Primer pair, method, and use for rapidly identifying newborn nude mice
By designing imperfectly paired PCR amplification primers, and utilizing PCR-RFLP technology combined with agarose gel electrophoresis and lateral flow method, newborn nude mice can be rapidly identified, solving the problem of difficult identification in existing technologies and achieving low-cost, real-time nude mouse identification.
Patent Information
- Application Number
- PCT/CN2025/070067
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-10-18
- Filing Date
- 2025-01-02
- Publication Date
- 2026-04-23
AI Technical Summary
Existing technologies make it difficult to quickly and cost-effectively identify newborn nude mice, leading to increased workload and material waste in the safety evaluation of biological products.
A pair of imperfectly paired PCR amplification primers were designed. Using PCR-RFLP technology, newborn nude mice were identified by agarose gel electrophoresis and lateral flow assay. The primer pair specifically recognizes the Foxn1 gene of nude mice, allowing for direct enzyme digestion without the need for PCR product purification.
It enables rapid and low-cost identification of newborn nude mice, simplifies the experimental process, reduces dependence on instruments, and allows for real-time detection.
Smart Images

Figure CN2025070067_23042026_PF_FP_ABST
Abstract
Description
A primer pair, method, and application for rapid identification of newborn nude mice Technical Field
[0001] This invention relates to the field of molecular genetics, specifically to a primer pair, method, and application for rapid identification of newborn nude mice. Background Technology
[0002] Nude mice were discovered accidentally in the 1960s, with the concept first proposed by scientist Flanagan in 1966. In 1968, biologist Pantelousis discovered thymic hypoplasia in nude mice during dissection. The thymus is a crucial site for the development and maturation of T lymphocytes, and this immunodeficiency resulted in a significantly reduced number of lymphocytes and a very poor immune response to thymus-dependent antigens, including inability to reject xenografts and susceptibility to infections. Due to their unique immunodeficiency, nude mice have become indispensable experimental animal models in the fields of biology and biomedicine, for example, in immunology, oncology, and the evaluation of drug efficacy and safety.
[0003] Nude mice are a commonly used animal model for the quality control of biopharmaceuticals, particularly in the areas of toxicity, tumorigenesis, and tumorigenicity. Newborn nude mice are indispensable for the biosafety of biopharmaceuticals due to their unique advantages. For example, in tumorigenicity safety assessments of biopharmaceuticals, the in vivo tumorigenesis method is the standard method for testing the tumorigenicity of cell matrix used in biopharmaceutical production. This method involves selecting specific animal species, inoculating experimental animals with a certain amount of cell matrix lysate or cell matrix DNA, culturing them for a period of time, and then determining the tumorigenicity of the cells by necropsy and pathological examination to determine whether tumor cells are growing. The FDA states that if the cell matrix is suspected of containing oncogenic viruses or exhibits a tumorigenic phenotype, tumorigenicity should be tested at the animal level using cell lysate and cell matrix DNA, respectively. The WHO and the Chinese Pharmacopoeia provide relatively detailed guidelines for the tumorigenicity testing of cell matrix used in biopharmaceutical production. In animal experiments for tumorigenicity testing, various animal models are frequently used. The WHO and the Chinese Pharmacopoeia recommend using 1-3 day old newborn nude mice, newborn rats, and newborn hamsters.
[0004] Homozygous mutant nude mice lack a thymus or possess only abnormal thymic epithelium. This epithelium cannot enable normal T cell differentiation, resulting in a lack of mature T lymphocytes and a lack of cell-mediated immune responses. Homozygous female nude mice have low conception rates, underdeveloped mammary glands, and a tendency to cannibalize their offspring. To obtain higher reproductive and survival rates, a breeding method of mating homozygous males with heterozygous females is generally used, which can produce half homozygous pups. However, newborn mice bred in this way cannot be identified as nude mice, often leading to increased workload, costs, and waste of experimental materials during the safety evaluation of biological products. Therefore, this stage often requires the use of molecular or biochemical methods to achieve rapid identification of nude mice. Summary of the Invention
[0005] To address the shortcomings of existing technologies, the purpose of this invention is to provide a primer pair, method, and application for rapid identification of newborn nude mice, which features simple operation, speed, low cost, and immediate detection.
[0006] To achieve the above objectives, the technical solution of the present invention is as follows:
[0007] In a first aspect, the present invention provides a primer pair for rapid identification of newborn nude mice, comprising two primers: a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown in SEQ ID NO.1 and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2; in the nucleotide sequence of the forward primer, the second base c at the 3' end is an introduced mismatched base.
[0008] A second aspect of the present invention provides the application of the above-described primer pairs in the rapid identification of newborn nude mice.
[0009] A third aspect of the present invention provides the use of the above-described primer pairs in the preparation of a kit for rapid identification of newborn nude mice.
[0010] A fourth aspect of the present invention provides a method for rapidly identifying newborn nude mice using the above-described primer pairs, including agarose gel electrophoresis and / or lateral flow method.
[0011] Furthermore, in the lateral flow method, the 5' ends of the two primers are marked. The 5' end of one primer is marked with Biotin, and the 5' end of the other primer is marked with either FITC or 6-FAM.
[0012] Furthermore, the lateral flow method for rapid identification of newborn nude mice includes the following steps: using the genomic DNA of newborn mice as a template, PCR amplification is performed using the two primers to obtain PCR products, and then the PCR products are digested with the restriction endonuclease SmaI to obtain the digested products. The newborn nude mice are then identified by detecting the digested products using lateral flow.
[0013] The criteria for identifying newborn nude mice are as follows: if both the control line and the test line of the lateral flow test strip are colored, the mouse is normal; if the control line of the lateral flow test strip is colored but the test line is not colored, the mouse is nude; if neither the control line nor the test line of the lateral flow test strip shows a band, it indicates that the test strip or amplification reagent used may be damaged, ineffective, or the operation may have been incorrect.
[0014] Furthermore, when using the lateral flow method, the final concentration of the two primers in the PCR amplification reaction system is 0.04 μM.
[0015] Furthermore, the rapid identification of newborn nude mice by agarose gel electrophoresis includes the following steps: using the genomic DNA of newborn mice as a template, PCR amplification is performed using the two primers described in claim 1 to obtain PCR products, and then the PCR products are digested with the restriction endonuclease SmaI to obtain the digested products. The digested products are then detected by agarose gel electrophoresis to identify newborn nude mice.
[0016] The criteria for identifying newborn nude mice are as follows: if the enzyme digestion products show a single 109bp band in the agarose gel electrophoresis results, the mouse is a nude mouse; if the enzyme digestion products show two bands, 109bp and 60bp, in the agarose gel electrophoresis results, the mouse is a normal mouse.
[0017] Furthermore, when using agarose gel electrophoresis, the PCR amplification reaction system is as follows: 0.5 μL DNA polymerase, 5 μL 5×SF Buffer, 0.5 μL 10 mM dNTP Mix, 1 μL each of the two 10 μM primers, 2 μL neonatal mouse genomic DNA, and 15 μL Nuclease-free water.
[0018] Optionally, the reaction system for the above enzyme digestion reaction is: 1 μL restriction endonuclease SmaI, 25 μL PCR amplification product; the reaction conditions for the above enzyme digestion reaction are: 37℃, 10 min.
[0019] Optionally, the reaction conditions for agarose gel electrophoresis are: 100V, 15min.
[0020] Furthermore, the crude extraction method for neonatal mouse genomic DNA includes the following steps:
[0021] S1. Cut off an appropriate amount of the tip of the tail of a newborn mouse;
[0022] S2. Add an appropriate amount of cell lysis buffer to the tip of the tail of the newborn mice in S1 and lyse them thoroughly;
[0023] S3. Cool the obtained crude neonatal mouse genomic DNA to room temperature and proceed directly to the next step or store it at -20°C or below for long-term storage.
[0024] Preferably, the condition for complete pyrolysis in S2 is a reaction at 95°C for 10 min.
[0025] It should be noted that the newborn mice are of the BALB / c breed.
[0026] Compared with the prior art, the beneficial effects of the present invention are:
[0027] 1. This invention utilizes PCR-RFLP to design a pair of imperfectly matched PCR amplification primers targeting the characteristics of the Foxn1 gene in normal mice and nude mice. These primers enable the normal mice and nude mice to carry different restriction enzyme sites, thereby achieving the identification of newborn nude mice. Compared with ordinary identification methods, this invention artificially alters the PCR amplification product by designing a pair of imperfectly matched PCR amplification primers without changing the template, making it more flexible and easier to optimize experiments.
[0028] 2. Compared with the commonly used PCR-RFLP technology, the present invention can directly carry out the enzyme digestion reaction without purifying the PCR amplification product after the PCR reaction is completed, which greatly simplifies the experimental process and takes less time.
[0029] 3. This invention only requires the use of conventional molecular experimental instruments in the laboratory, including PCR instruments, electrophoresis instruments, and ultraviolet gel imaging instruments. Compared with other KASP or high-resolution dissolution analysis (HRM) methods, it has low dependence on instruments, and the lateral flow method of this invention can quickly identify newborn nude mice and achieve real-time detection. Attached Figure Description
[0030] Figure 1 shows newborn BALB / c normal mice and BALB / c nude mice from the same litter, which are virtually indistinguishable.
[0031] Figure 2 is a sequencing peak diagram of the region where the base G at position 337 of the coding region of the Foxn1 gene in nude mice is deleted. The deletion position is circled.
[0032] Figure 3 shows the differences in the Foxn1 gene between normal mice and nude mice;
[0033] Figure 4 shows the agarose gel electrophoresis results verified by PCR-RFLP technology using incompletely paired primers to amplify A. M is the DL2000 marker, 1 is the band of homozygous newborn BALB / c nude mice before enzyme digestion, 2 is the band of homozygous newborn BALB / c nude mice after enzyme digestion, 3 is the band of heterozygous newborn BALB / c normal mice before enzyme digestion, and 4 is the band of heterozygous newborn BALB / c normal mice after enzyme digestion.
[0034] Figure 5 shows the results of lateral flow technology verification for PCR amplification of B using incompletely paired primers with a final concentration of 0.4 μM. 1 is the band of homozygous newborn BALB / c nude mice before enzyme digestion, 2 is the band of homozygous newborn BALB / c nude mice after enzyme digestion, 3 is the band of heterozygous newborn BALB / c normal mice before enzyme digestion, and 4 is the band of heterozygous newborn BALB / c normal mice after enzyme digestion.
[0035] Figure 6 shows the results of lateral flow technology verification for PCR amplification of B using incompletely paired primers with a final concentration of 0.2 μM. 1 is the band of homozygous newborn BALB / c nude mice before enzyme digestion, 2 is the band of homozygous newborn BALB / c nude mice after enzyme digestion, 3 is the band of heterozygous newborn BALB / c normal mice before enzyme digestion, and 4 is the band of heterozygous newborn BALB / c normal mice after enzyme digestion.
[0036] Figure 7 shows the results of lateral flow technology verification for PCR amplification of B using incompletely paired primers with a final concentration of 0.04 μM. 1 is the band of homozygous newborn BALB / c nude mice before enzyme digestion, 2 is the band of homozygous newborn BALB / c nude mice after enzyme digestion, 3 is the band of heterozygous newborn BALB / c normal mice before enzyme digestion, and 4 is the band of heterozygous newborn BALB / c normal mice after enzyme digestion.
[0037] Figure 8 shows the electrophoresis results of RFLP detection of BALB / c mice from the same litter of Company A (corresponding to Figure 5) using PCR amplification of A with incompletely paired primers. M is the DL2000 marker, 1, 2, 3, 4 and 8 are heterozygous newborn BALB / c normal mice, and 5, 6, 7 and 9 are homozygous newborn BALB / c nude mice.
[0038] Figure 9 shows the lateral flow verification results of RFLP detection of BALB / c mice from the same litter of Company A (corresponding to Figure 5) using PCR amplification with incompletely paired primers for B. 1, 2, 3, 4 and 8 are heterozygous newborn BALB / c normal mice, and 5, 6, 7 and 9 are homozygous newborn BALB / c nude mice.
[0039] Figure 10 shows the electrophoresis results of RFLP detection of BALB / c mice from the same litter of Company A (corresponding to Figure 5) using PCR amplification with incompletely paired primers for A. 1 is the DL2000 marker, 1, 3, 4, 7, 8 and 9 are heterozygous newborn BALB / c normal mice, and 2, 5, 6 and 10 are homozygous newborn BALB / c nude mice.
[0040] Figure 11 shows the lateral flow verification results of RFLP detection of BALB / c mice from the same litter of Company A (corresponding to Figure 5) using PCR amplification with incompletely paired primers for B. 1, 3, 4, 7, 8 and 9 are heterozygous newborn BALB / c normal mice, and 2, 5, 6 and 10 are homozygous newborn BALB / c nude mice.
[0041] Figure 12 shows the agarose gel electrophoresis results of the original PasI restriction site verification of BALB / c nude mice using PCR-RFLP technology. M is the DL2000 marker. 1 is the band of homozygous newborn BALB / c nude mice before restriction digestion, 2 is the band of homozygous newborn BALB / c nude mice after restriction digestion, 3 is the band of heterozygous newborn BALB / c normal mice before restriction digestion, and 4 is the band of heterozygous newborn BALB / c normal mice after restriction digestion. Detailed Implementation
[0042] The present invention will be explained below with reference to embodiments. Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Reagents or instruments whose manufacturers are not specified can be commercially available conventional products.
[0043] Newborn normal mice and nude mice from the same litter are virtually indistinguishable, as shown in Figure 1. To address the identification problem of newborn nude mice, various commercially available heterozygous female mice were purchased, and their genomic DNA was extracted. The types of genomic variations were identified, revealing a deletion of the G base at position 337 of the coding region of the Foxn1 gene, resulting in a frameshift mutation and loss of gene function.
[0044] Mutation analysis of the Foxn1 gene in BALB / c nude mice:
[0045] Sequencing results from heterozygous female mice revealed a deletion of base G at position 337 of the Foxn1 gene in nude mice, resulting in a frameshift mutation.
[0046] The sequencing results are shown in Figure 2, and the differences in the Foxn1 gene between normal mice and nude mice are shown in Figure 3.
[0047] By predicting the possible restriction enzyme sites, it was found that the mutated region contained only one uncommon restriction enzyme site, PasI. This enzyme requires a specific reaction buffer and has low reaction efficiency. To overcome the restriction of restriction enzyme sites, a pair of imperfectly paired PCR amplification primers were designed based on the characteristics of the Foxn1 gene in BALB / c normal mice and BALB / c nude mice. These primers ensured that the amplification products from BALB / c normal mice contained the SmaI restriction enzyme site, while the amplification products from BALB / c nude mice did not contain the SmaI restriction enzyme site. This mutation could be detected by PCR-RFLP, and agarose gel electrophoresis and / or lateral flow assays were used for rapid identification of newborn nude mice.
[0048] Agarose gel electrophoresis is used for rapid identification of newborn nude mice, including the following steps:
[0049] 1. Primer design
[0050] The coding region of the Foxn1 gene in BALB / c nude mice contains a deletion of base G at position 337. An imperfectly paired primer pair was designed using the technique of introducing restriction enzyme sites.
[0051] The nucleotide sequence of the forward primer is as follows:
[0052] TTCAGAAAAGTATCCTGGCTTTGGCTTTGAGGAGGGCCCAGCAGGCAGCCCCG
[0053] The nucleotide sequence of the reverse primer is as follows:
[0054] ATGGAAGTGCCTCTTGTAGG
[0055] The C in the forward primer introduces a mismatched base, resulting in incomplete primer pairing.
[0056] The above primers can be denoted as primer pair A.
[0057] 2. Crude extraction of genomic DNA from newborn mice
[0058] (1) Fix the mouse, use small surgical scissors to cut off the top of the mouse tail, about 0.2 cm in diameter, and put it into a 0.2 ml PCR tube;
[0059] (2) Add 30 μL of cell lysis buffer to the PCR tube, place it in the PCR instrument, and react at 95°C for 10 min;
[0060] (3) Cool the obtained crude newborn mouse genomic DNA to room temperature and proceed directly to the next step or store it at -20℃ or below for a long time.
[0061] 3. PCR amplification
[0062] (1) PCR reaction system:
[0063] Table 1 PCR reaction system
[0064] (2) PCR reaction procedure:
[0065] Table 2 PCR reaction procedure
[0066] 4. Enzyme digestion and agarose gel electrophoresis detection of PCR amplification products
[0067] (1) Enzyme digestion reaction system: 25 μL PCR amplification product, 1 μL restriction enzyme SmaI (thermo, FD0614 / FD0663);
[0068] (2) Enzyme digestion reaction conditions: PCR instrument at 37℃ for 10 min;
[0069] (3) Agarose gel electrophoresis detection: After the enzyme digestion reaction is completed, add 3 μL of 10×DNA loading buffer (Solepro, D1020) to the enzyme digestion product, mix by inverting, and then add 10 μL to the corresponding gel well. Perform agarose gel electrophoresis at 100V for 15 min. After the electrophoresis is completed, use a gel imaging instrument to perform gel imaging, observe and take pictures.
[0070] The criteria for identifying newborn nude mice are as follows: if the enzyme digestion product in the agarose gel electrophoresis result shows a 109bp band, it is a homozygous newborn BALB / c nude mouse; if the enzyme digestion product in the agarose gel electrophoresis result shows two bands, 109bp and 60bp, it is a heterozygous newborn BALB / c normal mouse.
[0071] The lateral flow method for rapid identification of newborn nude mice includes the following steps:
[0072] 1. Primer design
[0073] When using the lateral flow method, the nucleotide sequences of the forward and reverse primers are the same as those of the forward and reverse primers used in the agarose gel electrophoresis method; the 5' ends of the primers for the lateral flow method are labeled, with the 5' end of the forward primer labeled as 6-FAM and the 5' end of the reverse primer labeled as Biotin.
[0074] The above primers can be denoted as primer pair B.
[0075] 2. Crude extraction of genomic DNA from newborn BALB / c mice
[0076] (1) Fix the mouse, use small surgical scissors to cut off the top of the mouse tail, about 0.2 cm in diameter, and put it into a 0.2 ml PCR tube.
[0077] (2) Add 30 μL of cell lysis buffer to the PCR tube, place it in the PCR instrument, and react at 95°C for 10 min.
[0078] (3) Cool the obtained crude genomic DNA to room temperature and proceed directly to the next step or store it at -20°C or below for a long time.
[0079] 3. PCR amplification
[0080] (1) PCR reaction system:
[0081] Table 3 PCR reaction system
[0082] (2) PCR reaction procedure, as shown in Table 2.
[0083] 4. Enzyme digestion and lateral flow detection of PCR amplification products
[0084] (1) Enzyme digestion reaction system: 25 μL PCR amplification product, 1 μL restriction enzyme SmaI (thermo, FD0614 / FD0663);
[0085] (2) Enzyme digestion reaction conditions: PCR instrument at 37℃ for 10 min;
[0086] (3) Lateral flow detection: Add 25 μL of molecular-level water to the above enzyme digestion products, mix by inverting, place the PCR tube upright, and put the arrow-marked end of the lateral flow test strip (Bolais, M20801-F007) into the tube. Place at room temperature for 3 min, observe and take pictures.
[0087] When using the lateral flow method, if both the control line and the test line of the test strip show color, it indicates a heterozygous newborn BALB / c normal mouse; if the control line of the lateral flow test strip shows color but the test line does not, it indicates a homozygous newborn BALB / c nude mouse; if neither the control line nor the test line of the lateral flow test strip shows a band, it suggests that the test strip or amplification reagent may be damaged, expired, or the operation may be incorrect.
[0088] Example 1
[0089] 1. Primer design
[0090] The primer design is the same as that used for the rapid identification of newborn nude mice by agarose gel electrophoresis.
[0091] 2. Crude extraction of genomic DNA from newborn mice
[0092] The tails of four newborn BALB / c mice were cut off. The crude extraction method of genomic DNA from the newborn mice was the same as the agarose gel electrophoresis method described above for rapid identification of newborn nude mice.
[0093] 3. PCR amplification
[0094] The PCR reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2.
[0095] 4. Enzyme digestion and agarose gel electrophoresis detection of PCR amplification products
[0096] The enzyme digestion and agarose gel electrophoresis detection of PCR amplification products in newborn nude mice are the same as those described above for rapid identification using agarose gel electrophoresis.
[0097] The results are shown in Figure 4. The results show that 1 is the band of homozygous newborn BALB / c nude mice before enzyme digestion, 2 is the band of homozygous newborn BALB / c nude mice after enzyme digestion, 3 is the band of heterozygous newborn BALB / c normal mice before enzyme digestion, and 4 is the band of heterozygous newborn BALB / c normal mice after enzyme digestion.
[0098] Example 2
[0099] 1. Primer design
[0100] The primer design is the same as that used in the lateral flow method for rapid identification of newborn nude mice.
[0101] 2. Crude extraction of genomic DNA from newborn mice
[0102] The genomic DNA of the four newborn mice obtained in Example 1 was used.
[0103] 3. PCR amplification
[0104] Three PCR reaction systems were set up, with the final concentrations of primer pair B being 0.04 μM, 0.2 μM, and 0.4 μM, respectively. The other components and weights of the three PCR reaction systems were the same as those in Table 3, and the PCR reaction procedures were shown in Table 2.
[0105] 4. Enzyme digestion and lateral flow detection of PCR amplification products
[0106] The enzyme digestion and lateral flow detection of the PCR amplification products are the same as those used in the rapid identification of newborn nude mice by the lateral flow method described above.
[0107] When the final concentration of primer pair B was 0.4 μM, the results are shown in Figure 5.
[0108] When the final concentration of primer pair B was 0.2 μM, the results are shown in Figure 6.
[0109] When the final concentration of primer pair B was 0.04 μM, the results are shown in Figure 7.
[0110] Based on the above results, it can be seen that when the final concentration of primer pair B is 0.2 μM and 0.4 μM, the lateral flow method cannot identify newborn nude mice; when the final concentration of primer pair B is 0.04 μM, the lateral flow method can identify newborn nude mice.
[0111] Example 3
[0112] 1. Primer design
[0113] Primer pair A, which is the same as the one used in the above-mentioned agarose gel electrophoresis method for the rapid identification of newborn nude mice, and primer pair B, which is the same as the one used in the above-mentioned lateral flow method for the rapid identification of newborn nude mice, were designed respectively.
[0114] 2. Crude extraction of genomic DNA from newborn mice
[0115] The tails of BALB / c mice from the same litter were cut off, and the crude extraction of genomic DNA from newborn mice was performed using the same method as described above.
[0116] 3. PCR amplification
[0117] When using agarose gel electrophoresis for rapid identification of newborn nude mice, the PCR reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2.
[0118] When using the lateral flow method for rapid identification of newborn nude mice, the PCR reaction system is shown in Table 3, and the PCR reaction procedure is shown in Table 2.
[0119] 4. Enzyme digestion of PCR amplification products
[0120] The PCR amplification products were digested with enzymes according to the above-mentioned agarose gel electrophoresis method or lateral flow method for rapid identification of newborn nude mice.
[0121] Lateral flow technology detection:
[0122] The lateral flow method described above was used to quickly identify newborn nude mice, and lateral flow technology was used for detection.
[0123] Agarose gel electrophoresis detection:
[0124] The above-described agarose gel electrophoresis method was used to rapidly identify newborn nude mice, and agarose gel electrophoresis was performed for detection.
[0125] When using agarose gel electrophoresis for rapid identification of newborn nude mice, the results are shown in Figure 8. The results show that 1, 2, 3, 4 and 8 are heterozygous newborn BALB / c normal mice, while 5, 6, 7 and 9 are homozygous newborn BALB / c nude mice.
[0126] The results of rapid identification of newborn nude mice using the lateral flow method are shown in Figure 9. The results show that 1, 2, 3, 4 and 8 are heterozygous newborn BALB / c normal mice, while 5, 6, 7 and 9 are homozygous newborn BALB / c nude mice.
[0127] Example 4
[0128] 1. Primer design
[0129] Primer pair A, which is the same as the one used in the above-mentioned agarose gel electrophoresis method for the rapid identification of newborn nude mice, and primer pair B, which is the same as the one used in the above-mentioned lateral flow method for the rapid identification of newborn nude mice, were designed respectively.
[0130] 2. Crude extraction of genomic DNA from newborn mice
[0131] The tails of BALB / c mice from the same litter were cut off, and the crude extraction of genomic DNA from newborn mice was performed using the same method as described above.
[0132] 3. PCR amplification
[0133] When using agarose gel electrophoresis for rapid identification of newborn nude mice, the PCR reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2.
[0134] When using the lateral flow method for rapid identification of newborn nude mice, the PCR reaction system is shown in Table 3, and the PCR reaction procedure is shown in Table 2.
[0135] 4. Enzyme digestion of PCR amplification products
[0136] The PCR amplification products were digested with enzymes according to the above-mentioned agarose gel electrophoresis method or lateral flow method for rapid identification of newborn nude mice.
[0137] Lateral flow technology detection:
[0138] The lateral flow method described above was used to quickly identify newborn nude mice, and lateral flow technology was used for detection.
[0139] Agarose gel electrophoresis detection:
[0140] The above-described agarose gel electrophoresis method was used to rapidly identify newborn nude mice, and agarose gel electrophoresis was performed for detection.
[0141] When using agarose gel electrophoresis for rapid identification of newborn nude mice, the results are shown in Figure 10. The results show that 1, 3, 4, 7, 8 and 9 are heterozygous newborn BALB / c normal mice, while 2, 5, 6 and 10 are homozygous newborn BALB / c nude mice.
[0142] When using the lateral flow method to quickly identify newborn nude mice, the results are shown in Figure 11. The results show that 1, 3, 4, 7, 8 and 9 are heterozygous newborn BALB / c normal mice, while 2, 5, 6 and 10 are homozygous newborn BALB / c nude mice.
[0143] Comparative Example 1
[0144] 1. Primer design
[0145] Design a pair of primers that can amplify the mouse Foxn1 gene.
[0146] 2. Crude extraction of genomic DNA from newborn mice
[0147] The tails of four newborn BALB / c mice were cut off. The crude extraction method of genomic DNA from the newborn mice was the same as the agarose gel electrophoresis method described above for rapid identification of newborn nude mice.
[0148] 3. PCR amplification
[0149] Using the primers designed in this comparative example, the PCR reaction system is shown in Table 1, and the PCR reaction procedure is shown in Table 2.
[0150] 4. Enzyme digestion and agarose gel electrophoresis detection of PCR amplification products
[0151] Using the restriction enzyme PasI, the PCR amplification products of newborn nude mice were rapidly identified by enzyme digestion and agarose gel electrophoresis according to the above-described agarose gel electrophoresis method.
[0152] The results are shown in Figure 12.
[0153] Based on this result, it can be concluded that PCR-RFLP using the PasI restriction site, which is naturally present in nude mice, cannot identify newborn nude mice.
[0154] Although embodiments of the present invention have been shown and described, it will be readily understood by those skilled in the art that the scope of protection of the present invention is obviously not limited to these specific embodiments. Without departing from the principles of the present invention, those skilled in the art can make equivalent changes or substitutions to the relevant technical features, and the technical solutions resulting from such changes or substitutions will all fall within the scope of protection of the present invention.
Claims
1. A primer pair for rapid identification of newborn nude mice, characterized in that, It includes two primers: a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO.1, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.
2. In the nucleotide sequence of the forward primer, the second base c at the 3' end is an introduced mismatched base.
2. The application of the primer pair according to claim 1 in the rapid identification of newborn nude mice.
3. The use of the primer pair according to claim 1 in the preparation of a kit for rapid identification of newborn nude mice.
4. A method for rapidly identifying newborn nude mice using the primer pair described in claim 1, characterized in that, This includes agarose gel electrophoresis and / or lateral flow methods.
5. The method according to claim 4, characterized in that, In the lateral flow method, the 5' ends of the two primers are marked. The 5' end of one primer is marked with Biotin, and the 5' end of the other primer is marked with either FITC or 6-FAM.
6. The method according to claim 5, characterized in that, Includes the following steps: Using neonatal mouse genomic DNA as a template, PCR amplification was performed using the two primers to obtain PCR products. Then, the PCR products were digested with restriction endonuclease SmaI to obtain digested products. The digested products were then detected by lateral flow to identify neonatal nude mice. The criteria for identifying newborn nude mice are as follows: if both the control line and the test line of the lateral flow test strip are colored, the mouse is normal; if the control line of the lateral flow test strip is colored but the test line is not colored, the mouse is nude; if neither the control line nor the test line of the lateral flow test strip shows a band, it indicates that the test strip or amplification reagent used may be damaged, ineffective, or the operation may have been incorrect.
7. The method according to claim 6, characterized in that, In the PCR amplification reaction system, the final concentration of the two primers was 0.04 μM.
8. The method according to claim 4, characterized in that, The agarose gel electrophoresis method includes the following steps: using the genomic DNA of newborn mice as a template, PCR amplification is performed using the two primers described in claim 1 to obtain PCR products, and then the PCR products are digested with the restriction endonuclease SmaI to obtain the digested products. The digested products are then detected by agarose gel electrophoresis to identify newborn nude mice. The criteria for identifying newborn nude mice are as follows: if the enzyme digestion products show a single 109bp band in the agarose gel electrophoresis results, the mouse is a nude mouse; if the enzyme digestion products show two bands, 109bp and 60bp, in the agarose gel electrophoresis results, the mouse is a normal mouse.
9. The method according to claim 8, characterized in that, The PCR amplification reaction system consisted of: 0.5 μL DNA polymerase, 5 μL 5×SF Buffer, 0.5 μL 10 mM dNTP Mix, 1 μL each of the two 10 μM primers, 2 μL neonatal mouse genomic DNA, and 15 μL Nuclease-free water.
10. The method according to claim 6 or claim 8, characterized in that, The crude extraction method for neonatal mouse genomic DNA includes the following steps: S1. Cut off an appropriate amount of the tip of the tail of a newborn mouse; S2. Add an appropriate amount of cell lysis buffer to the tip of the tail of the newborn mice in S1 and lyse them thoroughly; S3. Cool the obtained crude neonatal mouse genomic DNA to room temperature and proceed directly to the next step or store it at -20°C or below for long-term storage.