACCGTGAAGAAAGCCGCCAGAGTGATCATCGAG AAGTACTACACCCGGCTGGGCAACGACTTCCACACCAACAAGAGAGTGTGCGAG GAAATCGCCATCATTCCCAGCAAGAAGCTGCGGAACAAGATCGCCGGCTACGTG ACCCACCTGATGAAGAGAATTCAGAGGGGCCCTGTGCGGGGCATCAGCATCAAA CTGCAAGAGGAAGAGAGAGAGCGCCGGGACAACTACGTGCCAGAAGTGTCTGCC CTGGACCAAGAGATCATTGAGGTGGACCCCGACACCAAAGAGATGCTGAAGCTG CTGGACTTCGGCAGCCTGAGCAACCTGCAAGTGACCCAGCCTACCGTGGGCATG AACTTCAAGACCCCTAGAGGCCCCGTCTGA

[0190] RPS24

[0191] In preferred embodiments, the construct encodes RPS24 encoded by the polypeptide sequence set forth in SEQ ID NO. 7, or a biologically active variant thereof having at least 70% identity, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least P7403PC00

[0192] 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to said SEQ ID NO. 7.

[0193] In some embodiments, the polypeptide sequence has at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO. 7.

[0194] In some embodiments, the construct comprises the RPS24 polynucleotide sequence of SEQ ID. NO 21 encoding RPS24, or a sequence having at least 90% identity to SEQ ID. NO 21. In other embodiments, the RPS24 polynucleotide sequence has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 21.

[0195] In some embodiments, the construct comprises a codon-optimized RPS24 (coRPS24) polynucleotide sequence. In preferred embodiments, the coRPS24 polynucleotide sequence is of SEQ ID. NO 38, or a sequence having at least 90% identity to SEQ ID. NO 38, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 38.

[0196] SEQ. ID. NO.: 38 - RPS24 codon-optimized DNA sequence ATGAACGACACCGTGACCATCCGGACCAGAAAGTTCATGACCAACCGGCTGCTG CAGCGGAAGCAGATGGTCATCGATGTGCTGCACCCTGGCAAGGCCACCGTGCCT AAGACAGAGATCAGAGAAAAGCTGGCCAAGATGTACAAGACCACACCTGACGTGA TCTTCGTGTTCGGCTTCAGAACCCACTTCGGCGGAGGCAAGACAACCGGCTTCG GCATGATCTACGACAGCCTGGACTACGCCAAGAAGAACGAGCCCAAGCACAGAC TGGCCAGACACGGCCTGTACGAGAAGAAGAAAACCAGCCGGAAGCAGCGGAAAG AACGGAAGAACCGGATGAAGAAAGTGCGGGGCACCGCCAAGGCCAATGTTGGCG CTGGCAAGAAACCCAAAGAATGA

[0197] RPS10 P7403PC00

[0198] In preferred embodiments, the construct encodes RPS10 encoded by the polypeptide sequence set forth in SEQ ID NO. 11 , or a biologically active variant thereof having at least 70% identity, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to said SEQ ID NO. 11.

[0199] In some embodiments, the polypeptide sequence has at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO. 11.

[0200] In some embodiments, the construct comprises the RPS10 polynucleotide sequence of SEQ ID. NO 22 encoding RPS10, or a sequence having at least 90% identity to SEQ ID. NO 22. In other embodiments, the RPS10 polynucleotide sequence has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 22.

[0201] In some embodiments, the construct comprises a codon-optimized RPS10 (coRPSIO) polynucleotide sequence. In preferred embodiments, the coRPSIO polynucleotide sequence is of SEQ ID. NO 39, or a sequence having at least 90% identity to SEQ ID. NO 39, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 39.

[0202] SEQ. ID. NO.: 39 - RPS10 codon-optimized DNA sequence ATGCTGATGCCCAAGAAGAACCGGATCGCCATCTACGAGCTGCTGTTCAAAGAGG GCGTGATGGTGGCCAAGAAAGACGTGCACATGCCTAAGCACCCCGAGCTGGCCG ACAAGAACGTGCCAAATCTGCACGTGATGAAGGCCATGCAGAGCCTGAAGTCCC GGGGCTACGTGAAAGAGCAGTTCGCCTGGCGGCACTTCTACTGGTATCTGACCA ACGAGGGCATCCAGTACCTGCGGGACTACCTGCATCTGCCTCCAGAGATTGTGC CCGCCACACTGAGAAGAAGCAGACCCGAAACCGGCAGACCCAGACCTAAAGGAC TGGAAGGCGAAAGACCCGCCAGACTGACTAGAGGCGAGGCCGACAGAGACACAT P7403PC00

[0203] ATCGGAGATCTGCTGTGCCTCCTGGCGCCGATAAGAAAGCTGAAGCTGGCGCCG GAAGCGCCACCGAGTTTCAGTTTAGAGGCGGCTTCGGCAGAGGCAGAGGACAGC CTCCTCAATGA

[0204] RPL35A

[0205] In preferred embodiments, the construct encodes RPL35a encoded by the polypeptide sequence set forth in SEQ ID NO. 12, or a biologically active variant thereof having at least 70% identity, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to said SEQ ID NO. 12.

[0206] In some embodiments, the polypeptide sequence has at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO. 12.

[0207] In some embodiments, the construct comprises the RPL35a polynucleotide sequence of SEQ ID. NO 23 encoding RPL35a, or a sequence having at least 90% identity to SEQ ID. NO 23 In other embodiments, the RPL35a polynucleotide sequence has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 23.

[0208] In some embodiments, the construct comprises a codon-optimized RPL35a (coRPL35a) polynucleotide sequence. In preferred embodiments, the coRPL35a polynucleotide sequence is of SEQ ID. NO 40, or a sequence having at least 90% identity to SEQ ID. NO 40, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 40.

[0209] SEQ. ID. NO.: 40 - RPL35A codon-optimized DNA sequence P7403PC00

[0210] ATGTCTGGCAGACTGTGGTCCAAGGCCATCTTCGCCGGCTACAAGAGAGGCCTG AGAAACCAGAGAGAGCACACAGCCCTGCTGAAGATCGAAGGCGTGTACGCCAGA GATGAGACAGAGTTCTACCTGGGCAAGAGATGCGCCTACGTGTACAAGGCCAAG AACAACACCGTGACACCTGGCGGCAAGCCCAACAAGACCAGAGTGATCTGGGGC AAAGTGACAAGAGCCCACGGCAACTCTGGAATGGTCCGAGCCAAGTTCAGAAGC AACCTGCCTGCCAAAGCCATCGGCCACCGGATCAGAGTGATGCTGTACCCCAGC CGGATCTGA

[0211] RPL11

[0212] In preferred embodiments, the construct encodes RPL11 encoded by the polypeptide sequence set forth in SEQ ID NO. 13, or a biologically active variant thereof having at least 70% identity, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to said SEQ ID NO. 13.

[0213] In some embodiments, the polypeptide sequence has at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO. 13.

[0214] In some embodiments, the construct comprises the RPL11 polynucleotide sequence of SEQ ID. NO 24 encoding RPL11, or a sequence having at least 90% identity to SEQ ID. NO 24 In other embodiments, the RPL11 polynucleotide sequence has at least 90% identity to is at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 24

[0215] In some embodiments, the construct comprises a codon-optimized RPL11 (coRPL11) polynucleotide sequence. In preferred embodiments, the coRPL11 polynucleotide sequence is of SEQ ID. NO 41 , or a sequence having at least 90% identity to SEQ ID. NO 41 , such as at least 91%, such as at least 92%, such as at least 93%, such as at P7403PC00 least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 41.

[0216] SEQ. ID. NO.: 41 - RPL11 codon-optimized DNA sequence

[0217] ATGGCTCAAGATCAGGGCGAGAAAGAAAACCCCATGCGCGAGCTGCGGATCAGA AAGCTGTGCCTGAATATCTGCGTGGGCGAGAGCGGCGACAGACTGACAAGAGCC GCTAAGGTGCTGGAACAGCTGACCGGACAGACCCCTGTGTTCAGCAAGGCCAGA TACACCGTGCGGAGCTTCGGCATCAGACGGAACGAGAAGATCGCCGTGCACTGT ACCGTTAGAGGCGCCAAGGCCGAGGAAATCCTGGAAAAGGGACTGAAAGTGCGC GAGTACGAGCTGAGGAAGAACAACTTCAGCGACACCGGCAACTTCGGCTTTGGC ATCCAAGAGCACATCGACCTGGGCATTAAGTACGACCCCAGCATCGGCATCTACG GCCTGGACTTTTACGTGGTGCTGGGCAGACCCGGCTTCTCTATCGCCGACAAGAA GAGAAGAACCGGCTGCATCGGCGCCAAGCACCGGATCTCTAAAGAAGAGGCCAT GCGGTGGTTCCAGCAGAAGTACGACGGCATCATCCTGCCTGGCAAATGA

[0218] RPS26

[0219] In preferred embodiments, the construct encodes RPS26 encoded by the polypeptide sequence set forth in SEQ ID NO. 15, or a biologically active variant thereof having at least 70% identity, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to said SEQ ID NO. 15.

[0220] In some embodiments, the polypeptide sequence has at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO. 15.

[0221] In some embodiments, the construct comprises the RPS26 polynucleotide sequence of SEQ ID. NO 25 encoding RPS26, or a sequence having at least 90% identity to SEQ ID. NO 25 In other embodiments, the RPS26 polynucleotide sequence has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at P7403PC00 least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 25.

[0222] In some embodiments, the construct comprises a codon-optimized RPS26 (coRPS26) polynucleotide sequence. In preferred embodiments, the coRPS26 polynucleotide sequence is of SEQ ID. NO 42, or a sequence having at least 90% identity to SEQ ID. NO 42, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 42.

[0223] SEQ. ID. NO.: 42 - RPS26 codon-optimized DNA sequence ATGACCAAGAAGCGGAGAAACAACGGCAGAGCCAAGAAAGGCAGAGGCCACGTG CAGCCCATCAGATGCACCAATTGCGCCAGATGCGTGCCCAAGGACAAGGCCATC AAGAAATTCGTGATCCGGAACATCGTGGAAGCCGCCGCTGTGCGGGATATCTCTG AGGCCTCTGTGTTCGACGCCTACGTGCTGCCTAAGCTGTACGTGAAGCTGCACTA CTGCGTGTCCTGCGCCATCCACTCTAAGGTCGTGCGGAACAGAAGCAGAGAGGC CCGGAAGGATAGAACCCCTCCACCTAGATTCAGACCTGCCGGCGCTGCTCCTAG ACCTCCTCCAAAACCTATGTAG

[0224] RPL5

[0225] In preferred embodiments, the construct encodes RPL5 encoded by the polypeptide sequence set forth in SEQ ID NO. 44, or a biologically active variant thereof having at least 70% identity, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to said SEQ ID NO. 44.

[0226] In some embodiments, the polypeptide sequence has at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO. 44. P7403PC00

[0227] In some embodiments, the construct comprises the RPL5 polynucleotide sequence of SEQ ID. NO 26 encoding RPL5, or a sequence having at least 90% identity to SEQ ID. NO 26 In other embodiments, the RPL5 polynucleotide sequence at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 26.

[0228] In some embodiments, the construct comprises a codon-optimized RPL5 (coRPL5) polynucleotide sequence. In preferred embodiments, the coRPL5 polynucleotide sequence is of SEQ ID. NO 43, or a sequence having at least 90% identity to SEQ ID. NO 43, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 43.

[0229] SEQ. ID. NO.: 43 - RPL5 codon-optimized DNA sequence ATGGGCTTTGTGAAGGTGGTCAAGAACAAGGCCTACTTCAAGCGCTACCAAGTGA AGTTCCGGCGGAGAAGAGAGGGCAAGACCGACTACTATGCCCGGAAGAGACTGG TCATCCAGGATAAGAACAAGTACAACACCCCGAAGTACCGGATGATCGTGCGCGT GACCAACCGGGACATCATCTGCCAGATCGCCTACGCCAGAATCGAGGGCGACAT GATCGTGTGTGCCGCCTATGCTCACGAGCTGCCTAAGTACGGCGTGAAAGTGGG CCTGACCAATTACGCCGCTGCCTACTGTACAGGCCTGCTGCTGGCTCGGAGACT GCTGAACAGATTCGGCATGGACAAGATCTACGAAGGCCAGGTGGAAGTGACCGG CGACGAGTACAACGTGGAATCCATCGACGGACAGCCTGGCGCCTTCACCTGTTAT CTGGATGCCGGACTGGCCAGAACCACCACCGGAAACAAAGTGTTCGGAGCCCTG AAGGGCGCTGTTGATGGCGGACTGTCTATCCCTCACAGCACCAAGAGATTCCCC GGCTACGACAGCGAGAGCAAAGAATTCAACGCCGAGGTGCACCGGAAGCACATC ATGGGACAGAACGTGGCCGACTACATGCGCTACCTGATGGAAGAGGACGAGGAC GCCTACAAGAAGCAGTTCAGCCAGTACATCAAGAACAGCGTGACCCCTGACATGA TGGAAGAAATGTACAAGAAGGCCCACGCCGCCATCCGCGAGAATCCTGTGTACG AGAAGAAACCCAAGAAAGAAGTGAAGAAAAAGCGCTGGAACAGGCCCAAGATGT CTCTGGCCCAGAAAAAGGACAGAGTCGCCCAGAAGAAGGCCAGCTTCCTGAGAG CCCAAGAGAGAGCCGCCGAGTCTTAA

[0230] Elements P7403PC00

[0231] In some embodiments, the construct further comprises the Kozak sequence of sequence SEQ. ID. NO.: 47 or a sequence having at least 90% identity to SEQ ID. NO 47, or a sequence exhibiting essentially the same effect. In other embodiments, the Kozak sequence has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO.: 47.

[0232] In preferred embodiments, the Kozak sequence is directly 5’ of the start codon of the RPS19, RPS17, RPS24, RPS10, RPL35A, RPL11, RPS26, or RPL5 polynucleotide sequence described herein, such as directly 5’ of the ATG start codon of the codon- optimized RPS19, RPS17, RPS24, RPS10, RPL35A, RPL11, RPS26, or RPL5 polynucleotide sequence described herein.

[0233] In other preferred embodiments, the start codon of the RPS19, RPS17, RPS24, RPS10, RPL35A, RPL11, RPS26, or RPL5 polynucleotide is directly followed by a G (Guanine) base. In some embodiments, the Kozak sequence is followed by the ATG start codon and the Kozak sequence and ATG start codon together are of the sequence GCCRCCATG, where R stands for A or G.

[0234] In other preferred embodiments, the construct of the invention further comprises a promoter region capable of controlling the transcription of the polynucleotide encoding the polypeptide selected from the group consisting of: RPS19 (SEQ ID NO. 1), RPS17 (SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, or SEQ ID NO. 5), RPS24 (SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10), RPS10 (SEQ ID NO. 11), RPL35a (SEQ ID NO. 12), RPL11 (SEQ ID NO. 3, SEQ ID NO. 14), RPS26 (SEQ ID NO. 15), and RPL5 (SEQ ID NO. 16), wherein the promoter region comprises or consists of an EF-1 alpha short (EF1as) promoter, a spleen focus-forming virus (SFFV) promoter, an EF-1 alpha (EF-1a) promoter, an EF-1 alpha with intron (EF1i) promoter, a phosphoglycerate kinase (PGK) promoter, a cytomegalovirus (CMV) promoter, a MND (myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer-binding site substituted) promoter, a ubiquitin C (UbC) promoter, or a CAG (CMV early enhancer / chicken actin) promoter. P7403PC00

[0235] In preferred embodiments of the construct of the present disclosure, the promoter region comprises or consists of an EF-1 alpha short (EF1as), a spleen focus-forming virus (SFFV) promoter, or a promoter exhibiting essentially the same effect.

[0236] In some embodiments: a. the EF1as promoter comprises or consists of the polynucleotide of SEQ ID NO. 27, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 27. b. the SFFV promoter comprises or consists of the polynucleotide of SEQ ID NO. 28, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 28.

[0237] The EF1as promoter may be referred to as EFS promoter.

[0238] In further embodiments, the construct of the invention further comprises a promoter region capable of controlling the transcription of the polynucleotide encoding the ribosomal protein described herein, wherein the promoter region comprises or consists of an RSV promoter, preferably wherein the RSV promoter comprises or consists of the polynucleotide of SEQ ID NO.: 49, or a sequence exhibiting essentially the same effect having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO.: 49.

[0239] In other embodiments, the construct further comprises a post-transcriptional regulatory element (PRE). P7403PC00

[0240] In some embodiments of the construct, the PRE is a safety optimized PRE comprising or consisting of the polynucleotide of SEQ ID NO. 29, or a sequence having at least 90% identity to SEQ ID. NO 29.

[0241] In preferred embodiments of the construct, the PRE is a safety optimized PRE comprising or consisting of the polynucleotide of or a sequence having at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 29.

[0242] In an alternative aspect, the invention relates to a construct which, upon expression, encodes: a. the RPS19 polypeptide sequence of SEQ ID. NO.: 1 , and wherein said construct comprises the codon-optimized RPS19 (coRPS19) polynucleotide sequence of SEQ ID NO: 18 or SEQ ID NO: 19 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 18 or SEQ ID NO: 19; b. the RPS17 polypeptide sequence of SEQ ID NO: 2, SEQ ID NO. 3, SEQ ID NO. 4, or SEQ ID NO. 5, and wherein said construct comprises the codon-optimized RPS17 (coRPS17) polynucleotide sequence of SEQ ID NO: 37 encoding RPS17, or a sequence having at least 90% identity to SEQ ID NO: 37; c. the RPS24 polypeptide sequence of SEQ ID NO: 7, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 9 or SEQ ID NO. 10, and wherein said construct comprises the codon-optimized RPS24 (coRPS24) polynucleotide sequence of SEQ ID NO: 38 encoding RPS24, or a sequence having at least 90% identity to SEQ ID NO: 38; d. the RPS10 polypeptide sequence of SEQ ID NO: 11 , and wherein said construct comprises the codon-optimized RPS10 (coRPSIO) polynucleotide sequence of SEQ ID NO: 39 encoding RPS10, or a sequence having at least 90% identity to SEQ ID NO: 39; e. the RPL35A polypeptide sequence of SEQ ID NO: 12, and wherein said construct comprises the codon-optimized RPL35a (coRPL35a) polynucleotide sequence of SEQ ID NO: 40 encoding RPL35a, or a sequence having at least 90% identity to SEQ ID NO: 40; P7403PC00 f. the RPL11 polypeptide sequence of SEQ ID NO: 13 or SEQ ID NO. 14, and wherein said construct comprises the codon-optimized RPL11 (coRPLI ) polynucleotide sequence of SEQ ID NO: 41 encoding RPL11, or a sequence having at least 90% identity to SEQ ID NO: 41; g. the RPS26 polypeptide sequence of SEQ ID NO: 15, and wherein said construct comprises the codon-optimized RPS26 (coRPS26) polynucleotide sequence of SEQ ID NO: 42 encoding RPS26, or a sequence having at least 90% identity to SEQ ID NO: 42; or, h. the RPL5 polypeptide sequence of SEQ ID NO: 44 or SEQ ID NO. 16, and wherein said construct comprises the codon-optimized RPL5 (coRPL5) polynucleotide sequence of SEQ ID NO: 43 encoding RPL5, or a sequence having at least 90% identity to SEQ ID NO: 43.

[0243] In an alternative aspect, the invention relates to a construct which, upon expression, encodes: a. the RPS19 polypeptide sequence of SEQ ID. NO.: 1 , and wherein said construct comprises the codon-optimized RPS19 (coRPS19) polynucleotide sequence of SEQ ID NO: 18 or SEQ ID NO: 19 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 18 or SEQ ID NO: 19; b. the RPS17 polypeptide sequence of SEQ ID NO: 2, and wherein said construct comprises the codon-optimized RPS17 (coRPS17) polynucleotide sequence of SEQ ID NO: 37 encoding RPS17, or a sequence having at least 90% identity to SEQ ID NO: 37; c. the RPS24 polypeptide sequence of SEQ ID NO: 7, and wherein said construct comprises the codon-optimized RPS24 (coRPS24) polynucleotide sequence of SEQ ID NO: 38 encoding RPS24, or a sequence having at least 90% identity to SEQ ID NO: 38; d. the RPS10 polypeptide sequence of SEQ ID NO: 11 , and wherein said construct comprises the codon-optimized RPS10 (coRPSIO) polynucleotide sequence of SEQ ID NO: 39 encoding RPS10, or a sequence having at least 90% identity to SEQ ID NO: 39; e. the RPL35A polypeptide sequence of SEQ ID NO: 12, and wherein said construct comprises the codon-optimized RPL35a (coRPL35a) P7403PC00 polynucleotide sequence of SEQ ID NO: 40 encoding RPL35a, or a sequence having at least 90% identity to SEQ ID NO: 40; f. the RPL11 polypeptide sequence of SEQ ID NO: 13, and wherein said construct comprises the codon-optimized RPL11 (coRPL11) polynucleotide sequence of SEQ ID NO: 41 encoding RPL11 , or a sequence having at least 90% identity to SEQ ID NO: 41 ; g. the RPS26 polypeptide sequence of SEQ ID NO: 15, and wherein said construct comprises the codon-optimized RPS26 (coRPS26) polynucleotide sequence of SEQ ID NO: 42 encoding RPS26, or a sequence having at least 90% identity to SEQ ID NO: 42; or, h. the RPL5 polypeptide sequence of SEQ ID NO: 44, and wherein said construct comprises the codon-optimized RPL5 (coRPL5) polynucleotide sequence of SEQ ID NO: 43 encoding RPL5, or a sequence having at least 90% identity to SEQ ID NO: 43.

[0244] In a preferred embodiment, the construct comprises the codon-optimized RPS19 (coRPS19) polynucleotide sequence of SEQ ID NO: 18 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 18.

[0245] In some embodiments, the polypeptide sequence has at least 70%, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11 , SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 44, or SEQ ID NO. 16.

[0246] In some embodiments, the construct further comprises the Kozak sequence of sequence SEQ. ID. NO.: 47 or a sequence having at least 90% identity to SEQ ID. NO 47, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO: 47. P7403PC00

[0247] In some embodiments, the construct further comprises a promoter region capable of controlling the transcription of the polynucleotide encoding the polypeptide selected from the group consisting of: RPS19 (SEQ ID NO. 1), RPS17 (SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, or SEQ ID NO. 5), RPS24 (SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10), RPS10 (SEQ ID NO. 11), RPL35a (SEQ ID NO. 12), RPL11 (SEQ ID NO. 13, SEQ ID NO. 14), RPS26 (SEQ ID NO. 15), and RPL5 (SEQ ID NO. 44, SEQ ID NO. 16), wherein the promoter region comprises or consists of an EF-1 alpha short (EF1as) promoter, a spleen focus-forming virus (SFFV) promoter, an EF-1 alpha (EF-1a) promoter, an EF-1 alpha with intron (EF1i) promoter, a phosphoglycerate kinase (PGK) promoter, a cytomegalovirus (CMV) promoter, a MND (myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer-binding site substituted) promoter, a ubiquitin C (UbC) promoter, or a CAG (CMV early enhancer / chicken actin) promoter, preferably wherein the promoter region comprises or consists of an EF-1 alpha short (EF1as) promoter.

[0248] In some embodiments: a. the EF1as promoter comprises or consists of the polynucleotide of SEQ ID NO. 27, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 27. b. the SFFV promoter comprises or consists of the polynucleotide of SEQ ID NO. 28, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 28.

[0249] In some embodiments, the construct further comprises a post-transcriptional regulatory element (PRE).

[0250] In some embodiments, the PRE is a safety optimized PRE comprising or consisting of the polynucleotide of SEQ ID NO. 29, or a sequence having at least 90% identity to SEQ ID. NO 29, such as at least 91%, such as at least 92%, such as at least 93%, P7403PC00 such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 29.

[0251] Vectors

[0252] Another aspect of the present disclosure relates to a vector comprising the construct of the present disclosure.

[0253] In preferred embodiments, the vector is a lentiviral vector.

[0254] In other preferred embodiments, the vector’s backbone is a pCCL backbone, a pCLL backbone, a pRRL backbone, a pRLL backbone, a pLL backbone, a pLenti backbone, a pLKO backbone, a pLPC backbone, a pHR backbone, or a pTRIP backbone.

[0255] In some embodiments, the vector comprises a 5’ long terminal repeat (5’ LTR), wherein the 5' LTR comprises a cytomegalovirus (CMV) enhancer / promoter.

[0256] In other embodiments, the 5' LTR sequence comprises or consists of the polynucleotide of SEQ ID NO. 30, or a sequence having at least 90% identity to SEQ ID. NO 30, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 30.

[0257] In further embodiments, said vector comprises a psi vector genome packaging signal. In some embodiments, the psi vector genome packaging signal sequence comprises or consists of the polynucleotide of SEQ ID NO. 31, or a sequence having at least 90% identity to SEQ ID. NO 31 , such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 31.

[0258] In some other embodiments, said vector comprises a primer binding site (PBS) comprising or consisting of the polynucleotide of SEQ ID NO.: 45, or a sequence having at least 90% identity to SEQ ID. NO 45, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 45. P7403PC00

[0259] The skilled person will appreciate that alternatively, the primer binding site (PBS) may be replaced with any other PBS or tRNA binding site that is functionally equivalent.

[0260] In other embodiments, said vector comprises a truncated form of the GAG gene of the HIV-1 genome (dGAG).

[0261] In some embodiments, the dGAG sequence comprises or consist of the polynucleotide of SEQ ID NO. 32, or a sequence having at least 90% identity to SEQ ID. NO 32, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 32.

[0262] In some embodiments, the dGAG sequence comprises or consist of the polynucleotide of SEQ ID NO.: 50, or a sequence having at least 90% identity to SEQ ID. NO 50, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 50.

[0263] In some embodiments, vector comprises a Rev Responsive Element (RRE).

[0264] In other embodiments, the RRE sequence comprises or consist of the polynucleotide of SEQ ID NO. 33, or a sequence having at least 90% identity to SEQ ID. NO 33, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 33.

[0265] In further embodiments, vector comprises a central polypurine tract (cPPT).

[0266] In some embodiments, the cPPT sequence comprises or consist of the polynucleotide of SEQ ID NO. 34, or a sequence having at least 90% identity to SEQ ID. NO 34, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 34. P7403PC00

[0267] In order to favor proper splicing and vector functionality, the HIV major splice donor may be used on the vector as binding site for the U1 small nuclear ribonucleoprotein (U1 snRNP).

[0268] Thus, in some embodiments, the vector comprises the HIV major splice donor.

[0269] In preferred embodiments, the HIV major splice donor sequence comprises or consists of the polynucleotide of SEQ ID NO.: 46, or a sequence having at least 90% identity to SEQ ID. NO 46, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO.: 46.

[0270] In some embodiments, the vector comprises a Simian Virus 40 polyadenylation (SV40 polyA) region, a Bovine Growth Hormone Polyadenylation Signal (BGH polyA) region, a Rabbit Beta-Globin Polyadenylation Signal (rBG polyA), a Human Beta-Globin Polyadenylation Signal (hBG polyA), a Human Growth Hormone Polyadenylation Signal (hGH polyA), a Mouse Beta-Globin Polyadenylation Signal (mBG polyA), or a Synthetic Polyadenylation Signal.

[0271] In preferred embodiments, the SV40 polyA sequence comprises or consists of the polynucleotide of SEQ ID NO. 35, or a sequence having at least 90% identity to SEQ ID. NO 35, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 35.

[0272] In other preferred embodiments, the vector is a self-inactivating (SIN) lentiviral vector such as a 3’ U3-deleted lentiviral vector.

[0273] In some embodiments, the vector comprises a Kanamycin resistance gene (Kan). The skilled person will appreciate that, alternatively to antibiotic selection, antibiotic-free selection systems might be used in the constructs, vectors, methods and uses thereof described herein for example to further improve safety and / or enhance vector production. These systems include, but not limited to, systems known in the art such as the RNA-OUT system. P7403PC00

[0274] In further embodiments, vector comprises or consists of the polynucleotide of SEQ ID NO. 36, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 36.

[0275] In an alternative aspect, the invention relates to a vector comprising the construct according to any one of the above aspects.

[0276] In some embodiments, the vector is a lentiviral vector, such as a self-inactivating (SIN) lentiviral vector, such as a 3’ U3-deleted lentiviral vector.

[0277] In some embodiments, said vector’s backbone is a pCCL backbone, a pCLL backbone, a pRRL backbone, a pRLL backbone, a pLL backbone, a pLenti backbone, a pLKO backbone, a pLPC backbone, a pHR backbone, or a pTRIP backbone, preferably a pCCL backbone.

[0278] In some embodiments, the vector comprises or consists of the polynucleotide of SEQ ID NO. 36, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 36.

[0279] In some embodiments, the vector comprises or consists of the polynucleotide of SEQ ID NO. 51 , or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 51 .

[0280] In some embodiments, the vector comprises or consists of the polynucleotide of SEQ ID NO. 52, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 52. P7403PC00

[0281] In some embodiments, the vector comprises or consists of the polynucleotide of SEQ ID NO. 53, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 53.

[0282] In some embodiments, the vector comprises or consists of the polynucleotide of SEQ ID NO. 54, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 54.

[0283] In some embodiments, the vector comprises or consists of the polynucleotide of SEQ ID NO. 55, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 55.

[0284] In some embodiments, the vector comprises or consists of the polynucleotide of SEQ ID NO. 56, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 56.

[0285] In some embodiments, the vector comprises or consists of the polynucleotide of SEQ ID NO. 57, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 57.

[0286] In some embodiments, the vector comprises or consists of the polynucleotide of SEQ ID NO. 36, SEQ ID NO. 51 , SEQ ID NO. 52, SEQ ID NO. 53, SEQ ID NO. 54, SEQ ID NO. 55, SEQ ID NO. 56 or SEQ ID NO. 57, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least P7403PC00

[0287] 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 36, SEQ ID NO. 51 , SEQ ID NO. 52, SEQ ID NO. 53, SEQ ID NO. 54, SEQ ID NO. 55, SEQ ID NO. 56 or SEQ ID NO. 57.

[0288] In some embodiments, the vector comprises or consists of a polynucleotide selected from the group consisting of: polynucleotide of SEQ ID NO. 36, polynucleotide of SEQ ID NO. 51, polynucleotide of SEQ ID NO. 52, polynucleotide of SEQ ID NO. 53, polynucleotide of SEQ ID NO. 54, polynucleotide of SEQ ID NO. 55, polynucleotide of SEQ ID NO. 56 andpolynucleotide of SEQ ID NO. 57, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 36, SEQ ID NO. 51, SEQ ID NO. 52, SEQ ID NO. 53, SEQ ID NO. 54,

[0289] SEQ ID NO. 55, SEQ ID NO. 56 or SEQ ID NO. 57.

[0290] Method of manufacturing a transfer vector

[0291] A further aspect of the present disclosure relates to a method of manufacturing a transfer vector, said method comprising the steps of: a. providing the construct of the present disclosure; and b. inserting the construct into a transfer vector backbone.

[0292] In preferred embodiments, the transfer vector is the vector described in the present disclosure. The transfer vector may be as described in the Vectors section herein. By way of example, the transfer vector’s backbone may be a pCCL backbone, a pCLL backbone, a pRRL backbone, a pRLL backbone, a pLL backbone, a pLenti backbone, a pLKO backbone, a pLPC backbone, a pHR backbone, or a pTRIP backbone.

[0293] Host cells

[0294] Another aspect of the disclosure relates to a host cell comprising the construct or vector of the present disclosure, for example as described in the Constructs encoding ribosomal proteins or Vectors sections herein. P7403PC00

[0295] Standard methods of lentiviral vector production rely on packaging cell lines, such as HEK293T cells, which are transfected with a transfer vector containing the therapeutic gene of interest, along with packaging plasmids that supply essential viral proteins like gag, pol, and rev. The packaging cell lines are specifically designed to produce these viral proteins, enabling the assembly of viral particles without including the viral genome itself. An additional envelope plasmid, commonly VSV-G, is co-transfected to facilitate the formation of infectious lentiviral particles. The resulting viral particles are released into the culture medium, where they are harvested and purified for use in gene therapy, ensuring high-efficiency delivery of the therapeutic transgene.

[0296] Thus, in some embodiments, the host cell is a packaging cell line.

[0297] Packaging cell lines used in lentiviral production include HEK293 and its derivatives, such as HEK293T and HEK293FT, due to their high transfection efficiency and robust viral production.

[0298] Thus in some embodiments, the host cell is a HEK293 cell, or derivative thereof, such as a HEK293T cell.

[0299] Lentiviral vector production typically utilizes 2-, 3-, or 4- or more plasmid helper systems, corresponding to different generations of lentiviral vectors. In 2-plasmid systems, the transfer vector and packaging components are combined into fewer plasmids, simplifying transfection but potentially increasing recombination risks. In 3- plasmid systems, the therapeutic gene, packaging proteins (gag, pol, rev), and envelope protein (VSV-G) are delivered separately, enhancing safety by reducing recombination. The 4-plasmid system, used in third-generation lentiviral vectors, further separates the packaging proteins, maximizing biosafety by limiting the chances of replication-competent lentivirus formation.

[0300] In some embodiments, the host cell further comprises one or more helper plasmids, such as two, such as three helper plasmids.

[0301] In preferred embodiments, said helper plasmids are one or more packaging plasmids, and / or an envelope plasmid. P7403PC00

[0302] In yet other preferred embodiments, said helper plasmids are a gag / pol-encoding plasmid, a rev-encoding plasmid and a VSV-G-encoding plasmid.

[0303] In preferred embodiments, the lentiviral vector is a clinical vector CLIN-LV-EFS- RPS19-PRE* comprising the construct of the present disclosure. The vector is produced by transient transfection of HEK293T cells with pCCL.EFS.rps19co.pre#- KAN BB (FIG. 1) and three other helper plasmids encoding lentiviral vector particle genes. The vector is a third-generation lentiviral self-inactivating (SIN) vector containing kanamycin resistance in the backbone, the codon optimization of RPS19 described herein, and a safety-modified post-transcriptional regulatory element (PRE*) sequence. The helper plasmids are Vesicular stomatitis virus-G (VSV-G), reverse transcriptase (Rev), and group antigen / reverse transcriptase (Gag / Pol)-plasmid; all 3 helper plasmids have a cytomegalovirus (CMV) promoter and strong polyA sequence. In addition, the Gag / Pol plasmid harbours a RRE (Rev-responsive element) to improve RNA export.

[0304] The pCCL.EFS.rps19co.pre construct#-KAN BB (SEQ. ID. NO.:36) includes an Elongation factor 1a short (EFS) promoter that greatly decreases the risk of insertional transformation compared with viral promoters, and a codon-optimized RPS19 transgene that results in higher expression levels and an increased therapeutic index.

[0305] Lentiviral vectors

[0306] In another aspect, the present disclosure relates to a lentiviral vector comprising the construct of the present disclosure. Said construct may be as defined in the Constructs encoding ribosomal proteins section herein.

[0307] The skilled person will appreciate that once transfected with the transfer vector and packaging components, the host cells produce and release lentiviral particles into the culture medium. These particles are then typically harvested and purified using techniques known in the art such as ultracentrifugation or chromatography, ensuring a concentrated and high-quality preparation for gene delivery in therapeutic applications.

[0308] In preferred embodiments, the lentiviral vectors are lentiviral particles. P7403PC00

[0309] Methods of manufacturing a lentiviral vector

[0310] A further aspect of the present disclosure relates to a method of manufacturing a lentiviral vector, said method comprising a step of transfecting a host cell with the vector of the present disclosure. The host cell and vector may be as defined in the Host cells and Vectors sections, respectively, of the present disclosure.

[0311] In preferred embodiments, the step of transfecting said host cell with the vector of the present disclosure further comprises a step of transfecting the host cell with one or more helper plasmids, such as two, such as three helper plasmids, preferably wherein said helper plasmids are one or more packaging plasmids, and / or an envelope plasmid, even more preferably wherein said helper plasmids are a gag / pol-encoding plasmid, a rev-encoding plasmid and a VSV-G-encoding plasmid.

[0312] Methods of manufacturing a cell expressing the a ribosomal protein gene

[0313] Vectors, including lentiviral particles of the present invention, find applications, for instance, in the treatment of Diamond-Blackfan Anemia (DBA). Typically, these methods involve transducing target cells with the lentiviral particles containing the ribosomal protein genes, such as the optimized rps19 gene construct, allowing for stable integration and expression of the therapeutic gene. The inventors show for example herein that resulting modified cells exhibit RPS19 expression, at a level resulting in therapeutic effects, addressing the underlying genetic deficiency.

[0314] In another aspect, the present disclosure provides a method of manufacturing a cell expressing a ribosomal protein gene, said method comprising the steps of: a. Providing a cell; and b. Transducing said cell with the lentiviral vector as described herein, thereby obtaining a cell expressing the ribosomal protein gene.

[0315] In an alternative aspect, the present disclosure provides a method of manufacturing a cell expressing a ribosomal protein gene, said method comprising the steps of: a. Providing a cell; and b. Transducing said cell with the vector as described herein, P7403PC00 thereby obtaining a cell expressing the ribosomal protein gene.

[0316] In a further aspect, the present disclosure relates to a method of manufacturing a cell expressing a ribosomal protein encoded by a ribosomal protein gene, said method comprising the steps of: a. Providing a cell; and b. Transducing said cell with the lentiviral vector as described herein, thereby obtaining a cell expressing the ribosomal protein encoded by the ribosomal protein gene.

[0317] In some embodiments, the ribosomal protein is encoded by a polypeptide selected from the group consisting of: RPS19 (SEQ ID NO. 1), RPS17 (SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, or SEQ ID NO. 5), RPS24 (SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10), RPS10 (SEQ ID NO. 11), RPL35a (SEQ ID NO. 12), RPL11 (SEQ ID NO. 13, SEQ ID NO. 14), RPS26 (SEQ ID NO. 15), and RPL5 (SEQ ID NO. 16), or a biologically active variant thereof having at least 70% identity to said SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, or SEQ ID NO. 16.

[0318] In other embodiments, the ribosomal protein is encoded by a polypeptide having at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, or SEQ ID NO. 16.

[0319] In preferred embodiments, the ribosomal protein gene is encoded by:

[0320] - the RPS19 polynucleotide sequence of SEQ ID. NO 17 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 17, such as has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such P7403PC00 as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 17.

[0321] - the codon-optimized RPS19 (coRPS19) polynucleotide sequence of SEQ ID. NO 18 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 18, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 18;

[0322] - the codon-optimized RPS19 (coRPS19) polynucleotide sequence of SEQ ID. NO 19 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 19, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 19;

[0323] - the RPS17 polynucleotide sequence of SEQ ID. NO 20 encoding RPS17, or a sequence having at least 90% identity to SEQ ID. NO 20, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 20;

[0324] - a codon-optimized RPS17 (coRPS17) polynucleotide sequence, preferably wherein the coRPS17 polynucleotide sequence is of SEQ ID. NO 37, or a sequence having at least 90% identity to SEQ ID. NO 37, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 37;

[0325] - the RPS24 polynucleotide sequence of SEQ ID. NO 21 encoding RPS24, or a sequence having at least 90% identity to SEQ ID. NO 21 , such as at least 91%, such as at least 92%, such as at least 93%, such P7403PC00 as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 21 ;

[0326] - a codon-optimized RPS24 (coRPS24) polynucleotide sequence, preferably wherein the coRPS24 polynucleotide sequence is of SEQ ID. NO 38, or a sequence having at least 90% identity to SEQ ID. NO 38, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 38;

[0327] - the RPS10 polynucleotide sequence of SEQ ID. NO 22 encoding RPS10, or a sequence having at least 90% identity to SEQ ID. NO 22, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 22;

[0328] - a codon-optimized RPS10 (coRPSIO) polynucleotide sequence, preferably wherein the coRPSIO polynucleotide sequence is of SEQ ID. NO 39, or a sequence having at least 90% identity to SEQ ID. NO 39, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 39;

[0329] - the RPL35a polynucleotide sequence of SEQ ID. NO 23 encoding RPL35a, or a sequence having at least 90% identity to SEQ ID. NO 23, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 23; P7403PC00

[0330] - a codon-optimized RPL35a (co RPL35a) polynucleotide sequence, preferably wherein the coRPL35a polynucleotide sequence is of SEQ ID. NO 40, or a sequence having at least 90% identity to SEQ ID. NO 40, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 40;

[0331] - the RPL11 polynucleotide sequence of SEQ ID. NO 24 encoding RPL11, or a sequence having at least 90% identity to SEQ ID. NO 24, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 24;

[0332] - a codon-optimized RPL11 (coRPL11) polynucleotide sequence, preferably wherein the coRPLI 1 polynucleotide sequence is of SEQ ID. NO 41 , or a sequence having at least 90% identity to SEQ ID. NO 41 , such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 41 ;

[0333] - the RPS26 polynucleotide sequence of SEQ ID. NO 25 encoding RPS26, or a sequence having at least 90% identity to SEQ ID. NO 25, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 25;

[0334] - a codon-optimized RPS26 (coRPS26) polynucleotide sequence, preferably wherein the coRPS26 polynucleotide sequence is of SEQ ID. NO 42, or a sequence having at least 90% identity to SEQ ID. NO 42, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at P7403PC00 least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 42;

[0335] - the RPL5 polynucleotide sequence of SEQ ID. NO 26 encoding RPL5, or a sequence having at least 90% identity to SEQ ID. NO 26, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 26; or,

[0336] - a codon-optimized RPL5 (coRPL5) polynucleotide sequence, preferably wherein the coRPL5 polynucleotide sequence is of SEQ ID. NO 43, or a sequence having at least 90% identity to SEQ ID. NO 43, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 43.

[0337] In preferred embodiments, the cell of step a. is a human cell. In other embodiments, the cell of step a. is a hematopoietic cell. In yet other embodiments, the cell of step a. is a hematopoietic progenitor cell. In other embodiments, the hematopoietic progenitor cell is a stem cell.

[0338] The present invention encompasses methods for manufacturing cells expressing the ribosomal protein gene, such as the RPS19, RPS17, RPS24, RPS10, RPL35A, RPL11, RPS26, orRPL5 genes described herein, and methods for manufacturing cells expressing the ribosomal protein encoded by said genes, and may make use of various sources of cells such as hematopoietic progenitor cells. These sources include, but not limited to, bone marrow aspirates, peripheral blood collected via leukapheresis, and umbilical cord blood.

[0339] Prior to apheresis, subjects from which the cells are sourced may be treated with filgrastim in combination with plerixafor to mobilize cells. Filgrastim may be administered at a dose of 5 pg / kg / dose every 12 to 24 hours SC for 5 to 6 days. P7403PC00

[0340] Plerixafor may be administered after the subject has received filgrastim for 4 days. Plerixafor may be administered via subcutaneous injection, preferably at 0.24 mg / kg. Typically, hematopoietic progenitor cells are isolated from these sources and subsequently transduced with lentiviral vectors containing the codon-optimized gene construct.

[0341] Thus, in some embodiments, the hematopoietic stem cell is a peripheral blood stem cell. In other embodiments, the hematopoietic stem cell is an umbilical cord blood stem cell. In yet other embodiments, the hematopoietic stem cell is a bone marrow stem cell. In further embodiments, the hematopoietic progenitor cell is a lymphoid progenitor cell. In additional embodiments, the hematopoietic progenitor cell is an erythroid progenitor cell. In some embodiments, the hematopoietic progenitor cell is a Burst-forming unit- erythroid (BFLI-E) progenitors or Colony-forming unit-erythroid (CFLI-E) progenitor.

[0342] The skilled person will appreciate that cells thus harvested may be stored in suitable containers such as leukopaks, in particular leukopaks for freezing.

[0343] In preferred embodiments, the cell of step a. is a CD34+ cell. In other embodiments, the CD34+ cell is a CD34+ stem cell. In further embodiments, the CD34+ cell is a CD34+ hematopoietic progenitor cell. The skilled person will appreciate that the cell may express further stem cell markers in addition to CD34+, such as CD90, CD49F or CD133, which do not impair their suitability for the methods and uses described herein.

[0344] In some embodiments of the method, the cell overexpresses genes associated with terminal erythropoiesis and / or downregulates expression of genes associated with apoptosis and p53 activation following the step b. of transduction of said cell with the lentiviral vector as described herein. Said gene expression changes typically use the levels of expression prior to the step b. of transduction, or of a non-transduced control cell, as baseline expression level.

[0345] In preferred embodiments, said genes associated to terminal erythropoiesis are HEMGN, HBB, AHSP, EPB42 and / or GYPA and said genes associated with apoptosis and p53 activation are BAX, MDM2, ZMAT3 and / or MIR34AHG. P7403PC00

[0346] In some embodiments, the cell overexpresses the large non-coding RNA LINC01133 and / or down-regulates the expression of XACT and / or ADA following the step b. of transduction of said cell with the lentiviral vector as described herein. Said gene expression changes typically use the levels of expression prior to the step b. of transduction, or of a non-transduced control cell, as baseline expression level..

[0347] In other embodiments, the cell overexpresses RPL22L1 and / or CD70 following the step b. of transduction of said cell with the lentiviral vector as described herein. Said gene expression changes typically use the levels of expression prior to the step b. of transduction, or of a non-transduced control cell, as baseline expression level..

[0348] In some embodiments, the method further comprises a step of contacting the cell with one or more cytokines, thereby obtaining an activated cell.

[0349] In preferred embodiments, the step of contacting the cell with one or more cytokines is performed prior to, simultaneously and / or after the step b. of transducing said cell with the lentiviral vector, preferably prior to the step b. of transducing said cell with the lentiviral vector.

[0350] In some embodiments of the methods described herein, the step b. of transduction is performed at a multiplicity of infection (MOI) number of viral particles I number of cells of 5, such as 10, such as 15, such as 20, such as 25, such as 30, such as 35, such as 50, such as 60, such as 65, such as 70, such as 70, such as 80, such as 90, such as 100, such as 120, such as 150, such as 200.

[0351] In other preferred embodiments, the one or more cytokines comprise or consist of Stem cell factor (SCF), Fms-related tyrosine kinase 3 ligand (FLT-3L) and thrombopoietin (TPO).

[0352] In preferred embodiments, the method further comprises a step of pre-stimulating the cell using a platelet wash, followed by a step of CD34+ cell selection, such as using the Miltenyi CliniMACS® system. Said step is typically performed prior to the step of transducing the cell.

[0353] In some embodiments, the cell, such as the CD34+ stem cell, are incubated in stem cell growth media (SCGM), with human stem cell factor, Fms-related tyrosine kinase 3 P7403PC00 ligand (FLT-3L), thrombopoietin (TPO), and cytokines for 24 to 48 hours in cell culture bags.

[0354] In some embodiments, the Stem cell factor (SCF), Fms-related tyrosine kinase 3 ligand (FLT-3L) and / or thrombopoietin are used at 50 to 500ng / mL, 50 to 500ng / mL, and 10 to 200 ng / mL, respectively, preferably at 100 to 300ng / mL, 100 to 300ng / mL, and 10 to 150ng / mL, respectively, even more preferably at 100ng / mL, 100ng / mL and 50ng / mL, respectively.

[0355] In other embodiments the Stem cell factor (SCF), Fms-related tyrosine kinase 3 ligand (FLT-3L) and / or thrombopoietin are used at 1 ng / mL to 1pg / mL.

[0356] In other embodiments, other molecules useful in expanding stem cells, such as LIM171, LIM729, SR1, prostaglandin E2 and / or the p38 inhibitor LY2228820 may be used alone or in combination with the cytokines in the methods of the present invention.

[0357] Transduction enhancers such as, but not limited to, polybrene, protamine sulfate, or retronectin, are known in the art and utilized to improve the efficiency of lentiviral vector delivery and gene integration. The selection of the most effective transduction enhancer is not obvious, as its efficacy can vary based on the specific cell type, vector system, and experimental conditions.

[0358] In some embodiments, the method further comprises a step of contacting the cell with adjuvants, such as one or more transduction enhancers.

[0359] In some embodiments the one or more transduction enhancers is protamine sulfate. In preferred embodiments, the one or more transduction enhancer comprises or consists of a polybrene, such as LentiBoost™. In preferred embodiments, Lentiboost™ is used at a final concentration of 0.3 to 10mg / mL, preferably 0.5 to 10mg / ml, even more preferably 0.3 to 1mg / mL, yet even more preferably 1mg / mL. In preferred embodiments, Lentiboost is used at 0.3 to 1mg / mL with a multiplicity of infection (MOI) number of viral particles I number of host cells in the range of 1-120, preferably 100, even more preferably 70. P7403PC00

[0360] In preferred embodiments the step of contacting the cell with adjuvants, such as one or more transduction enhancers is performed prior to, simultaneously and / or after the step b. of transducing said cell with the lentiviral vector, preferably simultaneously to the step b. of transducing said cell with the lentiviral vector.

[0361] The inventors have found that reduction of the volume of the medium in which the transduction step of the cells by the lentiviral vector is performed increased vector copy number and the transduction efficiency.

[0362] Thus, in some embodiments the step of transduction of the cells by the lentiviral vector is performed in a medium supporting transduction and said volume of medium is reduced compared to the volume of medium prior to the step of initiating the transduction. In preferred embodiments, the volume reduction is by at least 25%, such as 30%, such as 35%, such as 40%, such as 45%, such as 50%, such as 55%, such as 60% such as 65%, such as 70%, such as 75% compared to pre-transduction volume.

[0363] In some embodiments, the volume is reduced for at least 15 minutes, such as 20 minutes, such as 25 minutes, such as 30 minutes, such as 35 minutes, such as 40 minutes, such as 45 minutes , such as 1hour, such as 2 hours after initiation of the cell transduction (contacting of the cells with lentiviral vectors).

[0364] In preferred embodiments, the volume is reduced for no more than 1hour, such as no more than 30 minutes, preferably for 30 minutes, to mitigate any negative effects of a highly concentrated culture on the cells.

[0365] Following the volume reduction step, the volume may be increased so that cells are returned back to their target cell density (such as between 1x10A6 and 2x10A6 cells / mL).

[0366] An example of said method of manufacturing a cell expressing RPS19 encoded by a rps19 gene is outlined on Fig.6.

[0367] Thus in some embodiments, said method of manufacturing is a method comprising the steps of: a. Providing a cell, wherein said step comprises the steps of: P7403PC00 i. Providing CD34+ cells; ii. Culturing said CD34+ cells for 20-24h; b. Transducing said cell with the lentiviral vector described herein, wherein said transduction is performed for 16-24h, thereby obtaining a cell expressing RPS19.

[0368] As described herein the present invention also covers said methods of manufacturing a cell expressing RPS19, RPS17, RPS24, RPS10, RPL35A, RPL11, RPS26, or RPL5 encoded by a RPS19, RPS17, RPS24, RPS10, RPL35A, RPL11, RPS26, OR RPL5 gene as described herein, respectively.

[0369] The day in which step a. of providing a cell is performed may be referred to as day 0, the day in which step b. of transducing said cell is performed may be referred to as day 1.

[0370] In some embodiments, the step ii. of Culturing said CD34+ cells comprises culturing the cells in the medium comprising the cytokines as described herein, such as Stem cell factor (SCF), Fms-related tyrosine kinase 3 ligand (FLT-3L) and / or thrombopoietin (TPO) at the concentrations described herein.

[0371] In further embodiments, the method of manufacturing a cell expressing RPS19 encoded by a rps19 gene comprises the steps a. of providing a cell and step b. of transducing said cell, and further comprises the steps of: c. harvesting said cell; d. formulating said cell; and e. cryopreserving said cell.

[0372] The day in which step c. of harvesting said cell, step d. of formulating said cell, and step e. of cryopreserving said cells are performed may be referred to as day 2.

[0373] Such methods comprising steps a. to c., steps a. to d., or steps a. to e. hereinabove, preferably steps a. to d., or steps a. to e are useful in obtaining the Compositions comprising a sterile dispersion of the host cells or the cells described herein as described herein in the Compositions section, such as in obtaining APR-2020. P7403PC00

[0374] In some embodiments, the step d. of formulating said cell comprises diluting or concentrating said harvested cell in the solutions described in the Compositions section herein to the cell number and / or concentrations described herein in the Compositions section, such as in solutions comprising a pharmaceutically acceptable carrier or diluent.

[0375] In other embodiments, the step e. of cryopreserving said cell may comprise diluting or concentrating said harvested cell in the cryopreservation solutions described in the Compositions section herein followed by freezing of the composition thus obtained.

[0376] In some embodiments, the cell of the above methods is selected from a CD34+ cell, a CD34+ stem cell, a CD34+ hematopoietic progenitor cell, a hematopoietic stem and progenitor cell (HSPC), hematopoietic cell, a hematopoietic progenitor cell, a stem cell, a hematopoietic stem cell, a peripheral blood stem cell, an umbilical cord blood stem cell, a bone marrow stem cell, a lymphoid progenitor cell, an erythroid progenitor cell, a Burst-forming unit-erythroid (BFLI-E) progenitors or Colony-forming unit-erythroid (CFLI-E) progenitor, preferably a CD34+ cell.

[0377] Cells

[0378] A further aspect of the present disclosure relates to a cell obtained by the Methods of manufacturing a cell expressing the ribosomal protein gene, or a cell obtained by the Methods of manufacturing a cell expressing the ribosomal protein described herein.

[0379] The cell or the gene therapy product as referred to herein may be referred to as “APR- 2020).

[0380] “APR-2020” comprises the codon optimized sequence of RPS19 as disclosed herein.

[0381] “APR-2020” comprises the codon optimized sequence of RPS19 as disclosed herein, i.e. SEQ ID NO. 18.

[0382] ‘APR-2020” comprises or consists of a vector of SEQ ID NO. 36. P7403PC00

[0383] An alternative cell or gene therapy product comprises an alternative codon optimized sequence of RPS19 as disclosed herein, i.e. SEQ ID NO. 19.

[0384] An alternative cell or gene therapy product comprises the codon-optimized sequences of RPS17, RPS24, RPS10, RPL35A, RPL11 , RPS26 or RPL5, i.e. SEQ ID NO: 37 - 44.

[0385] An alternative cell or gene therapy product comprises a vector of SEQ ID NO. 51 - 57.

[0386] In another aspect, the present disclosure provides a cell comprising in its genome:

[0387] - the codon-optimized rps19 (corps19) polynucleotide sequence of SEQ ID. NO 18 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 18, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 18;

[0388] - the codon-optimized rps19 (corps19) polynucleotide sequence of SEQ ID. NO 19 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 19, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 19;

[0389] - a codon-optimized RPS17 (coRPS17) polynucleotide sequence, preferably wherein the coRPS17 polynucleotide sequence is of SEQ ID. NO 37, or a sequence having at least 90% identity to SEQ ID. NO 37, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 37;

[0390] - a codon-optimized RPS24 (coRPS24) polynucleotide sequence, preferably wherein the coRPS24 polynucleotide sequence is of SEQ ID. P7403PC00

[0391] NO 38, or a sequence having at least 90% identity to SEQ ID. NO 38, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 38;

[0392] - a codon-optimized RPS10 (coRPSIO) polynucleotide sequence, preferably wherein the coRPSIO polynucleotide sequence is of SEQ ID. NO 39, or a sequence having at least 90% identity to SEQ ID. NO 39, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 39;

[0393] - a codon-optimized RPL35a (coRPL35a) polynucleotide sequence, preferably wherein the coRPL35a polynucleotide sequence is of SEQ ID. NO 40, or a sequence having at least 90% identity to SEQ ID. NO 40, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 40;

[0394] - a codon-optimized RPL11 (coRPL11) polynucleotide sequence, preferably wherein the coRPL11 polynucleotide sequence is of SEQ ID. NO 41 , or a sequence having at least 90% identity to SEQ ID. NO 41 , such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 41 ;

[0395] - a codon-optimized RPS26 (coRPS26) polynucleotide sequence, preferably wherein the coRPS26 polynucleotide sequence is of SEQ ID. NO 42, or a sequence having at least 90% identity to SEQ ID. NO 42, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at P7403PC00 least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 42; or,

[0396] - a codon-optimized RPL5 (coRPL5) polynucleotide sequence, preferably wherein the coRPL5 polynucleotide sequence is of SEQ ID. NO 43, or a sequence having at least 90% identity to SEQ ID. NO 43, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 43.

[0397] In some embodiments, the host cell or the cell of the present disclosure is a human cell. In other embodiments, said host cell or cell is a hematopoietic cell. In further embodiments, said host cell or cell is a hematopoietic progenitor cell.

[0398] In other embodiments, the hematopoietic progenitor cell is a stem cell. In further embodiments, the hematopoietic stem cell is a peripheral blood stem cell.

[0399] In preferred embodiments, the hematopoietic stem cell is an umbilical cord blood stem cell. In other embodiments, the hematopoietic stem cell is a bone marrow stem cell. In yet other embodiments, the hematopoietic progenitor cell is a lymphoid progenitor cell.

[0400] In other preferred embodiments of the host cell or the cell of the present disclosure, said host cell or cell is a CD34+ cell. In further embodiments, the CD34+ cell is a CD34+ stem cell. In other embodiments, the CD34+ cell is a CD34+ hematopoietic progenitor cell.

[0401] In further embodiments, the host cell or cell overexpresses genes associated to terminal erythropoiesis and / or wherein the cell downregulates expression of genes associated with apoptosis and p53 activation.

[0402] In some embodiments, said genes associated with terminal erythropoiesis are HEMGN, HBB, AHSP, EPB42 and / or GYPA and wherein said genes associated with apoptosis and p53 activation are BAX, MDM2, ZMAT3 and / or MIR34AHG. P7403PC00

[0403] In some embodiments, host cell or cell overexpresses the large non-coding RNA LINC01133 and / or down-regulates the expression of XACT and / or ADA.

[0404] In some embodiments, the host cell or cell overexpresses RPL22L1 and / or CD70.

[0405] In preferred embodiments, the cells are autologous CD34+ cells derived from a subject with RPS19-deficient Diamond Blackfan Anaemia (DBA), transduced with a lentiviral vector (LVV) containing the genetic sequence to produce a wild-type ribosomal protein S19 (RPS19), said cells, in particular when transduced with lentiviral particles obtained by methods making use of the clinical vector CLIN-LV-EFS-RPS19-PRE* described herein, may be the main component of a composition referred to as APR-2020 herein.

[0406] Compositions

[0407] In another aspect, the present disclosure provides a composition comprising a sterile dispersion of the host cells or the cells described herein. When relating to the host cells or cells described herein and the rps19 gene and / or rps19 polynucleotide sequences described herein, said composition is referred to as the final drug product (FDP), APR- 2020 herein.

[0408] In some embodiments, the composition comprising the sterile dispersion may be for infusion.

[0409] In preferred embodiments, the composition further comprises a cryoprotectant. In some embodiments, the cryopreservative solution comprises DMSO.

[0410] In preferred embodiments, the composition comprising a sterile dispersion of the host cells or the cells described herein are cryopreserved 16-24h after transduction start with the vector described herein, corresponding to day 2 (D2) after the cells isolation / culture / seeding as described for example on Fig. 6.

[0411] In further embodiments, the composition may be packaged in a bag suitable for storing cells, or in a vial suitable for storing cells. P7403PC00

[0412] The skilled person will appreciate that bags and vials suitable for storing cells, such as in the context of manufacturing or biological cell storage typically display high biocompatibility, are able to maintain sterility, and some types of bags and vials might be designed to allow controlled levels of gas exchange. Such bags and vial typically comprise means for sealing and closing, such as caps. The skilled person will also know that other containers suitable for storing cells, such as containers known in the art for storing cells used in cell therapy may be used, for example FDA and / or EMA- compliant bags or vials.

[0413] In other embodiments, the composition can thus be under the form of a cryopreservation bag or vial, for example with a final volume of 10-100mL, such as 10 to 20mL final volume, such as 30-70mL final volume. In further embodiments, the composition may contain 1-10x10A6 cells / mL. Other suitable volumes may be used.

[0414] The skilled person will appreciate that in such embodiments, the bags or vials are able to withstand low temperatures, typically below -80°C, for example liquid nitrogen temperatures and to be compatible with the cryoprotectants used.

[0415] In some embodiments, the composition comprises 5% human serum albumin.

[0416] In other embodiments, the composition comprises a percentage of viable CD34+ cells, such as hematopoietic stem cells and progenitor cells from the bone marrow or mobilized peripheral blood cells, of at least 35%, such as at least 40%, such as at least 45%, such as at least 50%, such as at least 55%, such as at least 60%, such as at least 65%, such as at least 70%, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 100%.

[0417] The skilled person will appreciate that any suitable technique for cell marker measurement may be used, such as, but not limited to, flow cytometry. In some embodiments, the composition comprises a percentage of CD34+ cells of at least 35% as measured by flow cytometry, such as using a BD FACSLyric™ Flow Cytometry System.

[0418] In preferred embodiments, the composition comprises a percentage of viable double positive CD45+ / CD34+ cells of at least 35%, such as at least 40%, such as at least P7403PC00

[0419] 45%, such as at least 50%, such as at least 55%, such as at least 60%, such as at least 65%, such as at least 70%, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 100%.

[0420] The skilled person will appreciate that any suitable technique for cell marker measurement may be used, such as, but not limited to, flow cytometry. In some embodiments, the composition comprises a percentage of viable double positive CD45+ / CD34+ cells of at least 35% as measured by flow cytometry, such as using a BD FACSLyric™ Flow Cytometry System. The skilled person will appreciate that the double positive CD45+ / CD34+ cell population refers to hematopoietic stem cells and progenitor cells (HSPCs).

[0421] This percentage refers to the percentage of live cells expressing both CD45 and CD34 in the final cell therapy product.

[0422] In other embodiments, the composition comprises a percentage of CD3+, CD4+, CD8+, CD19+, CD16+, CD56+, CD14+, and CD15+ cells of at the most 30%, such as at the most 25%, such as at the most 20%, such as at the most 15 %, such as at the most 10%, such as at the most 5%, such as at the most 0%. The skilled person will appreciate that said markers relate to the population of T cells, B cells, and natural killer (NK) cells measured in the composition. The skilled person will appreciate that any suitable technique for cell marker measurement may be used, such as, but not limited to, flow cytometry. In some embodiments, the composition comprises a percentage of CD3+, CD4+, CD8+, CD19+, CD16+, CD56+, CD14+, and CD15+ cells of at the most 30 as measured by flow cytometry, such as using a BD FACSLyric™ Flow Cytometry System.

[0423] In some embodiments, the composition has a cell viability percentage of at least 70%, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 100%. The skilled person will appreciate that any suitable technique for viable cell count measurement may be used, such as, but not limited to, automated cell counter. In some embodiments, the composition has as viable cell count (VCC) of at least 70% as measured by automated cell counting, such as using a Nucleocounter® NC-200 cell counter. P7403PC00

[0424] In some embodiments, the composition has as viable cell concentration (VCC) of 1.6x10A6 to 2.4x10A6 viable cells / mL preferably wherein the VCC is measured by automated cell counting, such as using a Nucleocounter® NC-200 cell counter.

[0425] In some embodiments, the composition has as viable cell concentration (VCC) of 8x10A6 to 12x10A6 viable cells / mL preferably wherein the VCC is measured by automated cell counting, such as using a Nucleocounter® NC-200 cell counter.

[0426] In some embodiments, the composition comprises cells having a vector copy number comprised between 0.3 and 5 copies per cell. The skilled person will appreciate that any suitable technique for cell copy number measurement may be used, such as, but not limited to, Droplet Digital Polymerase Chain Reaction (ddPCR). In some embodiments, the composition comprises cells having a vector copy number comprised between 0.3 and 5 copies per cell as measured by ddCPR.

[0427] In preferred embodiments, the composition comprises: a percentage of viable double positive CD45+ / CD34+ cells of at least 35% as measured by flow cytometry, such as using a BD FACSLyric™ Flow Cytometry System, preferably measured at day 2 (D2), a percentage of CD3+, CD4+, CD8+, CD19+, CD16+, CD56+, CD14+, and CD15+ cells of at the most 30 as measured by flow cytometry, such as using a BD FACSLyric™ Flow Cytometry System preferably measured at day 2 (D2), a viable cell count (VCC) of at least 70% as measured by automated cell counting, such as using a Nucleocounter® NC-200 cell counter preferably measured at day 2 (D2), a viable cell concentration (VCC) of 1.6x10A6 to 2.4x10A6 viable cells / mL, or of 8x10A6 to 12x10A6 viable cells / mL, preferably wherein the VCC is measured by automated cell counting, such as using a Nucleocounter® NC-200 cell counter preferably measured at day 2 (D2), and / or cells having a vector copy number comprised between 0.3 and 5 copies per cell as measured by ddCPR, preferably measured at day 7 (D7) i.e. on cells cultured for 6 days following the day of transduction start as described herein. P7403PC00

[0428] In a further aspect, the present disclosure provides a pharmaceutical composition comprising the construct, the vector, the host cell, the lentiviral vector, the cell, or the composition described herein, and a pharmaceutically acceptable diluent or carrier.

[0429] Methods of treatment and medical uses

[0430] Another aspect of the present disclosure relates to a method of treating Diamond- Blackfan anemia (DBA) in a subject, the method comprising administering the construct, the vector, the host cell, the lentiviral vector, the cell, the composition, or the pharmaceutical composition described herein to the subject.

[0431] Most importantly, the constructs, vectors, cells and methods as disclosed herein ameliorate or rescue symptoms of DBA. Most importantly, the constructs, vectors, cells and methods as disclosed herein provide a disease modifying treatment of DBA.

[0432] In some embodiments, a target dose of 1 to 10A6 host cells or cells, such as 5x10A6 host cells or cells, preferably CD34+ cells as described herein, even more preferably CD34+ cells comprising the ribosomal protein gene or expressing the ribosomal protein as described herein, is administered to the subject.

[0433] In some embodiments, the subject has a genetic variation causing functional RPS19- protein deficiency. In preferred embodiments, the subject has a homozygous null genotype (null / null) for the ribosomal protein gene. In other embodiments, the subject is transfusion-dependent. In yet other embodiments, the subject is a pediatric subject. In some embodiments, the subject is between 3 and 18 years of age, inclusive.

[0434] In other embodiments, the subject may harbor a c.3 G>T rps19 variant with disrupted translation start site, a c.131_132delp.E44 Afs*49 rps19 variant with E44 frameshift and early stop at amino acid number 49, a c.173-2 A>C variant with disrupted acceptor spliced site, or a c.58 C>T variant wherein the Alanine 58 is replaced by Valine at position 58 (Ala58>Val58), such as the 4 subjects disclosed in Table 1.

[0435] Table 1 - Enrolled DBA patients with RPS19 mutations P7403PC00

[0436] A further aspect of the present disclosure relates to the construct, the vector, the host cell, the lentiviral vector, the cell, the composition, or the pharmaceutical composition as described herein, for use in medicine.

[0437] Yet another aspect of the present disclosure relates to the construct, the vector, the host cell, the lentiviral vector, the cell, the composition, or the pharmaceutical composition as described herein, for use in treating Diamond-Blackfan anemia (DBA).

[0438] Another aspect of the present disclosure provides the use of the construct, the vector, the host cell, the lentiviral vector, the cell, the composition, or the pharmaceutical composition as described herein for the manufacture of a medicament for the treatment of Diamond-Blackfan anemia (DBA).

[0439] In preferred embodiments, administration is performed by intravenous infusion, such as intravenous infusion of the cells or host cells described herein.

[0440] In some embodiments, the subjects receive conditioning therapy prior to administration of the cell, the composition, or the pharmaceutical composition as described herein, such as 7 days, such as 6 days, such as 4 days, such as 3 days, such as 2 days before administration. P7403PC00

[0441] In some embodiments, from 5 to 2 days prior to administration of the host cell, the lentiviral vector, the cell, the composition, or the pharmaceutical composition as described herein, subjects receive conditioning busulfan therapy consisting of full conditioning with 3.2 mg / kg busulfan / day for 4 days (0.8 mg / kg day Q6H IV for 4 days to maintain AUCotoehours in the range of 950 to 1150 pM*minute)

[0442] In other embodiments, from 5 to 2 days prior to administration of the host cell, the lentiviral vector, the cell, the composition, or the pharmaceutical composition as described herein, subjects receive reduced conditioning busulfan IV therapy dose level 2.24 mg / kg per day for 4 days (0.56 mg / kg every 6 hours).

[0443] In some embodiments, busulfan is washed out prior to administration of the cells.

[0444] Busilvex (busulfan IV) may be used as a single conditioning agent. Busulfan offers the advantage of being almost purely myeloablative as it induces very little immunosuppression (Lucarelli et al., 1993). Regimens using busulfan have resulted in short times to neutrophil and platelet recovery (15 days), few treatment-related complications, and stable donor engraftment (Lucarelli et al., 1993). Busulfan is typically used in conjunction with cyclophosphamide, etoposide, or fludarabine for conditioning prior to allogeneic stem cell transplant (Lucarelli et al., 1993). When the methods and uses of the present invention involve autologous stem cells, immunosuppression is dispensable and busulfan may be used as a single agent. Human HSCs from normal individuals do not have a spontaneous selective advantage in-vivo over HSCs from subjects with DBA; therefore, conditioning, such as myeloablative conditioning or milder conditioning, in gene therapy is beneficial for this disease. Indeed, to successfully implement gene therapy for DBA, it is important to first perform conditioning to create an environment where the introduced gene-modified HSCs in the subject have a survival advantage over the existing defective ones.

[0445] In some embodiments, anemia is rescued following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition. P7403PC00

[0446] "anemia rescue" may comprise the restoration of one or more of: normal red blood cell counts, hemoglobin levels, and reticulocyte counts in individuals suffering from anemia, particularly in genetic disorders like Diamond-Blackfan Anemia (DBA).

[0447] Therapeutic success is typically assessed through clinical readouts such as one or more of: increase in hemoglobin concentration, hematocrit levels, red blood cell count, and reticulocyte count.

[0448] In preferred embodiments blood cellularity is normalized in the subject, compared to healthy subjects, following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition.

[0449] In other preferred embodiments, bone marrow cellularity is normalized in the subject, compared to healthy subjects, following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition..

[0450] In yet other preferred embodiments, erythrocyte numbers, hemoglobin levels and / or reticulocyte counts are normalized in the subject, compared to healthy subjects, following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition..

[0451] In preferred embodiments, unsupported platelet count is greater than 100,000 cells / mm3and an absolute neutrophil count [ANC] is greater than 1000 cells / mm3in the subject, following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition. In further embodiments, at least 5% expression of the therapeutic transgene in circulating peripheral Burst-forming unit-erythroids (BFLI-E) and / or reticulocytes is further measured following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition to the subject, such as 2 months after administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition to the subject,

[0452] In further preferred embodiments, increased production of erythroblasts (CD71+CD235+) and mature red blood cells (CD71-CD235+) is observed in the subjects following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition.. P7403PC00

[0453] In other embodiments, blood transfusion dependence is alleviated in the subject following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition. In preferred embodiments, blood transfusion dependence is alleviated in the subject 6 to 18 months following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition.

[0454] In some embodiments, lethal bone marrow failure is prevented following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition..

[0455] In other embodiments, lethality is reduced or delayed in subjects following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition..

[0456] Kit of parts

[0457] A further aspect of the present disclosure relates to a kit-of-parts comprising: a. the construct, the vector, the host cell, the lentiviral vector, the cell, the composition, and / or the pharmaceutical composition described herein; and b. instructions for use.

[0458] Methods of assessing treatment response

[0459] In another aspect, the present disclosure provides a method of assessing a response in a subject suffering from DBA receiving or having received RPS19, RPS17, RPS24, RPS10, RPL35a, RPL11 , RPS26, or RPL5-based gene therapy, preferably RPS19, RPL11 or RPL5-based gene therapy, even more preferably RPS19-based gene therapy said method comprising the steps of: a. Determining the values of one or more markers selected from the group consisting of P53, CD70, BAX, RPS27L, RPL22L1 and ADA, in said subject after administration of the RPS19, RPS17, P7403PC00

[0460] RPS24, RPS10, RPL35a, RPL11, RPS26, or RPL5-based gene therapy; and b. Comparing said values with reference values of the one or more markers; and c. Assessing said response in said subject based on a comparison made in said comparing step, wherein a downregulation of the levels of CD70, BAX, RPS27L, or ADA, and / or an upregulation of the levels of RPL22L1 compared to the reference values is indicative of a response.

[0461] In an alternative aspect, the present disclosure relates to a method of assessing a response in a subject suffering from DBA receiving or having received RPS19, RPS17, RPS24, RPS10, RPL35a, RPL11, RPS26, or RPL5-based gene therapy, wherein the RPS19, RPS17, RPS24, RPS10, RPL35a, RPL11, RPS26, or RPL5- based gene therapy comprises the construct, the vector, the host cell, the lentiviral vector, the cell, the composition, the pharmaceutical composition, the method or the use according to any one above aspects, said method comprising the steps of: a. Determining the values of one or more markers selected from the group consisting of: P53, CD70, BAX, RPS27L.RPL22L1 , and ADA in said subject after administration of the RPS19, RPS17, RPS24, RPS10, RPL35a, RPL11, RPS26, or RPL5-based gene therapy; and b. Comparing said values with reference values of the one or more markers; and c. Assessing said response in said subject based on a comparison made in said comparing step, wherein a downregulation of the levels of CD70, BAX, RPS27L, or ADA, and / or an upregulation of the levels of RPL22L1 compared to the reference values is indicative of a response.

[0462] In some embodiments wherein the method is of assessing a response in a subject suffering from DBA receiving or having received RPL11 or RPL5-based gene therapy, said method comprises the steps of: a. Determining the values of one or more markers selected from the group consisting of: BAX, P7403PC00

[0463] RPS27L, and RPL22L1 , in said subject after administration of the RPL11 , or RPL5-based gene therapy; and b. Comparing said values with reference values of the one or more markers; and c. Assessing said response in said subject based on a comparison made in said comparing step, wherein a downregulation of the levels of BAX, and / or RPS27L, and / or an upregulation of the levels of RPL22L1 compared to the reference values is indicative of a response.

[0464] In preferred embodiments, the RPS19, RPS17, RPS24, RPS10, RPL35a, RPL11 , RPS26, or RPL5-based gene therapy comprises the construct, the vector, the host cell, the lentiviral vector, the cell, the composition, the pharmaceutical composition, the method or the use described herein.

[0465] Non-genotoxic protocol

[0466] The person skilled in the art will appreciate that, when performing autologous gene therapy involving cell replacement therapy using genetically corrected cells, space needs to be created in the body, e.g. in the bone marrow in the case of e.g. genetically corrected hematopoetic stem and progenitor cells, such as corrected CD34+ cells as disclosed herein, to enable engraftment of said cells. In the field, this is usually achieved by reducing the patients defective cells, i.e. the cells carrying a pathological mutation, by genotoxic conditioning, e.g. chemotherapy or radiation.

[0467] The inventors of the present invention have realized that, when using the herein disclosed constructs and vectors for treating DBA, genotoxic conditioning is not necessary. Instead, advantage is made of mobilizing hematopoietic stem and progenitor cells (HSPCs) and apheresis, herein described as non-genotoxic conditioning. This procedure is used to obtain the cells to be genetically corrected using the constructs and vectors disclosed herein, and to create the gene therapy product. At the same time, the herein disclosed protocol for mobilization (Example 14) is regarded sufficient to enable successful engraftment of the cells (i.e. the gene P7403PC00 therapy product). As such, genotoxic conditioning can be avoided, most importantly avoiding severe side effects of genotoxic conditioning and the burden on the patients.

[0468] Mobilization of bone marrow cells to the bloodstream stimulates stem cells to move from the bone marrow into the peripheral blood, where they can be collected via apheresis for procedures like stem cell transplantation. This process disrupts the molecular interactions that anchor stem cells in their native bone marrow niche, allowing them to enter circulation in sufficient numbers for collection. Apheresis is a medical procedure that removes specific components from a patient's blood using a special machine, with the rest of the blood returned to the body. As disclosed herein, population comprising CD34+ cell or CD34+ cells are obtained via apheresis using the protocol as disclosed herein.

[0469] A further aspect of the present invention relates to a method for autologous gene therapy in a subject suffering from or suspected suffering from Diamond-Blackfan Anemia (DBA), the method comprising the steps of:

[0470] (a) mobilizing hematopoietic stem and progenitor cells (HSPCs) from the bone marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor;

[0471] (b) performing apheresis for collecting CD34+HSPCs;

[0472] (c) manufacturing a gene therapy product by genetic modification of the collected CD34+HSPCs ex vivo to express a functional transgene of RPS 19, RPS17, RPS24, RPS10, RPL35A, RPL11, RPS26 or RPL5, wherein the genetic modification is performed by transducing the CD34+ HSPCs with the vector according the above aspects, thereby obtaining the gene therapy product;

[0473] (d) conditioning the subject by one of the following options i. performing non-genotoxic conditioning by performing a further mobilization of HSPCs from the bone marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor, and collecting CD34+HSPCs via apheresis; or ii. performing genotoxic conditioning by administering a genotoxic conditioning regimen comprising busulfan to the subject;

[0474] (e) administering the gene therapy product comprising genetically modified CD34+HSPCs to the subject via infusion. P7403PC00

[0475] A further aspect of the present invention relates to a method for autologous gene therapy in a subject suffering from or suspected suffering from Diamond-Blackfan Anemia (DBA), the method comprising the steps of:

[0476] (a) mobilizing hematopoietic stem and progenitor cells (HSPCs) from the bone marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor;

[0477] (b) performing apheresis for collecting CD34+HSPCs;

[0478] (c) manufacturing a gene therapy product by genetic modification of the collected CD34+HSPCs ex vivo to express a functional transgene of RPS 19, RPS17, RPS24, RPS10, RPL35A, RPL11 , RPS26 or RPL5, wherein the genetic modification is performed by transducing the CD34+ HSPCs with the vector according the above aspects, thereby obtaining the gene therapy product;

[0479] (d) conditioning the subject by one of the following options i. performing non-genotoxic conditioning by performing a further mobilization of HSPCs from the bone marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor, and collecting CD34+HSPCs via apheresis; or ii. performing genotoxic conditioning by administering a genotoxic conditioning regimen comprising busulfan to the subject;

[0480] (e) administering the gene therapy product comprising genetically modified CD34+HSPCs to the subject via infusion thereby treating the subject suffering from or suspected suffering from Diamond- Blackfan Anemia (DBA).

[0481] In some embodiments, the conditioning creates bone marrow space for engraftment of the gene therapy product.

[0482] In some embodiments, a step of cell selection and / or cell purification is performed after step (b) and / or step (d) i., such as magnetic-activated cell sorting (MACS).

[0483] In some embodiments, a further step of manufacturing a gene therapy product, i.e. a further manufacturing batch of the gene therapy product, is performed after the apheresis of CD34+ HSPCs in step (d) i., wherein the gene therapy product is manufactured by genetic modification of the collected CD34+HSPCs ex vivo to express a functional transgene of RPS 19, RPS17, RPS24, RPS10, RPL35A, RPL11 , RPS26 or P7403PC00

[0484] RPL5, wherein the genetic modification is performed by transducing the CD34+ HSPCs with the vector according the above aspects and embodiments, thereby obtaining the gene therapy product.

[0485] In some embodiments, option i. in step (d) in above aspect enables engraftment of the gene therapy product and therapeutic efficacy in the absence of genotoxic conditioning agents.

[0486] In some embodiments, the granulocyte colony-stimulating factor is administered at a daily dose of 5 pg / kg subcutaneously.

[0487] In some embodiments, plerixafor is administered at a daily dose of 0.24 mg / kg.

[0488] In some embodiments, the granulocyte colony-stimulating factor is administered for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days, preferably for 8 days.

[0489] In some embodiments, plerixafor is administered for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days, preferably for 4 days.

[0490] In some embodiments, the gene therapy product is administered no later than 48 hours after apheresis in step d) option i., such as wherein the gene therapy product is administered 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 25 hours, 26 hours, 27 hours, 28 hours, 29 hours, 30 hours, 31 hours, 32 hours, 33 hours, 34 hours, 35 hours, 36 hours, 37 hours, 38 hours, 39 hours, 40 hours, 41 hours, 42 hours, 43 hours, 44 hours, 45 hours, 46 hours, 47 hours, 48 hours after apheresis.

[0491] A further aspect of the present invention relates to method for autologous gene therapy in a subject suffering from or suspected suffering from an inherited bone marrow failure syndrome (IBMFS), the method comprising the steps of:

[0492] (a) mobilizing hematopoietic stem and progenitor cells (HSPCs) from the bone marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor; P7403PC00

[0493] (b) performing apheresis for collecting a cell population;

[0494] (c) manufacturing a gene therapy product by genetic modification of the collected cell population ex vivo to express a functional transgene, thereby obtaining the gene therapy product;

[0495] (d) conditioning the subject by one of the following options i. performing non-genotoxic conditioning by performing a further mobilization of HSPCs from the bone marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor, and collecting a further cell population via apheresis; or ii. performing genotoxic conditioning by administering a genotoxic conditioning regimen comprising busulfan to the subject;

[0496] (e) administering the gene therapy product comprising the genetically modified cell population to the subject via infusion.

[0497] The person skilled in the art will appreciate that the herein disclosed non-genotoxic conditioning protocol, with its clear advantage of avoiding genotoxic conditioning (as described above, e.g. reduction of severe side effects), is not limited to DBA but has a broader application across inherited bone marrow failure syndromes (IBMFS), where the unmet need for safer conditioning regimens is particularly acute. This applies, for example, to IBMFSW such as Fanconi Anemia, Shwachman-Diamond Syndrome, and Congenital Amegakaryocytic Thrombocytopenia which have key pathophysiological features such as defective hematopoiesis, stem cell depletion, and high sensitivity to genotoxic agents.

[0498] In some embodiments, the cell population and / or the further cell population and / or the genetically modified cell population comprises or consists of CD34+HSPCs.

[0499] In some embodiments, the IBMFS is Fanconi Anemia, Shwachman-Diamond Syndrome or Congenital Amegakaryocytic Thrombocytopenia.

[0500] In some embodiments, the conditioning creates bone marrow space for engraftment of the gene therapy product.

[0501] In some embodiments, the step of cell selection and / or cell purification is performed after step (b) and / or step (d) i., such as magnetic-activated cell sorting (MACS). P7403PC00

[0502] In some embodiments, option i. in step (d) enables engraftment of the gene therapy product and therapeutic efficacy in the absence of genotoxic conditioning agents.

[0503] In some embodiments, the granulocyte colony-stimulating factor is administered at a daily dose of 5 pg / kg subcutaneously.

[0504] In some embodiments, the plerixafore is administered at a daily dose of 0.24 mg / kg.

[0505] In some embodiments, the the granulocyte colony-stimulating factor is administered for 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 days, preferably for 8 days.

[0506] In some embodiments, the plerixafor is administered for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days, preferably for 4 days.

[0507] In some embodiments, the the gene therapy product is administered no later than 48 hours after apheresis in step d) option i., such as wherein the gene therapy product is administered 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 25 hours, 26 hours, 27 hours, 28 hours, 29 hours, 30 hours, 31 hours, 32 hours, 33 hours, 34 hours, 35 hours, 36 hours, 37 hours, 38 hours, 39 hours, 40 hours, 41 hours, 42 hours, 43 hours, 44 hours, 45 hours, 46 hours, 47 hours, 48 hours after apheresis.

[0508] Items

[0509] 1. A construct which, upon expression, encodes a polypeptide selected from the group consisting of: RPS19 (SEQ ID NO. 1), RPS17 (SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, or SEQ ID NO. 5), RPS24 (SEQ ID NO. 6, SEQ ID NO.

[0510] 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10), RPS10 (SEQ ID NO. 11), RPL35a (SEQ ID NO. 12), RPL11 (SEQ ID NO. 13, SEQ ID NO. 14), RPS26 (SEQ ID NO. 15), and RPL5 (SEQ ID NO. 16, SEQ ID NO. 44), or a sequence having at least 70% identity to said SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. P7403PC00

[0511] 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 16, or SEQ ID NO. 44.

[0512] 2. A construct which, upon expression, encodes a polypeptide selected from the group consisting of: RPS19 (SEQ ID NO. 1), RPS17 (SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, or SEQ ID NO. 5), RPS24 (SEQ ID NO. 6, SEQ ID NO.

[0513] 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10), RPS10 (SEQ ID NO. 11), RPL35a (SEQ ID NO. 12), RPL11 (SEQ ID NO. 13, SEQ ID NO. 14), RPS26 (SEQ ID NO. 15), and RPL5 (SEQ ID NO. 16, SEQ ID NO. 44), or biologically active variants thereof having at least 70% identity, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to said SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO.

[0514] 15, or SEQ ID NO. 16, or SEQ ID NO. 44.

[0515] 3. The construct according to any one of items 1 and 2, wherein the polypeptide sequence has at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO.

[0516] 16, or SEQ ID NO. 44.

[0517] 4. The construct according to any one of the preceding items, wherein said construct comprises the RPS19 polynucleotide sequence of SEQ ID. NO 17 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 17.

[0518] 5. The construct according to any one of the preceding items, wherein the RPS19 polynucleotide sequence has at least 91%, such as at least 92%, such as at P7403PC00 least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 17.

[0519] 6. The construct according to any one of the preceding items, wherein said construct comprises the codon-optimized RPS19 (coRPS19) polynucleotide sequence of SEQ ID. NO 18 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 18.

[0520] 7. The construct according to any one of the preceding items, wherein the codon- optimized rps19 (coRPS19) polynucleotide sequence has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 18.

[0521] 8. The construct according to any one of the preceding items, wherein said construct comprises the codon-optimized RPS19 (coRPS19) polynucleotide sequence of SEQ ID. NO 19 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 19.

[0522] 9. The construct according to any one of the preceding items, wherein the codon- optimized RPS19 (coRPS19) polynucleotide sequence has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 19.

[0523] 10. The construct according to any one of the preceding items, wherein said construct comprises the RPS17 polynucleotide sequence of SEQ ID. NO 20 encoding RPS17, or a sequence having at least 90% identity to SEQ ID. NO 20.

[0524] 11. The construct according to any one of the preceding items, wherein the RPS17 polynucleotide sequence has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 20. P7403PC00

[0525] 12. The construct according to any one of the preceding items, wherein said construct comprises a codon-optimized RPS17 (coRPS17) polynucleotide sequence.

[0526] 13. The construct according to any one of the preceding items, wherein said construct comprises a codon-optimized RPS17 (coRPS17) polynucleotide sequence of SEQ ID. NO 37, or a sequence having at least 90% identity to SEQ ID. NO 37, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 37.

[0527] 14. The construct according to any one of the preceding items, wherein said construct comprises the RPS24 polynucleotide sequence of SEQ ID. NO 21 encoding RPS24, or a sequence having at least 90% identity to SEQ ID. NO 21.

[0528] 15. The construct according to any one of the preceding items, wherein the RPS24 polynucleotide sequence has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 21.

[0529] 16. The construct according to any one of the preceding items, wherein said construct comprises a codon-optimized RPS24 (coRPS24) polynucleotide sequence.

[0530] 17. The construct according to any one of the preceding items, wherein said construct comprises a coRPS24 polynucleotide sequence of SEQ ID. NO 38, or a sequence having at least 90% identity to SEQ ID. NO 38, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 38. P7403PC00

[0531] 18. The construct according to any one of the preceding items, wherein said construct comprises the RPS10 polynucleotide sequence of SEQ ID. NO 22 encoding RPS10, or a sequence having at least 90% identity to SEQ ID. NO 22.

[0532] 19. The construct according to any one of the preceding items, wherein the RPS10 polynucleotide sequence has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 22.

[0533] 20. The construct according to any one of the preceding items, wherein said construct comprises a codon-optimized RPS10 coRPSIO) polynucleotide sequence.

[0534] 21. The construct according to any one of the preceding items, wherein said construct comprises a coRPSIO polynucleotide sequence of SEQ ID. NO 39, or a sequence having at least 90% identity to SEQ ID. NO 39, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 39.

[0535] 22. The construct according to any one of the preceding items, wherein said construct comprises the RPL35a polynucleotide sequence of SEQ ID. NO 23 encoding RPL35a, or a sequence having at least 90% identity to SEQ ID. NO

[0536] 23.

[0537] 23. The construct according to any one of the preceding items, wherein the RPL35a polynucleotide sequence has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 23.

[0538] 24. The construct according to any one of the preceding items, wherein said construct comprises a codon-optimized RPL35a (coRPL35a) polynucleotide sequence. P7403PC00

[0539] 25. The construct according to any one of the preceding items, wherein said construct comprises a coRPL35a polynucleotide sequence of SEQ ID. NO 40, or a sequence having at least 90% identity to SEQ ID. NO 40, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 40.

[0540] 26. The construct according to any one of the preceding items, wherein said construct comprises the RPL11 polynucleotide sequence of SEQ ID. NO 24 encoding RPL11, or a sequence having at least 90% identity to SEQ ID. NO 24.

[0541] 27. The construct according to any one of the preceding items, wherein the RPL11 polynucleotide sequence has at least 90% identity to is at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 24.

[0542] 28. The construct according to any one of the preceding items, wherein said construct comprises a codon-optimized RPL11 (coRPL11) polynucleotide sequence.

[0543] 29. The construct according to any one of the preceding items, wherein said construct comprises a coRPL11 polynucleotide sequence of SEQ ID. NO 41 , or a sequence having at least 90% identity to SEQ ID. NO 41 , such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 41.

[0544] 30. The construct according to any one of the preceding items, wherein said construct comprises the RPS26 polynucleotide sequence of SEQ ID. NO 25 encoding RPS26, or a sequence having at least 90% identity to SEQ ID. NO 25.

[0545] 31. The construct according to any one of the preceding items, wherein the RPS26 polynucleotide sequence has at least 91%, such as at least 92%, such as at P7403PC00 least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 25.

[0546] 32. The construct according to any one of the preceding items, wherein said construct comprises a codon-optimized RPS26 (coRPS26) polynucleotide sequence.

[0547] 33. The construct according to any one of the preceding items, wherein said construct comprises a coRPS26 polynucleotide sequence of SEQ ID. NO 42, or a sequence having at least 90% identity to SEQ ID. NO 42, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 42.

[0548] 34. The construct according to any one of the preceding items, wherein said construct comprises the RPL5 polynucleotide sequence of SEQ ID. NO 26 encoding RPL5, or a sequence having at least 90% identity to SEQ ID. NO 26.

[0549] 35. The construct according to any one of the preceding items, wherein the RPL5 polynucleotide sequence at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 26.

[0550] 36. The construct according to any one of the preceding items, wherein said construct comprises a codon-optimized RPL5 (coRPL5) polynucleotide sequence.

[0551] 37. The construct according to any one of the preceding items, wherein said construct comprises a coRPL5 polynucleotide sequence of SEQ ID. NO 43, or a sequence having at least 90% identity to SEQ ID. NO 43, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 43. P7403PC00

[0552] 38. The construct according to any one of the preceding items, further comprising the Kozak sequence of sequence SEQ. ID. NO.: 47 or a sequence having at least 90% identity to SEQ ID. NO 47.

[0553] 39. The construct according to any one of the preceding items, wherein the Kozak sequence has at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO.: 47.

[0554] 40. The construct according to any one of the preceding items, further comprising a promoter region capable of controlling the transcription of the polynucleotide encoding the polypeptide selected from the group consisting of: RPS19 (SEQ ID NO. 1), RPS17 (SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, or SEQ ID NO. 5), RPS24 (SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10), RPS10 (SEQ ID NO. 11), RPL35a (SEQ ID NO. 12), RPL11 (SEQ ID NO. 13, SEQ ID NO. 14), RPS26 (SEQ ID NO. 15), and RPL5 (SEQ ID NO. 16), wherein the promoter region comprises or consists of an EF-1 alpha short (EF1as) promoter, a spleen focus-forming virus (SFFV) promoter, an EF-1 alpha (EF-1a) promoter, an EF-1 alpha with intron (EF1i) promoter, a phosphoglycerate kinase (PGK) promoter, a cytomegalovirus (CMV) promoter, a MND (myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer-binding site substituted) promoter, a ubiquitin C (UbC) promoter, or a CAG (CMV early enhancer / chicken actin) promoter.

[0555] 41. The construct according to any one of the preceding items, wherein the promoter region comprises or consists of an EF-1 alpha short (EF1as) promoter, a spleen focus-forming virus (SFFV) promoter, or a promoter exhibiting essentially the same effect.

[0556] 42. The construct according to any one of the preceding items, wherein: a. the EF1as promoter comprises or consists of the polynucleotide of SEQ ID NO. 27, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at P7403PC00 least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 27. b. the SFFV promoter comprises or consists of the polynucleotide of SEQ ID NO. 28, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 28.

[0557] 43. The construct according to any one of the preceding items, further comprising a post-transcriptional regulatory element (PRE),

[0558] 44. The construct according to any one of the preceding items, wherein the PRE is a safety optimized PRE comprising or consisting of the polynucleotide of SEQ ID NO. 29, or a sequence having at least 90% identity to SEQ ID. NO 29.

[0559] 45. The construct according to any one of the preceding items, wherein the PRE is a safety optimized PRE comprising or consisting of the polynucleotide of or a sequence having at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 29.

[0560] 46. A vector comprising the construct according to any one of the preceding items.

[0561] 47. The vector according to item 46, wherein the vector is a lentiviral vector.

[0562] 48. The vector according to any one of the preceding items, wherein said vector’s backbone is a pCCL backbone, a pCLL backbone, a pRRL backbone, a pRLL backbone, a pLL backbone, a pLenti backbone, a pLKO backbone, a pLPC backbone, a pHR backbone, or a pTRIP backbone.

[0563] 49. The vector according to any one of the preceding items, wherein the vector comprises a 5’ long terminal repeat (5’ LTR), wherein the 5' LTR comprises a cytomegalovirus (CMV) enhancer / promoter. P7403PC00

[0564] 50. The vector according to any one of the preceding items, wherein the 5' LTR sequence comprises or consist of the polynucleotide of SEQ ID NO. 30, or a sequence having at least 90% identity to SEQ ID. NO 30, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 30.

[0565] 51. The vector according to any one of the preceding items, wherein said vector comprises a psi vector genome packaging signal.

[0566] 52. The vector according to any one of the preceding items, wherein the psi vector genome packaging signal sequence comprises or consists of the polynucleotide of SEQ ID NO. 31 , or a sequence having at least 90% identity to SEQ ID. NO 31, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 31.

[0567] 53. The vector according to any one of the preceding items, wherein said vecor comprises a primer binding site (PBS), preferably wherein said PBS comprises or consists of the polynucleotide of SEQ ID NO.: 45, or a sequence having at least 90% identity to SEQ ID. NO 45, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 45.

[0568] 54. The vector according to any one of the preceding items, wherein said vector comprises a truncated form of the Gag gene of the HIV-1 genome (dGAG).

[0569] 55. The vector according to any one of the preceding items, wherein the dGAG sequence comprises or consist of the polynucleotide of SEQ ID NO. 32, or SEQ ID NO.: 50, or a sequence having at least 90% identity to SEQ ID. NO 32 or SEQ ID NO.: 50, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as P7403PC00 at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 32, or SEQ ID NO.: 50.

[0570] 56. The vector according to any one of the preceding items, wherein said vector comprises a Rev Responsive Element (RRE).

[0571] 57. The vector according to any one of the preceding items, wherein the RRE sequence comprises or consist of the polynucleotide of SEQ ID NO. 33, or a sequence having at least 90% identity to SEQ ID. NO 33, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 33.

[0572] 58. The vector according to any one of the preceding items, wherein said vector comprises a central polypurine tract (cPPT).

[0573] 59. The vector according to any one of the preceding items, wherein the cPPT sequence comprises or consist of the polynucleotide of SEQ ID NO. 34, or a sequence having at least 90% identity to SEQ ID. NO 34, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 34.

[0574] 60. The vector according to any one of the preceding items, wherein the vector comprises the HIV major splice donor.

[0575] 61. The vector according to any one of the preceding items, wherein the HIV major splice donor sequence comprises or consists of the polynucleotide of SEQ ID NO.: 46, or a sequence having at least 90% identity to SEQ ID. NO 46, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO.: 46.

[0576] 62. The vector according to any one of the preceding items, wherein said vector comprises a Simian Virus 40 polyadenylation (SV40 polyA) region, a Bovine P7403PC00

[0577] Growth Hormone Polyadenylation Signal (BGH polyA) region, a Rabbit BetaGlobin Polyadenylation Signal (rBG polyA), a Human Beta-Globin Polyadenylation Signal (hBG polyA), a Human Growth Hormone Polyadenylation Signal (hGH polyA), a Mouse Beta-Globin Polyadenylation Signal (mBG polyA), or a Synthetic Polyadenylation Signal.

[0578] 63. The vector according to any one of the preceding items, wherein the SV40 polyA sequence comprises or consists of the polynucleotide of SEQ ID NO. 35, or a sequence having at least 90% identity to SEQ ID. NO 35, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 35.

[0579] 64. The vector according to any one of the preceding items, wherein said vector is a self-inactivating (SIN) lentiviral vector, such as a 3’ U3-deleted lentiviral vector.

[0580] 65. The vector according to any one of the preceding items, wherein said vector comprises a Kanamycin resistance gene (Kan).

[0581] 66. The vector according to any one of the preceding items, wherein said vector comprises or consists of the polynucleotide of SEQ ID NO. 36, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 36.

[0582] 67. The vector according to any one of the preceding items, wherein said vector comprises or consists of the polynucleotide of SEQ ID NO. 51 , or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 51. P7403PC00

[0583] 68. The vector according to any one of the preceding items, wherein said vector comprises or consists of the polynucleotide of SEQ ID NO. 52, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 52.

[0584] 69. The vector according to any one of the preceding items, wherein said vector comprises or consists of the polynucleotide of SEQ ID NO. 53, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 53.

[0585] 70. The vector according to any one of the preceding items, wherein said vector comprises or consists of the polynucleotide of SEQ ID NO. 54, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 54.

[0586] 71. The vector according to any one of the preceding items, wherein said vector comprises or consists of the polynucleotide of SEQ ID NO. 55, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 55.

[0587] 72. The vector according to any one of the preceding items, wherein said vector comprises or consists of the polynucleotide of SEQ ID NO. 56, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 56. P7403PC00

[0588] 73. The vector according to any one of the preceding items, wherein said vector comprises or consists of the polynucleotide of SEQ ID NO. 57, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 57.

[0589] 74. A method of manufacturing a transfer vector, said method comprising the steps of: a. providing the construct according to any one of the preceding items; and b. inserting the construct into a transfer vector backbone.

[0590] 75. The method according to item 74, wherein the transfer vector is the vector described in any one of items 46 to 73.

[0591] 76. A host cell comprising the construct or vector according to any one of the preceding items.

[0592] 77. The host cell according to item 76, wherein said host cell is a packaging cell line.

[0593] 78. The host cell according to any one of the preceding items, wherein said host cell is a HEK293 cell, or derivative thereof, such as a HEK293T cell.

[0594] 79. The host cell according to any one of the preceding items, further comprising one or more helper plasmids, such as two, such as three helper plasmids.

[0595] 80. The host cell according to any one of the preceding items, wherein said helper plasmids are one or more packaging plasmids, and / or an envelope plasmid.

[0596] 81. The host cell according to any one of the the preceding items, wherein said helper plasmids are a gag / pol-encoding plasmid, a rev-encoding plasmid and a VSV-G-encoding plasmid. P7403PC00

[0597] 82. A lentivi ral vector comprising the construct according to any one of the preceding items.

[0598] 83. A method of manufacturing a lentiviral vector, said method comprising a step of transfecting a host cell with the vector of any one of items 46 to 73.

[0599] 84. The lentiviral vector of item 82, or the method according to item 83, wherein the lentiviral vector is a lentiviral particle.

[0600] 85. The method according to any one of items 83 and 84, wherein the step of transfecting a host cells with the vector further comprises a step of transfecting said host cell with one or more helper plasmids, such as two, such as three, such as four helper plasmids, preferably wherein said helper plasmids are one or more packaging plasmids, and / or an envelope plasmid, even more preferably wherein said helper plasmids are a gag / pol-encoding plasmid, a rev-encoding plasmid and a VSV-G-encoding plasmid.

[0601] 86. A method of manufacturing a cell expressing a ribosomal protein gene, said method comprising the steps of: a. Providing a cell; and b. Transducing said cell with the lentiviral vector of any one of items 82 to 84, thereby obtaining a cell expressing a ribosomal protein gene.

[0602] 87. A method of manufacturing a cell expressing a ribosomal protein encoded by a ribosomal protein gene, said method comprising the steps of: a. Providing a cell; and b. Transducing said cell with the lentiviral vector of any one of items 82 to 84, thereby obtaining a cell expressing the ribosomal protein encoded by the ribosomal protein gene.

[0603] 88. The method according to any one of the preceding items, wherein the ribosomal protein is encoded by a polypeptide selected from the group consisting of: RPS19 (SEQ ID NO. 1), RPS17 (SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, P7403PC00 or SEQ ID NO. 5), RPS24 (SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10), RPS10 (SEQ ID NO. 11), RPL35a (SEQ ID NO. 12), RPL11 (SEQ ID NO. 13, SEQ ID NO. 14), RPS26 (SEQ ID NO. 15), and RPL5 (SEQ ID NO. 16), or a biologically active variant having at least 70% identity to said SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO.

[0604] 10, SEQ ID NO. 11 , SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, or SEQ ID NO. 16.

[0605] 89. The method according to any one of the preceding items, wherein the ribosomal protein is encoded by a polypeptide having at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO.

[0606] 4, SEQ ID NO. 5, SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11 , SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, or SEQ ID NO. 16.

[0607] 90. The method according to any one of the preceding items, wherein the ribosomal protein gene is encoded by:

[0608] - the RPS19 polynucleotide sequence of SEQ ID. NO 17 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 17, such as has at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 17.

[0609] - the codon-optimized RPS19 (coRPS19) polynucleotide sequence of SEQ ID. NO 18 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 18, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 18; P7403PC00

[0610] - the codon-optimized RPS19 (coRPS19) polynucleotide sequence of SEQ ID. NO 19 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 19, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 19;

[0611] - the RPS17 polynucleotide sequence of SEQ ID. NO 20 encoding RPS17, or a sequence having at least 90% identity to SEQ ID. NO 20, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 20;

[0612] - a codon-optimized RPS17 (coRPS17) polynucleotide sequence, preferably wherein said coRPS17 polynucleotide sequence is of SEQ ID. NO 37, or a sequence having at least 90% identity to SEQ ID. NO 37, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 37;

[0613] - the RPS24 polynucleotide sequence of SEQ ID. NO 21 encoding RPS24, or a sequence having at least 90% identity to SEQ ID. NO 21, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 21 ;

[0614] - a codon-optimized RPS24 (coRPS24) polynucleotide sequence, preferably wherein said coRPS24 polynucleotide sequence is of SEQ ID. NO 38, or a sequence having at least 90% identity to SEQ ID. NO 38, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at P7403PC00 least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 38.;

[0615] - the RPS10 polynucleotide sequence of SEQ ID. NO 22 encoding RPS10, or a sequence having at least 90% identity to SEQ ID. NO 22, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 22;

[0616] - a codon-optimized RPS10 (coRPSIO) polynucleotide sequence, preferably wherein said coRPSIO polynucleotide sequence is of SEQ ID. NO 39, or a sequence having at least 90% identity to SEQ ID. NO 39, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 39. ;

[0617] - the RPL35a polynucleotide sequence of SEQ ID. NO 23 encoding RPL35a, or a sequence having at least 90% identity to SEQ ID. NO 23, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 23;

[0618] - a codon-optimized RPL35a (coRPL35a) polynucleotide sequence, preferably wherein said coRPL35a polynucleotide sequence is of SEQ ID. NO 40, or a sequence having at least 90% identity to SEQ ID. NO 40, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 40.;

[0619] - the RPL11 polynucleotide sequence of SEQ ID. NO 24 encoding

[0620] RPL11, or a sequence having at least 90% identity to SEQ ID. NO 24, P7403PC00 such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 24;

[0621] - a codon-optimized RPL11 (coRPL11) polynucleotide sequence, preferably wherein said coRPLI 1 polynucleotide sequence is of SEQ ID. NO 41 , or a sequence having at least 90% identity to SEQ ID. NO 41 , such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 41 ;

[0622] - the RPS26 polynucleotide sequence of SEQ ID. NO 25 encoding RPS26, or a sequence having at least 90% identity to SEQ ID. NO 25, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 25;

[0623] - a codon-optimized RPS26 (coRPS26) polynucleotide sequence, preferably wherein said coRPS26 polynucleotide sequence is of SEQ ID. NO: 42, or a sequence having at least 90% identity to SEQ ID. NO 42, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 42.;

[0624] - the RPL5 polynucleotide sequence of SEQ ID. NO 26 encoding RPL5, or a sequence having at least 90% identity to SEQ ID. NO 26, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 26; or, P7403PC00

[0625] - a codon-optimized RPL5 (coRPL5) polynucleotide sequence, preferably wherein said coRPL5 polynucleotide sequence is of SEQ ID. NO 43, or a sequence having at least 90% identity to SEQ ID. NO 43, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 43.

[0626] 91. The method according to any one of the preceding items, wherein the cell of step a. is a human cell.

[0627] 92. The method according to any one of the preceding items, wherein the cell of step a. is a hematopoietic cell.

[0628] 93. The method according to any one of the preceding items, wherein the cell of step a. is a hematopoietic progenitor cell.

[0629] 94. The method according to any one of the preceding items, wherein the hematopoietic progenitor cell is a stem cell.

[0630] 95. The method according to any one of the preceding items, wherein the hematopoietic stem cell is a peripheral blood stem cell.

[0631] 96. The method according to any one of the preceding items, wherein the hematopoietic stem cell is an umbilical cord blood stem cell.

[0632] 97. The method according to any one of the preceding items, wherein the hematopoietic stem cell is a bone marrow stem cell.

[0633] 98. The method according to any one of the preceding items, wherein the hematopoietic progenitor cell is a lymphoid progenitor cell.

[0634] 99. The method according to any one of the preceding items, wherein the hematopoietic progenitor cell is a erythroid progenitor cell. P7403PC00

[0635] 100. The method according to any one of the preceding items, wherein the hematopoietic progenitor cell is a Burst-forming unit-erythroid (BFLI-E) progenitors or Colony-forming unit-erythroid (CFLI-E) progenitor.

[0636] 101. The method according to any one of the preceding items, wherein the cell of step a. is a CD34+ cell.

[0637] 102. The method according to any one of the preceding items, wherein the CD34+ cell is a CD34+ stem cell.

[0638] 103. The method according to any one of the preceding items, wherein the CD34+ cell is a CD34+ hematopoietic progenitor cell.

[0639] 104. The method according to any one of the preceding items, wherein said cell overexpresses genes associated to terminal erythropoiesis and / or wherein the cell downregulates expression of genes associated with apoptosis and p53 activation following the step b. of transduction of said cell with the lentiviral vector.

[0640] 105. The method according to any one of the preceding items, wherein said genes associated to terminal erythropoiesis are HEMGN, HBB, AHSP, EPB42 and / or GYPA and wherein said genes associated with apoptosis and p53 activation are BAX, MDM2, ZMAT3 and / or MIR34AHG.

[0641] 106. The method according to any one of the preceding items, wherein said cell overexpresses the large non-coding RNA LINC01133 and / or downregulates the expression of XACT following the step b. of transduction of said cell with the lentiviral vector.

[0642] 107. The method according to any one of the preceding items, wherein said host cell or cell overexpresses RPL22L1 and / or CD70 following the step b. of transduction of said cell with the lentiviral vector. P7403PC00

[0643] 108. The method according to any one of the preceding items, further comprising a step of contacting the cell with one or more cytokines, thereby obtaining an activated cell.

[0644] 109. The method according to any one of the preceding items, wherein the step of contacting the cell with one or more cytokines is performed prior to, simultaneously and / or after the step b. of transducing said cell with the lentiviral vector, preferably prior to the step b. of transducing said cell with the lentiviral vector.

[0645] 110. The method according to any one of the preceding items, wherein the step b. of transduction is performed at a multiplicity of infection (MOI) number of viral particles I number of cells of 5, such as 10, such as 15, such as 20, such as 25, such as 30, such as 35, such as 50, such as 60, such as 65, such as 70, such as 70, such as 80, such as 90, such as 100, such as 120, such as 150, such as 200.

[0646] 111. The method according to any one of the preceding items, wherein the one or more cytokines comprise or consist of Stem cell factor (SCF), Fms-related tyrosine kinase 3 ligand (FLT-3L) and thrombopoietin.

[0647] 112. The method according to any one of the preceding items, further comprising a step of pre-stimulating the cell using a platelet wash, and CD34+ cell selection, such as using the Miltenyi CliniMACS® system.

[0648] 113. The method according to any one of the preceding items, wherein the Stem cell factor (SCF), Fms-related tyrosine kinase 3 ligand (FLT-3L) and / or thrombopoietin (TPO) are used at 50 to 500ng / mL, 50 to 500ng / mL, and 10 to 200 ng / mL, respectively, preferably at 100 to 300ng / mL, 100 to 300ng / mL, and 10 to 150ng / mL, respectively, even more preferably at 100ng / mL, 100ng / mL and 50ng / mL, respectively.

[0649] 114. The method according to any one of the preceding items, wherein the cell, such as the CD34+ stem cell, is incubated in stem cell growth media (SCGM), P7403PC00 with human stem cell factor, Fms-related tyrosine kinase 3 ligand (FLT-3L), thrombopoietin (TPO), and cytokines for 24 to 48 hours.

[0650] 115. The method according to any one of the preceding items, further comprising a step of contacting the cell with adjuvants, such as one or more transduction enhancers, preferably protamine sulfate and / or Lentiboost™.

[0651] 116. The method according to any one of the preceding items, wherein the one or more transduction enhancer comprises or consists of LentiBoost™.

[0652] 117. The method according to any one of the preceding items, wherein Lentiboost is used at a final concentration of 0.3 to 10mg / mL, preferably 0.5 to 10mg / ml, even more preferably 0.3 to 1mg / mL, yet even more preferably 1mg / mL.

[0653] 118. The method according to any one of the preceding items, wherein the step of contacting the cell with adjuvants, such as one or more transduction enhancers is performed prior to, simultaneously and / or after the step b. of transducing said cell with the lentiviral vector, preferably simultaneously to the step b. of transducing said cell with the lentiviral vector.

[0654] 119. The method according to any one of the preceding items, wherein the step of b. of transduction of the cells by the lentiviral vector is performed in a medium supporting transduction and wherein said volume of medium is reduced compared to the volume of medium prior to initiating the step of transduction.

[0655] 120. The method according to any one of the preceding items, wherein the volume reduction is by at least 25%, such as 30%, such as 35%, such as 40%, such as 45%, such as 50%, such as 55%, such as 60% such as 65%, such as 70%, such as 75% compared to pre-transduction volume.

[0656] 121 . The method according to any one of the preceding items, wherein the volume is reduced for at least 15 minutes, such as 20 minutes, such as 25 minutes, such as 30 minutes, such as 35 minutes, such as 40 minutes, such as 45 minutes , such as 1 hour, such as 2 hours after initiation of the step of transduction P7403PC00

[0657] 122. The method according to any one of the preceding items, wherein the volume is reduced for no more than 1h, such as no more than 30 minutes, preferably for 30 minutes.

[0658] 123. The method according to any one of the preceding items, comprising the steps of: a. Providing a cell, wherein said step comprises the steps of: i. Providing CD34+ cells; ii. Culturing said CD34+ cells for 20-24h; b. Transducing said cell with the lentiviral vector described in any one of the preceding items, wherein said transduction is performed for 16-24h, thereby obtaining a cell expressing RPS19.

[0659] 124. The method according to any one of the preceding items, further comprising the steps of: c. harvesting said cell; d. formulating said cell; and e. cryopreserving said cell, preferably wherein the step of cryopreserving said cell is performed 16 to 24 hours after the step b. of transducing the cell.

[0660] 125. A cell obtained by the method according to any one of the preceding items.

[0661] 126. A cell comprising in its genome:

[0662] - the codon-optimized RPS19 (coRPS19) polynucleotide sequence of SEQ

[0663] ID. NO 18 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 18, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 18;

[0664] - the codon-optimized RPS19 (coRPS19) polynucleotide sequence of SEQ

[0665] ID. NO 19 encoding RPS19, or a sequence having at least 90% identity P7403PC00 to SEQ ID. NO 19, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 19;

[0666] - a codon-optimized RPS17 (coRPS17) polynucleotide sequence, preferably wherein coRPS17 polynucleotide sequence is of SEQ ID. NO 37, or a sequence having at least 90% identity to SEQ ID. NO 37, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 37;

[0667] - a codon-optimized RPS24 (coRPS24) polynucleotide sequence, preferably wherein the coRPS24 polynucleotide sequence is of SEQ ID. NO 38, or a sequence having at least 90% identity to SEQ ID. NO 38, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 38;

[0668] - a codon-optimized RPS10 (coRPSIO) polynucleotide sequence, preferably wherein the coRPSIO polynucleotide sequence is of SEQ ID. NO 39, or a sequence having at least 90% identity to SEQ ID. NO 39, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 39;

[0669] - a codon-optimized RPL35a (coRPL35a) polynucleotide sequence, preferably wherein the coRPL35a polynucleotide sequence is of SEQ ID. NO 40, or a sequence having at least 90% identity to SEQ ID. NO 40, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at P7403PC00 least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 40;

[0670] - a codon-optimized RPL11 (coRPL11) polynucleotide sequence, preferably wherein the coRPLI 1 polynucleotide sequence is of SEQ ID. NO 41 , or a sequence having at least 90% identity to SEQ ID. NO 41 , such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 41 ;

[0671] - a codon-optimized RPS26 (coRPS26) polynucleotide sequence, preferably wherein the coRPS26 polynucleotide sequence is of SEQ ID. NO 42, or a sequence having at least 90% identity to SEQ ID. NO 42, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 42.; or,

[0672] - a codon-optimized RPL5 (coRPL5) polynucleotide sequence, preferably wherein the coRPL5 polynucleotide sequence is of SEQ ID. NO 43, or a sequence having at least 90% identity to SEQ ID. NO 43, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 43.

[0673] 127. The host cell or the cell according to any one of the preceding items wherein said host cell or cell is a human cell.

[0674] 128. The host cell or the cell according to any one of the preceding items, wherein said host cell or cell is a hematopoietic cell.

[0675] 129. The host cell or the cell according to any one of the preceding items, wherein said host cell or cell is a hematopoietic progenitor cell. P7403PC00

[0676] 130. The host cell or the cell according to any one of the preceding items, wherein the hematopoietic progenitor cell is a stem cell.

[0677] 131 . The host cell or the cell according to any one of the preceding items, wherein the hematopoietic stem cell is a peripheral blood stem cell.

[0678] 132. The host cell or the cell according to any one of the preceding items, wherein the hematopoietic stem cell is an umbilical cord blood stem cell.

[0679] 133. The host cell or the cell according to any one of the preceding items, wherein the hematopoietic stem cell is a bone marrow stem cell.

[0680] 134. The host cell or the cell according to any one of the preceding items, wherein the hematopoietic progenitor cell is a lymphoid progenitor cell.

[0681] 135. The host cell or the cell according to any one of the preceding items, wherein said host cell or cell is a CD34+ cell.

[0682] 136. The host cell or the cell according to any one of the preceding items, wherein the CD34+ cell is a CD34+ stem cell.

[0683] 137. The host cell or the cell according to any one of the preceding items, wherein the CD34+ cell is a CD34+ hematopoietic progenitor cell.

[0684] 138. The host cell or the cell according to any one of the preceding items, wherein said host cell or cell overexpresses genes associated to terminal erythropoiesis and / or wherein the cell downregulates expression of genes associated with apoptosis and p53 activation.

[0685] 139. The host cell or the cell according to any one of the preceding items, wherein said genes associated to terminal erythropoiesis are HEMGN, HBB, AHSP, EPB42 and / or GYPA and wherein said genes associated with apoptosis and p53 activation are BAX, MDM2, ZMAT3 and / or MIR34AHG. P7403PC00

[0686] 140. The host cell or the cell according to any one of the preceding items, wherein said host cell or cell overexpresses the large non-coding RNA LINC01133 and / or down-regulates the expression of XACT and / or ADA.

[0687] 141. The host cell or the cell according to any one of the preceding items, wherein said host cell or cell overexpresses RPL22L1 and / or CD70.

[0688] 142. A composition comprising a sterile dispersion of the host cells or the cells according to anyone of the preceding items.

[0689] 143. The composition according to item 142, further comprising a cryoprotectant.

[0690] 144. The composition according to any one of items 142 to 143, wherein the composition comprises 5% human serum albumin.

[0691] 145. The composition according to any one of items 142 to 144, wherein said composition comprises a percentage of viable CD34+ cells, such as hematopoietic stem cells and progenitor cells from the bone marrow or mobilized peripheral blood cells, of at least 35%, such as at least 40%, such as at least 45%, such as at least 50%, such as at least 55%, such as at least 60%, such as at least 65%, such as at least 70%, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 100%.

[0692] 146. The composition according to any one of items 142 to 145, comprising a percentage of viable double positive CD45+ / CD34+ cells of at least 35%, such as at least 40%, such as at least 45%, such as at least 50%, such as at least 55%, such as at least 60%, such as at least 65%, such as at least 70%, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 100%.

[0693] 147. The composition according to any one of items 142 to 146, comprising a percentage of CD3+, CD4+, CD8+, CD19+, CD16+, CD56+, CD14+, and CD15+ cells of at the most 30%, such as at the most 25%, such as at the most P7403PC00

[0694] 20%, such as at the most 15 %, such as at the most 10%, such as at the most 5%, such as at the most 0%.

[0695] 148. The composition according to any one of items 142 to 147, having a cell viability percentage of at least 70%, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 100%.

[0696] 149. The composition according to any one of items 142 to 148, having a viable cell concentration (VCC) of 1.6x10A6 to 2.4x10A6 viable cells / mL or 8x10A6 to 12x10A6 viable cells / mL.

[0697] 150. The composition according to any one of items 142 to 149, wherein the cells of the composition have a vector copy number comprised between 0.3 and 5 copies per cell.

[0698] 151. The composition according to any one of items 142 to 150, wherein the composition comprises:

[0699] - a percentage of viable double positive CD45+ / CD34+ cells of at least 35% as measured by flow cytometry, such as using a BD FACSLyric™ Flow Cytometry System, preferably measured at day 2 (D2),

[0700] - a percentage of CD3+, CD4+, CD8+, CD19+, CD16+, CD56+, CD14+, and CD15+ cells of at the most 30 as measured by flow cytometry, such as using a BD FACSLyric™ Flow Cytometry System preferably measured at day 2 (D2),

[0701] - a viable cell count (VCC) of at least 70% as measured by automated cell counting, such as using a Nucleocounter® NC-200 cell counter preferably measured at day 2 (D2),

[0702] - a viable cell concentration (VCC) of 1 .6x10A6 to 2.4x10A6 viable cells / mL, or of 8x10A6 to 12x10A6 viable cells / mL, preferably wherein the VCC is measured by automated cell counting, such as using a Nucleocounter® NC-200 cell counter preferably measured at day 2 (D2), and / or P7403PC00

[0703] - cells having a vector copy number comprised between 0.3 and 5 copies per cell as measured by ddCPR, preferably measured at day 7 (D7) i.e. on cells cultured for 6 days following the day of transduction start as described herein.

[0704] 152. A pharmaceutical composition comprising the construct, the vector, the host cell, the lentiviral vector, the cell, or the composition according to any one of the preceding items, and a pharmaceutically acceptable diluent or carrier.

[0705] 153. A method of treating Diamond-Blackfan anemia (DBA) in a subject, the method comprising administering the construct, the vector, the host cell, the lentiviral vector, the cell, the composition, or the pharmaceutical composition according to any one of the preceding items to the subject.

[0706] 154. The construct, the vector, the host cell, the lentiviral vector, the cell, the composition, or the pharmaceutical composition according to any one of the preceding items for use in medicine.

[0707] 155. The construct, the vector, the host cell, the lentiviral vector, the cell, the composition, or the pharmaceutical composition according to any one of the preceding items, for use in treating Diamond-Blackfan anemia (DBA).

[0708] 156. Use of the construct, the vector, the host cell, the lentiviral vector, the cell, the composition, or the pharmaceutical composition according to any one of the preceding items for the manufacture of a medicament for the treatment of Diamond-Blackfan anemia (DBA).

[0709] 157. The method or the use according to any one of the preceding items, wherein the subjects receive conditioning therapy prior to administration of the cell, the composition, or the pharmaceutical composition according to any one of the preceding items, such as 7 days, such as 6 days, such as 4 days, such as 3 days, such as 2 days prior to administration of the cell, the composition, or the pharmaceutical composition according to any one of the preceding items. P7403PC00

[0710] 158. The method or the use according to any one of the preceding items, wherein anemia is rescued following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition.

[0711] 159. The method or the use according to any one of the preceding items, wherein blood cellularity is normalized in the subject, compared to healthy subjects, following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition.

[0712] 160. The method or the use according to any one of the preceding items, wherein bone marrow cellularity is normalized in the subject, compared to healthy subjects, following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition..

[0713] 161 . The method or the use according to any one of the preceding items, wherein erythrocyte numbers, hemoglobin levels and / or platelet counts are normalized in the subject, compared to healthy subjects, following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition..

[0714] 162. The method or the use according to any one of the preceding items, wherein increased production of erythroblasts (CD71-positive, CD235-positive) and mature red blood cells (CD71 -negative, CD235-positive) is observed in the subjects following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition..

[0715] 163. The method or the use according to any one of the preceding items wherein blood transfusion dependence is alleviated in the subject following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition.

[0716] 164. The method or the use according to any one of the preceding items, wherein lethal bone marrow failure is prevented following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition. P7403PC00

[0717] 165. The method or the use according to any one of the preceding items, wherein lethality is reduced or delayed in subjects following administration of said construct, vector, host cell, lentiviral vector, cell, composition, or pharmaceutical composition.

[0718] 166. A kit-of-parts comprising: a. The construct, the vector, the host cell, the lentiviral vector, the cell, the composition, or the pharmaceutical composition according to any one of the preceding items; and b. Instructions for use.

[0719] 167. A method of assessing a response in a subject suffering from DBA receiving or having received RPS19, RPS17, RPS24, RPS10, RPL35a, RPL11 , RPS26, or RPL5-based gene therapy, said method comprising the steps of: a. Determining the values of one or more markers selected from the group consisting of: P53, CD70, BAX, RPS27L.RPL22L1 , and ADA in said subject after administration of the RPS19, RPS17, RPS24, RPS10, RPL35a, RPL11 , RPS26, or RPL5- based gene therapy; and b. Comparing said values with reference values of the one or more markers; and c. Assessing said response in said subject based on a comparison made in said comparing step, wherein a downregulation of the levels of CD70, BAX, RPS27L, or ADA, and / or an upregulation of the levels of RPL22L1 compared to the reference values is indicative of a response.

[0720] 168. The method according to item 167, wherein the RPS19, RPS17, RPS24, RPS10, RPL35a, RPL11 , RPS26, or RPL5-based gene therapy comprises the construct, the vector, the host cell, the lentiviral vector, the cell, the composition, the pharmaceutical composition, the method or the use according to any one of the preceding items. P7403PC00

[0721] 169. The composition according to any one of the preceding items wherein said composition is for infusion.

[0722] 170. The composition according to any one of the preceding items, wherein the cryoprotectant comprises DMSO.

[0723] 171. The composition according to any one of the preceding items, wherein the composition is under the form of a cryopreservation bag, for example with a final volume of 10-100mL, such as 10 to 20mL final volume, such as 30-70mL final volume.

[0724] 172. The composition according to any one of the preceding items, wherein the composition comprises 1-10x10A6 cells / mL.

[0725] 173. The method or the use according to any one of the preceding items, wherein a target dose of 1 to 10A6 host cells or cells, such as 5x10A6 host cells or cells is administered to the subject.

[0726] 174. The method or the use according to any one of the preceding items, wherein the subject has a homozygous null genotype (null / null) for the rps19 gene.

[0727] 175. The method or the use according to any one of the preceding items, wherein the subject is transfusion-dependent.

[0728] 176. The method or the use according to any one of the preceding items, wherein the subject is a pediatric subject.

[0729] 177. The method or the use according to any one of the preceding items, wherein the subject is between 3 and 18 years of age, inclusive.

[0730] 178. The method or the use according to any one of the preceding items, wherein the subject harbors a c.3 G>T rps19 variant with disrupted translation start site, a c.131_132delp.E44 Afs*49 rps19 variant with E44 frameshift and early stop at aminoacid 49, a c.173-2 A>C variant with disrupted acceptor spliced P7403PC00 site, or a c.58 C>T variant wherein the Alanine 58 is replaced by Valine at position 58 (Ala58>Val58)

[0731] 179. A composition comprising one or more constructs or vectors according to any one of the preceding items.

[0732] 180. A method for autologous gene therapy in a subject suffering from or suspected suffering from Diamond-Blackfan Anemia (DBA), the method comprising the steps of:

[0733] (a) mobilizing hematopoietic stem and progenitor cells (HSPCs) from the bone marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor;

[0734] (b) performing apheresis for collecting CD34+HSPCs;

[0735] (c) manufacturing a gene therapy product by genetic modification of the collected CD34+HSPCs ex vivo to express a functional transgene of RPS 19, RPS17, RPS24, RPS10, RPL35A, RPL11 , RPS26 or RPL5, wherein the genetic modification is performed by transducing the CD34+ HSPCs with the vector according to any one of the preceding items, thereby obtaining the gene therapy product;

[0736] (d) conditioning the subject by one of the following options i. performing non-genotoxic conditioning by performing a further mobilization of HSPCs from the bone marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor, and collecting CD34+HSPCs via apheresis; or ii. performing genotoxic conditioning by administering a genotoxic conditioning regimen comprising busulfan to the subject;

[0737] (e) administering the gene therapy product comprising genetically modified CD34+HSPCs to the subject via infusion.

[0738] 181. The method according to item 180, wherein the conditioning creates bone marrow space for engraftment of the gene therapy product.

[0739] 182. The method according to any one of items 180 to 181 , wherein a step of cell selection and / or cell purification is performed after step (b) and / or step (d) i., such as magnetic-activated cell sorting (MACS). P7403PC00

[0740] 183. The method according to any one of items 180 to 182, wherein option i. in step (d) enables engraftment of the gene therapy product and therapeutic efficacy in the absence of genotoxic conditioning agents.

[0741] 184. The method according to any one of items 180 to 183, wherein the granulocyte colony-stimulating factor is administered at a daily dose of 5 pg / kg subcutaneously.

[0742] 185. The method according to any one of items 180 to 184, wherein plerixafore is administered at a daily dose of 0.24 mg / kg.

[0743] 186. The method according to any one of items 180 to 185, wherein the granulocyte colony-stimulating factor is administered for 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 days, preferably for 8 days.

[0744] 187. The method according to any one of items 180 to 186, wherein plerixafor is administered for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days, preferably for 4 days.

[0745] 188. The method according to any one of items 180 to 187, wherein the gene therapy product is administered no later than 48 hours after apheresis in step d) option i., such as wherein the gene therapy product is administered 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours,

[0746] 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 25 hours, 26 hours,

[0747] 27 hours, 28 hours, 29 hours, 30 hours, 31 hours, 32 hours, 33 hours, 34 hours,

[0748] 35 hours, 36 hours, 37 hours, 38 hours, 39 hours, 40 hours, 41 hours, 42 hours, 43 hours, 44 hours, 45 hours, 46 hours, 47 hours, 48 hours after apheresis.

[0749] 189. A method for autologous gene therapy in a subject suffering from or suspected suffering from an inherited bone marrow failure syndrome (IBMFS), the method comprising the steps of:

[0750] (a) mobilizing hematopoietic stem and progenitor cells (HSPCs) from the bone P7403PC00 marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor;

[0751] (b) performing apheresis for collecting a cell population;

[0752] (c) manufacturing a gene therapy product by genetic modification of the collected cell population ex vivo to express a functional transgene, thereby obtaining the gene therapy product;

[0753] (d) conditioning the subject by one of the following options iii. performing non-genotoxic conditioning by performing a further mobilization of HSPCs from the bone marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor, and collecting a further cell population via apheresis; or iv. performing genotoxic conditioning by administering a genotoxic conditioning regimen comprising busulfan to the subject;

[0754] (e) administering the gene therapy product comprising the genetically modified cell population to the subject via infusion.

[0755] 190. The method according to item 189, wherein the cell population and / or the further cell population and / or the genetically modified cell population comprises or consists of CD34+HSPCs.

[0756] 191. The method according to any one of items 189 to 190, wherein the IBMFS is Fanconi Anemia, Shwachman-Diamond Syndrome or Congenital Amegakaryocytic Thrombocytopenia.

[0757] 192. The method according to any one of items 189 to 191 , wherein the conditioning creates bone marrow space for engraftment of the gene therapy product.

[0758] 193. The method according to any one of items 189 to 192, wherein a step of cell selection and / or cell purification is performed after step (b) and / or step (d) i., such as magnetic-activated cell sorting (MACS).

[0759] 194. The method according to any one of items 189 to 193, wherein option i. in step (d) enables engraftment of the gene therapy product and therapeutic efficacy in the absence of genotoxic conditioning agents. P7403PC00

[0760] 195. The method according to any one of items 189 to 194, wherein the granulocyte colony-stimulating factor is administered at a daily dose of 5 pg / kg subcutaneously.

[0761] 196. The method according to any one of items 189 to 195, wherein plerixafore is administered at a daily dose of 0.24 mg / kg.

[0762] 197. The method according to any one of items 189 to 196, wherein the granulocyte colony-stimulating factor is administered for 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 days, preferably for 8 days.

[0763] 198. The method according to any one of items 189 to 197, wherein plerixafor is administered for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days, preferably for 4 days.

[0764] 199. The method according to any one of items 189 to 198, wherein the gene therapy product is administered no later than 48 hours after apheresis in step d) option i., such as wherein the gene therapy product is administered 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours,

[0765] 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 25 hours, 26 hours,

[0766] 27 hours, 28 hours, 29 hours, 30 hours, 31 hours, 32 hours, 33 hours, 34 hours,

[0767] 35 hours, 36 hours, 37 hours, 38 hours, 39 hours, 40 hours, 41 hours, 42 hours,

[0768] 43 hours, 44 hours, 45 hours, 46 hours, 47 hours, 48 hours after apheresis.

[0769] Examples

[0770] Example 1: RPS19 construct manufacturing and manufacturing of constructs with RPS17, RPS24, RPS10, RPL35a, RPL11, RPS26, orRPL5

[0771] Aim: To manufacture a construct encoding RPS19, including codon-optimization. P7403PC00

[0772] To improve expression from the RPS19 transgene cassette, the cassette was further optimized. A Kozak consensus sequence was added (for higher protein production) and the coding sequence codon-optimized for more stable and better exported mRNAs and better translatibility.

[0773] Material and methods: Different algorithms were applied to ensure adaption to favoured tRNA codons for H. sapiens, G / C content was considered / measured and sequence screened for cryptic splice sites, RNA instability motifs and cryptic splice splice (donor and acceptor sites) and polyadenylation sites.

[0774] Full genes usually cannot be incorporated into lentiviral vectors as the exon / intron- containing structure is often not compatible with the cargo size of lentiviral vectors and can interfere with the splicing elements (donors I acceptors) in the vector and in neighboring genes. Within lentiviral vectors, a minigene as an intron-less cDNA is routinely used because of aforementioned problems. To further improve expression levels, RNA stability and translability, codon-optimized cDNA offer further benefits. We have codon-optimized the cDNA sequences (and included a Kozak sequence in front of these) and have designed algorithms to use favoured Homo sapiens codons and to remove cryptic splice sites (donors and acceptors), cryptic polyadenylation motifs and potential instability motifs. This was done to result in improved and safer (codon- optimized) sequences that express more stable, correct and better exported RNAs, and are better translatable into the therapeutic protein.

[0775] Results: The resulting codon-optimized sequence is shown in Fig.8 (SEQ ID NO: 18) aligned with the wild-type (wt) RPS19 sequence (including stop codon, SEQ ID NO: 48 ). Cryptic splice sites were removed and further sequence optimizations were performed to address the points mentioned in the Material and methods section above. A similar approach, individualized for each of the other DBA variants genes, was used to obtain the codon-optimized versions of RPS19, RPS17, RPS24, RPS10, RPL35a, RPL11, RPS26, or RPL5 described herein, i.e. sequences of SEQ ID NO: 37 - 44.

[0776] Conclusion: A codon optimized version of the rps19 gene was generated (see Fig. 8 and SEQ ID. NO: 18). The codon-optimization fulfils multiple purposes: Taking away peaks of GC I AT content to improve transcription, removal of cryptic splice sites (splice donor and acceptor sites), RNA instability motifs and cryptic polyadenylation sites (improving RNA stability), and adaptation to favored codons of Homo sapiens for P7403PC00 optimal translation. Using a similar approach, individualized to each of the other DBA variants genes, the codon-optimized versions of RPS19, RPS17, RPS24, RPS10, RPL35a, RPL11, RPS26, or RPL5 described herein were generated.

[0777] Example 2: Gene therapy cures the anemia and lethal bone marrow failure in a mouse model of RPS19-deficient Diamond-Blackfan anemia

[0778] Aim: Assess the therapeutic efficacy and safety of gene therapy using mouse models of RPS19-deficient DBA.

[0779] Material and Methods: The self-inactivating lentiviral vectors used in this study were derived from the pRRL.PPT.PGK.GFPpre vector. A codon-optimized human RPS19 cDNA was designed according to the codon optimisation approach described in Example 1 and inserted downstream of the spleen focus-forming virus (SFFV) promoter (Fig 1A). Following the RPS19 cDNA, internal ribosomal entry site (IRES), GFP, and improved posttranscriptional regulatory element (Pre*) were inserted to form the pRRL.PPT.SF.RPS19co.iresGFP.pre* vector (hereafter termed SFFVRPS19). A similar vector, in which the RPS19 cDNA was replaced with an equally long non-coding spacer sequence, was used as a control (pRRL.PPT.SF.spacer.iresGFP.pre*; hereafter termed SFFV-GFP). Lentiviral vectors were produced by the Vector Unit at Lund University.

[0780] Generation of the transgenic Rps19 knockdown mice has been reported previously. Briefly, this model contains an Rps79-targetingshRNA (shRNA-D) that is expressed by a doxycycline-responsive promoter located downstream of the Collagen A1 gene (Fig 1 B). Experimental animals were bred to be either heterozygous (D / +) or homozygous (D / D) for the shRNA in order to generate two models with intermediate or severe Rps19 deficiency, respectively (Fig 10). To genetically correct the Rps19 deficiency, we developed lentiviral vectors harboring a codon-optimized human RPS19 cDNA driven by the internal SFFV promoter, followed by IRES and GFP (SFFV-RPS19) (Fig 1 D). Rps19 deficiency was induced by feeding the mice with doxycycline-containing food pellets (200 mg / kg doxycycline; Bio-Serv), with the exception of the recipients transplanted with D / D BM which were given doxycycline in the drinking water (2 mg / mL doxycycline; Sigma Aldrich) supplied with 10 mg / mL sucrose (Sigma-Aldrich) for the first 2 weeks of induction. Mice were maintained at Lund University animal facility and P7403PC00 all animal experiments were performed with consent from the Lund University animal ethics committee.

[0781] The codon-optimized RPS19 cDNA was further modified to prevent its recognition and downregulation by the Rps19-targeting shRNA used. A similar vector without the RPS19 cDNA was used as a control vector (SFFV-GFP). c-Kit+ cells were enriched from the BM of the transgenic mice (CD45.2) using CD117 MicroBeads and MACS separation columns (Miltenyi), and pre-stimulated in serum- free StemSpanOSFEM medium supplemented with penicillin / streptomycin (GIBCO), murine stem cell factor (100 ng / mL, PeproTech), human thrombopoietin (50 ng / mL, PeproTech), murine interleukin-3 (10 ng / mL, PeproTech) and human interleukin-6 (10 ng / mL, PeproTech) in six-well plates (non-tissue culture treated; BD) for 1 day (0.5x106 cells / mL). Retronectin-coated (20 ng / mL; Takara) six-well plates were preloaded with the SFFV-RPS19 or SFFV-GFP vector (100 pL / well corresponding to a MOI of 15-30), and 1x10e6 cells were seeded into each well in 3 mL pre-stimulation medium.

[0782] After incubation for 1 day, 1.0 x10e6 (experiment 1) or 0.5x10e6 (experiments 2 and 3) bulk transduced cells were transplanted in 500 pL phosphate-buffered saline into the tail veins of lethally irradiated (900 cGy) wild-type recipients (CD45.1). Secondary transplants were performed by intravenous injection of 3x106 whole BM cells into lethally irradiated wild-type recipients (CD45.1.2). An additional experiment (experiment 4) was performed by transducing FACS-sorted lineage-Sca1+c-Kit+ (LSK) hematopoietic stem and progenitor cells. In this experiment, 100x10e3 LSK were pre-stimulated in serum-free medium supplemented with penicillin / streptomycin, murine stem cell factor (100 ng / mL) and human thrombopoietin (100 ng / mL) in 48-well plates (tissue culture treated, BD). After 1 day, LSK were transferred into 96-well plates (tissue culture treated, BD; 20x10e3 LSK / well in 100 pL prestimulation medium), and transduced with 100 pL virus-containing pre-stimulation media, corresponding to a MOI of ~50). One day after transduction, 10x103 bulk transduced LSK, together with 250x10e3 fresh BM cells of the same genotype, were transplanted as above.

[0783] Results: In order to assess the functionality of these vectors, we cultured transduced c- Kit-enriched BM cells from control and D / D mice in liquid cultures in the presence of doxycycline. The D / D cells transduced with the SFFV-GFP control vector failed to P7403PC00 expand during 4 days of culture (Figure 1E). In contrast, the SFFV-RPS19 vector mediated a 6-fold increase in total cell number when compared to the SFFV-GFP vector. Next the inventors quantified the expression of endogenous Rps19 and vector- derived RPS19 in these cultures on day 4. The SFFV-RPS19-vector-transduced control cells showed, on average, a 1.5-fold higher expression of RPS19 compared to endogenous Rps19, while the SFFV-GFP-vector-transduced cells showed no RPS19 expression (Figure 1 F). The SFFVRPS19-vector-transduced control cells showed, on average, a 1.5-fold higher expression of RPS19 compared to endogenous RPS19, while the SFFV-GFP-vector-transduced cells showed no RPS19 expression. The expression of RPS19 was on average more pronounced in the D / D cells transduced with SFFV-RPS19 vector (2.2-fold).

[0784] After 2 weeks of doxycycline administration, the recipients transplanted with SFFV- RPS19 or SFFVGFP control cells had similar blood cellularity (Fig 1G). The recipients with the SFFV-GFP-transduced D / D BM developed lethal BM failure as exemplified by dramatic decreases in erythrocyte, reticulocyte, white blood cell and platelet counts, and died around this time-point (Fig 1 H). The reduction in the mean corpuscular volume in these mice reflects a complete lack of new erythrocytes produced under doxycycline administration (Fig 1 H). Remarkably, the recipients transplanted with the SFFV-RPS19 D / D BM had normal blood cellularity. In contrast to the recipients with SFFV-GFP D / D BM, the recipients with SFFV-GFP D / + BM showed mild reductions in the number of erythrocytes and white blood cells and in hemoglobin concentration, but were able to compensate for the erythroid defect as indicated by the normal reticulocyte count. Similarly to the recipients with D / D BM, SFFV-RPS19 cured the erythroid defect and improved the number of white blood cells. Remarkably, the recipients with SFFV-RPS19 D / D BM continued to show normal blood cellularity over time, demonstrating a long-term cure of the acute lethal BM failure (Fig 11-K). The recipients with SFFV-GFP D / + BM were able to compensate for the erythroid defect over time and showed only a reduction in the number of white blood cells after 4 months (Fig 1K). The number of white blood cells was slightly improved by SFFV- RPS19, although the observed increase was not statistically significant (Fig 1K).

[0785] Finally, at this timepoint all groups showed high overall donor reconstitution confirming the absence of recipient-derived hematopoiesis. P7403PC00

[0786] As expected based on the initial transduction efficiencies, the mean percentage of total GFP+ cells before the administration of doxycycline varied between 30% and 63% (Fig 1L-M). Following doxycycline administration, the mean percentage of GFP+ cells remained relatively stable in the recipients repopulated with SFFV-GFP and SFFVRPS19 control BM, and SFFV-GFP D / + BM, while it decreased in the recipients with SFFV-GFP D / D BM (Fig 1M). By contrast, the recipients with SFFV-RPS19 D / + BM and SFFV-RPS19 D / D BM showed clear increases in the frequency of total GFP+ cells at 4 months (46% to 64%, and 63% to 77%, respectively)(Fig 1 N). Similarly to the total white blood cells, the percentage of GFP+ myeloid cells in the recipients with SFFV-GFP and SFFV-RPS19 control BM, and SFFV-GFP D / + BM remained relatively stable. By contrast, in the recipients with SFFV-RPS19 D / + BM and SFFV-RPS19 D / D BM, administration of doxycycline increased the mean percentage of GFP+ cells to almost 100% (Fig 10). Enforced expression of RPS19 conferred Rps19-deficient cells a growth advantage compared to untransduced Rps19-deficient cells. The recipients with SFFV-GFP D / + BM showed a trend toward reduced BM cellularity that was improved by RPS19 overexpression (Fig 10). The mean percentage of GFP+ progenitor cells was considerably higher in the recipients with SFFV-RPS19 D / + BM and SFFV-RPS19 D / D BM than in the other groups demonstrating the competitive advantage of gene-corrected cells already early in the hematopoietic hierarchy (Fig 1 P).

[0787] The inventors demonstrated that gene therapy is feasible in a mammalian model of Diamond-Blackfan anemia. Lentiviral vectors overexpressing RPS19 corrected the anemia and lethal bone marrow failure in Rps19-deficient mice showing that pathophysiological correction of the disease is possible through gene therapy.

[0788] Conclusion: Our findings demonstrate the feasibility of developing clinical gene therapy for the treatment of RPS19-deficient DBA.

[0789] Example 3: Lentiviral Vectors with Cellular Promoters Correct Anemia and Lethal Bone Marrow Failure in a Mouse Model for Diamond-Blackfan Anemia

[0790] Aim: Assess the efficacy of clinically relevant promoters to drive the therapeutic gene.

[0791] Material and Methods: The inventors designed lentiviral vectors harboring a codon- optimized human RPS19 cDNA (SEQ ID NO. 18) driven by the shortened version of the human elongation factor 1a (EFS) promoter. The EFS promoter was followed by P7403PC00

[0792] IRES and GFP (EFS-RPS19), while a vector without the RPS19 cDNA was used as a control (EFS-Spacer). To assess the therapeutic potential of the EFS-RPS19 vector in vivo, the inventors transduced c-Kit-enriched bone marrow cells from control and uninduced small hairpin RNA (shRNA)-D mice and these were injected into lethally irradiated wild-type mice.

[0793] Briefly, this model contains an Rps19-targeting shRNA (shRNA-D) that is expressed under a doxycycline-responsive promoter located downstream of the collagen A1 gene (Fig 2A). Experimental animals were bred to be either heterozygous (D+) or homozygous (DD) for the shRNA in order to generate two models with intermediate or severe Rps19 deficiency, respectively (Fig 2A). To correct the Rps19 deficiency, the inventors developed self-inactivating (SIN) lentiviral vectors harboring a codon- optimized human RPS19 cDNA driven by the internal EPS promoter, followed by IRES and GFP (EFS-RPS19) with or without a p-globin locus control region (LCR) cassette (Fig 2A). The codon-optimized RPS19 cDNA was further modified to prevent its recognition and downregulation by the RPS 79-targeting shRNA used. A similar vector without the RPS19 cDNA was used as a control vector (EFS-Spacer).

[0794] Results To assess the functionality of these vectors the inventors cultured transduced c-Kit-enriched bone marrow (BM) cells from control and heterozygous RPS19 shRNA

[0795] (D+) mice in liquid cultures in the presence of doxycycline (Fig 2B). Based on the percentage of GFP+ cells, the initial transduction efficiency was between 20% and 40% on average (Fig 20). D+ cells transduced with the EFS-Spacer control vector failed to expand during 7 days of culture after transduction (Fig 2D). In contrast, the EFS- RPS19 and LCR-EFS-RPS19 vectors mediated a 2-fold increase in total cell number compared to the EFS-Spacer vector.

[0796] Next the inventors quantified the erythroid colony-forming potential of transduced c-Kit- enriched BM cells from control and D+ mice in methyl cellulose cultures in the presence of doxycycline for 14 days (Fig 2E). The findings demonstrate that the EFS- RPS19 and LCR-EFS-RPS19 vectors mediated a 3-fold increase in the total number of erythroid colonies compared to the EFS-Spacer vector.

[0797] Following engraftment and stable donor-derived regeneration of the hematopoietic system, recipient mice were administered doxycycline to downregulate endogenous Rps19 in order to induce the disease (Fig 2F). Since the inventors showed previously that the hematopoietic phenotype in Rps19-deficient mice is autonomous to the blood system, it was decided to use lethally irradiated wild-type recipients. P7403PC00

[0798] Before transplantation, initial transduction efficiencies with therapeutic and control vectors were measured based on the percentage of GFP+ cells and were between 20% and 40% on average (Fig 2G). After 2 weeks of doxycycline treatment, most of the mice receiving DD BM transduced with EFS-Spacer vector died due to dramatic BM failure (data not shown). At this time point, all groups showed high overall donor reconstitution, confirming the absence of recipient-derived hematopoiesis. The inventors demonstrated that the recipients transplanted with the EFS-RPS19 or LCR- EFS-RPS19 DD BM had normal blood cellularity (Fig 2F-K).

[0799] Doxycycline administration for 18 weeks was used as the time point to assess longterm efficacy (Fig 2L). Most recipients with DD BM transduced with EFS-Spacer vectors died (Fig 2M), but the remaining surviving recipients exhibited macrocytic anemia and a decrease in erythrocyte numbers, hemoglobin value, and platelet counts (Fig 2N-S). Remarkably, recipients transplanted with the EFS-RPS19 or LCR-EFS- RPS19 DD BM had normal blood cellularity and BM cellularity (Fig 2N-S). Additionally, the inventors analyzed the samples by fluorescence-activated cell sorting (FACS) to allow fractionation of the myeloid-erythroid compartment in the BM. The mean percentage of GFP+ cells was substantially higher in recipients with EFS-RPS19 or LCR-EFS-RPS19 DD BM than in the other groups, indicating the competitive advantage of gene-corrected cells in the hematopoietic hierarchy (Fig 2O-S).

[0800] The inventors asked whether doxycycline-induced, Rps19-defcient BM cells transduced with RPS19 lentiviral vectors can result in long-term engraftment in doxycycline-induced lethally irradiated wild-type recipient mice (Fig 2T). To this end, DD and control mice were induced with doxycycline for 1 week and erythrocyte numbers and hemoglobin levels were measured to confirm the DBA phenotype (Fig 2T). BM cells from induced mice were transduced and transplanted into doxycycline- induced lethally irradiated mice. Initial transduction efficiencies with therapeutic and control vectors were measured based on the percentage of GFP+ cells and were between 20% and 50% (Fig 2T). Most of the mice receiving DD BM transduced with EFS-Spacer failed to engraft and did not survive beyond 2-3 weeks after transplantation (Fig 2U). Almost 60% of the mice receiving DD BM with corrected EFS- RPS19 vector survived and showed long-term engraftment (Fig 2V). The inventors assessed long-term engraftment and the hematopoietic contribution of mice with gene- corrected DD BM at 16 weeks post-transplantation. At this point, these mice exhibited P7403PC00 improved BM cellularity and recovery of erythrocyte numbers, hemoglobin levels, and platelet counts (Fig 2W-Z).

[0801] The recipients transplanted with the EFS-Spacer transduced shRNA-D bone marrow showed a dramatic decrease in blood cellularity that led to death after a few weeks, while the recipients transduced with EFS-RPS19 shRNA-D bone marrow exhibited close to normal blood cellularity.

[0802] Conclusion: These results demonstrate that EFS promoter-driven enforced expression of RPS19 can cure severe anemia and bone marrow failure in RPS19-deficient mice.

[0803] Example 4: Engineered human Diamond-Blackfan anemia disease model confirms therapeutic effects of clinically applicable lentiviral vector at single-cell resolution

[0804] Aim: Create a traceable RPS 79-deficient cell model using Cas9 via homologous recombination in cord blood-derived human CD34+ HSPC

[0805] Material and Methods: The SIN lentiviral vector is derived from the pRRL.PPT.PGK. vector backbone. A codon-optimized human RPS19 cDNA was designed according to the codon optimisation approach described in Example land inserted downstream of the EFS promoter. Lentiviral vectors were produced by the Vector Unit at Lund University as previously described.

[0806] The inventors designed a complementary adeno-associated virus (AAV)-based homology-directed repair (HDR) template that allows GFP expression driven by PGK promoter (Figure 3A).

[0807] A gentle nanostraw delivery platform was developed to edit the RPS19 gene in primary human cord blood derived CD34+ hematopoietic stem and progenitor cells.

[0808] Human cord blood samples were obtained from the maternity wards of Helsingborg General Hospital and Skane University Hospital in Lund and Malmo, Sweden, after informed, written consent according to guidelines approved by the regional ethical committee. Mononuclear cells were separated through densitygradient centrifugation. CD34+ cells were magnetically isolated according to the manufacturer’s description (Milteny Biotec, cat. n. 130-046-702). Cells were cultured in serum-free expansion P7403PC00 medium (Stem Cell Technologies), supplemented with human stem cell factor, thrombopoietin, and FLT3-ligand at 100 ng / mL from Peprotech.

[0809] The inventors used electroporation to deliver Cas9 RNP or mRNA into CD34+ HSPC, followed by AAV transduction at optimized MOI (Figure 3B).

[0810] Results:

[0811] Considering that the complete loss of RPS19 causes lethal effects, we included a control condition in which the cell surface marker CD45 was targeted, the KO of which is well tolerated by CD34+ HSPC.15 The cell viability was measured one day after editing. We found about 26% live cells (7-AADAnnexin V-) were recovered in the Cas9 RNP RPS19-edited group relative to the untreated group (Figure 3C-F) up to 12% GFP+ cells (Figure 3C-F) on day 1 post electroporation.

[0812] The inventors previously showed that both the viability and function of CD34+ are fully maintained after nanostraw-mediated delivery of a transiently expressed mRNA (Figure 3G). To investigate if nanostraws could be used for stable gene editing via Cas9 mRNA delivery, we first attempted to KO CD45 (Figure 3H). As shown in Figure 3I-L, total live cell numbers at a rate of 75% (day 1) and 53% (day 4) relative to completely untreated cells could be recovered upon CD45-targeting using Cas9 mRNA delivery. The efficiency of CD45 KO can reach up to 23% (Figure 3M).

[0813] The inventors delivered Cas9 mRNA and RPS 79-targeting sgRNA to CD34+ HSPC with nanostraws and added the AAV HDR-template at the optimized MOI to the cells (Figure 3N). In the RPS 19-defi ci ent group, we obtained similar numbers of viable cells (7-AAD-Annexin V-) compared to the untreated group on day 1, and 70% 7- AAD- cells relative to the untreated group on day 4 (Figure 3O-Q). This was an enormous improvement over the electroporation results, where less than 3% viable cells compared to the untreated condition could be recovered on day 4. Importantly, we could obtain far more viable GFP+ cells on day 1 (12% on average) and day 4 (1% on average; Figure 3O-Q) compared to electroporation (0.2% on average on day 4).

[0814] The number of colonies for BFLI-E, CFU-G / M / GM, and CFU-GEMM in the edited group was significantly lower than in the mocktreated group (Figure 3R). The abundance of the edited allele compared to the alleles of a reference gene (APOE, on same chromosome) are in the range of 40-60% in the majority of colonies

[0815] (85%), which indicated monoallelic integration in the GFP+ cells that successfully formed colonies (Figure 3S). P7403PC00

[0816] RPS19-deficient cells (RPS19-D) were generated using nanostraws after 2 days of culture (Figure 3T). Expression levels of endogenous RPS19 were strongly reduced in GFP+ cells, which further confirms the successful generation of

[0817] RPS19-deficient CD34+ HSPC (Figure 3U). Interestingly, endogenous RPS19 expression was significantly reduced in cells transduced with the therapeutic vector, which might be caused by a compensatory mechanism triggered by the overexpression of the transgene RPS19 (Figure 3V). The edited cells showed impaired erythroid differentiation with increased numbers of progenitor cells (CD71-CD235-) and BFU- E / CFU-E cells (CD71+CD235-) on day 10 (Figure 3W). with increased numbers of progenitor cells (CD71-CD235-) and BFU-E / CFU-E cells (CD71+CD235-) on day 10 (Figure 3X).

[0818] To summarise, the edited cells showed the expected impaired erythroid differentiation phenotype. The therapeutic vector could rescue the abnormal erythropoiesis by activating cell cycle-related signaling pathways and promoted red blood cell production. RPS79-deficient cells (RPS19-D) were generated using nanostraws after 2 days of culture. As expected, expression levels of endogenous RPS19 were strongly reduced in GFP+ cells, which further confirms the successful generation of RPS 19-deficient CD34+ HSPC. Interestingly, endogenous RPS19 expression was significantly reduced in cells transduced with the therapeutic vector, which might be caused by a compensatory mechanism triggered by the overexpression of the transgene RPS19. It is also possible that survival of potential homozygous RPS 19-deficient cells that would not have survived otherwise was enabled by transduction with the EFS-RPS19 vector. The edited cells showed impaired erythroid differentiation with increased numbers of progenitor cells (CD71-CD235-) and BFU-E / CFU-E cells (CD71+CD235-) on day 10. The erythroid differentiation block is consistently present throughout all measured timepoints (days 6, 8 and 10) during differentiation. In contrast, cells treated with EFS- RPS19 could be rescued from the impaired erythroid differentiation, and showed significantly increased production of erythroblasts (CD71+CD235+) and mature red blood cells (CD71-CD235+) at all timepoints. The RPS19-D group produced a smaller and fainter red pellet compared to the CD34 group, or the Cas9-only group, while the LV-RPS19 group produced larger pellets than the RPS19-D group on day 21. Overall, the results show that the inventors successfully created a RPS19-deficient model that accurately mimics the impaired DBA erythroid differentiation phenotype, which could be rescued by our therapeutic EFS-RPS19 vector. P7403PC00

[0819] Conclusion: Overall, these results establish nanostraws as a gentle option for CRISPR- Cas9- based gene editing in sensitive primary hematopoietic stem and progenitor cells, and provide support for future clinical investigations of the lentiviral gene therapy strategy

[0820] Example 5: Successful gene therapy of Diamond-Blackfan anemia in a mouse model and human CD34+ cord blood hematopoietic stem cells using a clinically applicable lentiviral vector

[0821] Aim: Develop a clinically applicable single gene, self-inactivating lentiviral vector, containing the human RPS19 cDNA driven by the human elongation factor 1a short promoter, which can be used for clinical gene therapy development for RPS19-deficient DBA, and examine the efficacy and safety of the vector in a Rps19-deficient DBA mouse model and in human primary RPS19- deficient CD34+ cord blood cells.

[0822] Material and Methods: The SIN lentiviral vector is derived from the pRRL.PPT.PGK. vector backbone. A codon-optimized human RPS19 cDNA was designed according to the codon optimization approach described in Example 1 and inserted downstream of the EFS promoter. Lentiviral vectors were produced by the Vector Unit at Lund University as previously described.

[0823] The inventors generated a traceable RPS19-deficient cell model using CRISPR-Cas9 and homology-directed repair to investigate the therapeutic effects of a clinically applicable lentiviral vector at single-cell resolution. This model contains the Rps19- targeting shRNA expressed under a doxycycline-responsive promoter located downstream of the collagen A1 gene (Figure 4A).

[0824] Mice were maintained at the Lund University animal facility and all animal experiments were approved by the Lund University animal ethics committee. The homozygous doxycycline-inducible Rps 79-deficient mouse model used in the study was established as previously described. c-kit+ or lineage negative (Lin-) cells isolated from BM of transgenic mice were enriched by using CD117 or Lin- microbeads and magnetic-activated cell sorting separation columns (all from Miltenyi Biotec) according to the manufacturer’s protocol. After enrichment, cells were pre-stimulated for 24 h in StemSpan serum-free expansion medium (Stem Cell Technologies), supplemented with penicillin / streptomycin (Gibco), murine stem cell factor (100 ng / mL; PeproTech), and human thrombopoietin (50 P7403PC00 ng / mL; PeproTech) in six-well plates at the concentration of 0.5x106 cells / mL. For transduction, retronectin-coated (20 ng / mL; Takara) 12-well plates were preloaded with the viral vectors (multiplicity of infection [MOI]=5-10), followed by seeding of 0.5x106 cells into each well filled with 1 mL pre-stimulation medium.

[0825] Experimental animals were bred to be either heterozygous (D / +) or homozygous (D / D) for the shRNA to generate two models with intermediate or severe RPS19 deficiency (Figure 4A). The clinically applicable single gene lentiviral vector was developed using a SIN lentiviral vector design harboring the codon-optimized human RPS19 cDNA driven by an internal EFS promoter (named EFS-RPS19) (Figure 4A). Compared to the human codon-optimized RPS19 cDNA, there are six mismatches in the shRNA construct for generating the mouse model. Because of this, gene expression derived from the human codon-optimized RPS19 cDNA is not affected by the shRNA.

[0826] Human cord blood samples were obtained from the maternity wards of Helsingborg General Hospital and Skane University Hospital in Lund and Malmo, Sweden. Mononuclear cells were separated through density-gradient centrifugation, as described previously.5 Cells were cultured in serum-free expansion medium, supplemented with stem cell factor, thrombopoietin, and FLT3-ligand at 100 ng / mL (all from Stem Cell Technologies). Transduction of the therapeutic lentiviral vector was performed at a multiplicity of infection (MOI) of 5, according to the published protocol. Whole BM cells were isolated at 16 weeks after transplantation. Genomic DNA was isolated from the BM of flushed femora using the DNA Blood & Tissue kit (Qiagen). The vectorgenome junction was amplified using the integration Site Pipeline for palRed- End reaDs (INSPIIRED) workflow as described by Sherman and colleagues.

[0827] Results: The results show that mouse cells transduced with the EFS-RPS19 vector could successfully express the human RPS19 transgene.

[0828] Uninduced (no doxycycline) c-kit+ BM cells from D / D mice (CD45.2) were transduced with the EFSRPS19 vector (MOI=5-10), and then transplanted into lethally irradiated wild-type B6SJL recipient mice (CD45.1 / CD45.2, named the EFS-RPS19 group)(Figure 4B). Mice receiving uninduced c-kit+ BM cells without vector transduction were regarded as the mock group (negative control). Following engraftment and stable donor-derived reconstitution of the hematopoietic system, doxycycline was administrated to all recipients to induce the DBA phenotype. To determine whether the P7403PC00 vector-treated cells could achieve a full correction, age-matched B6SJL wildtype (WT) mice receiving no irradiation and no transplantation but the same doxycycline administration were used as the control group.

[0829] After induction with doxycycline for 2 weeks, recipients in the mock group showed a dramatic decrease in red blood cell counts, mean corpuscular volume (MCV), and white blood cell and platelet counts, indicating that the mice developed BM failure shortly after doxycycline administration (Figure 4C-D).

[0830] To assess the long-term therapeutic effects, recipients were administered doxycycline for 16 weeks (Figure 4E). As shown in Figure 4F, most of the recipients in the mock group died (9 out of 16) at 2-3 weeks after doxycycline administration.

[0831] The few remaining recipients exhibited a macrocytic anemia phenotype with significantly reduced red blood cell counts and increased MCV at 16 weeks. The hemoglobin levels and platelet counts were also decreased compared to those in the WT group (Figure 4G-H). Strikingly, all the mice in the EFS-RPS19 group survived without any signs of anemia and with normal BM cellularity compared to the WT group. These results indicate that the lethal BM failure can be prevented by the vector.

[0832] The vector copy number at 16 weeks after transplantation was 5.2±1.6 and 4.7±1.0 on average in gene-corrected cells isolated from peripheral blood and BM, respectively (Figure 4I). Donor-derived hematopoiesis was observed in the EFS-RPS19 group, and the mean percentage of donor cells (CD45.2) in every progenitor population was significantly higher in the EFS-RPS19 group than in the mock group (Figure 4J-K).

[0833] The inventors next investigated whether the EFS-RPS19 vector-treated Rps19- deficient BM cells could generate long-term engraftment and reconstitution in doxycycline-induced lethally irradiated WT recipients (Figure 4L). After induction with doxycycline for 2-3 weeks, the majority of mice in the mock group died (13 out of 16 animals) due to severe anemia or BM failure (Figure 4M). The few surviving mice exhibited concomitant development of a severe anemia phenotype in the mock group (Figure 4N-O). In contrast, all recipients in the EFS-RPS19 group survived with normal blood cellularity compared to the WT group.

[0834] The vector copy number was on average 8.3±4.0 and 10.9±3.9 in gene-corrected Rps 79-deficient cells isolated from peripheral blood and BM, respectively (Figure 4P). By analyzing the fraction of myeloid-erythroid compartments at 16 weeks, the inventors P7403PC00 observed almost complete donor-derived hematopoiesis in the EFS-RPS19 group, which was significantly higher than in the mock group (Figure 4P-Q).

[0835] As shown in Figure 4R, both shRNAI and shRNA2 significantly decreased RPS19 mRNA expression, with slightly more efficient knockdown being obtained with shRNAI than shRNA2. The impaired differentiation was rescued by EFS-RPS19, with significantly increased GFPhigh populations (1.6-fold for shRNAI and 1.8-fold for shRNA2)(Figure 4S). Particularly, during terminal erythropoiesis on day 16, cells in the RPS79-deficient groups showed reduced red blood cell production (especially in the shRNA2 group) and few GFPhigh cells (<1%) could be detected (Figure 4T).

[0836] To summarise, after induction with doxycycline for 2 weeks, recipients in the mock group showed a dramatic decrease in red blood cell counts, mean corpuscular volume (MCV), and white blood cell and platelet counts, indicating that the mice developed BM failure shortly after doxycycline administration. In contrast, recipients in the EFSRPS19 vector-treated group showed normal blood cellularity compared to the WT group. Most of the recipients in the mock group died (9 out of 16) due to severe anemia or BM failure (data not shown) at 2-3 weeks after doxycycline administration. The few remaining recipients exhibited a macrocytic anemia phenotype with significantly reduced red blood cell counts and increased MCV at 16 weeks. The hemoglobin levels and platelet counts were also decreased compared to those in the WT group.

[0837] Strikingly, all the mice in the EFS-RPS19 group survived without any signs of anemia and with normal BM cellularity compared to the WT group. These results indicate that the lethal BM failure can be prevented by the vector. Donor-derived hematopoiesis was observed in the EFS-RPS19 group, and the mean percentage of donor cells (CD45.2) in every progenitor population was significantly higher in the EFS- RPS19 group than in the mock group. Unlike in the EFSRPS19 group, the transplanted cells in the mock group had limited reconstituting ability. In addition, the inventors observed a significantly higher reconstitution of resident recipient cells (CD45.1 / CD45.2) in the few surviving mice in the mock group than in the EFS-RPS19 group. The inventors demonstrated that this vector can rescue the anemia and lethal BM failure observed in mouse models of Rps 79-deficient DBA, with a low-risk insertion profile and no evidence of clonal expansion associated with vector integration near cancer-associated genes.

[0838] Conclusion: The results demonstrate the feasibility and preclinical efficacy for treatment of RPS 79-deficient DBA using a clinically applicable SIN lentiviral vector, which opens P7403PC00 the possibility for the development of clinical gene therapy for RPS 19-defi ci ent DBA patients.

[0839] Example 6: Confirming safety of APR-2020

[0840] Aim: Determine the potential toxicity, biodistribution, and tumorigenicity of APR-2020 when given via a single intravenous infusion to NSG (NOD.Cg Prkdcscid H2rgtm1Wjl / SzJ) mice. Material and Methods:

[0841] Table 2: Experimental Design

[0842] No. = number; - = not applicable.

[0843] Dose administration occurred once on Day 1.

[0844] Myeloablative agent (Busulfex®) was administered via intraperitoneal injection (20mg / kg / dose; 0.8 mg / mL) once on Day -2 and Day -1. P7403PC00

[0845] Results: Genomic DNA (gDNA) from bone marrow collected from mice at 163 ± 4 days postdose showed a highly polyclonal insertion site pattern reflecting the known integration preferences of lentiviral vectors. There was no selection of integrations in proximity to proto-oncogenes after transplantation, and there were no signs of clonal dominance (i.e., none of the integrations contributed with more than 8.62% to the total sequence pool).

[0846] Conclusion: In conclusion, administration of APR-2020 as a single intravenous injection was tolerated in NOD.Cg-Prkdcscid H2rgtm1Wjl / SzJ (NSG) mice at levels of 1.5 x 106 cells / mouse. There were no clinical observations related to APR-2020 in animals surviving to scheduled euthanasia. Changes in hematological parameters observed were related to APR-2020 engraftment. There was a decrease in cholesterol in males and an increase in potassium in females compared to vehicle control animals. Flow cytometry data suggested that administration of APR-2020 induced multilineage hematopoietic reconstitution. Systemic biodistribution of APR-2020 was demonstrated with QPCR with highest detectable concentrations occurring in bone marrow, spleen, and lymph nodes.

[0847] Example 7: Single-Cell-Multiomics Demonstrates Molecular Efficacy of a Clinical Lentiviral Vector for Gene Therapy of RPS19-Deficient Diamond-Blackfan Anemia

[0848] Aim: Elucidate the molecular mechanisms underlying the pathogenesis of Diamond- Blackfan anemia and to evaluate the therapeutic potential of gene therapy for the correction of ribosomal protein gene mutations in RPS19-deficient DBA.

[0849] Material and Methods: Cells from 4 transfusion-dependent DBA patients with identified RPS19 mutation (Table 1) were used to enrich for the mononuclear cell fraction by centrifugation, cells were cryopreserved in a 20 mL bag containing freezing medium (10% DMSO, 1 % Dextran). The bag was quickly thawed in a 37°C water bath, wiped clean with 70% ethanol, and cell suspension (about 20ml) was gently flushed out / diluted off the bag with 200ml of 37°C pre-warmed RPMI supplemented with 20% heat- inactivated FCS (thawing solution). After spinning at 350g, and 4°C for 5 minutes, cells were washed once in MACS buffer (PBS supplemented with 2% of heat-inactivated FCS and 2mM EDTA) and immediately processed for CD34+ cells enrichment with Direct P7403PC00

[0850] CD34 progenitor cell-isolation kit, and according to manufacturer’s protocol (Miltenyi Biotech).

[0851] Anonymized umbilical cord blood samples from healthy donors were collected from full term deliveries at maternity wards of Lund, Malmo and Helsingborg hospitals in Sweden. Mononuclear cells were separated using lymphoprep pre-filled tubes, according to manufacturer’s instructions (Axis-Shield). Cells were washed twice in MACS buffer, and immediately processed once for CD34+ cells purification with Direct CD34 progenitor cell-isolation kit, and according to Manufacturer’s protocol (Miltenyi Biotech, and frozen in RPMI supplemented by 40% heat-inactivated FCS and 10% DMSO. Cells were recovered by pipetting ice cold thawing solution on the frozen cells, and then immediately collecting the cells back into the tube of thawing solution until complete thawing of cell pellet. After spinning at 350g and 4°C for 5 minutes, cells were washed once in PBS.

[0852] CD34+-enriched cells were cultured in expansion medium (Stemspan-AOF medium supplemented with the following recombinant human cytokines: SCF, FLT3-Ligand, and TPO at a final concentration of 100ng / ml, 100ng / ml, and 50ng / ml respectively). After 24hrs, 50000 cells were plated in 100 pl of fresh expansion medium, and lentiviral particles of CLIN-LV-EFS-RPS19-PRE* at target MOI of 120 were added together with lentiboost (Sirion Biotech) at the final concentration at 1mg / ml for another 24 hours.

[0853] Cells were pelleted by a 5 minutes centrifugation at 350g and 4°C and cells were resuspended in erythro-myeloid culture medium. After 7 days, cells were washed by a 5 min centrifugation at 350g and 4°C, and cultured for the remaining of the experiment in erythro-myeloid culture medium. Cells growth was monitored, and cultures were replated at equal concentration, before reaching confluence.

[0854] Cells were collected to 96-Ushaped wells plate, pelleted by a 5 minutes centrifugation at 350g and 4°C, stained with specified antibodies for 30 minutes at 4°C, washed once with, and finally re-suspend in MACS buffer supplemented with dead cells exclusion dye. Data were acquired on BD FACS canto ll / Fortessa / X20 analyzers, and cells were sorted on BD Symphony S6.

[0855] Approximately 10000 cells were spun down on cytospin slides, and fixed with May- Grunwald solution (Sigma Aldrich) for 5 min, transferred for 5 min in distilled H2O (dH2O), stained with Giemsa solution at 1 :20 in distillated H2O (Sigma Aldrich), washed with distillated H2O after 10 minutes, and the slides were air-dried overnight. P7403PC00

[0856] Morphologic characteristics were acquired on an Olympus BX43 microscope (Olympus Corporation, Tokyo, Japan) at 40x magnification.

[0857] Genomic DNA was isolated with DNeasy Blood and Tissue mini kit following manufacturer’s instructions for cultured suspension cells, and quantified with Qubit dsDNA assay. Proviral integration site and human genome were amplified with primerprobe pairs targeting WPRE and PTP2B respectively and with Advanced Mastermix on a Quantstudio 1 (Thermofisher).

[0858] Cells were lysed by adding RLT buffer (supplemented by p-mercaptoethanol), and total RNA were extracted using RNeasy micro kit (Qiagen), following manufacturer’s instructions, including the DNAse incubation. Complementary DNA were prepared with First strand synthesis kit, following manufacturer’s instructions (Thermofisher). WPRE, RPS19, GAPDH and HPRT expression were quantified using Taqman probes and Taqman Gene Expression mastermix and the reactions were run on a Quantstudio 1 (Thermofisher).

[0859] At specified time points, 100000 cells were collected, washed once in MACS buffer, blocked, and stained with a pool of ADT-antibodies, according to instructions from Biolegend’s website, and washed 3 times. After sort for viability to PBS-0,04% BSA into DNA LoBind eppendorfs, cells were spun down, re-suspended at 20000 cells / 50pl of PBS-0,04% BSA, and handed over to CTG core at Lund Stem Cell Center for further processing. Briefly, single cell cDNA and ADT libraries were prepared with Chromium Next GEM Single Cell 3' Kit (v3.1 , 10X Genomics) and sequenced on a NovaSeq 6000 (S1 Reagent Kit v1.5).

[0860] Four mock-treated and GT-treated samples from transfusion-dependent DBA patients and four mock-treated and GT-treated samples from healthy donors pooled by 2-3 donors in a sample were sequenced with single-cell CITE-Seq approach. The raw bcl and fastq data were processed using the CellRanger (v.6.0) pipelines (10x Genomics), comprising demultiplexing and alignment including intronic mapped reads. Custom reference was created on the base of GRCh38 to incorporate coRPS19 transgene into the human transcriptome reference. Scanpy package was used for quality control and initial analysis. Cells with less than 3000 UMIs, cells with less than 12% UMIs derived from the mitochondrial genome, and cell doublets predicted using scrablet tool were removed. Genes expressed in less than 10 cells throughout the dataset were excluded from analysis. Gene counts were normalized per medium cell expression and naturally P7403PC00 log-transformed. The top 5000 highly variable genes were used to denoise the data with principal component analysis. The top 50 principal components were used to create batch-corrected knn-graph, which was used to calculate Uniform Manifold Approximation and Projection (UMAP) and cell clusters. The Leiden community detection algorithm was used to detect cell clusters for further annotation. Cell types were identified on cluster level based on expression of known marker genes and surface protein abundance, and verified by predictions for individual cells obtained from Azimuth and CellTypist models. Final integration and batch correction for the whole dataset was performed with SCVI and SCANVI models from scvi python package.

[0861] Two-sided Wilcoxon rank-sum test was used to identify differentially expressed genes (DEGs). Mock-treated DBA and healthy cells were compared to identify DBA features. Mock-treated and coRPSI 9-positive cells were compared to identify gene therapy induced effects separately for DBA and healthy cells. DEGs with p-value < 0.01 and absolute logFC > 0.15 were selected to identify enriched pathways using Hallmark and GO gene sets from the MSigDB database. GSEA with phenotype permutation (n=1000) and over-representative analysis on the same gene sets were used as alternative approaches. Diffusion pseudotime for erythroid lineage was calculated starting from the root cell defined by maximum expression of KIT gene within erythro-megakaryocyte progenitor cluster. Gene regulatory network (GRN) was calculated using SCENIC tool.

[0862] Results The inventors applied high-throughput single-cell gene expression analysis combined with immunophenotypic profiling (CITE-Seq) (Figure 5A). Activation of p53- pathway, apoptosis and DNA damage response was observed in DBA erythroid cells (Figure 5B). Expression of PHLDA3 and GDF15 in DBA erythroblasts further indicates active DNA damage and death processes in these cells (Figure 5C).

[0863] Several genes had prominent association with DBA phenotype and were consistent across all patients (Figure 5C).

[0864] General enrichment of p53-pathway and apoptosis was found in all mock-treated DBA samples (Figure 5D). Moreover, the inventors identified a set of p53-target genes robustly associated with DBA phenotype across all patients, including upregulation of BAX, MDM2, and RPS27L genes, which was confirmed also in public data (Figure 5D). Pathway analysis in DBA-coRPS19+ vs. mock-treated cells revealed a reversal of changes observed in DBA-mock vs. healthy-mock comparisons (Figure 5E). Pathways related to p53, apoptosis and DNA damage response, which were upregulated in DBA- P7403PC00 mock erythroid cells compared to healthy, were downregulated in coRPSI 9+ DBA compared to mock (Figure 5E). The inventors observed significant changes in the DBA-related genes expression: downregulation of CD70, BAX, MDM2, RPS27L and upregulation of RPL22L1 in DBA- coRPS19+ erythroid cells compared to DBA-mock (Figure 5F-G). Additionally, the expression of genes required for erythroid maturation increased dramatically in coRPS19-corrected DBA cells (Figure 5). The inventors observed a reduced expression of ADA gene in erythroid DBA-coRPS19+ cells compared to DBA-mock (Figure 5H). Additionally, ribosomal synthesis impairment observed in DBA-mock myeloid cells was also corrected in DBA- coRPS19+ myeloid cells (Figure 5).

[0865] Conclusion: Expression of coRPS19 in DBA erythroid progenitor cells led to a significant induction of genes associated with terminal erythropoiesis (HEMGN, HBB, AHSP, EPB42 and GYPA) and down-regulation of genes associated with apoptosis and p53 activation (BAX, MDM2, ZMAT3 and MIR34AHG). GT also induced up-regulation of the large non-coding RNA LINC01133 and down-regulation of XACT. Interestingly, the two most-significantly changed genes in coRPSI 9-positive erythroid cells in all DBA samples were RPL22L1 and CD70. RPL22L1 is an RNA-binding component of the 60S ribosomal subunit that regulates pre-mRNA splicing but is not required for global cap-dependent translation. CD70 mRNA and protein exclusively expressed in erythroid progenitors in Mock- treated DBA samples and down-regulated in coRPSI 9-positive cells. CD70 is thus a new potential marker of DBA erythroid progenitor cells with a possible role in DBA pathogenesis. Myeloid progenitor DBA cells primarily responded to GT by up-regulation of ribosomal protein genes, suggesting RPS19-deficiency in myeloid progenitors leads to reduced ribosome biogenesis without the nucleolar stress observed in erythroid cells.

[0866] To summarize, GT-induced changes in gene and protein expression agree with restoration of healthy ribosome biogenesis and elimination of nucleolar stress-induced p53 activation in erythroid progenitor cells responsible for the DBA phenotype, demonstrating molecular efficacy of CLIN-LV-EFS-coRPS19-PRE* supporting development for clinical gene therapy. In addition, the GT-induced reversal of RPS19- deficiency reveals several genes with potential relevance in DBA diagnostics and pathogenesis, such as RPL22L1 and CD70 for further investigation. P7403PC00

[0867] Example 8: Isolation and transduction process for producing LV-EFS-RPS19- PRE transduced hematopoietic stem and progenitor cells for the treatment of the pediatric orphan disease Diamond Blackfan Anemia

[0868] Aim: To develop a process capable of producing LV-EFS-RPS19-PRE transduced hematopoietic stem and progenitor cells for the treatment of the pediatric orphan disease Diamond Blackfan Anemia.

[0869] Material and methods: To this end, a 3-day CliniMACS Prodigy-based isolation and transduction process using cryopreserved G-CSF mobilized peripheral blood from healthy donors as the starting material was developed (Figure 6).

[0870] During the development runs 1 to 7 (DR, DR01-DR07) the feasibility of isolating and expanding human CD34+ hematopoietic stem and progenitor cells (HSPC) (HSCE program) using the CliniMACS Prodigy® platform was evaluated on cryopreserved G- CSF mobilized peripheral blood (MPB) with three different donors: Donor 1 (#33966) for DR01 and DR05, Donor 2 (#45117) for DR02, DR04 and DR07 and Donor 3 (#46019) for DR03 and DR06, all from AllCells (Table 3). Additionally, DR02-DR07 were transduced with the lentivirus LV-EFS-RPS19-PRE (technical batch) and the transduction process was optimized.

[0871] Table 3: List of Donors, MPB bags, culture and transduction parameters used during each development run.

[0872] P7403PC00 ':Each donor is shown in the graphs with a similar color, for example Donor 1 in fifue (dork and light blue).

[0873] * Two-fold cell concentration during first (two) bourfs) of transduction.

[0874] If a donor was used for a second development run, the composition of the pooled mobilized peripheral blood (MPB) was not identical between the development runs because different numbers of bags from and / or different collection days were used. On Day 1 (D1 , 20-24h after seeding), the transduction was performed using lentivirus with a MOI of 100 in DR02-DR04 and a MOI of 150 in DR05 and the transduction enhancer LentiBOOST® with a concentration of 0.75 mg / mL for DR02 and 1 mg / mL for all other transduction runs. To potentially increase the vector copy number (VON) of DR03- DR05, the volume was reduced by 50% during the first hour of transduction. After that, the volume was increased back to the pre-transduction volume. To further increase the transduction efficacy, the volume reduction was carried out for two hours in DR06 and DR07. On Day 2 (D2, 16-24h after transduction start), the target cells were cryopreserved for DR01-DR06 in vials (a 1.0 mL) in cryomedium (Cryostor CS10 / 5%HSA (50% / 50%)) with a cell concentration of 5.0e6 cells / mL with a controlled-rate freezer (CRF). Additionally, a part of the cell suspension was used for the evaluation of different cryo cell concentrations (between 0.5e6 and 5e6 VNCs / mL) P7403PC00 in the same cryomedium. In DR07 the target cells were cryopreserved with a cell concentration of 1.5e6 VNCs / mL in cryobags (fill volume 10 / 15 / 19 mL).

[0875] Bulk Vector Copy Number by ddPCR

[0876] The bulk VCN provides information on the average distribution of transgene copies per cell within the final product. In the approach presented here, the genomic DNA (gDNA) was extracted from bulk cells, and the total number of viral genome copies (WPRE), as determined by ddPCR, was set in relation to the number of reference gene copies (PTBP2) per diploid genome.

[0877] 5x10A4 viable nucleated cells were used to determine the VCN in DR06 and DR07.

[0878] Transduction Efficiency

[0879] To evaluate the transduction efficiency, transduced cells were counted by encapsulating individual whole cells into oil droplets readable by the ddPCR and amplifying the DNA of the transgene, WPRE, and the reference gene, SOD1 , in a targeted manner within those droplets.

[0880] The development of the transduction efficiency assay was done from scratch. The assay is based on a protocol from the ddPCR machine manufacturer Biorad (https: / / www.bio-rad.com / webroot / web / pdf / lsr / literature / Bulletin_7321.pdf).

[0881] The approach was to use two duplex assay mixes in two separate wells. One mix, called the transduction assay, consisted of the transgene assay WPRE and the reference gene assay SOD1. The second mix, called control assay, consisted of the two reference gene assays SOD1 and RPP30. The number of double positive (WPRE+ / S0D1+) droplets in relation to the number of total SOD1 positive droplets (SOD1+ and WPRE+ / S0D1+) within the transduction assay determined the percentage of transduced cells. In contrast to the triplex approach, there is an increased risk within the duplex assay that the number of SOD1 -positive droplets was influenced by free-floating DNA. Therefore, for each sample, an additional control assay targeting the two reference genes, RPP30 and SOD1 , was used in parallel, to check whether the number of intact cells determined in the control well was > 90%. Within the duplex approach, the double-positive population WPRE+ / S0D1+ was detectable in the transduced samples (data not shown), but the separation to the SOD1 single positive droplets was not clear-cut, resulting in background noise of SOD1 single positive droplets in the double positive population. This background noise could be determined by a negative control (DR01_FP) which was carried along each run. To P7403PC00 keep the background noise as low as possible, different probe concentrations (50 nM - 500 nM) as well as different annealing temperatures (53°C - 56°C) were tested. With the optimized ddPCR parameters of 166 nM for the WPRE probe and an annealing temperature of 53°C, the background noise was reduced to < 5% in the corresponding DR01 control samples (data not shown).

[0882] Since the development of the transduction efficiency assay took place in parallel with the development runs, the routine analysis with the optimized settings was performed only on final product (FP, Cryopreserved CD34+ cells) of DR06 and DR07. The same (new) assay for WPRE (WPRE5) was used as for the VCN analysis (see section above). Those settings have only a minimal effect on the result, namely a reduced background noise, therefore it is still possible to compare the different runs to see any trend in the transduction efficiency

[0883] Results :

[0884] Vector Copy Number and Transduction Efficiency Analysis by ddPCR

[0885] To determine if the transduction within the individual development runs was successful and if the different transduction parameters had an effect on the transduction rate, the bulk vector copy number (VCN) on isolated DNA as well as the transduction efficiency on single-cell level were measured by ddPCR on FP CD34+ cells that have been subcultured for four days.

[0886] While only a mock transduction was performed in DR01 to implement the isolation and culture of CD34+ cells, lentiviral transduction with LV-EFS-RPS19-PRE (technical batch) was performed in DR02- DR07. Within these six runs, the transduction parameters differed according to Table 4.

[0887] Transduction parameters during the different process runs DR01-DR07. P7403PC00

[0888] Leaving aside the possible donor-specific influence on transduction, the bulk VCN increased from 0.4 (DR02) to 0.8 (DR03-DR05) up to ~2 (DR06, DR07) (Figure 7, Table 5. On Day 1 (20-24h after seeding), the transduction was performed using lentivirus with a MOI of 100 in DR02-DR04 and a MOI of 150 in DR05 and the transduction enhancer LentiBOOST® with a concentration of 0.75 mg / mL for DR02 and 1 mg / mL for all other transduction runs. Increasing the MOI from 100 (DR03-DR04) to 150 (DR05) had no significant impact on the VCN. To potentially increase the vector copy number (VCN) of DR03-DR05, the volume was reduced by 50% during the first hour of transduction. After that, the volume was increased back to the pre-transduction volume. To further increase the transduction efficacy, the volume reduction was carried out for two hours in DR06 and DR07 and resulted in a VCN of well over 1.5

[0889] The process could recover 67.9±7.7% of the CD34+ cells present in the thawed leukopaks (data not shown), while the isolated cells did not expand between Day 0 and Day 2. The transduction efficiency parameters were optimized during the development, with the optimized settings being 1 mg / mL Lentiboost, a MOI of 100 and a medium reduction during the first 2 h of the transduction. These settings of the optimized process resulted in a mean transduction efficiency of 51.8% with a mean vector copy number per cell of 1.96. (see Table 5) DR06 and DR07)

[0890] Table 5: Overview of the viable number of cell (VNC) used as input for DNA isolation and the determined total copies of WPRE and PTBP2 within a ddPCR sample for each development run (DR) and the corresponding bulk VCN. The data is based on the WHV_WPRE assay for DR01 - DR05 and WPRE5 assay for DR06 and DR07

[0891] P7403PC00

[0892] Table 6: Transduction efficiency determined by ddPCR. The data is based on the

[0893] WPRE5 assay. The “linkage” column represents the transduction efficiency within the transduction assay and the percentage of encapsulated cells within the control assay.

[0894] P7403PC00

[0895] P7403PC00

[0896] Table 7: Combining ddPCR derived VCN and transduction efficiency datasets

[0897] Conclusions:

[0898] Regarding the established ddPCR-based methods to characterize the transduction step, it could be shown that FP cells were successfully transduced with the lentivector LV-EFS-RPS19-PRE by measuring the bulk VCN and the transduction efficiency on single cell level. It was further shown that the transduction rate could be influenced by implementing a medium reduction step during the first (two) transduction hour(s) (Table 2, transduction parameters), increasing the VCN (Table 3) and the determined transduction efficiency (Table 4). A combination of the two datasets revealed the average VCN per transduced cell, which allows a much better assessment of the risk for mutagenicity in the transduced cells as the bulk VCN alone. In the present case, the average VCN per transduced cell was 3.8 (average of DR06 and DR07, Table 5) with the optimized process parameters. The promoter activity of the integrated lentiviral vector sequence was also shown by analyzing the mRNA level of the regulatory element WPRE. The determined expression rate correlated with the VCN data, i.e. with increasing VCN, the expression rate of WPRE also increased. The implemented CD34+ isolation process recovers slightly more CD34+ cells than stated by the manufacturer (data not shown). Furthermore, the seeding density of 1.0x10A6 VNCs cells / mL could be confirmed as the cell loss in the HSCE process is marginal. The MOI for the transduction was set at 100, and the LentiBOOST® concentration at 1mg / mL. The transduction step was further optimized by reducing the transduction volume by P7403PC00

[0899] 50% for 2h, which lead to a mean transduction efficiency of 51.8% with a mean bulk VCN per cell of 1.96.

[0900] Example 9: Molecular Efficacy of a Clinical Lentiviral Vector for Gene Therapy of RPS19-Deficient Diamond-Blackfan Anemia

[0901] Material and methods:

[0902] The material and methods are as described previously in Example 7 herein.

[0903] Results:

[0904] Table 8. Transduction settings and coRPSI 9-positive early progenitor cells (LMPP) and cells developed into myeloid and erythroid lineages for each sample_first part. P7403PC00

[0905] Table 9: Transduction settings and coRPSI 9-positive early progenitor cells (LMPP) and cells developed into myeloid and erythroid lineages for each sample_second part. Results of this Example are presented in Figures 9-25.

[0906] Conclusions:

[0907] The data shows that in patient cells, CLIN-LV-EFS-coRPS19-PRE* can correct the pathogenic DBA gene expresson profile and leads to its normalization compared to healthy individuals (Figs. 9-25).

[0908] By looking at different expression levels of the transgenes, the inventors also shown that already at detectable levels of the transgene (Fig. 17N) the pathogenic DBA gene expression is corrected.

[0909] Further, the inventors have identified several genes which can be used as biomarkers of the efficacy due to their correlation with the disease and / or its correction. ADA for example is rescued by the CLIN-LV-EFS-coRPS19-PRE* treatment and shown here as a relevant predictive biomarker of efficacy. The cell surface marker CD70’s expression is shown to be reduced in treated cells and efficacy can be followed by flow cytometry P7403PC00 of the treated cells for this marker. Further BAX is shown to correlate with efficacy in the treatment (Figs. 11-23).

[0910] The data further also shows that the main pathways that are activated in DBA, apoptosis and p53 activation are reversed by the treatment (Fig. 25).

[0911] Example 10: Generation and comparison of vectors

[0912] Aim:

[0913] Lentiviral vectors were developed to express both codon-optimized and non-codon- optimized RPS19 cDNAs under the control of the EFS and PGK promoters. Further, lentiviral vectors were developed to express both codon-optimized and non-codon- optimized cDNAs of RPL11, RPL5, RPS10, RPS17, RPS24, RPS26, and RPL35a . Further, vector variants were compared.

[0914] Material and Methods:

[0915] Vector plasmid variants (see below) were packaged into vi...

Claims

1. P7403PC00Claims1. A construct which, upon expression, encodes: i. the RPS19 polypeptide sequence of SEQ ID. NO.: 1 , and wherein said construct comprises the codon-optimized RPS19 (coRPS19) polynucleotide sequence of SEQ ID NO: 18 or SEQ ID NO: 19 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 18 or SEQ ID NO: 19; ii. the RPS17 polypeptide sequence of SEQ ID NO: 2, SEQ ID NO. 3, SEQ ID NO. 4, or SEQ ID NO. 5, and wherein said construct comprises the codon-optimized RPS17 (coRPS17) polynucleotide sequence of SEQ ID NO: 37 encoding RPS17, or a sequence having at least 90% identity to SEQ ID NO: 37; iii. the RPS24 polypeptide sequence of SEQ ID NO: 7, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 9 or SEQ ID NO. 10, and wherein said construct comprises the codon-optimized RPS24 (coRPS24) polynucleotide sequence of SEQ ID NO: 38 encoding RPS24, or a sequence having at least 90% identity to SEQ ID NO: 38; iv. the RPS10 polypeptide sequence of SEQ ID NO: 11, and wherein said construct comprises the codon-optimized RPS10 (coRPSIO) polynucleotide sequence of SEQ ID NO: 39 encoding RPS10, or a sequence having at least 90% identity to SEQ ID NO: 39; v. the RPL35A polypeptide sequence of SEQ ID NO: 12, and wherein said construct comprises the codon-optimized RPL35a (coRPL35a) polynucleotide sequence of SEQ ID NO: 40 encoding RPL35a, or a sequence having at least 90% identity to SEQ ID NO: 40; vi. the RPL11 polypeptide sequence of SEQ ID NO: 13 or SEQ ID NO. 14, and wherein said construct comprises the codon-optimized RPL11 (coRPLI ) polynucleotide sequence of SEQ ID NO: 41 encoding RPL11 , or a sequence having at least 90% identity to SEQ ID NO: 41 ; vii. the RPS26 polypeptide sequence of SEQ ID NO: 15, and wherein said construct comprises the codon-optimized RPS26 (coRPS26) polynucleotide sequence of SEQ ID NO: 42 encoding RPS26, or a sequence having at least 90% identity to SEQ ID NO: 42; or,P7403PC00 viii. the RPL5 polypeptide sequence of SEQ ID NO: 44 or SEQ ID NO. 16, and wherein said construct comprises the codon-optimized RPL5 (coRPL5) polynucleotide sequence of SEQ ID NO: 43 encoding RPL5, or a sequence having at least 90% identity to SEQ ID NO: 43.

2. The construct according to claim 1 , wherein the polypeptide sequence has at least 70%, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10, SEQ ID NO. 11, SEQ ID NO. 12, SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15, SEQ ID NO. 44, or SEQ ID NO. 16.

3. The construct according to any one of the preceding claims, further comprising the Kozak sequence of sequence SEQ. ID. NO.: 47 or a sequence having at least 90% identity to SEQ ID. NO 47, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID NO: 47.

4. The construct according to any one of the preceding claims, further comprising a promoter region capable of controlling the transcription of the polynucleotide encoding the polypeptide selected from the group consisting of: RPS19 (SEQ ID NO. 1), RPS17 (SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, or SEQ ID NO. 5), RPS24 (SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 9, SEQ ID NO. 10), RPS10 (SEQ ID NO. 11), RPL35a (SEQ ID NO. 12), RPL11 (SEQ ID NO. 13, SEQ ID NO. 14), RPS26 (SEQ ID NO. 15), and RPL5 (SEQ ID NO. 44, SEQ ID NO. 16), wherein the promoter region comprises or consists of an EF-1 alpha short (EF1as) promoter, a spleen focus-forming virus (SFFV) promoter, an EF-1 alpha (EF-1 a) promoter, an EF-1 alpha with intron (EF1 i) promoter, a phosphoglycerate kinase (PGK) promoter, a cytomegalovirus (CMV) promoter, a MND (myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer-binding site substituted) promoter, aP7403PC00 ubiquitin C (UbC) promoter, or a CAG (CMV early enhancer / chicken p actin) promoter, preferably wherein the promoter region comprises or consists of an EF-1 alpha short (EF1as) promoter.

5. The construct according to any one of the preceding claims, wherein: a. the EF1as promoter comprises or consists of the polynucleotide of SEQ ID NO. 27, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 27. b. the SFFV promoter comprises or consists of the polynucleotide of SEQ ID NO. 28, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 28.

6. The construct according to any one of the preceding claims, further comprising a post-transcriptional regulatory element (PRE).

7. The construct according to any one of the preceding claims, wherein the PRE is a safety optimized PRE comprising or consisting of the polynucleotide of SEQ ID NO. 29, or a sequence having at least 90% identity to SEQ ID. NO 29, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 29.

8. A vector comprising the construct according to any one of the preceding claims.

9. The vector according to claim 8, wherein the vector is a lentiviral vector, such as a self-inactivating (SIN) lentiviral vector, such as a 3’ U3-deleted lentiviral vector.P7403PC0010. The vector according to any one of claims 8 to 9, wherein said vector’s backbone is a pCCL backbone, a pCLL backbone, a pRRL backbone, a pRLL backbone, a pLL backbone, a pLenti backbone, a pLKO backbone, a pLPC backbone, a pHR backbone, or a pTRIP backbone, preferably a pCCL backbone.11 . The vector according to any one of claims 8 to 10, wherein said vector comprises or consists of the polynucleotide of SEQ ID NO. 36, SEQ ID NO. 51 , SEQ ID NO. 52, SEQ ID NO. 53, SEQ ID NO. 54, SEQ ID NO. 55, SEQ ID NO. 56 or SEQ ID NO. 57, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 36, SEQ ID NO. 51 , SEQ ID NO. 52, SEQ ID NO. 53, SEQ ID NO.54, SEQ ID NO. 55, SEQ ID NO. 56 or SEQ ID NO. 57.

12. A method of manufacturing a transfer vector, said method comprising the steps of: a. providing the construct according to any one of claims 1 to 7; and b. inserting the construct into a transfer vector backbone.

13. The method according to claim 12, wherein the transfer vector is the vector described in any one of claims 8 to 11 .

14. A method of manufacturing a lentiviral vector, said method comprising a step of transfecting a host cell with the vector of any one of claims 8 to 11.

15. A method of manufacturing a cell expressing a ribosomal protein gene, said method comprising the steps of: a. Providing a cell; and b. T ransducing said cell with the vector of any one of claims 8 to 11 , thereby obtaining a cell expressing a ribosomal protein gene.

16. The method according to claim 15, wherein the cell of step a. is selected from a CD34+ cell, a CD34+ stem cell, a CD34+ hematopoietic progenitor cell, aP7403PC00 hematopoietic stem and progenitor cell (HSPC), hematopoietic cell, a hematopoietic progenitor cell, a stem cell, a hematopoietic stem cell, a peripheral blood stem cell, an umbilical cord blood stem cell, a bone marrow stem cell, a lymphoid progenitor cell, an erythroid progenitor cell, a Burstforming unit-erythroid (BFLI-E) progenitors or Colony-forming unit-erythroid (CFLI-E) progenitor, preferably a CD34+ cell.

17. A cell obtained by the method according to any one of claims 15 to 16.

18. A cell comprising in its genome:- the codon-optimized RPS19 (coRPS19) polynucleotide sequence of SEQID. NO 18 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 18, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 18;- the codon-optimized RPS19 (coRPS19) polynucleotide sequence of SEQID. NO 19 encoding RPS19, or a sequence having at least 90% identity to SEQ ID. NO 19, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 19;- a codon-optimized RPS17 (coRPS17) polynucleotide sequence, preferably wherein coRPS17 polynucleotide sequence is of SEQ ID. NO 37, or a sequence having at least 90% identity to SEQ ID. NO 37, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 37;- a codon-optimized RPS24 (coRPS24) polynucleotide sequence, preferably wherein the coRPS24 polynucleotide sequence is of SEQ ID. NO 38, or a sequence having at least 90% identity to SEQ ID. NO 38, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as atP7403PC00 least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 38;- a codon-optimized RPS10 coRPSIO) polynucleotide sequence, preferably wherein the coRPSIO polynucleotide sequence is of SEQ ID. NO 39, or a sequence having at least 90% identity to SEQ ID. NO 39, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 39;- a codon-optimized RPL35a (coRPL35a) polynucleotide sequence, preferably wherein the coRPL35a polynucleotide sequence is of SEQ ID. NO 40, or a sequence having at least 90% identity to SEQ ID. NO 40, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 40;- a codon-optimized RPL11 (coRPL11) polynucleotide sequence, preferably wherein the coRPL11 polynucleotide sequence is of SEQ ID. NO 41 , or a sequence having at least 90% identity to SEQ ID. NO 41 , such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 41 ;- a codon-optimized RPS26 (coRPS26) polynucleotide sequence, preferably wherein the coRPS26 polynucleotide sequence is of SEQ ID. NO 42, or a sequence having at least 90% identity to SEQ ID. NO 42, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 42.; or,- a codon-optimized RPL5 (coRPL5) polynucleotide sequence, preferably wherein the coRPL5 polynucleotide sequence is of SEQ ID. NO 43, or a sequence having at least 90% identity to SEQ ID. NO 43, such as at least 91 %, such as at least 92%, such as at least 93%, such as at leastP7403PC0094%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identity to SEQ ID. NO 43.

19. A composition comprising a sterile dispersion of the cells according to anyone of claims 17 to 18.

20. A pharmaceutical composition comprising the construct, the vector, the host cell, the lentiviral vector, the cell, or the composition according to any one of the preceding claims, and a pharmaceutically acceptable diluent or carrier.

21. The construct, the vector, the lentiviral vector, the cell, the composition, or the pharmaceutical composition according to any one of the preceding claims for use in medicine.

22. The construct, the vector, the lentiviral vector, the cell, the composition, or the pharmaceutical composition according to any one of the preceding claims, for use in treating Diamond-Blackfan anemia (DBA).

23. A method of assessing a response in a subject suffering from DBA receiving or having received RPS19, RPS17, RPS24, RPS10, RPL35a, RPL11 , RPS26, or RPL5-based gene therapy, wherein the RPS19, RPS17, RPS24, RPS10, RPL35a, RPL11 , RPS26, or RPL5-based gene therapy comprises the construct, the vector, the host cell, the lentiviral vector, the cell, the composition, the pharmaceutical composition, the method or the use according to any one of the preceding claims, said method comprising the steps of: a. Determining the values of one or more markers selected from the group consisting of: P53, CD70, BAX, RPS27L.RPL22L1 , and ADA in said subject after administration of the RPS19, RPS17, RPS24, RPS10, RPL35a, RPL11 , RPS26, or RPL5-based gene therapy; and b. Comparing said values with reference values of the one or more markers; and c. Assessing said response in said subject based on a comparison made in said comparing step,P7403PC00 wherein a downregulation of the levels of CD70, BAX, RPS27L, or ADA, and / or an upregulation of the levels of RPL22L1 compared to the reference values is indicative of a response.

24. The composition according to any one of the preceding claims wherein said composition is for infusion.

25. A method for autologous gene therapy in a subject suffering from or suspected suffering from Diamond-Blackfan Anemia (DBA), the method comprising the steps of:(a) mobilizing hematopoietic stem and progenitor cells (HSPCs) from the bone marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor;(b) performing apheresis for collecting CD34+HSPCs;(c) manufacturing a gene therapy product by genetic modification of the collected CD34+HSPCs ex vivo to express a functional transgene of RPS 19, RPS17, RPS24, RPS10, RPL35A, RPL11 , RPS26 or RPL5, wherein the genetic modification is performed by transducing the CD34+ HSPCs with the vector according to any one of claims 8 to 11 , thereby obtaining the gene therapy product;(d) conditioning the subject by one of the following options i. performing non-genotoxic conditioning by performing a further mobilization of HSPCs from the bone marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor, and collecting CD34+HSPCs via apheresis; or ii. performing genotoxic conditioning by administering a genotoxic conditioning regimen comprising busulfan to the subject;(e) administering the gene therapy product comprising genetically modified CD34+HSPCs to the subject via infusion.

26. The method according to claim 25, wherein the conditioning creates bone marrow space for engraftment of the gene therapy product.P7403PC0027. The method according to any one of claims 25 to 26, wherein a step of cell selection and / or cell purification is performed after step (b) and / or step (d) i., such as magnetic-activated cell sorting (MACS).

28. The method according to any one of claims 25 to 27, wherein option i. in step (d) enables engraftment of the gene therapy product and therapeutic efficacy in the absence of genotoxic conditioning agents.

29. The method according to any one of claims 25 to 28, wherein the granulocyte colony-stimulating factor is administered at a daily dose of 5 pg / kg subcutaneously.

30. The method according to any one of claims 25 to 29, wherein plerixafore is administered at a daily dose of 0.24 mg / kg.

31. The method according to any one of claims 25 to 30, wherein the granulocyte colony-stimulating factor is administered for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days, preferably for 8 days.

32. The method according to any one of claims 25 to 31 , wherein plerixafor is administered for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 days, preferably for 4 days.

33. The method according to any one of claims claims 25 to 32, wherein the gene therapy product is administered no later than 48 hours after apheresis in step d) option i., such as wherein the gene therapy product is administered 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours,19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 25 hours, 26 hours,27 hours, 28 hours, 29 hours, 30 hours, 31 hours, 32 hours, 33 hours, 34 hours,35 hours, 36 hours, 37 hours, 38 hours, 39 hours, 40 hours, 41 hours, 42 hours,43 hours, 44 hours, 45 hours, 46 hours, 47 hours, 48 hours after apheresis.

34. A method for autologous gene therapy in a subject suffering from or suspected suffering from an inherited bone marrow failure syndrome (IBMFS), the methodP7403PC00 comprising the steps of:(a) mobilizing hematopoietic stem and progenitor cells (HSPCs) from the bone marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor;(b) performing apheresis for collecting a cell population;(c) manufacturing a gene therapy product by genetic modification of the collected cell population ex vivo to express a functional transgene, thereby obtaining the gene therapy product;(d) conditioning the subject by one of the following options v. performing non-genotoxic conditioning by performing a further mobilization of HSPCs from the bone marrow to the blood of the subject using a granulocyte colony-stimulating factor, such as filgrastim, and plerixafor, and collecting a further cell population via apheresis; or vi. performing genotoxic conditioning by administering a genotoxic conditioning regimen comprising busulfan to the subject;(e) administering the gene therapy product comprising the genetically modified cell population to the subject via infusion.

35. The method according to claim 34, wherein the cell population and / or the further cell population and / or the genetically modified cell population comprises or consists of CD34+HSPCs.

36. The method according to any one of claims 34 to 35, wherein the IBMFS is Fanconi Anemia, Shwachman-Diamond Syndrome or Congenital Amegakaryocytic Thrombocytopenia.

37. The method according to any one of claims 34 to 36, wherein the conditioning creates bone marrow space for engraftment of the gene therapy product.

38. The method according to any one of claims 34 to 37, wherein a step of cell selection and / or cell purification is performed after step (b) and / or step (d) i., such as magnetic-activated cell sorting (MACS).P7403PC0039. The method according to any one of claims 34 to 38, wherein option i. in step (d) enables engraftment of the gene therapy product and therapeutic efficacy in the absence of genotoxic conditioning agents.

40. The method according to any one of claims 34 to 39, wherein the granulocyte colony-stimulating factor is administered at a daily dose of 5 pg / kg subcutaneously.

41. The method according to any one of claims 34 to 40, wherein plerixafore is administered at a daily dose of 0.24 mg / kg.

42. The method according to any one of claims 34 to 41 , wherein the granulocyte colony-stimulating factor is administered for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days, preferably for 8 days.

43. The method according to any one of claims 34 to 42, wherein plerixafor is administered for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19 or 20 days, preferably for 4 days.

44. The method according to any one of claims claims 34 to 43, wherein the gene therapy product is administered no later than 48 hours after apheresis in step d) option i., such as wherein the gene therapy product is administered 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours,19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 25 hours, 26 hours,27 hours, 28 hours, 29 hours, 30 hours, 31 hours, 32 hours, 33 hours, 34 hours,35 hours, 36 hours, 37 hours, 38 hours, 39 hours, 40 hours, 41 hours, 42 hours,43 hours, 44 hours, 45 hours, 46 hours, 47 hours, 48 hours after apheresis.

Citation Information

Patent Citations

  • Modified polynucleotides for production of proteins associated with human disease

    JP2019054813A

  • Lentiviral vectors and uses thereof

    WO2022238595A1