Bioelectric characterization of senescing human keratinocytes

By measuring cell senescence through membrane voltage patterns and biomarkers, the methods effectively detect and monitor senescence progression, facilitating personalized health interventions and treatments.

WO2026080749A1PCT designated stage Publication Date: 2026-04-16TRUSTEES OF TUFTS COLLEGE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2025/050333
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2025-03-17
Filing Date
2025-10-09
Publication Date
2026-04-16

AI Technical Summary

Technical Problem

There is a need for methods to quickly detect and monitor the progression of cell senescence, and identify treatments to counter its effects, which are associated with aging and age-related diseases.

Method used

Measuring cell senescence through membrane voltage patterns using voltage-sensitive dyes and analyzing clustering and voltage intensity, combined with biomarker analysis, to determine senescence levels and relative age differences.

Benefits of technology

Provides a comprehensive understanding of senescence levels and age-related changes, enabling personalized health regimens and effective treatments to slow down or reverse senescence-related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025050333_16042026_PF_FP_ABST
    Figure US2025050333_16042026_PF_FP_ABST
Patent Text Reader

Abstract

Systems and methods for measuring cell senescence are provided herein.
Need to check novelty before this filing date? Find Prior Art

Description

T002873 166118.01575BIOELECTRIC CHARACTERIZATION OF SENESCING HUMAN KERATINOCYTESCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. Provisional Application No. 63 / 705,362, filed on October 9, 2024, and U.S. Provisional Application No. 63 / 773,295, filed on March 17, 2025, each of which is incorporated herein by reference in its entirety for all purposes.SEQUENCE LISTING

[0002] A sequence listing (file name: 166118_01575.xml; size: (2,857 bytes; date generated: October 9, 2025) is hereby incorporated by reference in its entirety.BACKGROUND

[0003] Cell senescence is a deterioration of cell function associated with aging and age- related diseases. There exists a need for measuring cell senescence, monitoring progression of cell senescence, and identifying treatments to counter cell senescence.SUMMARY

[0004] Disclosed herein are methods and systems for measuring cell senescence.

[0005] In one aspect, methods and systems for measuring cell senescence are provided. In some embodiments, the method includes: providing a plurality of cells; measuring a membrane voltage pattern of the plurality of cells; calculating a degree of clustering of the membrane voltage pattern; and determining a level of senescence of the plurality of cells based on the degree of clustering. In some embodiments, the method includes: providing a plurality of cells; measuring a membrane voltage of the plurality of cells and determining a first level of senescence based on the membrane voltage; and measuring a membrane voltage pattern of the plurality of cells, calculating a degree of clustering of the membrane voltage pattern, and determining a second level of senescence based on the degree of clustering

[0006] In another aspect, methods and systems for determining a relative age of a test subject compared to a control subject are provided. The method may include: obtaining a sample of the tissue collected from the test subject; measuring the level of senescence of the tissue sample from the test subject using the methods of any one of the disclosed methods; comparing1QB\166118.01575'98919900.1T002873166118.01575 the level of senescence of the tissue sample from the test subject to a level of senescence of a tissue sample from the control subject to determine a relative level of senescence between the tissue sample from the test subject and the tissue sample from the control subject; and relating the relative level of senescence to the relative age of the tissue of the test subject.

[0007] In another aspect, methods and systems for comparing a relative age difference between two tissues in a subject are provided. The method may include: obtaining a sample of a tissue from a first tissue and a sample of a tissue from a second tissues; measuring the level of senescence of the first tissue sample and the second tissue sample using the methods of any one of the disclosed methods; comparing the level of senescence of the first sample to the level of senescence of the second sample to determine a relative level of senescence between the first and second samples; and relating the relative level of senescence to the relative age difference between the first and second samples.

[0008] In another aspect, methods and systems of monitoring a level of senescence in a subject are provided. The methods may include: (a) measuring a first level of senescence of a patient at an initial time using the methods of any one of the disclosed methods; (b) measuring a later level of senescence of a patient at a later time using the method used in step (a); and (c) comparing the first level of senescence and later level of senescence. In some embodiments, the method may be used to monitor the effect of a treatment on a subject. In such embodiments, a treatment is administered to a subject, and the effect of the treatment is monitored using the method above.

[0009] In another aspect, methods of determining a personalized health regimen are provided. The method may include completing at least one of (a) screening for the effect of a plurality of bioactive compounds using the method of any one of relevant methods described herein, or (b) monitoring the effect of a treatment using any one of the relevant methods described herein; and providing a report that identifies personalized recommendations for the personalized health regimen based on steps (a) and (b).

[0010] In another aspect, methods of treating a subject are provided. The methods include determining a level of senescence in the subject using any one of the methods or systems disclosed herein; and administering a beneficial treatment to the subject based on the determined level of senescence.2QB\166118.01575'98919900.1T002873166118.01575BRIEF DESCRIPTION OF THE DRAWINGS

[0011] FIGS. 1A-1B show that control dye VF2.0 reveals concentration dependent spatial artifacts. Keratinocytes at 20-days of culture were stained with 600 nM or 50 nM VF2.0 for 30-minutes in a humidified incubator at 37°C and 5% CO2, washed twice with PBS and then given fresh keratinocyte media. Fluorescence Lifetime Imaging was performed with the Leica SP8 Confocal microscope. The collected FLIM images were fitted with biexponential decay curve in the Leica suit, thresholded to remove background, and exported as ‘.Tif files for further analysis. Using a 15 x 15 pixels ROI was used to scan the image and generate an excel file containing ‘X’, ‘Y’ , and ‘Lifetime’ for rois above 100% ‘ON’ pixels. To control for differences in cell number, we subsampled our data (1000 cells) with 10 iterations which was then averaged. (FIG. 1A) Violin plot showing high spatial Moran’s I of 0.50 in keratinocytes stained with 600 nM; however, reducing concentration to 50 nM resulted in a Moran’s I of 0.04 (p< 0.001, n= 3 replicates). (FIG. IB) Representative images showing artifactual clustering.

[0012] FIGS. 2A-2D show aged human epidermal keratinocytes depolarize, exhibit increased inter- and reduced intra-culture Vmem heterogeneity. Human epidermal keratinocytes were cultured onto flat-bottom 96-well plate 24-hours prior to imaging. Cells were loaded with 600 nM BeRST in Keratinocyte Media for 30-minutes in humidified incubator at 37°C and 5% CO2, then washed twice with PBS and kept in fresh Keratinocyte Media for imaging with the Leica SP8 Confocal microscope. (FIG. 2A) Human epidermal keratinocytes became significantly depolarized at day 40 and 50 (n=6 biological replicates, p<0.05 and p<0.001, respectively)). (FIG. 2B) The calculated standard deviation of each biological replicate shows increased variability between replicates. (FIG. 2C) The average standard deviation within each biological e.g., within a single dish, was calculated by averaging the standard deviation in each age group. This analysis revealed that variability within a single cell culture significantly decreases with age. (FIG. 2D) Representative FLIM Images of BeRST stained Keratinocytes.

[0013] FIGS. 3A-3C show senescent human epidermal keratinocytes exhibit reduced responsiveness and resilience. Human Epidermal Keratinocytes cultured in 96-well plate were stained with 600 nM BeRST and kept in a humidified incubator (37°C; 5% CO2) for 30-minutes and washed twice with PBS prior to imaging with the Leica SP8 Confocal Microscope. Keratinocytes were initially imaged to establish pre-treatment baseline, then given fresh media containing 10 pM Pinacidil just prior to imaging. Percentage change in the Fluorescence3QB\166118.01575'98919900.1T002873166118.01575Lifetime of BeRST was calculated by subtracting and dividing post-treatment values by pretreatment average value. (FIG. 3A) Treatment with Pinacidil revealed significant increase in responsiveness at 30-days (p<0.05, n=3 biological replicates), and significant decrease in responsiveness at 40 and 50-days (p< 0.0001; n=8). (FIG. 3B) The timeseries variability of 50- day old cells, measured by the standard deviation, was significantly larger than younger cells. (FIG. 3C) Average Timeseries of each age group shows that younger cells (Day 10 - 40) hyperpolarize when exposed to pinacidil and exhibit a relatively stable oscillation of Vmcm. However, 50-day old cells immediately undergo depolarization followed by hyperpolarization and a return towards depolarization.

[0014] FIGS. 4A-4D show spatial organization and clustering is significantly reduced in older keratinocytes. Human Epidermal Keratinocytes were stained with the Vmem dye, Vf2.1 (50 nM) for 30-minutes in a humidified incubator at 37°C and 5% CO2, then washed twice with PBS and given fresh keratinocyte media. Fluorescence Lifetime Imaging was performed with the Leica SP8 Confocal microscope. The collected FLIM images were fitted with biexponential decay curve in the Leica suit, thresholded to remove background, and exported as ‘.Tif’ files for further analysis. Using a 15 x 15 pixel ROI was used to scan the image and generate an excel file containing ‘X’, ‘Y’ , and ‘Lifetime’ for rois above 100% ‘ON’ pixels’. To determine the appropriate ‘k’ value, i.e. number of clusters, for the Moran’s I calculation, we initially ran an elbow test to trial k values from 1 - 10 and determined the elbow of the curve to be at k=3. To control for differences in cell number, we subsampled our data (1000 cells) with 10 iterations which was then averaged. (FIG. 4A) Results revealed significant reduction in Moran’s I in 40- (p=0.0011, n=7 biological replicates) and 50-day (p=0.0005, n=10 biological replicates) old cells compared to 10-day old cells (n=10 biological replicates). (FIG. 4B) Moran’s I scatter plots generated by plotting the Lifetime against spatial lag Lifetime shows localization of points in the top right comer of the quadrant, revealing a positive spatial correlation. This correlation appeared strongest in the 10-day old cells (r2=0.58) and significantly reduced by day 40 and 50 (r2=0.02, and r2=0.08, respectively). (FIG. 4C) Representative images mapping distribution of local Moran’s I reveal significantly more distinct clustering in younger cells, and a progressive decrease in size and distribution with age. Red points represents distinct clusters relative to the bulk population, whereas blue points represents non-significant clustering. (FIG. 4D) Representative BeRST FLIM images.4QB\166118.01575'98919900.1T002873166118.01575

[0015] FIGS. 5A-5D show hyperpolarizing reduces while depolarizing keratinocytes increases senescence phenotypes. Keratinocytes 30-days old were either cultured in control mediate, media containing 10 pM Pinacidil, or 25 mM potassium gluconate for 6 days. Media was replaced every second day; after the sixth day, all groups were given fresh control media. On day 8, cells were stained with BeRST and Hoechst 33432, then imaged using the Leica SP8 confocal microscope. (FIG. 5A) Treatment with Pinacidil (10 pM) resulted in almost three-fold increase in cell number (p<0.0001, n=18 biological replicates) compared to the control group. Conversely, treatment with potassium gluconate resulted in significant reduction in cel number (p<0.05, n=24 biological replicates). (FIG. 5B) The PGal / nuclei signal significantly increased in cells treated with potassium gluconate (n=6 biological replicates) compared to control cells (p<0.001, n=12 biological replicates). Pinacidil treated cells did not exhibit a significant reduction when compared to control group; however, compared to the potassium gluconate group, pinacidil treated cells had a significantly lower pGal / nuc signal. (FIG. 5C) Chromatin condensation levels of depolarized was significantly higher, while hyperpolarized cells exhibited significantly reduced compaction. (FIG. 5D) Representative images of (i) Hoechst nuclei, (ii) processed images of Hoechst nuclei for CCP computation, and (iii) pGal levels.

[0016] FIGS. 6A-6B show hyperpolarizing keratinocytes maintains cellular responsiveness. Keratinocytes at 30-days of culture were grown for an additional 6 days in either control media, media containing Pinacidil or potassium gluconate (+ 25 mM). They were then given fresh control media and grown for another two days, then stained with 600 nM BeRST and 1 pM Hoechst 33432 prior to imaging. Keratinocytes (FIG. 6A) The percentage change in BeRST lifetime was significantly higher in Pinacidil treated cells compared to control (p<0.01, control n=4 biological replicates, Pinacidil n=3 biological replicates). Treatment with potassium gluconate appeared to decrease the level of responsiveness; however, this was not significantly different than control cells. (FIG. 6B) Average timeseries of each group reveals control cells appeared to oscillate near 0%, whereas, potassium gluconate treated cells, progressively became hyperpolarized. Notably, pinacidil treated cells progressively depolarized over time.

[0017] FIGS. 7A-7D show depolarization of keratinocytes leads to loss of spatial organization and clustering. Keratinocytes at 30-days of culture were grown for an additional 6 days in either control media, media containing Pinacidil or potassium gluconate (+ 25 mM). They were then given fresh control media and grown for another two days, then immediately5QB\166118.01575'98919900.1T002873166118.01575 prior to imaging, cells were stained with 50 nM VF2.1 and 1 pM Hoechst 33342 for 30-minutes in a humidified incubator at 37°C and 5% CO2, washed twice with PBS and then given fresh keratinocyte media. Fluorescence Lifetime Imaging was performed with the Leica SP8 Confocal microscope. The collected FLIM images were fitted with biexponential decay curve in the Leica suit, thresholded to remove background, and exported as ‘.Tif’ files for further analysis. Using a 15 x 15 pixels ROI was used to scan the image and generate an excel file containing ‘X’, ‘Y’, and ‘Lifetime’ for ROIs above 100% ‘ON’ pixels. To determine the appropriate ‘k’ value, i.e. number of clusters, for the Moran’s I calculation, we initially ran an elbow test to trial k values from 1 - 10 and determined the elbow of the curve to be at k=3. To control for differences in cell number, we subsampled our data (1000 cells) with 10 iterations which was then averaged. (FIG. 7A) Pre-treatment with Pinacidil did not result in a significant change; however, potassium gluconate treatment significantly reduced Moran’s I from 0.63 to 0.26 (p<0.01, control n=4 biological replicates, potassium gluconate n=4 biological replicates). (FIG. 7B) Scatter plot of Lifetime vs spatial lag Lifetime also revealed a more random distribution of points, consistent with reduced spatial autocorrelation. (FIG. 7C) Local Moran computation shows reduction in size and distribution of distinct clusters in potassium gluconate pre-treated cells. (FIG. 7D) representative images of VF2.1 stained cells showing corresponding clusters.

[0018] FIGS. 8A-8C show aging biomarkers significantly increases in 50-day keratinocyte cultures. Human epidermal keratinocytes thawed 7-days prior were plated in 6-well plate and 96-well for p 16 mRNA expression, and senescence associated P-galactosidase and Chromatin condensation level characterization, respectively. (FIG. 8A) Results from RT-qPCR were normalized to 10-day old cells and revealed a two-fold increase in p!6 expression in 50-day old cells (p<0.05, n=4 biological replicates). (FIG. 8B) SA-P-Gal staining was quantified by calculating the integrated density of inverted-stain images in Image!, normalized to the number of nuclei per field. Results showed a 9.8-fold increase in 50-day cultures compared to 10-day cultures (p < 0.0001, n = 6 biological replicates). (FIG. 8C) Chromatin condensation was assessed using the chromatin condensation parameter (CCP), a metric that quantifies intranuclear edge density in Hoechst-stained images. CCP serves as a proxy for detecting senescence- associated heterochromatin foci (SAHFs). 50-day cultures exhibited the highest CCP values, indicating increased chromatin compaction (0.001 <p < 0.05, n = 6 biological replicates). (FIG.6QB\166118.01575'98919900.1T002873 166118.015758D) Representative images of (i) SA-P-galactosidase-stained Keratinocyte and (ii) Hoechst dye and (iii) CCP images showing 50-day old cells with highest number of intra-nuclear edges.

[0019] FIG. 9 shows an example process of measuring cell senescence in accordance with some embodiments of the disclosure.

[0020] FIG. 10 shows an example system in accordance with some embodiments of the disclosure.DETAILED DESCRIPTION

[0021] The disclosures of any these patents, patent applications, and publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art as known to those skilled therein as of the date of the invention described and claimed herein. The instant disclosure will govern in the instance that there is any inconsistency between the patents, patent applications, and publications and this disclosure.

[0022] Before any embodiments of the disclosure are explained in detail, it is to be understood that the disclosure is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the following drawings. The disclosure is capable of other embodiments and of being practiced or of being carried out in various ways.

[0023] It is to be understood that the phraseology and terminology used herein is for the purpose of description and should not be regarded as limiting. The use of “including,” “comprising,” or “having” and variations thereof herein is meant to encompass the items listed thereafter and equivalents thereof as well as additional items.

[0024] In accordance with some embodiments of the disclosed subject matter, mechanisms (which can include, for example, systems and methods) for measuring cell senescence are described herein.

[0025] Cell senescence can be described as deterioration in cellular function due to aging, and is associated with age-associated diseases such as dementia, heart disease, type 2 diabetes, osteoarthritis, kidney disease, macular degeneration, and dysregulation of the immune system. There is an unmet need for methods to quickly detect a level of senescence in a subject.7QB\166118.01575'98919900.1T002873 166118.01575Further, there is an unmet need for methods to monitor the progression of senescence, and identify treatments for senescence.

[0026] Measuring senescence

[0027] Measuring cell senescence using membrane voltage patterns

[0028] Methods and systems of measuring cell senescence are disclosed herein. Throughout the application, “cell senescence” is used interchangeably with “senescence.” As described in further detail in the Examples, cell senescence is associated with specific membrane voltage (Vmem) values and patterns of behavior. Therefore, characterizing membrane voltages of a sample of cells can be used to measure cell senescence.

[0029] In some embodiments, the methods of measuring senescence include providing a plurality of cells; measuring a membrane voltage pattern of the plurality of cells; calculating a degree of clustering of the membrane voltage pattern; and determining a level of senescence of the plurality of cells based on the degree of clustering.

[0030] In some embodiments the method includes culturing the plurality of cells and contacting the plurality of cells with the voltage sensitive dye. The fluorescent dye may be Vf2.1. In some embodiments, the method may further include contacting the plurality of cells with a voltage-insensitive dye, such as Vf2.0. This allows one to observe and measure the membrane potential (Vmem) of the plurality of cells. Time series imaging may include collecting intensity images or fluorescence lifetime imaging (FLIM) images from the plurality of cells. Based on the time series images, membrane voltage and membrane voltage patterns may be visualized.

[0031] Calculating the degree of clustering of the membrane voltage pattern may include determining spatial autocorrelation patterns. These spatial autocorrelation patterns may be determined based on calculating a fast Fourier Transform, Yule-Walker equations, or Global Moran’s I value or a Local Moran’s I value. A Global Moran’s I value provides one value for the entire sample, or entire area of interest within a sample. In contrast, a Local Moran’s I value identifies individual clusters and calculates a measurement of spatial autocorrelation for each cluster. Global and Local Moran’s I values may be used alone or in combination.

[0032] In some embodiments, determining the level of senescence may be based calculating the Global Moran’s I value and / or Local Moran’s I value. This may include8QB\166118.01575'98919900.1T002873 166118.01575 comparing the Global Moran’s I value and / or Local Moran’s T value to a reference value. The reference value may be calculated from young cells, which are presumed to have little to no senescence.

[0033] Measuring cell senescence using membrane voltage

[0034] In another aspect, methods and systems for measuring cell senescence without calculating the degree of clustering are disclosed. In some embodiments, these methods include: measuring cell senescence may include providing a plurality of cells; measuring a membrane voltage of the plurality of cells; and determining a level of senescence of the plurality of cells based on the membrane voltage. The method may include culturing the plurality of cells and contacting the plurality of cells with a voltage-sensitive dye. The voltage-sensitive dye may be BERST. The membrane voltage may be measured by measuring signals from the voltagesensitive dye in the plurality of cells. This may include obtaining time series imaging from FLIM imaging and / or intensity imaging. It may further include comparing the imaging data to a reference value to determine the level of cell senescence. The reference value may be calculated from young cells, which are presumed to have little to no cell senescence.

[0035] Further methods to measure cell senescence

[0036] In some embodiments, senescence can be determined using a combination of methods. For example, the same sample can be measured using both clustering analysis and voltage intensity. This provides multiple views of senescence and may provide a more complete understanding of the senescence of a sample.

[0037] In some embodiments, the method may further include obtaining an expression level of at least one biomarker associated with senescence. The biomarker may be pl6INK4A, Interleukin-6, Interleukin- 8, P-galactosidase activity, or chromatin condensation. Biomarkers may be labeled (e.g., fluorescently labeled) in a sample; by imaging the sample, the biomarkers may be detected and the level of expression of the biomarker may be quantified. Additionally or alternatively, RNA may be isolated and specific RNA may be detected using RT-qPCR.

[0038] Samples

[0039] Cell samples9QB\166118.01575'98919900.1T002873 166118.01575

[0040] In some embodiments, cell culture may be used. Cell culture may be derived from animals or humans.

[0041] In some embodiments, cells may be collected from a subject. A “subject” refers to an animal (e.g., a lab animal such as a mouse, rat, dog, monkey, etc.) or a human. The subject may be suspected of having senescence or a disease associated with senescence. Additionally or alternatively, the subject may desire to characterize their level of senescence without having or being suspected of having a disease.

[0042] The cells may be collected from the epidermis, blood, saliva. Urine, bone marrow, spleen, thyroid, trachea, or retina. In some embodiments, the cells may be keratinocytes. The cells may be collected via biopsy.

[0043] The cells from the different tissues may have common characteristics. For instance, the selected cells may be cells that form gap junctions.

[0044] By collecting cells from a subject, measuring senescence of a sample collected from a subject therefore includes determining the level of senescence of the subject, or the specific tissue of the subject.

[0045] Depending on the cell type used, the method of measuring cell senescence can be noninvasive. For instance, epidermal cells or retinal cells are easily accessible and noninvasively.

[0046] Applications

[0047] Determining relative age of a sample

[0048] In another aspect, methods of determining a relative age of a subject, or a sample from a subject, are provided. “Relative age” refers to a difference based on expected levels of senescence and experimentally measured levels of cell senescence. Relative age can also be understood as “relative level of cell senescence.” For example, a subject may exhibit higher levels of senescence than one would expect for the subject’s age (e.g., the subject is 50 years old; the measured level of senescence is similar to that of a 70 year old subject). In another example, one organ or tissue may show more rapid aging or advanced senescence than other tissues in the subject’s body. Therefore, determining the relative age of a subject, or of a tissue in a subject, provides key insights into the health of a subject.10QB\166118.01575'98919900.1T002873166118.01575

[0049] In some embodiments, methods of determining the age of a test sample relative to a control sample are provided. The method may include: obtaining a sample of the tissue collected from the test subject; measuring the level of senescence of the tissue sample from the test subject; comparing the level of senescence of the tissue sample from the test subject to a level of senescence of a tissue sample from the control subject to determine a relative level of senescence between the tissue sample from the test subject and the tissue sample from the control subject; and relating the relative level of senescence to the relative age of the tissue of the test subject.

[0050] The “control” may be selected from a person who is known to be healthy and is the same age (e g., within 1 -3 years of the same age) as the subject. Additionally or alternatively, the “control” may be a plurality of healthy subjects who are the same age as the subject. Thus, a “control level of senescence” may be the average level of senescence of a cohort of healthy subjects who are the same or similar age.

[0051] In some embodiments, a method of comparing a relative age between two tissues within a subject are provided. A specific organ or tissue may have more advanced senescence compared to the rest of a subject’s body. For instance, macular degeneration (MD) is associated with senescence. If a subject has MD, retinal cells may have an increased senescence compared to cells collected from other tissues. Identifying a difference in senescence between tissues in the body may provide insights into whether a specific tissue or organ is diseased.

[0052] The method of comparing a relative age between two tissues in a subject may include: obtaining a sample of a tissue from a first tissue and a sample of a tissue from a second tissues; measuring the level of senescence of the first tissue sample and the second tissue sample; comparing the level of senescence of the first sample to the level of senescence of the second sample to determine a relative level of senescence between the first and second samples; and relating the relative level of senescence to the relative age difference between the first and second samples.

[0053] Diagnostics

[0054] In another aspect, the systems and methods described herein can be used to diagnose a subject with a disease associated with senescence. As described above, detecting higher senescence in retinal cells compared to other cells in the body may indicate that a subject11QB\166118.01575'98919900.1T002873166118.01575 has macular degeneration. Diseases associated with senescence include advanced aging of an organ, cancer, cardiovascular diseases (e.g., atherosclerosis and heart failure), neurodegenerative diseases (e.g., Alzheimer's and Parkinson's), metabolic disorders, osteoarthritis, idiopathic pulmonary fibrosis, osteoporosis, or renal disease. In some embodiments, advanced cell senescence itself can be considered to be a disease.

[0055] Methods of diagnosing a patient may further include providing a report based on the measured level(s) of senescence. The report may include a diagnosis of a specific illness, or a list of illnesses that are associated with the patterns of senescence observed in the subject. The report may further include a list of potential beneficial treatments, or a list of potential ineffective treatments. A “beneficial treatment” refers to a treatment that is likely to decrease symptoms of a disease, slow down progression of a disease, or stop or reverse the effects of the disease. A “beneficial treatment” may further include treatments that increase longevity, improve the biological age of cells, tissues, organs and the whole organism, and improve quality of life in aging individuals, or specific tissues that are identified as "older" by the senescence assays in described in the application. An “ineffective treatment” refers to a treatment that is unlikely to decrease the symptoms of a disease, or slow progression, or stop or reverse the effects of a diseases.

[0056] In some embodiments, the disease is macular degeneration, and the report includes treatment options for macular degeneration such as antioxidant supplements, anti-VEGF injections, laser photocoagulation, or photodynamic therapy.

[0057] In some embodiments, the disease is related to immune responses. The disease may be associated with inflammation, infection, or immune susceptibility. Immune system dysregulation and senescence are associated with neurodegenerative diseases (for example, Alzheimer's), cancers, cardiovascular diseases (for example, atherosclerosis), metabolic disorders (for example, type 2 diabetes), and autoimmune diseases (for example, rheumatoid arthritis). The report may include information on immunization, vaccination, immune supplements, or other treatments. The report may include information on effective and ineffective times to administer a treatment.

[0058] In some embodiments, the disease is chronic kidney disease, psoriasis, or atopic dermatitis.12QB\166118.01575'98919900.1T002873 166118.01575

[0059] Bioactive compound screening

[0060] In another aspect, methods and systems for screening bioactive compounds are provided. The method may include contacting a plurality of cells with a bioactive compound; and measuring senescence of the plurality of cells. Bioactive compounds that exhibit an effect on senescence may be identified as potentially useful compounds to treat senescence.

[0061] Bioactive compounds include, but are not limited to, drugs and nutritional supplements.

[0062] The drug may be a drug known to modulate membrane potential, or ion targeted compounds. In some embodiments, the drugs may be ionophores, ion channel blockers, ion channel openers, ion pump inhibitors, or ion pump activators. In some embodiments, the drugs are A-83-01, mirdametinib, laduviglusib, or tofactinib.

[0063] Nutritional supplements include, but are not limited to, vitamins, minerals, dietary supplements, herbal products, or antioxidants.

[0064] Monitoring cell senescence

[0065] In another aspect, methods of monitoring a level of cell senescence over time are provided. The method may include measuring a first level of senescence in a subject at an initial time (e.g., day 0); measuring a later level of senescence in the subject at a later time (e.g., day 7); and comparing the first level of senescence and later level of senescence. In some embodiments, senescence may be monitored over an extended period of time, and measurements of senescence may be taken periodically. For instance, senescence may be monitored over the course of a year, and it may be measured every month. Senescence may be measured weekly, monthly, bimonthly, or every 3-4 months. The length of monitoring may range from months to years. If monitoring senescence is due to

[0066] In some embodiments, this method may be used to monitor an effect of a treatment. A treatment may be administered to a subject, and the subject may be monitored to observe if any changes in senescence occur.

[0067] A treatment may include at least one of a lifestyle change, administration of a bioactive compound, naturopathic treatment, or combination thereof.13QB\166118.01575'98919900.1T002873 166118.01575

[0068] A lifestyle change may includes at least one of a diet, change in physical activity, exercise regimens, caloric restriction diet, intermittent fasting, regular physical exercise, consumption of more plant-based diets, optimizing sleep / circadian health, avoiding prosenescence agents such as smoking, UV damage, metabolic insults (e.g. hyperglycemia), increasing uptake of agents that promote gut health (probiotics, fiber, etc.), or any combination thereof.

[0069] A bioactive compound may be any of the bioactive compounds provided above. A bioactive compound may be administered once, or periodically throughout the treatment.

[0070] A naturopathic treatment may include meditation, acupuncture, reiki, massage, myofascial release, craniosacral adjustment, or yoga.

[0071] Personalized health

[0072] In another aspect, the systems and methods disclosed herein may be used to develop personalized health regimens. In some embodiments, a sample of cells may be collected from a subject, and the subject sample can be used to screen bioactive compounds. This provides personalized insight as to whether any bioactive compounds are particularly effective or ineffective at treating senescence in a specific subject.

[0073] In other embodiments, a subject may choose to try different treatments (e.g., lifestyle changes, bioactive compounds, etc.), and senescence of the subject may be monitored during each treatment. This provides personalized insight as to which treatments are particularly effective or ineffective at treating senescence in a specific subject.

[0074] Aging

[0075] Senescence is associated with aging; therefore, the disclosed methods and systems of measuring senescence, screening bioactive compounds to see which effect senescence, and monitoring the effect of treatments on senescence, can all be used to help identify anti-aging treatments.

[0076] EXAMPLES

[0077] Example 114QB\166118.01575'98919900.1T002873166118.01575

[0078] Aging, a ubiquitous process that affects almost all multicellular organisms, is accompanied by the accumulation of senescent cells, leading to a decline of morphology and function. The Toss of morphostatic information’ theory posits that aging occurs due to gradual breakdown of order initially established during embryo development. Spatial differences in cellular resting potential have many roles in organizing cell activity into complex anatomical structures during embryogenesis and regeneration. Thus, while bioelectric patterns are a good candidate for the information that degrades during aging, long-term changes in bioelectrical state in adult cells are not well -understood. Here, we sought to characterize the temporal and spatial bioelectric dynamics of human epidermal keratinocytes undergoing replicative senescence. We stained keratinocytes of varying ages using voltage sensitive dyes - BeRST, VoltageFluor 2.0 & 2.1 - and characterized pl6 expression levels, senescence associated -galactosidase activity, and chromatin condensation levels. Our results revealed senescence-associated membrane depolarization - consistent change of bioelectrical potential over the lifespan of cells. Moreover, we found increased heterogeneity of Vmem between cultures, reduced intra-culture variability, diminished cellular responsiveness to hyperpolarizing treatments, reduced resilience (ability to quickly and effectively achieve equilibrium post-perturbation), and degradation of multi-cellular patterns of bioelectric spatial organization. Modulation of resting membrane potential towards hyperpolarization abated, while depolarization exacerbated, senescence-associated phenotypes, demonstrating the instructive role of bioelectricity in replicative aging. These results reveal a breakdown of bioelectric patterning and regulation with senescence, consistent with the loss of morphostatic information theory of aging.

[0079] Introduction

[0080] Aging, the progressive decline of form and function, affects almost all multicellular organisms and. Many theories have been proposed to explain the cause of aging, and generally fall into two broad categories: damaged-based and programmatic-based. Damagedbased theories argue that aging occurs due to the accumulation of damage caused by oxidative stress, DNA damage, and the progressive malfunction of cellular repair mechanisms. Conversely, programmatic-based theories posit that aging is hardwired into the genome to give an evolutionary benefit at the cost of a limited lifespan. Despite much effort consistent with these hypotheses, there is a notable lack of definitive anti-aging treatments. This led to the emergence of the Information-loss theory of aging which posits that aging is caused due to the progressive 15QB\166118.01575'98919900.1T002873166118.01575 loss of biological information required to maintain homeostasis. This loss of information is said to occur at the level of the epigenome - changes in the methylation profiles lead to epigenetic drift, reducing the fidelity of information driving cellular processes, and causing loss of cell identity.

[0081] Theories of aging focused on loss of information at the genetic (telomere) or epigenetic levels can explain changes in cellular properties. However, resistance to aging is a whole-body phenomenon that is likely connected to the overall processes of embryogenesis and regeneration. Resistance to aging is not something that is only needed later in life - it is likely part of the general machinery needed for a body to maintain order against the daily replacement of cells and the molecular noise that constantly threaten to disrupt tissue- and organ-level structures. Aging can be seen as the eventual failure of fundamental, ubiquitous mechanisms that organize cellular and molecular events toward the maintenance and repair of the target morphology and away from degeneration and cancer.

[0082] One possible cause of aging is progressive loss of Morphostatic Information. During development, cellular collectives traverse the anatomical morphospace (the latent space of potential geometric configurations), to reach their target morphology - a region within that space that corresponds to the correct anatomy of a given species. Importantly, even after development into an adult, maintaining the final adult morphology is a highly active state that must counteract environmental stress and noise. It is likely that the key to longevity is understanding the computational processes enabling cellular collectives to establish and maintain order at various scales. One area of inquiry is what maintains the information needed for continuous upkeep of structure, within a specific region of morphospace over decades. A number of mechanisms have been implicated in on-going morphostasis, including dynamic biochemical and biomechanical gradients. Here we focus on endogenous bioelectricity: an important modality that has been implicated in large-scale morphogenetic control in embryogenesis, regeneration, and cancer suppression.

[0083] Endogenous bioelectrical signaling is driven by ion channels and pumps, present in all cells - not only neurons. The resting potential of cells regulates proliferation, migration, differentiation, and gene expression. However, as in the brain, bioelectric signaling is not just a factor determining single cell behavior: due to electrical synapses known as gap junctions and16QB\166118.01575'98919900.1T002873166118.01575 large-scale trans-epithelial electric fields, tissue-level bioelectric states propagate and integrate across considerable distances in vivo. Spatial patterns of resting membrane potential have been shown to regulate the morphogenesis of the wing, eye, heart, limb, and brain in a range of model species and human patients, and it is becoming clear that bioelectric regionalization provides an important underlying scaffold for defining tissue boundaries and organ-level structure. Recent work has especially shown that a number of birth defects, induced both chemically and genetically, exert their teratogenic influence by blurring the endogenous bioelectric prepatterns that set the size and shape of the brain; moreover, the sharpness of these patterns are an attractive target for therapeutics because reinforcing the crisp boundaries between different bioelectric regions results in repair of severe defects of brain, gut, and heart. Interestingly, cancer - another loss of tissue-level order, which a human intact body must battle for decades - can likewise be induced by disruptions of endogenous bioelectric states and normalized by therapeutic restoration of Vmem and gap junctional connectivity.

[0084] While much work on Vmem patterns has occurred in various model systems, less is known about human cells - a prerequisite for developing therapeutics. More generally, while resting potential of human cells, such as mesenchymal stem cells in culture, has been studied, it is not known what kind of multicellular patterns would exist in vitro - a scenario different from the cells’ usual evolutionarily-established organ context, in which embryonic organizer processes are not available to regionalize Vmem patterns. Finally, the changes in bioelectric pattern over long timescales, beyond embryogenesis, are not well-characterized. Thus, here we sought to address these knowledge gaps by studying bioelectric states in human cells in vitro, during their natural process of senescence, using a state-of-the-art voltage dye visualization method that goes beyond first-generation bioelectric profiling methods.

[0085] While there is a paucity of research into the role of bioelectricity in aging, some researchers have investigated ion channels and membrane potential changes in senescing cells. Plasma membrane depolarization has been suggested to be an important trigger for the induction of senescence, via depolarization as a result of increased expression of voltage-gated sodium channels. Knocking down these channels prevented the expression of p53 and the downregulation of mitotic genes. Experiments exposing cells to depolarizing treatments were shown to exacerbate replicative aging and induce senescence. Together with the functional evidence for a role of bioelectric patterns in regenerative, embryonic, and neoplastic contexts,17QB\166118.01575'98919900.1T002873 166118.01575 these data suggest the importance of bioelectricity not only as a biomarker of aging, but also reveal it to have a functional role in cellular senescence.

[0086] Thus, we proposed a model in which loss of morphostatic information is specifically due to spatial bioelectric patterns’ degrading with age, becoming blurred and thus making it more difficult for individual cells, even when replaced with new progeny, to take on appropriate system-level roles within the anatomical structure. This model makes a number of non-mutually exclusive predictions, which we tested here: whether there is (a) an absolute shift in mean Vmem during senescence, (2) a reduction of precision (increase in variance) among cells as they age, (3) spatial order (separated domains of resting potential) which becomes less distinct over time, and (4) a decline in a cells’ ability to respond to bioelectric signals or resilience (time to return to equilibrium after perturbation) in senescence.

[0087] To explore these ideas, we used human keratinocytes isolated from the neonatal epidermis. Progenitor keratinocytes residing in the basal layer of the epidermis initially undergo proliferation, then differentiate while migrating towards the surface of the skin. However, with increasing age, progenitor keratinocytes in the basal and spinous layer increasingly become senescent, reducing the skin’s regenerative potential, thinning the epidermis, and impairing homeostasis. As keratinocytes are the dominant cell type in skin, in vitro cultures provide researchers with a highly relevant model for studying skin aging processes such as senescence.

[0088] The present study aimed to determine the presence of age-dependent changes in the spatial patterning, responsiveness, and resilience of aging human epidermal keratinocytes’ bioelectric states. We found that senescent-associated membrane depolarization is accompanied by increased bioelectric inter-culture and reduced intra-culture heterogeneity with respect to resting potential, diminished cellular responsiveness and resilience, as well as degradation of bioelectric spatial organization. Moreover, we report that modulation of resting membrane potential towards hyperpolarization abated senescence associated phenotypes, while depolarization exacerbated these phenotypes.

[0089] Methods

[0090] Cell Culture18QB\166118.01575'98919900.1T002873166118.01575

[0091] To grow cells of varying ages, isolated Human Epidermal Keratinocytes-neonatal (HEK-n) (Science Cell Cat: 2100) were cultured in a T75 flask precoated with poly-L-lysine (Science Cell CAT: 0403) for 24-hours at 37°C. Hek-n cells were kept in a humidified incubator at 37°C and 5% CO2 for 12 hours before being given fresh keratinocyte media (Science Cell CAT:2101). The cell culture media was replaced every two days until reaching 80% confluency, after which they were split into T75 flasks and grown until the desired age was reached, after which they were cryopreserved in keratinocyte media containing 10% DMSO.

[0092] Bioelectric Imaging of Resting Voltage Potential

[0093] A week prior to imaging, HEK-n cells were thawed from cry opreservation and cultured onto 10-cm2culture dishes containing 20-ml of keratinocyte media, and kept in a humidified incubator at 37°C, and 5% CO2 for 6-hours. The media was then replaced with fresh keratinocyte media to remove any traces of DMSO. Cells were cultured in a 96-well precoated with Poly-L Lysine at least 48-hours prior to Vmem characterization. Prior to timeseries imaging, cells were incubated with 600 nM of BeRST for 30 minutes, washed twice with PBS, and imaged with the Leica SP8 Confocal microscope for Fluorescence Lifetime characterization. FLIM images were acquired by exciting the BeRST dye at 658-nm and collecting the emission in the range of 681-nm - 800 nm. FLIM images were fitted with a biexponential decay curve, exported as ‘ Tif’ files, then loaded into ImageJ for cell segmentation by ‘Ostu’ thresholding. Then the mean Lifetime was calculated for each cell. These data were then transferred to Prism GraphPad for graphing or R-studio for statistical testing.

[0094] Global and Local Moran’s I - Calculation of Spatial Autocorrelation

[0095] To acquire FLIM images for spatial analysis, we used the Vmem sensitive Vf2.1 and the Vmem insensitive Vf2.0 dyes. The difference between these two fluorophores is that Vf2.0 lacks the aniline donor group which is crucial for voltage sensitivity. Consequently, this dye can be used to determine the contribution of any non- Vmem artifacts. For example, we found that using higher concentrations of VF2.0 led to quenching, consequently creating what appeared to be ‘depolarized’ regions in the culture. Reducing the concentration down to 50 nM of Vf2.0 gave rise to images that appeared to have a more random distribution of Lifetime values (FIGS. 1A- 1B). This concentration was then used to acquire large image cells with the voltage sensitive VF2.1 dye for spatial analysis.19QB\166118.01575'98919900.1T002873166118.01575

[0096] To perform Moran’s T computation, HEK-n cells of different ages were cultured in a flat bottom 96-well plate 24-hr prior to imaging. Cells were stained with 50 nM VF2.1 (ex: 488-nm, em: 500 - 700 nm) and with 1 pM of Hoechst (Ex: 405-nm, Em: 420 - 480 nm) for 30 minutes at 37°C and 5% CO2. Keratinocyte imaged with the Leica SP8 Confocal microscope paired with a 25x air Objective (refer to metadata of Leicha Image File for image settings / parameters). To generate centroid X, Centroid Y, and intensity values for each cell, background pixels were zeroed by creating masks via Otsu thresholding of intensity images, then applying the mask to the FLIM images. A python script was written to use a 15 x 15 pixel ROI to scan the image and only save X, Y, and Lifetime values of regions in the image that had no background pixels (i.e., pixel values >0). These data were then saved as a csv fde. Prior to Moran’s computation, an elbow test was performed to determine the appropriate k value which was revealed to be k=3. For this computation we subsampled our data using 1000 cells at a time and took the average over 10 iterations to account for differences in cell number.

[0097] Senescence Associated 3-galactosidase characterization

[0098] Keratinocytes of varying ages were cultured onto a 96-well plate at least 48-hours prior to PGal characterization. Detection of SA-0-Gal was performed according to the manufacturer’s specification (Cell Signaling Technologies, Cat: 9860). Briefly, cells were washed with PBS, fixed with the fixative solution, rinsed and then stained with the staining solution. Then the 96-well plate was sealed with parafilm to prevent evaporation prior to incubation for 24 hours in a dry incubator (no CO2). The cells were then stained with Hoechst 3342 and imaged using EVOS M7000. Images of SA-P-Gal-stained cells were analyzed in ImageJ using the protocol developed by Krzystynial et al

[0065] , Their analysis involves color thresholding images to mask positively stained cells, then measuring the integrated density of the inversed image. This value is then divided by the number of nuclei to generate the ‘integrated density of P Gal signal per cell’.

[0099] RT-qPCR

[0100] Total RNA was isolated using the Qaigen ‘RNeasy Mini Kit’ (Cat: 74104) according to manufacturer’s instructions. To synthesize cDNA using 200 ng of isolated RNA, the Biorad Iscript cDNA synthesis (Cat: 1725035) kit was used. The expression level of pl6INK4A mRNA was determined using PowerUp SYBR Green Master Mix (Fisher Scientific, Cat:20QB\166118.01575'98919900.1T002873166118.01575A25777) using the following primers: FWD ‘ CTCGTGCTGATGCTACTGAGGA’ (SEQ ID NO: 1) and RVS ‘GGTCGGCGCAGTTGGGCTCC’ (SEQ ID NO: 2). The following PCR parameters were used: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.

[0101] Absolute quantification of mRNA transcripts was performed using the Linear Regression of Efficiency method

[0066] , This approach works because during PCR the amplification efficiency progressively decreases as the amplicon concentration increases, and therefore, this reduction is linearly coupled to the amplicon DNA mass. For all RT-qPCR quantification, 100 femtograms of lambda DNA was used to as a standard to quantify pl6INK4A mRNA.

[0102] Results

[0103] Senescent Keratinocytes Exhibit Depolarization, and Reduced Intra-culture, butIncreased Inter-culture, V mem Heterogeneity

[0104] To characterize the baseline bioelectrics of aging human epidermal keratinocytes, we imaged cells of different ages stained with 600 nM BeRST - a Vmem sensitive fluorophore. BeRST is comprised of a silicon rhodamine fluorophore attached to a phenylvenevinylene molecular wire that is sensitive to changes in the electric field. The mechanism underpinning the voltage sensing involves photoinduced electron transfer (PeT). Staining cells with BeRST results in the molecular wire embedding into the plasma membrane, while the silicon rhodamine head resides on the surface. If the membrane potential is hyperpolarized the electron-rich molecular wire quenches the head, causing a reduction in fluorescence and Lifetime. Upon membrane depolarization, the PeT mechanism is disrupted, leading to an increase in fluorescence and Lifetime from the silicon rhodamine head. This dye provides important advantages over other voltage dyes currently being used. Firstly, it has a near-far red excitation, reducing photo-toxicity and enabling long-term live imaging. Secondly, since PeT underpins the voltage sensing mechanism of this dye - unlike other dyes that use the movement of a charged fluorophore in / out of the cell - the fluorescence intensity and Lifetime is not altered by changes in membrane permeability. This reduces artifacts introduced by differential dye uptake by cells.21QB\166118.01575'98919900.1T002873166118.01575

[0105] Our results revealed significant depolarization of Keratinocytes upon reaching 40- (p<0.05, n=4 biological replicates) and 50-days (p<0.05, biological replicate n=13 biological replicates) in culture (FIG. 2A) relative to 10-day old cells (n=9 biological replicates). This coincided with increased levels of three aging biomarkers: pl6INK4A expression, SA-P- galactosidase activity, and chromatin condensation levels (p<0.05, n=4 biological replicate; p<0.0001, n=6 biological replicate; p<0.0001, n=6 biological replicates). Moreover, the degree of Vmcm heterogeneity between biological replicate cultures in a given age group, as measured by the size of standard deviation, became greater than 22-fold at day 40 and 15-fold at 50 days relative to 10-day old cells. In contrast, within each biological replicate, i.e. within a single culture, levels of heterogeneity were 38% lower in 50-day old (n=16 biological replicates) compared to 10-day (p<0.0001, n=9 biological replicates) old keratinocytes. Taken together, these data show that during senescence, keratinocytes undergo a change in the bioelectric state from polarization to depolarization which is accompanied by increased inter-culture Vmem heterogeneity and reduced intra-culture heterogeneity. These results show these bioelectric patterns as biomarkers of replicative senescence.

[0106] Senescent Keratinocytes are Less Responsive and Less Resilient to Induced Changes of Vmem

[0107] We next investigated age-dependent changes in responsiveness of keratinocytes to bioelectric signals, which is of relevance to both - design of external interventions via electroceutical drugs and the understanding of responsiveness of cells to endogenous bioelectric signals in vivo. To trigger a Vmem change, we used the hyperpolarizing drug Pinacidil - a KATP channel activator. We acquired images of keratinocytes stained with BeRST pre- and posttreatment to calculate the percentage change in Fluorescence Lifetime (FIG. 3A). Keratinocytes progressively exhibited greater absolute percentage change in Lifetime, peaking on day 30 (p<0.0001, n=3 biological replicates). However, by day 40 keratinocytes appear to have the most diminished response level, albeit statistically not significantly different than day 10. In 50-day old senescent cultures, keratinocytes responded by depolarizing (FIG. 3 A) when exposed to pinacidil. These data show that keratinocytes become increasingly more responsive to Pinacidil treatment up to day 30; however, once they approach and achieve senescence, they become not only less responsive but also depolarize when given a hyperpolarizing stimulus (FIGS. 3A-3C).22QB\166118.01575'98919900.1T002873166118.01575

[0108] To determine the presence of age-dependent changes in keratinocyte’s resilience to Vmem perturbations, we calculated the level of time series’ variance post treatment with Pinacidil. In system Dynamics, Resilience is the ability of a complex system to adapt to a new equilibrium post perturbation. A system that is resilient will quickly and effectively adjust to a new setpoint, exhibiting little variance; conversely, a frail system will struggle with adjusting to a new setpoint, exhibiting greater variance in their response. The Variance of each age group was calculated by using the standard deviation of each timeseries. This analysis revealed 50-day old cells with the highest level of variance compared to younger cells exposed to Pinacidil (p<0.05 day 10-day n=3 biological replicates, vs 50-day n=8 biological replicates). Furthermore, old senescent cultures immediately depolarized when given pinacidil followed by hyperpolarization, then a gradual progression towards depolarization. These data reveal that senescent cells have the lowest degree of Vmem resilience, and they fail to achieve a steady hyperpolarized state despite an initial attempt.

[0109] Senescent Keratinocytes Lose Ability to Form Distinct Bioelectric Domains

[0110] We next sought to determine whether cells in culture exhibit large-scale spatial regionalization with respect to Vmem (as observed in bioelectric patterns in vivo) and whether this changes with age. To this end, we used the voltage insensitive ‘VoltageFluor 2.0’ and voltage sensitive ‘VoltageFluor 2.1’ which are analogs of BeRST. These fluorophores have a Sulfofluorescein rather than a rhodamine fluorophore so they are excitable with 488-nm light. The Vf2.0 dye lacks the aniline donor group which results in no PeT mechanism and is therefore not voltage sensitive. Using VF2.0 revealed concentration dependent quenching that gave rise to what appeared to be distinct voltage domains (FIGS. 1A-1B). However, upon reducing the concentration down to 50 nM, the VF2.0 images appeared to have a more random distribution of Lifetime values (FIGS. 1A-1B). This concentration was used to stain keratinocytes with VF2.1 for spatial autocorrelation characterization.

[0111] Surprisingly, we found that even in vitro - in the absence of exogeneous morphogenetic cues - the cells self-organized into domains (FIGS. 4A-4D). This was particularly apparent in 10-day old keratinocytes evident by the relatively high positive Global Moran’s I of 0.5 (FIG. 4A). This metric measures the degree of spatial autocorrelation - Moran’s I value close to +1 indicates a strong positive spatial correlation, values close to zero indicate23QB\166118.01575'98919900.1T002873166118.01575 random spatial patterning, while negative values imply dissimilar values are adjacent. Furthermore, to investigate whether aging affects Keratinocyte’s bioelectric spatial organization, we computed Moran’s Global and Local I for each age. This metric allowed us to quantify the spatial “sharpness” of bioelectric patterns - the crispness with which adjacent regions- maintained differences in Vmem. Compared to 10-day old cultures (n=10 biological replicates), a significant reduction in Moran’s I from to 0.5 down to 0.13 in 40-day (p<0.0001, n=7 biological replicates) and 0.26 in 50-day old cells (p<0.0001, n=10 biological replicates) was observed. A reduction in linear regression was also observed when plotting the Lifetime values against spatially lagged Lifetime (FIG. 4B) - the distribution of points became progressively more random with increasing age (FIG. 4C). Moreover, computing and mapping Local Moran’s I revealed a reduction in the size and distribution of distinct clusters with increasing age (FIG. 4D). Taken together these data show a loss of bioelectric spatial organization and reduced spatial heterogeneity (loss of ability to maintain coherent, distinct voltage regions) with increasing age.

[0112] Bioelectric Modulation of Keratinocytes Alters Senescence- AssociatedPhenotypes

[0113] To ascertain whether bioelectricity is a simple read-out of senescence rather than a highly relevant lever that can control cellular aging, we modulated keratinocyte resting membrane potential and characterized its impact on senescence biomarkers. To this end, we grew 30-day old cells an additional 6-days in either control media, media containing 10 pM Pinacidil or elevated potassium ion levels (+25 mM potassium gluconate). After 6 days, keratinocytes were cultured in fresh control media for 2 additional days until imaging. FIG. 5A reveals a significantly higher number of cell nuclei in pinacidil treated (p<0.0001, n=18 biological replicates) and lower numbers in potassium gluconate treated cell cultures (p<0.05, n=24 biological replicates) relative to control cells (n=17 biological replicates). PGal staining revealed depolarizing treatment with potassium gluconate (n=6 biological replicates) increased levels of staining compared to control group (p<0.001, n=12 biological replicates). It was also apparent that despite the decrease in PGal staining levels of pinacidil treated cells, this difference was not statistically significant, likely due to the large standard deviation in the control group (FIG. 5B). Notably, potassium gluconate treated cells appeared more solitary than control or pinacidil treated cells. This was especially apparent by cells heavily stained for PGal activity. This data suggests that senescent keratinocytes may have altered gap junctions which diminish their ability24QB\166118.01575'98919900.1T002873166118.01575 to bioelectrically communicate with each other. Analysis of chromatin condensation levels revealed significant decrease in pinacidil treated cells (p<0.05, control n=18 biological replicates, pinacidil n=16 biological replicates). Potassium gluconate treated cells appeared to have significantly higher levels of chromatin condensation (p<0.0001, n=2 biological replicate 3). Taken together, these data show hyperpolarization abates, while depolarization exacerbates, senescence markers.

[0114] To determine if hyperpolarization of keratinocytes also helped abate diminished cellular responsiveness associated with cellular senescence, we acquired timeseries images of keratinocytes pre- and post-treatment with Pinacidil. Our results revealed that keratinocytes pretreated with pinacidil for 6 days exhibited the greatest degree of responsiveness (p<0.01, control n=4 biological replicates, Pinacidil n=3 biological replicates) when exposed to fresh media containing 10 uM of pinacidil (FIG. 6A). Conversely, cells pre-treated with elevated potassium levels (+25 mM potassium gluconate) exhibited the lowest levels of responsiveness (n=3 biological replicates), albeit this diminished responsiveness was not statistically significant relative to the control group; however, it is suggestive. Notably, FIG. 6B reveals that although pre-treated pinacidil cultures had the highest levels of responsiveness, they in fact progressively depolarized with time (FIG. 6B). In contrast, pre-treated potassium cells appeared to initially depolarize but then progressively hyperpolarized when exposed to pinacidil. Control cells exhibited an initial recovery from depolarization, followed by oscillation near +10%. Taken together, these data reveal that while hyperpolarization abates diminished cellular responsiveness associated with senescence, the cellular response is altered so that cells depolarize when given hyperpolarizing stimulus.

[0115] We next investigate the impact of Vmem modulation on bioelectric spatial clustering and organization. FIG. 7A reveals no significant difference between control cells and cells pre-treated with Pinacidil for 6 days. However, it appears that pre-treatment with elevated potassium ions significantly reduced Moran’s I from 0.64 down to 0.26 (p<0.01, control n=4 biological replicates, potassium gluconate n=4 biological replicates). This is also evident in the Lifetime vs spatial lag Lifetime scatter plots which show that pre-treated potassium keratinocytes with a reduced R2 value of 0.31 vs 0.67 in the control group, and by the more random distribution of points (FIG. 7B). Performing local Moran analysis also revealed that the size and distribution of distinct clusters was significantly reduced (FIG. 7C). These data demonstrate that 25QB\166118.01575'98919900.1T002873166118.01575 hyperpolarization via Pinacidil, did not significantly improve Vmem clustering, while depolarization significantly diminished keratinocytes’ ability to self-organize in distinct Vmem domains.

[0116] Discussion

[0117] Here, we characterized bioelectric patterns associated with keratinocyte senescence. We determined the relative Vmem of keratinocyte stained with the voltage responsive dye - BeRST, while also quantifying aging biomarkers pl6INK4A expression levels, senescence associated 0-galactosidase activity, and senescence associated chromatin condensation. Our results revealed that keratinocytes significantly depolarize after 50 days in culture (FIGS. 2A- 2B). This timepoint coincides with a significant increase in p!6INK4A expression, [3- galactosidase activity, and chromatin condensation levels (FIGS. 8A-8C). These data reveal depolarization as a biomarker of keratinocyte replicative senescence and is in agreement with previous research showing significant membrane depolarization as a crucial step for the induction of senescence.

[0118] We also found that the inter-culture heterogeneity of cells’ Vmem values were significantly greater in 40 and 50-day old senescent keratinocyte cultures (FIG. 2C). Paradoxically, we observed a significant reduction in intra-culture Vmem heterogeneity at 50 days relative to earlier timepoints. This suggests that biological replicates of older senescing cells will vary because some replicates would have already achieved senescence while others are still presenescent. However, possibly due to the loss of proliferative or differentiating cells, individual older senescing keratinocyte cultures exhibit more homogenous Vmem distributions within a given culture. While it is known that senescent cultures exhibit increased levels of cell-to-cell variability with respect to many aging biomarkers, the current study reports that old senescing keratinocytes exhibit reduced Vmem heterogeneity within the same culture and increased levels between replicate cultures.

[0119] Homeostatic processes, such as the ones that enable cells to cooperate towards reaching and maintaining a specific large-scale target morphology, can fail in one of several ways. For example, they can lose setpoint information, and / or, they can become unable to implement the error minimization steps even if the setpoint information is available to them. Thus, over time, one way in which the on-going maintenance of the body can be disrupted is26QB\166118.01575'98919900.1T002873166118.01575 through progressive degradation of bioelectrically-encoded information. Our data on Vmem changes during senescence is consistent with this. Another possible failure point of the morphological homeostasis cycle in vivo could be diminished responsiveness of individual cells to signals that drive collective behavior. It is known that with increasing age cells have a reduced response to growth factors, hormones, immune signals, and even nutrients e.g. aged muscle cells show reduced sensitivity to amino acids such as leucine. Here we investigated whether the ability to implement instructive bioelectrical signals likewise reduces over time, by determining cell’s responsiveness to a Vmem-altering drug. We characterized, at different ages, the Vmem of cells pre- and post-treatment with Pinacidil - KATP agonist (FIGS. 3A-3C). Results show that keratinocytes become increasingly more responsive to hyperpolarization until day 30; however, upon approaching and achieving senescing on 40 -50 days of culture, a significant reduction in responsiveness is observed (FIGS. 3A-3C). In fact, it appears that 50-day old senescent cultures undergo depolarization rather than hyperpolarization when exposed to pinacidil. Immediately after exposure to pinacidil, 50-day old senescent cultures became depolarized and then they ostensibly attempt a correction with hyperpolarization; however, they seem unable to maintain a hyperpolarized state. This data suggests that even if senescing cells produce and receive the signals needed to maintain tissue-level bioelectrical order, they may be incapable of responding appropriately. If this phenomenon holds in vivo, then it would mean that senescent cells contribute to disrupting tissue homeostasis not only by their diminished responsivity to bioelectric / morphogenetic cues, but by executing the wrong response. The accumulation of these senescent cells in tissue would increasingly lead to aprogressive loss of morphostatic information stored in bioelectric gradients. These data also reveal that bioelectric interventions aiming to prevent senescence should target keratinocytes when they are most responsive to hyperpolarization (30-days of culture) rather than attempting to rescue unresponsive senescent cells.

[0120] The resilience of a system is measured by how quickly and effectively it can converge or diverge from its equilibrium after perturbation. Stochastic resilience theory incorporates the randomness of biological systems and therefore investigates the distribution of the system around equilibrium. Here, we sought to investigate how the resilience of keratin ocyte bioelectrics changes with age. One resilience metric is the variance of a timeseries after perturbation - greater variance indicates lower resilience. To this end, we performed a time series27QB\166118.01575'98919900.1T002873166118.01575 acquisition pre- and post-treatment with Pinacidil. Our results revealed that 50-day old senescing cells exhibit the greatest degree of variance in Vmem (FIGS. 3B and 3C). These data reveal that senescent cells have significantly reduced resilience preventing them from quickly and effectively reaching a new homeostatic setpoint. The presence of such frail cells would expectedly introduce noise to the system, diminishing the ability to collectively coordinate their Vmem, and possibly reducing its ability to navigate through morphospace, because bioelectric patterns and their integration with downstream transcriptional and other mechanisms require significant temporal coordination to maintain longevity and optimal function.

[0121] The presence of frail senescent cells in culture or in tissue may consequently result in the degradation of instructive spatial bioelectric patterns. To investigate whether there were age-dependent differences in the spatial organization of bioelectric patterns, we computed Moran’s Global and Local I, as well as linear regression analysis of Lifetime vs spatial -lag Lifetime for each age group. Moran’s I, which ranges from -1 to +1, is a measure of spatial autocorrelation and consequently the degree of spatial clustering and organization present. A high Moran’s I indicates strong spatial clustering of similar Vmem values; values closer to zero indicates randomness, and values close to negative one indicates negative clustering i.e. cells with dissimilar Vmem values neighbor each other. Computing Moran’s I for keratinocytes of different ages revealed an age-dependent decrease in Moran’s I, reaching the lowest degree in 40- and 50-day cultures. Plotting the Lifetime values of cells against the spatial lag-Lifetime values, which reveals whether there is strong linear regression, showed higher levels of linear regression in younger cells, and a progressive reduction with age, reaching the lowest at 40- and 50-days cultures. Moreover, computation and mapping of Local Moran’s I showed a reduction in the size and distribution of distinct Vmem clusters with increasing age. Taken together, these data show that the bioelectric spatial organization of 2D culture of Keratinocytes significantly diminishes with age, providing further evidence for the morphostatic information loss theory of aging, in which the sharp differences between regions of different Vmem is blurred (as occurs during a number of birth defects). Notably, the reduction in Moran’s I is consistent with the reduction in intra-culture variability - reduced variability (FIG. 2C) would result in more homogenous and less distinct cell subpopulations. One notable feature of these data is that bioelectric regionalization exists at all, in vitro. While domains of different Vmem, demarcating developmental compartments, are well-known in the context of complex morphogenesis in vivo,28QB\166118.01575'98919900.1T002873166118.01575 it is surprising to find them in the absence of organizing centers. While the origin and significance of in vitro bioelectric patterns are as yet unknown, it is likely that they indicate the innate tendency of patterns to emerge via symmetry-breaking and self-organization in the excitable media of bioelectrically active and sensitive cells.

[0122] To determine whether bioelectricity plays an instructive role rather than just another biomarker of cellular senescence, we modulated the resting membrane potential of keratinocytes and characterized the impact on aging phenotypes. To this end, 30-day old keratinocytes were culture in either control media, hyperpolarizing media containing pinacidil or depolarizing media containing elevated levels of potassium ions (FIGS. 5A-5D). We found that hyperpolarizing keratinocytes for 6-days significantly increased proliferation, and reduced chromatin condensation levels. Though it was not statistically significant due to the large standard deviation of control cells, pinacidil treated cells did appear to have almost a 50% drop in PGal staining levels. Depolarizing keratinocytes for 6-days resulted in decreased cell number, increased PGal activity and chromatin condensation levels. Taken together, these data demonstrate that hyperpolarization abates while depolarization exacerbates senescent associated phenotypes. These data are consistent with previous research showing hyperpolarization delaying the onset of aging biomarkers, while depolarization increased the expression of aging biomarker levels.

[0123] We also observed that in the K+Glu-treated cultures, keratinocytes appeared more disconnected from each other, particularly cells that exhibited higher PGal signal. Within K+Glu cultures, cells that did not show high PGal staining appeared to still have connections and cluster together. This is reminiscent of cancer cells which become bioelectrically isolated from their neighbors and unresponsive to high order morphogenic cues. Moreover, cancer cells are also significantly more depolarized compared to their wild-type counterparts. At first, it may seem paradoxical that depolarization in cancer cells leads to increased levels of proliferation, whereas depolarization in the context of senescence leads to growth arrest. However, it is possible that there is a different Vmem window required for senescence, and if cancer cells are pushed towards senescent Vmem values, they may undergo growth arrest. Indeed, research by Mathews et al.

[0101] , shows that chemical cocktail combinations (e.g. Temozolomide+NS1643, or Pantoprazole+Retigabine) which further depolarized U87 human glioblastoma cells also induced cellular senescence and growth arrest.29QB\166118.01575'98919900.1T002873166118.01575

[0124] We next characterized pre-treated keratinocytes’ responsiveness to ascertain whether modulation of the resting membrane potential also helped abate diminished cellular responsiveness associated with senescence (FIG. 6A). Our results revealed that pre-treatment with hyperpolarization resulted in keratinocytes with the highest level of responsivity (FIG. 6A). However, these cells underwent depolarization rather than hyperpolarization when given fresh pinacidil. This could be due to compensatory mechanisms activated during the chronic exposure to pinacidil over the 6-days. These data imply that future bioelectric modulations should possibly employ multiple hyperpolarizing drugs with different mechanisms of action to overcome the compensatory mechanisms of cells. Pre-treatment with depolarization resulted in the lowest responsivity; however, this was not statistically significant. Taking together, these data demonstrate that bioelectric interventions can abate senescent associated diminished responsivity.

[0125] We then characterized the spatial organization of cells pre-treated with depolarization or hyperpolarization (FIGS. 7A-7D). We expected that depolarization would lead to a reduction, while hyperpolarization to an increase in spatial Vmem clustering and organization. Our results show that compared to control cells, depolarization treatment did lead to significant reduction in spatial organization and clustering. However, Pinacidil treatment did not increase spatial autocorrelation but instead led to a non-statistically significant reduction. These data reveal that depolarization diminishes cells’ ability to collectively organize and cluster in distinct Vmem domains, revealing a possible role of gap-junction disruption during senescence. Indeed, gap-junction (cx43) mRNA and protein levels are reportedly downregulated in aged Human umbilical vein endothelial cells. Our data also reveals that treatment with pinacidil did not enhance spatial autocorrelation as expected. This may be due to the fact that pinacidil prevented the onset of senescence on an individual cell level but did not work to drive collective cell behavior.

[0126] Conclusion

[0127] The present study describes the bioelectrics of senescing keratinocytes, both in terms of the Vmem patterns they generate and in turn their ability to respond to bioelectric signals. We observed changes in both of these dimensions of anatomical homeostasis, consistent with the bioelectric emphasis of the ‘Loss of Morphostatic Information’ theory of aging. Future work will30QB\166118.01575'98919900.1T002873 166118.01575 explore bioelectric patterns, and the mechanisms that interpret changes therein, as potential targets for longevity therapeutics.

[0128] References

[0129] 1. Cohen, A.A., et al., A complex systems approach to aging biology. NatureAging, 2022. 2(7): p. 580-591.

[0130] 2 Pio-Lopez, L. and M. Levin, Aging as a loss of morphostatic information: A developmental bioelectricity perspective. Ageing Research Reviews, 2024. 97: p. 102310.

[0131] 3. Freitas, A. A. and J.P. de Magalhaes, A review and appraisal of the DNA damage theory of ageing. Mutat Res, 2011. 728(1-2): p. 12-22.

[0132] 4. Gladyshev, V.N., et al., Molecular damage in aging. Nature Aging, 2021. 1(12): p. 1096-1106.

[0133] 5 Kirkwood, T.B. and S. Melov, On the programmed / non-programmed nature of ageing within the life history. Current Biology, 2011. 21(18): p. R701-R707.

[0134] 6. Trubitsyn, A.G., The Mechanism of Programmed Aging: The Way to Create aReal Remedy for Senescence. Curr Aging Sci, 2020. 13(1): p. 31-41.

[0135] 7 Tenchov, R., et al., Antiaging Strategies and Remedies: A Landscape ofResearch Progress and Promise. ACS Chemical Neuroscience, 2024. 15(3): p. 408-446.

[0136] 8. Lu, Y.R., X. Tian, and D.A. Sinclair, The Information Theory of Aging. NatureAging, 2023. 3(12): p. 1486-1499.

[0137] 9. Rubin, H., Ordered heterogeneity and its decline in cancer and aging. Advances in cancer research, 2007. 98: p. 117-47.

[0138] 10. Rubin, H., What keeps cells in tissues behaving normally in the face of myriad mutations? BioEssays, 2006. 28(5): p. 515-24.

[0139] 11. Rubin, H., Cellular epigenetics: control of the size, shape, and spatial distribution of transformed foci by interactions between the transformed and nontransformed cells. Proc Natl Acad Sci U S A, 1994. 91(3): p. 1039-43.31QB\166118.01575'98919900.1T002873 166118.01575

[0140] 12. Chow, M., A. Yao, and H. Rubin, Cellular epigenetics: topochronology of progressive "spontaneous" transformation of cells under growth constraint. Proc Natl Acad Sci U S A, 1994. 91(2): p. 599-603.

[0141] 13. Rubin, H., Cellular epigenetics: effects of passage history on competence of cells for "spontaneous" transformation. Proc Natl Acad Sci U S A, 1993. 90(22): p. 10715-9.

[0142] 14. Fields, C. and M. Levin, Competency in Navigating Arbitrary Spaces as anInvariant for Analyzing Cognition in Diverse Embodiments. Entropy (Basel), 2022. 24(6).

[0143] 15. Pezzulo, G. and M. Levin, Re-membering the body: applications of computational neuroscience to the top-down control of regeneration of limbs and other complex organs. Integr Biol (Camb), 2015. 7(12): p. 1487-517.

[0144] 16. Levin, M., Bioelectric signaling: Reprogrammable circuits underlying embryogenesis, regeneration, and cancer. Cell, 2021. 184(4): p. 1971-1989.

[0145] 17. Bates, E., Ion Channels in Development and Cancer. Annu Rev Cell Dev Biol,2015. 31 : p. 231-47.

[0146] 18. Harris, M.P, Bioelectric signaling as a unique regulator of development and regeneration. Development, 2021. 148(10).

[0147] 19. Sundelacruz, S., M. Levin, and D.L. Kaplan, Role of membrane potential in the regulation of cell proliferation and differentiation. Stem Cell Rev Rep, 2009. 5(3): p. 231-46.

[0148] 20. Blackiston, D.J., K.A. McLaughlin, and M. Levin, Bioelectric controls of cell proliferation: ion channels, membrane voltage and the cell cycle. Cell Cycle, 2009. 8(21): p. 3519-28.

[0149] 21. Pai, V.P, et al., Genome-wide analysis reveals conserved transcriptional responses downstream of resting potential change in Xenopus embryos, axolotl regeneration, and human mesenchymal cell differentiation. Regeneration (Oxf), 2016. 3(1): p. 3-25.

[0150] 22. Lang, F., et al., Ion channels in cell proliferation and apoptotic cell death. TheJournal of membrane biology, 2005. 205: p. 147-157.32QB\166118.01575'98919900.1T002873 166118.01575

[0151] 23. Schwab, A. and C. Stock, Ion channels and transporters in tumour cell migration and invasion. Philosophical Transactions of the Royal Society B: Biological Sciences, 2014. 369(1638): p. 20130102.

[0152] 24. Chen, L., F. Hassani Nia, and T. Stauber, Ion Channels and Transporters inMuscle Cell Differentiation. International Journal of Molecular Sciences, 2021. 22(24): p. 13615.

[0153] 25. Li, B., et al., Nuclear BK channels regulate gene expression via the control of nuclear calcium signaling. Nature neuroscience, 2014. 17(8): p. 1055-1063.

[0154] 26. Galva, C., P. Artigas, and C. Gatto, Nuclear Na+ / K+-ATPase plays an active role in nucleoplasmic Ca2+ homeostasis. J Cell Sci, 2012. 125(24): p. 6137-6147.

[0155] 27. Chen, Y, et al., Functional KV10.1 Channels Localize to the Inner NuclearMembrane. PLOS ONE, 2011. 6(5): p. el9257.

[0156] 28. Mazzanti, M., J.O. Bustamante, and H. Oberleithner, Electrical dimension of the nuclear envelope. Physiological Reviews, 2001. 81(1): p. 1-19.

[0157] 29. Mathews, J. and M. Levin, Gap junctional signaling in pattern regulation:Physiological network connectivity instructs growth and form. Dev Neurobiol, 2017. 77(5): p. 643-673.

[0158] 30. Wang, E.T. and M. Zhao, Regulation of tissue repair and regeneration by electric fields. Chin J Traumatol, 2010. 13(1): p. 55-61.

[0159] 31. Zhao, M., Electrical fields in wound healing-An overriding signal that directs cell migration. Semin Cell Dev Biol, 2009. 20(6): p. 674-82.

[0160] 32. George, L.F. and E.A. Bates, Mechanisms Underlying Influence ofBioelectricity in Development. Front Cell Dev Biol, 2022. 10: p. 772230.

[0161] 33. Levin, M., Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo. Molecular biology of the cell, 2014. 25(24): p. 3835-50.

[0162] 34. Levin, M. and C.J. Martyniuk, The bioelectric code: An ancient computational medium for dynamic control of growth and form. Biosystems, 2018. 164: p. 76-93.33QB\166118.01575'98919900.1T002873 166118.01575

[0163] 35. Pai, VP. and M. Levin, HCN2 channel-induced rescue of brain, eye, heart and gut teratogenesis caused by nicotine, ethanol and aberrant notch signaling. Wound Repair Regen, 2022.

[0164] 36. Pai, VP, et al., HCN2 Rescues brain defects by enforcing endogenous voltage pre-patterns. Nature Communications, 2018. 9(1): p. 998.

[0165] 37. Pai, V.P., et al., Endogenous Gradients of Resting Potential InstructivelyPattern Embryonic Neural Tissue via Notch Signaling and Regulation of Proliferation. The Journal of Neuroscience, 2015. 35(10): p. 4366-85.

[0166] 38. Pai, VP, et al., Local and long-range endogenous resting potential gradients antagonistically regulate apoptosis and proliferation in the embryonic CNS. The International journal of developmental biology, 2015. 59(7-9): p. 327-340.

[0167] 39. Rubin, H., M. Chow, and A. Yao, Cellular aging, destabilization, and cancer.Proc Natl Acad Sci U S A, 1996. 93(5): p. 1825-30.

[0168] 40. Lobikin, M., et al., Resting potential, oncogene-induced tumorigenesis, and metastasis: the bioelectric basis of cancer in vivo. Physical Biology, 2012. 9(6): p. 065002.

[0169] 41. Chemet, B.T. and M. Levin, Endogenous Voltage Potentials and theMicroenvironment: Bioelectric Signals that Reveal, Induce and Normalize Cancer. Journal of clinical & experimental oncology, 2013. Suppl 1.

[0170] 42. Chemet, B.T. and M. Levin, Transmembrane voltage potential is an essential cellular parameter for the detection and control of tumor development in a Xenopus model. Disease models & mechanisms, 2013. 6(3): p. 595-607.

[0171] 43. Prevarskaya, N., R. Skryma, and Y. Shuba, Ion Channels in Cancer: AreCancer Hallmarks Oncochannelopathies? Physiol Rev, 2018. 98(2): p. 559-621.

[0172] 44. Foust, A.J., et al., Voltage-Sensitive Optical Probes for Measuring CellMembrane Potentials: An Update and Applications to “Nonexcitable” Cells. Bioelectricity, 2023. 5(4): p. 250-265.

[0173] 45. Payne, S.L., M. Levin, and M.J. Oudin, Bioelectric Control of Metastasis inSolid Tumors. Bioelectricity, 2019. 1(3): p. 114-130.34QB\166118.01575'98919900.1T002873 166118.01575

[0174] 46. Levin, M., J. Selberg, and M. Rolandi, Endogenous Bioelectrics inDevelopment, Cancer, and Regeneration: Drugs and Bioelectronic Devices as Electroceuticals for Regenerative Medicine. iScience, 2019. 22: p. 519-533.

[0175] 47. McLaughlin, K.A. and M. Levin, Bioelectric signaling in regeneration:Mechanisms of ionic controls of growth and form. Dev Biol, 2018. 433(2): p. 177-189.

[0176] 48. Pchelintseva, E. and M.B.A. Djamgoz, Mesenchymal stem cell differentiation:Control by calcium-activated potassium channels. J Cell Physiol, 2018. 233(5): p. 3755-3768.

[0177] 49. Sundelacruz, S., M. Levin, and D.L. Kaplan, Depolarization alters phenotype, maintains plasticity of predifferentiated mesenchymal stem cells. Tissue engineering. Part A, 2013. 19(17-18): p. 1889-908.

[0178] 50. Sundelacruz, S., et al., Membrane Potential Depolarization Alters CalciumFlux and Phosphate Signaling During Osteogenic Differentiation of Human Mesenchymal Stem Cells. Bioelectricity, 2019. 1(1): p. 56-66.

[0179] 51. Sundelacruz, S., M. Levin, and D.L. Kaplan, Comparison of the depolarization response of human mesenchymal stem cells from different donors. Sci Rep, 2015. 5: p. 18279.

[0180] 52. Bhuyan, A.K., A. Varshney, and M.K. Mathew, Resting membrane potential as a marker of apoptosis: studies on Xenopus oocytes microinjected with cytochrome c. Cell Death & Differentiation, 2001. 8(1): p. 63-69.

[0181] 53. Nelson, M.T. and J.M. Quayle, Physiological roles and properties of potassium channels in arterial smooth muscle. Am J Physiol, 1995. 268(4 Pt 1): p. C799-822.

[0182] 54. Riihl, P, et al., Monitoring of compound resting membrane potentials of cell cultures with ratiometric genetically encoded voltage indicators. Communications Biology, 2021. 4(1): p. 1164.

[0183] 55. McMillen, P. and M. Levin, Optical Estimation of Bioelectric Patterns inLiving Embryos. Methods Mol Biol, 2024. 2745: p. 91-102.

[0184] 56. Kirk, M.J., B.K. Raliski, and E.W. Miller, Monitoring neuronal activity with voltage-sensitive fluorophores. Methods Enzymol, 2020. 640: p. 185-204.35QB\166118.01575'98919900.1T002873 166118.01575

[0185] 57. Li, M., et al., PPP3R1 Promotes MSCs Senescence by Inducing PlasmaMembrane Depolarization and Increasing Ca2+ Influx. International Journal of Molecular Sciences, 2023. 24(5): p. 4421.

[0186] 58. Chen, A., et al., mTORCl induces plasma membrane depolarization and promotes preosteoblast senescence by regulating the sodium channel Senia. Bone Research, 2022. 10(1).

[0187] 59. Wamier, M., et al., The <scp>SCN< / scp>9A channel and plasma membrane depolarization promote cellular senescence through Rb pathway. Aging Cell, 2018. 17(3): p. el2736.

[0188] 60. Whited, J.L. and M. Levin, Bioelectrical controls of morphogenesis: from ancient mechanisms of cell coordination to biomedical opportunities. Curr Opin Genet Dev, 2019. 57: p. 61-69.

[0189] 61. Vandenberg, L.N., R.D. Morrie, and D.S. Adams, V-ATPase-dependent ectodermal voltage and pH regionalization are required for craniofacial morphogenesis. Dev Dyn, 2011. 240(8): p. 1889-904.

[0190] 62. Park, S.C., et al., What matters in aging is signaling for responsiveness.Pharmacol Ther, 2023. 252: p. 108560.

[0191] 63. Eckert, R.L., et al., Keratinocyte survival, differentiation, and death: many roads lead to mitogen-activated protein kinase. J Investig Dermatol Symp Proc, 2002. 7(1): p. 36-40.

[0192] 64. Gruber, F., et al., Cell aging and cellular senescence in skin aging — Recent advances in fibroblast and keratinocyte biology. Experimental Gerontology, 2020. 130: p. 110780.

[0193] 65. Krzystyniak, A., et al., Fiji-Based Tool for Rapid and Unbiased Analysis ofSA-[3-Gal Activity in Cultured Cells. Biomolecules, 2023. 13(2): p. 362.

[0194] 66. Rutledge, R.G., A Java Program for LRE-Based Real-Time qPCR that EnablesLarge-Scale Absolute Quantification. PLoS ONE, 2011. 6(3): p. el7636.36QB\166118.01575'98919900.1T002873 166118.01575

[0195] 67. Huang, Y.L., A S. Walker, and E.W. Miller, A Photostable Silicon RhodaminePlatform for Optical Voltage Sensing. J Am Chem Soc, 2015. 137(33): p. 10767-76.

[0196] 68. Walker, A.S., et al., Optical Spike Detection and Connectivity Analysis With aFar-Red Voltage-Sensitive Fluorophore Reveals Changes to Network Connectivity in Development and Disease. Frontiers in Neuroscience, 2021. 15.

[0197] 69. McMillen, P. and M. Levin, Optical Estimation of Bioelectric Patterns inLiving Embryos. 2024, Springer US. p. 91-102.

[0198] 70. Lazzari-Dean, J.R., A.M.M. Gest, and E.W. Miller, Optical estimation of absolute membrane potential using fluorescence lifetime imaging. eLife, 2019. 8: p. e44522.

[0199] 71. Liu, P. and E.W. Miller, Electrophysiology, Unplugged: Imaging MembranePotential with Fluorescent Indicators. Accounts of Chemical Research, 2020. 53(1): p. 11-19.

[0200] 72. Lapak, K.M. and C.E. Burd, The Molecular Balancing Act of pl6INK4a inCancer and Aging. Molecular Cancer Research, 2014. 12(2): p. 167-183.

[0201] 73. Hartmann, C., et al., Systematic estimation of biological age of in vitro cell culture systems by an age-associated marker panel. Frontiers in Aging, 2023. 4.

[0202] 74. Shaban, H.A. and S.M. Gasser, Dynamic 3D genome reorganization during senescence: defining cell states through chromatin. Cell Death & Differentiation, 2025. 32(1): p. 9-15.

[0203] 75. Djamgoz, M.B.A., Electrical excitability of cancer cells-CELEX model updated. Cancer Metastasis Rev, 2024. 43(4): p. 1579-1591.

[0204] 76. Balasubramanian, S., et al., Electroceuticals: emerging applications beyond the nervous system and excitable tissues. Trends Pharmacol Sci, 2024. 45(5): p. 391-394.

[0205] 77. Churchill, C.D.M., et al., EDEn - Electroceutical Design Environment: AnIon Channel Database with Small Molecule Modulators and Tissue Expression Information. iScience, 2018. 11 : p. 42-56.

[0206] 78. Cao, C., et al., ATP-sensitive potassium channel: A novel target for protection against UV-induced human skin cell damage. Journal of Cellular Physiology, 2007. 212(1): p. 252-263.37QB\166118.01575'98919900.1T002873 166118.01575

[0207] 79. Weiss, I. and J. Bohrmann, Electrochemical patterns during Drosophila oogenesis: ion-transport mechanisms generate stage-specific gradients of pH and membrane potential in the follicle-cell epithelium. Bmc Developmental Biology, 2019. 19(1): p. 12.

[0208] 80. Durant, F., et al., Long-Term, Stochastic Editing of Regenerative Anatomy viaTargeting Endogenous Bioelectric Gradients. Biophysical Journal, 2017. 112(10): p. 2231-2243.

[0209] 81. Schmal, C., et al., Moran’s I quantifies spatio-temporal pattern formation in neural imaging data. Bioinformatics, 2017. 33(19): p. 3072-3079.

[0210] 82. Venkatachalam, K., Regulation of Aging and Longevity by Ion Channels andTransporters. Cells, 2022. 11(7): p. 1180.

[0211] 83. Wiley, C D., et al., Analysis of individual cells identifies cell-to-cell variability following induction of cellular senescence. Aging Cell, 2017. 16(5): p. 1043-1050.

[0212] 84. Matsuda, T., et al., Decreased response to epidermal growth factor during cellular senescence in cultured human microvascular endothelial cells. Journal of Cellular Physiology, 1992. 150(3): p. 510-516.

[0213] 85. Palmer, A.K., et al., Targeting senescent cells alleviates obesity-induced metabolic dysfunction. Aging Cell, 2019. 18(3): p. el2950.

[0214] 86. Marrella, V, A. Facoetti, and B. Cassani, Cellular Senescence in Immunity against Infections. International Journal of Molecular Sciences, 2022. 23(19): p. 11845.

[0215] 87. Dardevet, D., et al., Leucine: a key amino acid in ageing-associated sarcopenia? Nutrition Research Reviews, 2003. 16(01): p. 61.

[0216] 88. Qiu, Z., et al., Detection of differentially expressed genes in spatial transcriptomics data by spatial analysis of spatial transcriptomics: A novel method based on spatial statistics. Frontiers in Neuroscience, 2022. 16.

[0217] 89. Pai, V.P, et al., Endogenous gradients of resting potential instructively pattern embryonic neural tissue via Notch signaling and regulation of proliferation. J Neurosci, 2015. 35(10): p. 4366-85.

[0218] 90. Schotthofer, S.K. and J. Bohrmann, Analysing bioelectrical phenomena in theDrosophila ovary with genetic tools: tissue-specific expression of sensors for membrane38QB\166118.01575'98919900.1T002873 166118.01575 potential and intracellular pH, and RNAi -knockdown of mechanisms involved in ion exchange. BMC Dev Biol, 2020. 20(1): p. 15.

[0219] 91. Weiss, I. and J. Bohrmann, Electrochemical gradients are involved in regulating cytoskeletal patterns during epithelial morphogenesis in the Drosophila ovary. BMC Dev Biol, 2019. 19(1): p. 22.

[0220] 92. Telfer, W, R. Woodruff, and E. Huebner, Electrical polarity and cellular differentiation in meroistic ovaries. American Zoologist, 1981. 21 : p. 675-686.

[0221] 93. Woodruff, R. and W. Telfer, Electrophoresis of proteins in intercellular bridges. Nature, 1980. 286(5768): p. 84-6.

[0222] 94. Jaffe, L. and R. Woodruff, Large electrical currents traverse developingCecropia follicles. Proceedings of the National Academy of Sciences of the United States of America, 1979. 76(3): p. 1328-1332.

[0223] 95. Woodruff, R. and W. Telfer, Electrical properties of ovarian cells linked by intercellular bridges. Annals of the New York Academy of Sciences, 1974. 238: p. 408-19.

[0224] 96. Cervera, J., S. Meseguer, and S. Mafe, Intercellular Connectivity andMulticellular Bioelectric Oscillations in Nonexcitable Cells: A Biophysical Model. ACS Omega, 2018. 3(10): p. 13567-13575.

[0225] 97. Cervera, J., et al., From non-excitable single-cell to multicellular bioelectrical states supported by ion channels and gap junction proteins: Electrical potentials as distributed controllers. Prog Biophys Mol Biol, 2019. 149: p. 39-53.

[0226] 98. Cervera, J., et al., Synchronization of Bioelectric Oscillations in Networks ofNonexcitable Cells: From Single-Cell to Multicellular States. J Phys Chem B, 2019. 123(18): p. 3924-3934.

[0227] 99. Pietak, A. and M. Levin, Bioelectric gene and reaction networks: computational modelling of genetic, biochemical and bioelectrical dynamics in pattern regulation. J R Soc Interface, 2017. 14(134).39QB\166118.01575'98919900.1T002873 166118.01575

[0228] 100. Pietak, A. and M. Levin, Exploring Instructive Physiological Signaling with the Bioelectric Tissue Simulation Engine (BETSE). Frontiers in Bioengineering and Biotechnology, 2016. 4: p. 55.

[0229] 101. Mathews, J., et al., Ion Channel Drugs Suppress Cancer Phenotype inNG108-15 and U87 Cells: Toward Novel Electroceuticals for Glioblastoma. Cancers, 2022. 14(6): p. 1499.

[0230] 102. Stevenson, D., et al., Relationship between cell membrane potential and natural killer cell cytolysis in human hepatocellular carcinoma cells. Cancer Res, 1989. 49(17): p. 4842-5.

[0231] 103. Srivastava, P., et al., A Meta- Analysis of Bioelectric Data in Cancer,Embryogenesis, and Regeneration. Bioelectricity, 2020. in press(l): p. 42-67.

[0232] 104. Xie, H.Q. and V.W. Hu, Modulation of gap junctions in senescent endothelial cells. Exp Cell Res, 1994. 214(1): p. 172-6.

[0233] 105. Pio-Lopez, L. and M. Levin, Aging as a loss of morphostatic information: A developmental bioelectricity perspective. Ageing Res Rev, 2024. 97: p. 102310.

[0234] Example 2

[0235] FIG. 9 shows an example process 900 to measure cell senescence. At step 902, a plurality of cells is provided. The cells may be collected from a subject. At step 904, a membrane voltage of the plurality of cells is obtained. The membrane voltage may be obtained by contacting the plurality of cells with a fluorescent dye and using imaging, such as FLIM, to observe the membrane voltage. In some embodiments, the method further includes measuring a membrane voltage pattern, and calculating a degree of clustering of the membrane voltage pattern. At step 906, a level of cell senescence of the cells based on the membrane voltage is determined.

[0236] In FIG. 10, an example 1000 of a system (e.g., a data processing system) for measuring senescence in accordance with some embodiments of the disclosed subject matter is shown.

[0237] In some embodiments, computing device 1004 and / or server 1016 can be any suitable computing device or combination of devices, such as a desktop computer, a laptop40QB\166118.01575'98919900.1T002873166118.01575 computer, a smartphone, a tablet computer, a wearable computer, a server computer, a virtual machine being executed by a physical computing device, etc. As described herein, system 1000 can present information about the characterized protein to a user (e.g., a researcher and / or a physician).

[0238] In some embodiments, communication network 1002 can be any suitable communication network or combination of communication networks. In some embodiments, communication network 1002 can be any suitable communication network or combination of communication networks. For example, communication network 1002 can include a Wi-Fi network (which can include one or more wireless routers, one or more switches, etc.), a peer-to- peer network (e.g., a Bluetooth network), a cellular network (e.g., a 4G network, a 5G network, etc., complying with any suitable standard, such as CDMA, GSM, LTE, LTE Advanced, WiMAX, etc.), a wired network, etc. In some embodiments, communication network 1002 can be a local area network, a wide area network, a public network (e.g., the Internet), a private or semi-private network (e.g., a corporate or university intranet), any other suitable type of network, or any suitable combination of networks. Communications links shown in FIG. 10 can each be any suitable communications link or combination of communications links, such as wired links, fiber optic links, Wi-Fi links, Bluetooth links, cellular links, etc.

[0239] FIG. 10 additionally shows an example of hardware that can be used to implement computing device 1004 and server 1016 in accordance with some embodiments of the disclosed subject matter. In some embodiments, computing device 1004 can be used to execute one or more set of instructions to measure senescence. In other embodiments, computing device 1004 can be used to screen a bioactive compound for effects on senescence. In still other embodiments, computing device 1004 can be used to monitor senescence over time, such as over the time course of a treatment.

[0240] As shown in FIG. 10, computing device 1004 can include one or more hardware processor 1006, one or more displays 1008, one or more inputs 1010, one or more communications 1012, and / or memory 1014. In some embodiments, processor 1006 can be any suitable hardware processor or combination of processors, such as central processing unit, a graphics processing unit, etc. In some embodiments, display 1008 can include any suitable display devices, such as a computer monitor, a touchscreen, a television, etc. In some41QB\166118.01575'98919900.1T002873166118.01575 embodiments, inputs 1010 can include any suitable input device and / or sensors that can be used to receive user input, such as a keyboard, a mouse, a touchscreen, a microphone, etc.

[0241] In some embodiments, communication systems 1012 can include any suitable hardware, firmware, and / or software for communicating information over communication network 1002 and / or any other suitable communication networks. For example, communications systems 1012 can include one or more transceivers, one or more communication chips and / or chip sets, etc. In a more particular example, communications systems 1012 can include hardware, firmware and / or software that can be used to establish a Wi-Fi connection, a Bluetooth connection, a cellular connection, an Ethernet connection, etc.

[0242] In some embodiments, memory 1014 can include any suitable storage device or devices that can be used to store instructions, values, etc., that can be used, for example, by processor 1006 to present content using display 1008, to communicate with server 1016 via communications system(s) 1012, etc.

[0243] Memory 1014 can include any suitable volatile memory, non-volatile memory, storage, or any suitable combination thereof. For example, memory 1014 can include RAM, ROM, EEPROM, one or more flash drives, one or more hard disks, one or more solid state drives, one or more optical drives, etc. In some embodiments, memory 1014 can have encoded thereon a computer program for controlling operation of computing device 1004. In such embodiments, processor 1006 can execute at least a portion of the computer program to present content (e.g., images, user interfaces, graphics, tables, etc ), receive content from server 1016, transmit information to server 1016, etc.

[0244] In some embodiments, server 1016 can include a processor 1018, a display 1020, one or more inputs 1022, one or more communications systems 1024, and / or memory 1026. In some embodiments, processor 1018 can be any suitable hardware processor or combination of processors, such as a central processing unit, a graphics processing unit, etc. In some embodiments, display 1020 can include any suitable display devices, such as a computer monitor, a touchscreen, a television, etc. In some embodiments, inputs 1022 can include any suitable input devices and / or sensors that can be used to receive user input, such as a keyboard, a mouse, a touchscreen, a microphone, etc.42QB\166118.01575'98919900.1T002873166118.01575

[0245] In some embodiments, communications systems 1024 can include any suitable hardware, firmware, and / or software for communicating information over communication network 1002 and / or any other suitable communication networks. For example, communications systems 1024 can include one or more transceivers, one or more communication chips and / or chip sets, etc. In a more particular example, communications systems 1024 can include hardware, firmware and / or software that can be used to establish a Wi-Fi connection, a Bluetooth connection, a cellular connection, an Ethernet connection, etc.

[0246] In some embodiments, memory 1026 can include any suitable storage device or devices that can be used to store instructions, values, etc., that can be used, for example, by processor 1018 to present content using display 1020, to communicate with one or more computing devices 1004, etc. Memory 1026 can include any suitable volatile memory, nonvolatile memory, storage, or any suitable combination thereof. For example, memory 1026 can include RAM, ROM, EEPROM, one or more flash drives, one or more hard disks, one or more solid state drives, one or more optical drives, etc. In some embodiments, memory 1026 can have encoded thereon a server program for controlling operation of server 1016. In such embodiments, processor 1018 can execute at least a portion of the server program to transmit information and / or content (e g., results of a tissue identification and / or classification, a user interface, etc.) to one or more computing devices 1004, receive information and / or content from one or more computing devices 1004, receive instructions from one or more devices (e.g., a personal computer, a laptop computer, a tablet computer, a smartphone, etc.), etc.

[0247] In some embodiments, any suitable computer readable media can be used for storing instructions for performing the functions and / or processes described herein. For example, in some embodiments, computer readable media can be transitory or non-transitory. For example, non-transitory computer readable media can include media such as magnetic media (such as hard disks, floppy disks, etc.), optical media (such as compact discs, digital video discs, Blu-ray discs, etc.), semiconductor media (such as RAM, Flash memory, electrically programmable read only memory (EPROM), electrically erasable programmable read only memory (EEPROM), etc.), any suitable media that is not fleeting or devoid of any semblance of permanence during transmission, and / or any suitable tangible media. As another example, transitory computer readable media can include signals on networks, in wires, conductors,43QB\166118.01575'98919900.1T002873 166118.01575 optical fibers, circuits, or any suitable media that is fleeting and devoid of any semblance of permanence during transmission, and / or any suitable intangible media.

[0248] A number of references to patent and non-patent documents are made throughout the publication, each of which is herein incorporated by reference in its entirety.

[0249] Thus, while the invention has been described above in connection with particular embodiments and examples, the invention is not necessarily so limited, and that numerous other embodiments, examples, uses, modifications and departures from the embodiments, examples and uses are intended to be encompassed by the claims attached hereto.

[0250] Example 3

[0251] In one example, a subject suffering from advanced cell senescence or a disease associated with cell senescence, is administered a therapeutically effective amount of a composition comprising at least one of A-83-01, mirdametinib, laduviglusib, or tofactinib may be suitably be administered by any route that is indicated by the particular treatment needs of the subject, e.g., oral, transdermal, percutaneous, intravenous, intramuscular, intranasal, buccal, intrathecal, intracerebral, or intrarectal routes. Signs and symptoms of cell senescence may be reduced by the administration of the composition. Administering the treatment may increase longevity, improve the biological age of cells, tissues, organs and the whole organism, and / or improve quality of life in aging individuals, or specific tissues that are identified as "older" by the senescence assays in described in the application. Treatment may be administered daily, every other day, every third day, or on a schedule as determined by the patient's progress, pursuant to a physician's decision. It is anticipated that the subject will experience an increase in body mass, appetite, or amelioration of nausea, vomiting, abdominal pain, or diarrhea, or other metrics associated with reduction in signs or symptoms of cell senescence, as compared to an untreated subject. Methods of measuring reductions in signs and symptoms of cell senescence are described in the application.44QBU66118.01575198919900.1

Claims

T002873 166118.01575CLAIMSWhat is claimed is:

1. A method of measuring cell senescence, comprising: providing a plurality of cells; measuring a membrane voltage pattern of the plurality of cells; calculating a degree of clustering of the membrane voltage pattern; and determining a level of senescence of the plurality of cells based on the degree of clustering.

2. The method of claim 1, wherein providing the plurality of cells further comprises: culturing the plurality of cells, and contacting the plurality of cells with a voltage-sensitive dye.

3. The method of claim 1 or 2, wherein measuring the membrane voltage pattern of the plurality of cells further comprises: measuring signals from the voltage-sensitive dye in the plurality of cells.

4. The method of claim 3, wherein measuring the signals from the voltage-sensitive dye in the plurality of cells further comprises: obtaining at least one of fluorescence lifetime imaging (FLIM) images or intensity images from the plurality of cells.45QB\166118.01575'98919900.1T002873 166118.015755. The method of claim 4, wherein calculating the degree of clustering of the membrane voltage pattern further comprises: determining spatial autocorrelation values based on the membrane voltage pattern.

6. The method of claim 5, wherein determining the spatial autocorrelation values based on the membrane voltage pattern further comprises: determining the spatial autocorrelation values based on the membrane voltage pattern based on calculating at least one of Fast Fourier Transform, Yule-Walker equations, Global Moran’s I value, or Local Moran’s I value.

7. The method of claim 6, wherein determining the level of senescence of the cell based on the degree of clustering further comprises: determining the level of senescence of the cell based on calculating at least one of the Global Moran’s I value or the Local Moran’s I value.

8. The method of claim 7, wherein determining the level of senescence of the cell based on calculating the at least one of the Global Moran’s I value or the Local Moran’s I value further comprises: comparing the at least one of the Global Moran’s I value or the Local Moran’s I value to a reference value.

9. The method of any one of claims 2-8, wherein the voltage sensitive dye comprises Vf2.1, and wherein the method further comprises: contacting the plurality of cells with a voltage-insensitive dye comprising Vf2.0.46QB\166118.01575'98919900.1T002873 166118.0157510. A method of measuring cell senescence, comprising: providing a plurality of cells; measuring a membrane voltage of the plurality of cells; and determining a level of senescence of the plurality of cells based on the membrane voltage.

11. The method of claim 10, wherein providing the plurality of cells further comprises: culturing the plurality of cells, and contacting the plurality of cells with a voltage-sensitive dye.

12. The method of claim 11, wherein measuring the membrane voltage of the plurality of cells further comprises: measuring signals from the voltage-sensitive dye in the plurality of cells.

13. The method of claim 12, wherein measuring the signals from the voltage-sensitive dye in the plurality of cells further comprises: obtaining at least one of fluorescence lifetime imaging (FLIM) images or intensity images from the plurality of cells.

14. The method of claim 13, wherein determining the level of senescence of the plurality of cells based on the membrane voltage further comprises: obtaining data from at least one of the FLIM images or the intensity images, and comparing the data to reference values to determine the level of senescence.

15. The method of any one of claims 10-14, wherein the voltage sensitive dye comprises BeRST.47QB\166118.01575'98919900.1T002873 166118.0157516. A method of measuring cell senescence, comprising: providing a plurality of cells; measuring a membrane voltage of the plurality of cells and determining a first level of senescence based on the membrane voltage; and measuring a membrane voltage pattern of the plurality of cells, calculating a degree of clustering of the membrane voltage pattern, and determining a second level of senescence based on the degree of clustering.

17. The method of any one of claims 1-16, wherein the method further comprises obtaining an expression level of at least one biomarker associated with senescence.

18. The method of claim 17, wherein the at least one biomarker is selected from a group comprising: pl6INK4A, Interleukin-6, Interleukin-8, P-galactosidase activity, or chromatin condensation.

19. The method of any one of claims 1-18, wherein providing the plurality of cells further comprises: obtaining the plurality of cells from a subject, and wherein determining the level of senescence of the plurality of cells further comprises: determining the level of senescence of the subject.

20. The method of claim 19, wherein obtaining the plurality of cells from the subject further comprises: obtaining a plurality of cells from a tissue from the subject, wherein the plurality of cell comprises cells collected from the epidermis, blood, bone marrow, spleen, thyroid, or retina.48QB\166118.01575'98919900.1T002873166118.0157521. The method of claim 20, wherein the plurality of cells forms gap junctions.

22. The method of claim 21, wherein the plurality of cells comprises keratinocytes.

23. A method of determining a relative age of a test subject compared to a control subject comprising: obtaining a sample of the tissue collected from the test subject; measuring the level of senescence of the tissue sample from the test subject using the methods of any one of claims 1-22; comparing the level of senescence of the tissue sample from the test subject to a level of senescence of a tissue sample from the control subject to determine a relative level of senescence between the tissue sample from the test subject and the tissue sample from the control subject; and relating the relative level of senescence to the relative age of the tissue of the test subject.

24. A method of comparing a relative age difference between two tissues in a subject comprising: obtaining a sample of a tissue from a first tissue and a sample of a tissue from a second tissues; measuring the level of senescence of the first tissue sample and the second tissue sample using the methods of any one of claims 1-23; comparing the level of senescence of the first sample to the level of senescence of the second sample to determine a relative level of senescence between the first and second samples; and relating the relative level of senescence to the relative age difference between the first and second samples.49QB\166118.01575'98919900.1T002873 166118.0157525. The method of claim 23 or 24, wherein the method is used to diagnose a patient with a condition related to advanced senescence, selected from a group comprising: advanced aging of an organ, cancer, cardiovascular diseases (e.g., atherosclerosis and heart failure), neurodegenerative diseases (e.g., Alzheimer's and Parkinson's), metabolic disorders, osteoarthritis, idiopathic pulmonary fibrosis, osteoporosis, chronic kidney disease, psoriasis, atopic dermatitis, or renal disease.

26. The method of claim 25, wherein the method further comprises: providing a report comprising at least one of the diagnosis, a list of potential beneficial treatments, or a list of potential ineffective treatments.

27. The method of claim 26, wherein the diagnosis comprises macular degeneration and the report comprises treatment options for macular degeneration.

28. The method of claim 26, wherein the method comprises a diagnosis related to immune responses, and the report comprises information regarding at least one of inflammation, infection, or immune susceptibility, and wherein the report comprises information regarding at least one of immunization, vaccination, immune supplements, or treatments.

29. A method of screening a bioactive compound to determine an effect of cell senescence, comprising: contacting a plurality of cells with the bioactive compound; and measuring cell senescence of the plurality of cells using the methods of any one of claims 1-28.50QB\166118.01575'98919900.1T002873 166118.0157530. The method of claim 29, wherein the bioactive compound is selected from a group comprising drugs or nutritional supplements.

31. The method of claim 30, wherein the drug is selected from a group comprising be ionophores, ion channel blockers, ion channel openers, ion pump inhibitors, or ion pump activators.

32. The method of claim 31, wherein the drug is selected from a group comprising A-83-01, mirdametinib, laduviglusib, or tofactinib.

33. The method of claim 30, wherein the nutritional supplement is selected from a group comprising vitamins, minerals, dietary supplements, herbal products, or antioxidants.

34. A method of monitoring a level of senescence of a subject comprising:(a) measuring a first level of senescence of a patient at an initial time using the methods of any one of claims 1-22;(b) measuring a later level of senescence of a patient at a later time using the method used in step (a); and(c) comparing the first level of senescence and later level of senescence.

35. The method of claim 34, wherein the method further comprises: repeating steps (b) and (c) over a time course to continually monitor the level of senescence of a subject.

36. A method of monitoring an effect of a treatment comprising: administering a treatment to a subject; and51QB\166118.01575'98919900.1T002873 166118.01575 monitoring a progression of senescence of the subject comprising using the method of claim 34 or 35.

37. The method of claim 36, wherein the treatment comprises at least one of a lifestyle change, administration of a bioactive compound, naturopathic treatment, or combination thereof.

38. The method of claim 37, wherein the lifestyle change comprises at least one of diet, change in physical activity, exercise regimens, caloric restriction diet, intermittent fasting, regular physical exercise, consumption of more plant-based diets, optimizing sleep / circadian health, avoiding pro-senescence agents such as smoking, UV damage, metabolic insults (e g. hyperglycemia), or increasing uptake of agents that promote gut health (probiotics, fiber, etc.).

39. The method of claim 37, wherein the bioactive compound comprises at least one of a drug or nutritional supplement.

40. The method of claim 37, wherein the naturopathic treatment comprises at least one of meditation, acupuncture, reiki, massage, myofascial release, craniosacral adjustment, or yoga.

41. A method of determining a personalized health regimen comprising: completing at least one of:(a) screening for the effect of a plurality of bioactive compounds using the method of any one of claims 29-33, or(b) monitoring the effect of a treatment using the method of any one of claims 34- 40; and providing a report that identifies personalized recommendations for the personalized health regimen based on steps (a) and (b).52QB\166118.01575'98919900.1T002873 166118.0157542. The method of any one of claims 36-41 wherein the treatment is designed to slow effects of aging.

43. A system to measure cell senescence, comprising: a processor in communication with a memory, the memory having stored thereon a set of instructions which, when executed by the processor, cause the processor to: obtain imaging data of a plurality of cells, wherein the plurality of cells has been contacted with a voltage-sensitive dye, and wherein the imaging data comprises at least one of FLIM images or intensity images from the plurality of cells; measure a membrane voltage pattern of a plurality of cells using the imaging data; calculate a degree of clustering of the membrane voltage pattern; and determine a level of senescence of the plurality of cells based on the degree of clustering.

44. The system of claim 43, wherein measuring the membrane voltage pattern of the plurality of cells further comprises: measuring signals from the voltage-sensitive dye in the plurality of cells.

45. The system of claim 44, wherein calculating the degree of clustering of the membrane voltage pattern further comprises: determining spatial autocorrelation values based on the membrane voltage pattern.

46. The system of claim 45, wherein determining the spatial autocorrelation values based on the membrane voltage pattern further comprises:53QB\166118.01575'98919900.1T002873 166118.01575 determining the spatial autocorrelation values based on the membrane voltage pattern based on calculating at least one of Fast Fourier Transform, Yule-Walker equations, Global Moran’s I value, or Local Moran’s I value.

47. The system of claim 46, wherein determining the level of senescence of the cell based on the degree of clustering further comprises: determining the level of senescence of the cell based on calculating at least one of the Global Moran’s I value or the Local Moran’s I value.

48. The system of claim 47, wherein determining the level of senescence of the cell based on calculating the at least one of the Global Moran’s I value or the Local Moran’s I value further comprises: comparing the at least one of the Global Moran’s I value or the Local Moran’s I value to a reference value.

49. The system of any one of claims 43-48, wherein the voltage sensitive dye comprises Vf2.1, and wherein the plurality of cells was further contacted with a voltage-insensitive dye comprising Vf2.0.

50. A system to measure cell senescence, comprising: a processor in communication with a memory, the memory having stored thereon a set of instructions which, when executed by the processor, cause the processor to: obtain imaging data of a plurality of cells, wherein the plurality of cells has been contacted with a voltage-sensitive dye, and wherein the imaging data comprises at least one of FLIM images or intensity images from the plurality of cells;54QB\166118.01575'98919900.1T002873 166118.01575 measure a membrane voltage of the plurality of cells; and determine a level of senescence of the plurality of cells based on the membrane voltage.

51. The system of claim 50, wherein measuring the membrane voltage of the plurality of cells further comprises: measuring signals from the voltage-sensitive dye in the plurality of cells.

52. The system of claim 50 or 51, wherein determining the level of senescence of the plurality of cells based on the membrane voltage further comprises: obtaining data from at least one of the FLIM images or the intensity images, and comparing the data to reference values to determine the level of senescence.

53. The system of any one of claims 50-52, wherein the voltage sensitive dye comprises BeRST.

54. A system to measure cell senescence, comprising: a processor in communication with a memory, the memory having stored thereon a set of instructions which, when executed by the processor, cause the processor to: obtain imaging data of a plurality of cells, wherein the plurality of cells has been contacted with a voltage-sensitive dye, and wherein the imaging data comprises at least one of FLIM images or intensity; measure a membrane voltage of the plurality of cells and determining a first level of senescence based on the membrane voltage; and measure a membrane voltage pattern of the plurality of cells, calculating a degree of clustering of the membrane voltage pattern, and determining a second level of senescence based on the degree of clustering.55QB\166118.01575'98919900.1T002873 166118.0157555. The system of any one of claims 43-54, wherein the method further comprises obtaining an expression level of at least one biomarker associated with senescence.

56. The system of claim 55, wherein the at least one biomarker is selected from a group comprising: pl6INK4A, Interleukin-6, Interleukin-8, P-galactosidase activity, or chromatin condensation.

57. The system of any one of claims 43-56, wherein the plurality of cells was obtained from a subject, and wherein determining the level of senescence of the plurality of cells further comprises: determining the level of senescence of the subject.

58. The system of claim 57, wherein the plurality of cells is obtained from a tissue from the subject, wherein the plurality of cell comprises cells collected from the epidermis, blood, bone marrow, spleen, thyroid, or retina.

59. The system of claim 58, wherein the plurality of cells forms gap junctions.

60. The system of claim 59, wherein the plurality of cells comprises keratinocytes.

61. A system to determine a relative age of a test subject compared to a control subject, comprising: a processor in communication with a memory, the memory having stored thereon a set of instructions which, when executed by the processor, cause the processor to:56QB\166118.01575'98919900.1T002873 166118.01575 obtain imaging data of a plurality of cells, wherein the plurality of cells has been contacted with a voltage-sensitive dye, and wherein the imaging data comprises at least one of FLIM images or intensity images from the plurality of cells; measure the level of senescence of the tissue sample from the test subject using the system of any one of claims 43-60; compare the level of senescence of the tissue sample from the test subject to a level of senescence of a tissue sample from the control subject to determine a relative level of senescence between the tissue sample from the test subject and the tissue sample from the control subject; and relate the relative level of senescence to the relative age of the tissue of the test subject.

62. A system to compare a relative age difference between two tissues in a subject comprising: a processor in communication with a memory, the memory having stored thereon a set of instructions which, when executed by the processor, cause the processor to: obtain imaging data of a sample of a tissue from a first tissue and a sample of a tissue from a second tissue, wherein the plurality of cells has been contacted with a voltage-sensitive dye, and wherein the imaging data comprises at least one of FLIM images or intensity; measure the level of senescence of the first tissue sample and the second tissue sample using the methods of any one of claims 43-61;57QB\166118.01575'98919900.1T002873 166118.01575 compare the level of senescence of the first sample to the level of senescence of the second sample to determine a relative level of senescence between the first and second samples; and relate the relative level of senescence to the relative age difference between the first and second samples.

63. The system of claim 61 or 62, wherein the method is used to diagnose a subject with a condition related to advanced senescence, selected from a group comprising: advanced aging of an organ, cancer, cardiovascular diseases (e.g., atherosclerosis and heart failure), neurodegenerative diseases (e.g., Alzheimer's and Parkinson's), metabolic disorders, osteoarthritis, idiopathic pulmonary fibrosis, osteoporosis, chronic kidney disease, psoriasis, atopic dermatitis, or renal disease.

64. The system of claim 63, wherein the system is further configured to: provide a report comprising at least one of the diagnosis, a list of potential beneficial treatments, or a list of potential ineffective treatments.

65. The system of claim 64, wherein the diagnosis comprises macular degeneration and the report comprises treatment options for macular degeneration.

66. The system of claim 64, wherein the method comprises a diagnosis related to immune responses, and the report comprises information regarding at least one of inflammation, infection, or immune susceptibility, and wherein the report comprises information regarding at least one of immunization, vaccination, immune supplements, or treatments.58QB\166118.01575'98919900.1T002873 166118.0157567. A system to screen a bioactive compound to determine an effect of cell senescence, comprising: a processor in communication with a memory, the memory having stored thereon a set of instructions which, when executed by the processor, cause the processor to: obtain imaging data for a plurality of cells, wherein the plurality of cells has been contacted with a voltage-sensitive dye, wherein the plurality of cells has been contacted with a bioactive compound, and wherein the imaging data comprises at least one of FLIM images or intensity images from the plurality of cells; measure cell senescence of the plurality of cells using the methods of any one of claims 43-60.

68. The system of claim 67, wherein the bioactive compound is selected from a group comprising drugs or nutritional supplements.

69. The system of claim 68, wherein the drug is selected from a group comprising ionophores, ion channel blockers, ion channel openers, ion pump inhibitors, or ion pump activators.

70. The system of claim 69, wherein the drug is selected from a group comprising A-83-01, mirdametinib, laduviglusib, or tofactinib.

71. The system of claim 68, wherein the nutritional supplement is selected from a group comprising vitamins, minerals, dietary supplements, herbal products, or antioxidants.

72. A system to monitor a level of senescence of a subject comprising:59QB\166118.01575'98919900.1T002873 166118.01575 a processor in communication with a memory, the memory having stored thereon a set of instructions which, when executed by the processor, cause the processor to:(a) measure a first level of senescence of a patient at an initial time using the system of any one of claims 43-60;(b) measure a later level of senescence of a patient at a later time using the method used in step (a); and(c) compare the first level of senescence and later level of senescence.

73. The system of claim 72, wherein the system is further configured to: repeat steps (b) and (c) over a time course to continually monitor the level of senescence of a subject.

74. A system to monitor an effect of a treatment comprising: a processor in communication with a memory, the memory having stored thereon a set of instructions which, when executed by the processor, cause the processor to: obtain imaging data for a plurality of cells, wherein the plurality of cells has been collected from a subject, and wherein a treatment has been administered to the subject; monitor a progression of senescence of the subject comprising using the method of claim 72 or 73.

75. The system of claim 74, wherein the treatment comprises at least one of a lifestyle change, administration of a bioactive compound, naturopathic treatment, or combination thereof.

76. The system of claim 75, wherein the lifestyle change comprises at least one of diet, change in physical activity, exercise regimens, caloric restriction diet, intermittent fasting,60QB\166118.01575'98919900.1T002873 166118.01575 regular physical exercise, consumption of more plant-based diets, optimizing sleep / circadian health, avoiding pro-senescence agents such as smoking, UV damage, metabolic insults (e.g. hyperglycemia), or increasing uptake of agents that promote gut health (probiotics, fiber, etc.).

77. The system of claim 75, wherein the bioactive compound comprises at least one of a drug or nutritional supplement.

78. The system of claim 75, wherein the naturopathic treatment comprises at least one of meditation, acupuncture, reiki, massage, myofascial release, craniosacral adjustment, or yoga.

79. A system to determine a personalized health regimen comprising: a processor in communication with a memory, the memory having stored thereon a set of instructions which, when executed by the processor, cause the processor to: complete at least one of:(a) screen for the effect of a plurality of bioactive compounds using the method of any one of systems 67-71;(b) monitor the effect of a treatment using the method of any one of claims 34-41; and provide a report that identifies personalized recommendations for the personalized health regimen based on steps (a) and (b).

80. The system of any one of claims 74-79, wherein the treatment is designed to slow effects of aging.

81. A method of treating a subj ect comprising: determining a level of senescence in the subject using any one of the methods or systems of at least one of claims 1-80; and61QB\166118.01575'98919900.1T002873 166118.01575 administering a beneficial treatment to the subject based on the determined level of senescence.

82. The method of claim 81, wherein the beneficial treatment comprises a treatment which at least one of decrease symptoms of a disease, slow down progression of a disease, stop or reverse the effects of a disease, increase longevity, improve the biological age of cells, tissues, organs, or the whole organism, or improve quality of life in aging individuals or specific tissues that are identified as older.

83. The method of any one of claims 81 or 82, wherein administering the beneficial treatment further comprises: administering at least one of a therapeutically effective amount of A-83-01, mirdametinib, laduviglusib, or tofactinib.62QB\166118.01575'98919900.1